8482;æ¦â¢ å¶å¼ç§æ°å¼ å¶ æç½®è¬² æµ â¢ #8722;è¡·æ¢ - Intellectual ...

¯Öê™ëü™ü úÖµÖÖÔ»ÖµÖ úÖ ¿ÖÖÃÖúßµÖ •Ö−ÖÔ»Ö OFFICIAL JOURNAL OF THE PATENT OFFICE

×−ÖÖÔ´Ö−Ö ÃÖÓ. ISSUE NO.

14/2008 14/2008

¿ÖãÎú¾ÖÖ¸ü FRIDAY

×¤ü−ÖÖÓú: 04/04/2008 DATE: 04/04/2008

¯Öê™ëü™ü úÖµÖÖÔ»ÖµÖ úÖ ‹ú ¯ÖÏúÖ¿Ö−Ö PUBLICATION OF THE PATENT OFFICE

The Patent Office Journal 04/04/2008

5210

INTRODUCTION

In view of the recent amendment made in the Patents Act, 1970 by the Patents (Amendment) Act, 2005 effective from 01st January 2005, the Official Journal of The Patent Office is required to be published under the Statute. This Journal is being published on weekly basis on every Friday covering the various proceedings on Patents as required according to the provision of Section 145 of the Patents Act 1970. All the enquiries on this Official Journal and other information as required by the public should be addressed to the Controller General of Patents, Designs & Trade Marks. Suggestions and comments are requested from all quarters so that the content can be enriched.

(V.RAVI) Controller General of Patents, Designs & Trade Marks 4th APRIL, 2008


5211

CONTENTS

SUBJECT

PAGE NUMBER

JURISDICTION

:

5213-5214

SPECIAL NOTICE

:

5215-5216

CORRIGENDUM (KOLKATA)

:

5217

CORRIGENDUM (CHENNAI)

:

5217-5218

EARLY PUBLICATION (KOLKATA)

:

5219

:

5220

EARLY PUBLICATION (MUMBAI)

:

5221-5244

PUBLICATION AFTER 18 MONTHS (DELHI)

:

5245-5545

PUBLICATION AFTER 18 MONTHS (MUMBAI)

:

5547-5563

PUBLICATION AFTER 18 MONTHS (CHENNAI)

:

5564-5610

PUBLICATION AFTER 18 MONTHS (KOLKATA)

:

5611-5679

PUBLICATION U/R 84(3) IN RESPECT OF APPLICATION FOR RESTORATION OF PATENTS (CHENNAI)

:

5680

PUBLICATION UNDER SECTION 43(2) IN RESPECT OF THE GRANT (KOLKATA)

:

5681-5684

EARLY PUBLICATION (DELHI)


5212

THE PATENT OFFICE KOLKATA, 04/04/2008 Address of the Patent Offices/Jurisdictions The following are addresses of all the Patent Offices located at different places having their Territorial Jurisdiction on a Zonal basis as shown below:1

Office of the Controller General of Patents, Designs & Trade Marks, Boudhik Sampada Bhavan, Near Antop Hill Post Office,S.M.Road,Antop Hill, Mumbai – 400 037

4

Phone: (91)(22) 24123311, Fax : (91)(22) 24123322 E-mail: [email protected]

2

The Patent Office, Government of India, Intellectual Property Rights Building, G.S.T. Road, Guindy, Chennai – 600 032. Phone: (91)(44) 2250 2081-84 Fax : (91)(44) 2250 2066 E-mail: [email protected] The States of Andhra Pradesh, Karnataka, Kerala, Tamil Nadu and the Union Territories of Puducherry and Lakshadweep.

The Patent Office, Government of India, Boudhik Sampada Bhavan, Near Antop Hill Post Office,S.M.Road,Antop Hill, Mumbai – 400 037 Phone: (91)(22) 24137701 Fax: (91)(22) 24130387 E-mail: [email protected] The States of Gujarat, Maharashtra, Madhya Pradesh, Goa and Chhattisgarh and the Union Territories of Daman and Diu & Dadra and Nagar Haveli

5

The Patent Office (Head Office), Government of India, Boudhik Sampada Bhavan, CP-2, Sector –V, Salt Lake City, Kolkata- 700 091 Phone: (91)(33) 2367 1943/44/45/46/87 Fax: (91)(33) 2367 1988 E-Mail: [email protected]

Rest of India 3

The Patent Office, Government of India, Boudhik Sampada Bhavan, Plot No. 32., Sector-14, Dwarka, New Delhi – 110075 Phone: (91)(11) 2808 1921 – 25 Fax: (91)(11) 2808 1920 & 2808 1940 E.mail: [email protected] The States of Haryana, Himachal Pradesh, Jammu and Kashmir, Punjab, Rajasthan, Uttar Pradesh, Uttaranchal, Delhi and the Union Territory of Chandigarh.

Website: www.ipindia.nic.in www.patentoffice.nic.in All applications, notices, statements or other documents or any fees required by the Patents Act, 1970 and The Patents (Amendment) Act, 2005 or by the Patents (Amendment) Rules, 2006 will be received only at the appropriate offices of the Patent Office. Fees: The Fees may either be paid in cash or may be sent by Bank Draft or Cheques payable to the Controller of Patents drawn on a scheduled Bank at the place where the appropriate office is situated. The Patent Office Journal 04/04/2008

5213

¯Öê™ëü™ü úÖµÖÖÔ»ÖµÖ úÖê»ÖúÖŸÖÖ, ×¤ü−ÖÖÓ 04/04/2008 úÖµÖÖÔ»ÖµÖÖë êú &Öê¡ÖÖ×¬ÖúÖ¸ü êú ¯ÖŸÖê 1

2

3

×¾Ö×³Ö®Ö •ÖÖÆüÖë ¯Ö¸ü ÛÃ£ÖŸÖ ¯Öê™êü−™ü úÖµÖÖÔ»ÖµÖ êú ¯ÖŸÖê †ÖÓ“Ö×»Öú †Ö¬ÖÖ¸ü ¯Ö¸ü ¤üÙ¿ÖŸÖ ˆ−Öúê ¯ÖÏÖ¤êü×¿Öú †×¬ÖúÖ¸ü &Öê¡Ö êú ÃÖÖ£Ö −Öß“Öê ×¤ü‹ Ö‹ Æïü :úÖµÖÖÔ»ÖµÖ: ´ÖÆüÖ×−ÖµÖÓ¡Öú, ‹úÃ¾Ö, †×³Öú»¯Ö ¯Öê™ëü™ü úÖµÖÖÔ»ÖµÖ “Öê®Ö‡Ô, 4 ŸÖ£ÖÖ ¾µÖÖ¯ÖÖ¸ü ×“ÖÅ−Ö, ‡Ó™êü»ÖêŒ“Öã†»Ö ¯ÖÏÖ¯ê Ö™üá ¸üÖ‡™ËüÃÖ ×²ÖÜ»›üÖ ‹−Ö™üÖ¯ò Ö ×Æü»Ö ›üüÖú‘Ö¸ êú ÃÖ´Öß¯Öü, ‡Ó›üÛÃ™ÒüµÖ»Ö ‡Ã™êü™ü ‹ÃÖ. ‹´Ö. ¸üÖ›ê ü, ‹ÃÖ†Ö‡Ô›üßÃÖß†Öê †Ö¸ü‹´Ö›üß ÖÖê›üÖˆ−Ö ‹×¸üµÖÖ ‹−Ö™üÖ¯ò Ö ×Æü»Ö, ´Öã´²Ö‡Ô -400 037, ³ÖÖ¸üŸÖ. ‹›ü•ÖÃÖê−™ü ™ãü ‡ÔÖ»Ö °»ÖÖÃú ±úÖê−Ö: (91)(22) 24123311 •Öß.‹ÃÖ.™üß. ¸üÖ›ê ü, ÖÖµÖ−›üß, ±îúŒÃÖ: (91)(22) 24123322 “Öê®Ö‡Ô - 600 032. ±úÖê−Ö: (91)(44) 2250 2081-84 ‡Ô.´Öê»Ö: [email protected] ±îúŒÃÖ: (91)(44) 2250-2066 ‡Ô.´Öê»Ö: [email protected] †Ö−¬ÖÐ ¯ÖÏ¤êü¿Ö, ú−ÖÖÔ™üú, êú¸ü»Ö, ŸÖ×´Ö»Ö−ÖÖ›ãü ŸÖ£ÖÖ ¯Öã›ãü“Öê¸üß ¸üÖ•µÖ &Öê¡Ö ‹¾ÖÓ ÃÖÓ‘Ö ¿ÖÖ×ÃÖŸÖ &Öê¡Ö, »Ö&Ö«üß¯Ö ¯Öê™ëü™ü úÖµÖÖÔ»ÖµÖ, ³ÖÖ¸üŸÖ ÃÖ¸üúÖ¸ 5 ²ÖÖî×¨üú ÃÖÓ¯Ö¤üÖ ³Ö¾Ö−Ö, ¯Öê™ëü™ü úÖµÖÖÔ»ÖµÖ úÖê»ÖúÖŸÖÖ (¯ÖÏ¬ÖÖ−Ö úÖµÖÖÔ»ÖµÖ), ‹−Ö™üÖ¯ò Ö ×Æü»Ö ›üüÖú‘Ö¸ êú ÃÖ´Öß¯Öü, ²ÖÖî×¨üú ÃÖÓ¯Ö¤üÖ ³Ö¾Ö−Ö, ‹ÃÖ. ‹´Ö. ¸üÖ›ê ü, ÃÖß¯Öß-2, ÃÖêŒ™ü¸ü-V, ÃÖÖ»™ü »Öêú ×ÃÖ™üß, ‹−Ö™üÖ¯ò Ö ×Æü»Ö, ´Öã´²Ö‡Ô - 400 037, úÖê»ÖúÖŸÖÖ- 700 091, ³ÖÖ¸üŸÖ. ±úÖê−Ö: (91)(22) 2413 7701, ±úÖê−Ö: (91)(33) 2367 1943/44/45/46/87 ±îúŒÃÖ: (91)(22) 2413 0387 ±îúŒÃÖ/Fax: (91)(33) 2367 1988 ‡Ô.´Öê»Ö: [email protected] ‡Ô.´Öê»Ö: [email protected] Öã•Ö¸üÖŸÖ, ´ÖÆüÖ¸üÖÂ™Òü, ´Ö¬µÖ ¯ÖÏ¤êü¿Ö, ÖÖê†Ö ŸÖ£ÖÖ ”û¢ÖßÃÖÖœÍü ¸üÖ•µÖ &Öê¡Ö ‹¾ÖÓ ÃÖÓ‘Ö ¿ÖÖ×ÃÖŸÖ &Öê¡Ö, ¤ü´Ö−Ö ŸÖ£ÖÖ ¤üß¾Ö, ¤üÖ¤ü¸ü ³ÖÖ¸üŸÖ úÖ †¾Ö¿ÖêÂÖ &Öê¡Ö †Öî¸ü −ÖÖ¸ü Æü¾Öê»Öß. ¯Öê™ëü™ü úÖµÖÖÔ»ÖµÖ ×¤ü»»Öß, ²ÖÖî×¨üú ÃÖÓ¯Ö¤üÖ ³Ö¾Ö−Ö, ¯»ÖÖò™ü ÃÖÓ. 32, ÃÖêŒ™ü¸ü - 14, «üÖ¸üúÖ, −Ö‡Ô ×¤ü»»Öß - 110 075. ±úÖê−Ö: (91)(11) 2808 1921-25 ±îúŒÃÖ: (91)(11) 2808 1920, 2808 1940 ‡Ô.´Öê»Ö: [email protected] Æü×¸üµÖÖSÖÖ, ×Æü´ÖÖ“Ö»Ö ¯ÖÏ¤êü¿Ö, •Ö´´Öæ ŸÖ£ÖÖ ú¿´Öß¸ü, ¯ÖÓ•ÖÖ²Ö, ¸üÖ•ÖÃ£ÖÖ−Ö, ˆ¢Ö¸ü ¯ÖÏ¤êü¿Ö, ×¤ü»»Öß ŸÖ£ÖÖ ˆ¢Ö¸üÖ“Ó Ö»Ö ¸üÖ•µÖ &Öê¡ÖÖë, ‹¾ÖÓ ÃÖÓ‘Ö ¿ÖÖ×ÃÖŸÖ &Öê¡Ö “ÖÓ›üßÖœÍü ¾Öê²ÖÃÖÖ‡™ü: http://www.ipindia.nic.in www.patentoffice.nic.in

¯Öê™ëü™ü †×¬Ö×−ÖµÖ´Ö, 1970 ŸÖ£ÖÖ ¯Öê™ëü™ü (ÃÖÓ¿ÖÖê¬Ö−Ö) †×¬Ö×−ÖµÖ´Ö, 2005 †£Ö¾ÖÖ ¯Öê™ëü™ü (ÃÖÓ¿ÖÖê¬Ö−Ö) ×−ÖµÖ´Ö, 2006 «üÖ¸üÖ ¾ÖÖÓ×”ûŸÖ ÃÖ³Öß †Ö¾Öê¤ü−Ö, ÃÖæ“Ö−ÖÖ‹Ñ, ×¾Ö¾Ö¸üSÖ µÖÖ †−µÖ ¤üÃŸÖÖ¾Öê•Ö µÖÖ úÖê‡Ô ¿Öã»ú ¯Öê™ëü™ü úÖµÖÖÔ»ÖµÖ êú êú¾Ö»Ö ˆ¯ÖµÖãŒŸÖ úÖµÖÖÔ»ÖµÖ ´Öë Ã¾ÖßéúŸÖ ÆüÖë Öê … ¿Öã»ú: ¿Öã»ú µÖÖ ŸÖÖê −Öú¤ü ºþ¯Ö ´Öë µÖÖ "Controller of Patents" êú −ÖÖ´Ö ´Öë ¤êüµÖ ²Öïú ›ÒüÖ°™ü µÖÖ “Öêú êú «üÖ¸üÖ ³Öê•Öß •ÖÖ ÃÖúŸÖß Æîü •ÖÖê ˆÃÖß Ã£ÖÖ−Ö êú ×úÃÖß †−ÖãÃÖæ×“ÖŸÖ ²Öïú ´Öë ¯ÖÏ¤ü¢Ö ÆüÖê •ÖÆüÖÑ ˆ¯ÖµÖãŒŸÖ úÖµÖÖÔ»ÖµÖ ÛÃ£ÖŸÖ Æïü… The Patent Office Journal 04/04/2008

5214

SPECIAL NOTICE 18 Months publication as required under Section 11A of the Patents Act, 1970 as amended by the Patents (Amendment) Act, 2005.

Notice is hereby given that any person at any time before the grant of Patent may give representation by way of opposition to the Controller of Patents at appropriate office on the ground and in a manner specified under section 25(1) of the Patents (Amendment) Act, 2005 read with Rule 55 of the Patents (Amendment) Rules, 2006. Notice is also given that if any interested person requests for copies of the complete specification, drawing and abstract of any application already published, the photocopy of the same can be supplied by the Patent Office as per the jurisdiction on payment of prescribed fees of Rs.4/- per page. If any further details are required to be obtained, the same can be provided by the respective Patent Offices on request.

(V. RAVI ) CONTROLLER GENERAL OF PATENTS, DESIGNS & TRADE MARKS


5215

Special Notice Under the new provision of the Patents Act, 1970 as amended by the Patents (Amendment) Act, 2005 and Rules thereunder, Publication of the matter relating to Patents in the Official Gazette of India Part III, Section 2 has been discontinued and instead “The Official Journal of the Patent Office” is being published containing all the activities of The Patent Office such as publication of all the patent applications after 18th months , grant of patents & all other information in respect of the proceedings as required under the provisions of the Patents (Amendment) Act, 2005 and Rules thereunder on weekly basis on every Friday. The price of each copy of the journal is Rs. 400/- (Postal charge included) in paper form and Rs. 250/-(Postal charge included) in CD-ROM form, while annual subscription of the journal for a calendar year 2008 is Rs. 20,000/- (Postal charge included) in paper form and that is Rs. 12,000/- (Postal charge included) in CD-ROM form. There will be 52 issues in a calendar year. The annual subscription for the Year 2008 is required to be paid in advance in any of the Patent Offices located at Kolkata, New Delhi, Mumbai and Chennai. A request on plain paper addressed to the Controller of Patents should be made for supply of the Journals accompanied by payment for annual subscription/Single copy either in cash or cheque(at par)/Demand Draft drawn in favour of the Controller of Patents, payable at the respective Office. Other mode of payment i.e. M.O/I.P.O. or any out station cheque will not be accepted. The request for annual subscription (CD-ROM/paper form)or subscription of single copy in paper form should be made before 30th APRIL, 2008. SPECIAL NOTICE

Every effort is being taken to publish all the patent applications under section 11(A) of the Patents Act. However, if duplication of publication of any application is found, then earlier date of publication will be taken for the purpose of provisional protection for applicant and Patent Office will grant Patent not before six months from the date of second publication, provided that there is there is no third party representation.


5216

C O R R I G E N DU M

Under the headings “Publication Under Section 43(2) in respect of the Grant” dated 28th March, 2008 in the Journal No.13/2008 please delete the Patent No.216842 (00873/KOLNP/2005) in the serial number 1 of the list. CORRIGENDUM 1. Name and address of the applicant for the application no 1389/CHENP/2003 published in the journal date 25/11/2005 shall be read as follows. Name of the applicant: M.C.M ENVIRONMENTAL TECHNOLOGIES LTD Instead of:

MOSENSON Benjamin

Address of the applicant: Moledet, 19130 Mobile Post, Gilboa, Israel Instead of: of Rimonim Street 30, 36000 Kiryat Tivon 2. Name, address and title of the applicant for the application no 244/MAS/2003 published in the journal date 01/09/2006 shall be read as follows. Name of the applicant: RAJA GOPALAN VENKATA KRISHNAN. Instead of: DOLDA JOHN EDWIN. Address of the applicant: B-44 (New No:B-11), Anna Nagar-East, Chennai-600 102, Tamil nadu, India. Instead of: FLOT NO.301, VIJAYA TOWERS, SHANTINAGAR, MASABTANK, HYDERABAD-500 028, ANDHRA ARADESH, INDIA. Title: FEED COMPONENT FOR LIVE STOCK AND BIRDS WITH BI-FOLD EFFICIENT METHIONINE. The Patent Office Journal 04/04/2008

5217

Instead of: SOLAR WATER – TREATMENT PLANT.

3. Name and address of the applicant for the application no 950/CHENP/2003 published in the journal date 22/04/2005 shall be read as follows. Name of the applicant: TECHNIP FRANCE. Instead of: Cabinet Lavoix. Address of the applicant: 170 Place Henri Regnault, La Defense 6, 92400 Courbevoie, France. Instead of: 170 Place Henri Regnault, La Defense 6, 92973 Paris La Defense Cedex, France. 4. Title of the applicant for the application no 94/CHENP/2003 published in the journal date 08/04/2005 shall be read as follows. Title: A FIBRE REACTIVE ORGANIC COMPOUND. Instead of: CLARIANT FINANCE (BVI) LIMITED. 5. Name and address of the applicant for the application no 1965/CHENP/2004 published in the journal date 24/02/2006 shall be read as follows. Name: SUMITOMO CHEMICAL COMPANY, LIMITED. Instead of: SUMIKA FINE CHEMICALS CO., LTD. Address of the applicant: 5-33, Kitahama 4-chome, Chuo-ku, Osaka-shi, Osaka 541-8550, Japan. Instead of: 1-21, Utajima 3-chome, Nishiyodogawa-ku, Osaka-shi, Osaka 555-0021, Japan. 6. 1493/MAS/1998 Published in the journal dated 07/03/2008 is treated as cancelled.


5218

Early Publication: The following patent applications have been published under section 11A (2) of The Patents (Amendment) Act 2005 and rule 24A of The Patents (Amendment) Rules, 2006. Any person may file representation by way of opposition to the Controller of Patents at the appropriate office against the grant of the patent in the prescribed manner under section 25(1) of the Patents (Amendment) Act 2005 read with the rule 55 of The Patents (Amendment) Rules, 2006:

(12) PATENT APPLICATION PUBLICATION

(21) Application No.503/KOL/2008 A

(19) INDIA (22) Date of filing of Application :12/03/2008

(43) Publication Date : 04/04/2008

(54) Title of the invention : CONVERTIBLE PHACO CHOPPER CUM SPATULA WITH OR WITHOUT VISCOELASTIC (OVD) INJECTOR (51) International classification :A61F9/00 (31) Priority Document No :NA (71)Name of Applicant : (32) Priority Date :NA 1)SUVEN BHATTACHARJEE (33) Name of priority country :NA Address of Applicant :B-44, JAL VAYU VIHAR, BLOCKLB, SECTOR III, SALT LAKE, KOLKATA West Bengal India (86) International Application No :NA Filing Date :NA (72)Name of Inventor : (87) International Publication No : NA 1)SUVEN BHATTACHARJEE (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A device for nucleus chopping and manipulation and viscoelastic injection during cataract surgery by phaco emulsification is described. The device has a handle to which a syringe with viscoelastic is clipped on and a probe end which enters the eye. The probe tip can be converted from a spatula to chopper and back to a spatula, within the anterior chamber of the eye, by using a finger to move a knob at the lower end of the handle. Viscoelastic can be injected into the anterior chamber during surgery through the probe. The device helps emulsification of the nucleus and viscoelastic injection, without repeated entry and exit of multiple instruments. Another version of the device, without provision for aVD injection, makes the handle and probe slimmer. The device enables the surgeon to have better concentration and also provides greater protection against posterior capsule rupture during this stage of surgery.


5219


(21) Application No.2740/DEL/2007 A



(54) Title of the invention : "BIAXIAL ORIENTED POLYESTER FILM AND A PROCESS FOR PREPARING THE SAME" (51) International classification

:C08J5/18; (71)Name of Applicant : B32B27/20 1)POLYPLEX CORPORATION LIMITED :NA Address of Applicant :B 37 SECTOR 1, NOIDA 201 :NA 301,INDIA. Uttar Pradesh India :NA (72)Name of Inventor : :NA 1)DR.BIDHAN KRUSHNA MOHANTY :NA 2)KRISHNA REDDY :NA :NA :NA :NA :NA

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The present invention relates to a biaxial oriented polyester film and process for preparing the same, the said film is having an average ellipticity of not more than 0.6, Poisson ratio of not more than 0.7 (at elongation greater than 25%) all along the width of web and residual enthalpy in the range of 12 % to 20 %, a continuous reduction in residual film area up to an elongation of 100%.


5220


(21) Application No.189/MUM/2008 A



(54) Title of the invention : GEAR SELECTION SYSTEM :F16H61/00 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)TATA MOTORS LIMITED (32) Priority Date :NA Address of Applicant :BOMBAY HOUSE, 24 HOMI MODY (33) Name of priority country :NA STREET, HUTATMA CHOWK, MUMBAI-400001, Maharashtra (86) International Application No :NA India (72)Name of Inventor : Filing Date :NA (87) International Publication No : NA 1)ABHIMANYU SINGH (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : In accordance with this invention, gear selection system comprises; a shifter shaft (1) rotateably mounted in the gear box casing configured to slide axially, plurality of recesses (2) provided on the cylindrical surface of said shifter shaft, at least one fork member (3) slidably mounted on the said shifter shaft through bearings. The said fork members (3) perform the function of engaging a gear ratio through a synchroniser cone or a dog clutch. The said fork members (3) are preferably interchangeable. Each fork member (3) is free to slide on the said shifter shaft (1). The said fork members (3) comprises pin guides (4) for holding the locking pins (5). Said pin guides (4) hold the said locking pins (5) positively spring loaded against the cylindrical surface of the said shifter shaft (1). The pin guides (4) facilitate the locking pins (5) to slide towards or away from the cylindrical surface of the shifter shaft (1). The pin guides (4) may either be separate components attached to the fork members (3), or they may be integral with the fork members (3). A locking plate (6) is provided parallel to the shifter shaft (1). The said locking plate has holes (7) to engage the locking pins (5). The locking plate (6) may either be integral with the gearbox casing, or it may be a separate component fixed in place through suitable means.


5221





(54) Title of the invention : PEGYLATED LIPOSOMAL DRUG DELIVERY SYSTEM FOR DOXORUBICIN HYDROCHLORIDE (51) International classification :A61K31/7048 (71)Name of Applicant : (31) Priority Document No :NA 1)CLARIS LIFESCIENCES LTD (32) Priority Date :NA Address of Applicant :CLARIS LIFESCIENCES LTD. (33) Name of priority country :NA CLARIS CORPORATE HEADQUARTERS, NR. PARIMAL (86) International Application No :NA CROSSING, ELLISBRIDGE, AHMEDABAD-380006, Gujarat Filing Date :NA India (87) International Publication No : NA (72)Name of Inventor : (61) Patent of Addition to Application Number :NA 1)MAJMUDAR CHETAN Filing Date :NA 2)BOSE MILINA (62) Divisional to Application Number :NA 3)SUTHAR MINESH Filing Date :NA (57) Abstract : The delivery by liposome technology gives us the advantage to deliver toxic drugs to the target cells without causing damage to the normal cells. Also, many drugs with low aqueous solubility and/or combination of both water-soluble and lipid soluble drugs can be formulated in the liposomes, increasing the bioavailability of the drug, reducing dosage and also reducing systemic toxicity. Doxorubicin is a toxic antineoplastics agent used in the treatment of Metastatic ovarian cancer refractory to Paclitaxel and Platinum chemotherapy regimen and AIDS related Kaposi syndrome. It is available both in the normal and stealth liposomal injection form. Liposomal doxorubicin delivers the drug 5 to 11 times more to the sarcoma lesions, and also requires frequent dose modification, reduced toxicity to normal cells, reduced number to dosage administration and better patient compliance. The Pegylatation was carried out by Poly Ethylene Glycol (PEG). Pegylated Doxorubicin Liposomal Injection has a good chemical stability which is much better then the innovator’s product in terms of physical and chemical as per the in-house specifications.


5222





(54) Title of the invention : IMPROVED PIPE BELLING/SOCKETING DEVICE :B21K1/58,B21K1/00 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)JOSHIPARA NARESH JAYENDRARAI (32) Priority Date :NA Address of Applicant :240, MANEKBAG SOCIETY, (33) Name of priority country :NA AMBAVADI, AHMEDABAD-380015, Gujarat India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)JOSHIPARA NARESH JAYENDRARAI (87) International Publication No : NA (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An improved pipe belling/socketing machine divided into three sections wherein first section being receiving end section comprises of pipe through line of extrusion pulled by pipe pulling device, pipe edge sensor senses the edge of pipe and positions pipe for heating section, pipe support and transfer system transfers pipe to adjacent sections; second section being heating section comprises of plurality of pipe heating ovens where end portion of pipe is heated to make it soft at socket formation end, socket length adjustment and control device adjusts length and positions the pipe with respect to socket shape formation tool at which socket is to be formed; third section being forming section comprises of pipe clamping arrangement wherein pipe is clamped in place by air/hydraulic actuating pipe clamping arrangement, the socket shape formation tool is inserted into pipe and the socket is formed.


5223





(54) Title of the invention : A PROCESS FOR PREPARING PRALLETHRIN :A01N53/00 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)SHOGUN ORGANICS LIMITED (32) Priority Date :NA Address of Applicant :504, SAMARTHA VAIBHAV, (33) Name of priority country :NA LOKHANDWALA COMPLEX, OFF.LINK ROAD, ANDHERI (86) International Application No :NA (W), MUMBAI-400053, Maharashtra India Filing Date :NA (72)Name of Inventor : (87) International Publication No : NA 1)R. KALYANARAMA N (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : This invention relates to method for repelling insects and further relates to Process synthesis of manufacture of "Prallethrin" technical. The product is used as an active ingredient in mosquito repellant and control products. The process includes the esterification of an optically active alcohol with an acid chloride. The ester so formed has high insect repellant properties. This special synthesis route has been developed for specific use in household insecticide products as an active ingredient against mosquitoes.


5224





(54) Title of the invention : A SYSTEM FOR REDUCING CLUTCH PEDAL EFFORT FOR VEHICLE :B60K23/00,B60K23/02 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)TATA MOTORS LIMITED (32) Priority Date :NA Address of Applicant :BOMBAY HOUSE, 24 HOMI MODY (33) Name of priority country :NA STREET, HUTATMA CHOWK, MUMBAI-400001, Maharashtra (86) International Application No :NA India (72)Name of Inventor : Filing Date :NA (87) International Publication No : NA 1)SANDIP R GHOLKAR (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The system for reducing clutch pedal effort for vehicle comprises; Control mounting bracket assembly fitted on vehicle structure, clamps provided on said vehicle structure, Clutch cable routed through said clamps, clutch cable stop bracket mounted on gear box with fasteners, yoke fitted in clutch housing of said gear box. The said control mounting bracket assembly comprises clutch pedal assembly, Said clutch pedal assembly comprises clutch pedal, cable mounting hole provided on said clutch pedal, Pin for locking of said clutch pedal assembly, plurality of bushes and locking clips. Said clutch pedal assembly comprises clutch pedal connected with pivot tube. Said clutch cable comprises outer cover and inner cable having 7 x 19 construction Said clutch cable which is having two ends, one end of said clutch cable is connected to clutch pedal assembly and other end of said clutch cable is fitted to yoke. Said clutch cable is routed through at least three clamps provided on vehicle structure to avoid sharp bend while routine on vehicle. Said clutch cable stop bracket is fitted on gear box with at least two fasteners having M12 threading. Said yoke comprises two end portions. One end is for connection to clutch release bearing and at the other end, clutch cable is locked. Said system for reducing clutch pedal effort for vehicle is simple in construction and cost effective.


5225





(54) Title of the invention : IMPROVED SUB FRAME MOUNTING BRACKET FOR VEHICLES :B62D21/00,B60G17/00 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)TATA MOTORS LIMITED (32) Priority Date :NA Address of Applicant :BOMBAY HOUSE, 24 HOMI MODY (33) Name of priority country :NA STREET, HUTATMA CHOWK, MUMBAI-400001, Maharashtra (86) International Application No :NA India (72)Name of Inventor : Filing Date :NA (87) International Publication No : NA 1)TAJUDEEN AHMED A (61) Patent of Addition to Application 2)SAMIR GHODEKAR :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Improved sub frame mounting bracket for vehicles, in accordance with the present invention comprises; Top cross member, bottom cross member, reinforcement cross member, Wherein said top cross member comprises; body panel member having central panel member which is attached to the anti roll bar mounting, top panel member, left panel member, right panel member, intermediate panel portion, and base panel member with curved notch provided therein on both side is attached to the top member of the body structure of vehicles. For attaching said central panel member with the anti roll bar mounting welding means is used. Said top panel member comprises through aperture for mounting. Reinforcement panel member comprises; central portion, bend portion, through aperture, side wall portion, and side wall portion and second top portion with through aperture which is preferably at perpendicular to straight portion connecting slant portion which is inward inclined.


5226





(54) Title of the invention : A CONTROL SYSTEM INTEGRATED WITH STEERING WHEEL OF VEHICLE :B62D6/00 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)TATA MOTORS LIMITED (32) Priority Date :NA Address of Applicant :BOMBAY HOUSE, 24 HOMI MODY (33) Name of priority country :NA STREET, HUTATMA CHOWK, MUMBAI-400001, Maharashtra (86) International Application No :NA India (72)Name of Inventor : Filing Date :NA (87) International Publication No : NA 1)SUNILA MULYE (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Type of steering wheel control switches which are interfaced with controller packaged inside the steering wheel. The switches which work on contact less principle are utilized. The controller in this case, is referred to a steering control inputs interface unit cum controller with CAN bus interface. The controller gets the communication data from flexible spiral ribbon which is packaged between the steering wheel and the combination switch. The contact less switches are interfaced to the controller which is the interface between the vehicle and the driver. The status of the contact less switches is read by the controller and depicted in terms of data messages. These messages are transmitted on the communication bus. The messages are read for the concerned electronic control units and related actions are performed. The contact less switch basically works Hall Effect principal. The controller referred here consists of a central processing unit with input/output processing capability, programmable memory storage, with a very good operating frequency. The system and functional program are re-writable depending upon the modification required. The communication bus is a part on the vehicle network system. This network has respective electronic control unit interfaced to the bus


5227





(54) Title of the invention : DHOTE PRINT BIND INK :C09D11/00 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)RAMAKANT RAMKISAN DHOTE (32) Priority Date :NA Address of Applicant :UNIT NO.5, MOHATTA BHAVAN, (33) Name of priority country :NA DR. E. MOSES RD, WORLI, MUMBAI-400006, Maharashtra (86) International Application No :NA India Filing Date :NA (72)Name of Inventor : (87) International Publication No : NA 1)RAMAKANT RAMKISAN DHOTE (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention is used to avoid duplication and to identify original. It is mainly invented to make the forger’s job more difficult and to prevent the fraud, the use of security ink represent the part of the many, varied procees employed by the security printers. Security papers and printing technologies are equally important in this sphere of operation. The duplicators may not be aware that the paper and ink may have been choosen cause that they are difficult to photograph in combination. Such prints are not only difficult to photograph but very expensive to reproduce without the printer’s elaborate machinery. Apart from the reproduction of a geniune label there is another aspect of forgery known as “adulteration”. In order to ensure that sufficient bleed occurs water soluble media are used as the bassis of such inks. Formulations of this nature are used for a purpose of forgery detection. The said printing ink when chemicaly treated with alkaline it will undergo a colour change. Alkaline is relating to or containing an alkali; having a pH greater than 7, alkaline soils derived from chalk or limestone. A related clour change system will be used for the help of manufacture to prevent their label form duplication. This type of printing ink will be used for the pupose of security of the printed label, as well as the product. This type of ink can be used for the printing of labels on papers, tin, boards, by printing procees. A special type of ink paste is added in a proportion and final finished ink is to be used for printing of labels on a papers by printing proceess. After printing proceess the final ink shade comes in contact with any alkaline product, it shows the colour changing effect on papers, tin boards.


5228





(54) Title of the invention : EGR COOLER, EGR VALVE & WATER DISTRIBUTION RAIL ASSEMBLY AND MOUNTING ARRANGEMENT THEREOF ON ENGINE (51) International classification :F02B47/08,F16K27/02 (71)Name of Applicant : (31) Priority Document No :NA 1)TATA MOTORS LIMITED (32) Priority Date :NA Address of Applicant :BOMBAY HOUSE, 24 HOMI MODY (33) Name of priority country :NA STREET, HUTATMA CHOWK, MUMBAI-400001, Maharashtra (86) International Application No :NA India Filing Date :NA (72)Name of Inventor : (87) International Publication No : NA 1)SAMRENDRA NATH MISHRA (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : EGR Cooler, EGR Valve & Water Distribution Rail assembly comprises of water distribution rail, EGR cooler, EGR valve, EGR pipes, plurality of coolant hoses, plurality of connecting pipes, clamps and fasteners, said water distribution rail is provided with plurality of though holes adopted to mount directly on the cylinder head of an engine, said water distribution rail is provided with plurality of openings for coolant inflow and an opening for coolant flow to EGR cooler, said water distribution rail is provided with plurality of tapped opening to accommodate the mounting fasteners of EGR cooler, said EGR cooler is mounted on said water distribution rail, one end of said EGR cooler is provided with EGR valve and other end is provided with tapped opening for mounting EGR pipe.


5229





(54) Title of the invention : A NOVEL LUBRICATION SYSTEM FOR AN INTERNAL COMBUSTION ENGINE (51) International classification :F16N7/00,F01M5/00 (71)Name of Applicant : (31) Priority Document No :NA 1)TATA MOTORS LIMITED (32) Priority Date :NA Address of Applicant :BOMBAY HOUSE, 24 HOMI MODY (33) Name of priority country :NA STREET, HUTATMA CHOWK, MUMBAI-400001, Maharashtra (86) International Application No :NA India (72)Name of Inventor : Filing Date :NA (87) International Publication No : NA 1)RAJENDRA M. PETKAR (61) Patent of Addition to Application 2)AMAR S. BAKARE :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : This invention relates to an oil passage arrangement through the bedplate of an internal combustion engine. An oil gallery is cast along the length of the bedplate of the engine, which can be tapped anywhere along its length by a pick up pipe connecting the oil sump to the oil gallery. One end of the oil gallery is connected to the oil pump which further supplies pressurized oil to different parts of the engine. This invention permits a design of a short and robust pick up arrangement irrespective of the position of the oil strainer with respect to the oil pump.


5230





(54) Title of the invention : SUSPENSION SYSTEM FOR A VEHICLE :B60G17/015 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)TATA MOTORS LIMITED (32) Priority Date :NA Address of Applicant :BOMBAY HOUSE, 24 HOMI MODY (33) Name of priority country :NA STREET, HUTATMA CHOWK, MUMBAI-400001, Maharashtra (86) International Application No :NA India (72)Name of Inventor : Filing Date :NA (87) International Publication No : NA 1)SOHEB AHMED (61) Patent of Addition to Application Number :NA 2)ABHAY DESHPANDE Filing Date :NA 3)UMESH ABHYANKAR (62) Divisional to Application Number :NA 4)MANDAR HAJARE Filing Date :NA (57) Abstract : This invention relates to a suspension system for a vehicle, which comprises of outer arm, inner arm and their reinforcements. The shape of the arms and reinforcements is such that it gives improved stiffness in camber and toe. The outer arm and inner arm are assembled with respective reinforcements such that in assembled conditions there is improved joinery between the two. This helps in improving rigidity and durability of the suspension system. The joining between outer and inner arm and their reinforcements is designed so that there is least distortion which helps in achieving better manufacturing tolerances.


5231





(54) Title of the invention : LOW-PROFILE PLANAR TRANSFORMER :H01F5/02,H01F27/28 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)KUAN TECH (SHENZHEN) CO., LTD. (32) Priority Date :NA Address of Applicant :6TH, HONGHUA ROAD, (33) Name of priority country :NA GONGMING, SHENHEN, GUANGDONG, China (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)CHENG, CHUN-CHENG (87) International Publication No : NA (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A low-profile planar transformer in one embodiment includes a rectangular frame including top and bottom recesses, a first opening through the top and the bottom, a transverse slot open to the side, and a flange on the other side; a sheet primary winding including a second opening through its top and bottom, the primary winding being adapted to insert into the slot with the other side thereof exposed and the second opening aligned with the first opening; a rectangular secondary winding adapted to put on the recesses; two insulators of U-shaped adapted to clamp front and rear ends of the secondary winding; a first core of E shape; and a second core of sheet core adapted to couple to the first core by inserting the central ridge of the first core through the first and the second openings with the frame, the winding, and the insulators there between.


5232





(54) Title of the invention : AMBULANCE SYSTEM WITH INTEGRATED ADJUSTABLE STRETCHER SUPPORT STRUCTURE FOR CARRYING EMERGENCY PATIENT AND AMBULANCE ACCESSORIES THEREOF. (51) International classification :A61G1/00 (71)Name of Applicant : (31) Priority Document No :NA 1)TATA MOTORS LIMITED (32) Priority Date :NA Address of Applicant :BOMBAY HOUSE, 24 HOMI MODY (33) Name of priority country :NA STREET, HUTATMA CHOWK, MUMBAI-400001, Maharashtra (86) International Application No :NA India Filing Date :NA (72)Name of Inventor : (87) International Publication No : NA 1)SANDIP R. GHOLKAR (61) Patent of Addition to Application Number :NA 2)SANGAMESH MATHAD Filing Date :NA 3)ILANGO NAGAPPAN (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Ambulance system with integrated adjustable improved stretcher support structure for carrying emergency patient comprises; stretcher support frame (19,20) mounted on the floor of the vehicle for mounting stretcher, said stretcher support frame comprises; cross adjustment means (17,18,22) mounted underneath of the said stretcher support frame, stretcher locking means (15) mounted on top of the said stretcher support frame adapted to receive the pin member mounted on the said stretcher, at least two outer channel groove rails (13,13) mounted longitudinally on top edge of said stretcher support frame at least two inner channel groove rails (14,14) disposed longitudinally adjacent to the said outer channel groove rails for guiding the rollers (26,28) provided at the bottom of the said stretcher (27). Ambulance accessory system comprises; support means (8) mounted at floor of vehicle on opposite side to the stretcher support frame for providing seat for attendee, oxygen cylinder mounting means (9) behind the co driver’s seat and washing means (5) with dustbin (6) underneath of said washing means (5) behind the driver’s seat. Mounting means (7) is provided on the roof of the said ambulance above attendee’s seat for mounting fan. Said ambulance accessory system also comprises light fixture means (3,3) at the rear end and middle of roof top for mounting lighting system. Curtain fixture means provided longitudinally at the middle of roof top of vehicle for providing curtain means. Fire extinguisher mounting means (12) mounted at the left side of the wall at the rear end of said side wall for mounting fire extinguisher.


5233





(54) Title of the invention : A STEERING COLUMN SUPPORT STRUCTURE FOR VEHICLE :B62D1/16 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)TATA MOTORS LIMITED (32) Priority Date :NA Address of Applicant :BOMBAY HOUSE, 24 HOMI MODY (33) Name of priority country :NA STREET, HUTATMA CHOWK, MUMBAI-400001, Maharashtra (86) International Application No :NA India (72)Name of Inventor : Filing Date :NA (87) International Publication No : NA 1)VIVEK DWIVEDI (61) Patent of Addition to Application Number :NA 2)MAHENDRA A PETALE Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A steering column mounting structure extended from cabin firewall and supported by pedal unit and tie member of the vehicle to provide stabilized support to adjustable steering column remote from instrument cluster and vehicle dashboard to permit highly efficient steering operation.


5234





(54) Title of the invention : GEAR CHANGE MECHANISM :B60K17/08 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)TATA MOTORS LIMITED (32) Priority Date :NA Address of Applicant :BOMBAY HOUSE, 24 HOMI MODY (33) Name of priority country :NA STREET, HUTATMA CHOWK, MUMBAI-400001, Maharashtra (86) International Application No :NA India (72)Name of Inventor : Filing Date :NA (87) International Publication No : NA 1)ABHIMANYU SINGH (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Gear change mechanism comprises of a guide member (1) revolute mounted in the gearbox casing. The guide member (1) is provided with plurality of circumferential grooves (2) and longitudinal channel (3) on its cylindrical surface. The said guide member (1) supports a sliding member (6) and shifter forks (4) through suitable bearings. The said shifter forks (4) perform the function of engaging a gear ratio through a synchroniser cone or a dog clutch. The said shifter forks (4) are preferably identical in construction. Each of the said shifter forks (4) can slide on the said guide member (1). The said shifter forks (4) are provided with lugs (5). The said lugs (5) may either be integral with the said shifter forks (4) or separate components installed onto the said shifter forks (4). The said sliding member (6) is located in the said axial channel (3) present in the said guide member (1). The sliding motion of the said sliding member (6) is along the said axial channel (3). The said sliding member (6) comprises at least one recess (7) to engage the said lugs (5) on the said shifter forks (4). This arrangement provides an interlock between said shifter forks (4) and circumferential groove (2) of said guide member (1) which prevents accidental engagement of two gear ratios simultaneously. It doesn't utilise any spring loaded components. Lugs are fixed so it's having fewer moving parts. This makes the system more durable.


5235





(54) Title of the invention : A SOLENOID OPERATED LATCHING DEVICE FOR VEHICLES :H01H51/22 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)TATA MOTORS LIMITED (32) Priority Date :NA Address of Applicant :BOMBAY HOUSE, 24 HOMI MODY (33) Name of priority country :NA STREET, HUTATMA CHOWK, MUMBAI-400001, Maharashtra (86) International Application No :NA India (72)Name of Inventor : Filing Date :NA (87) International Publication No : NA 1)SHIVKUMAR H CHOUGULE (61) Patent of Addition to Application Number :NA 2)SHEKHAR D PHULAMBRIKAR Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : This invention relates to a latching device comprising of a solenoid wherein plunger of said solenoid acting a latch member, which is adequate and efficient in latching and unlatching the striker bar, can be manufactured in less process time and requiring less voltage for activation and is cost effective. According to this invention solenoid with a composite plunger wherein said plunger is having two separate portions made in non-metallic and in steel thereby avoiding critical manufacturing processes required incase of steel plunger and also avoiding corrosion. These two separate portions are combined using a locking means formed by insert molding to restrict the axial and rotational movement. By avoiding critical machining the manufacturing time and cost can be reduced.


5236





(54) Title of the invention : A NOVEL METHOD OF ENERGY EFFICIENT T5 FITTING TO BE MOUNTED IN CONVENTIONAL T8/ T12 FITTING (51) International classification :H01K1/42 (71)Name of Applicant : (31) Priority Document No :NA 1)BAKERI KARTIK PRAFULL (32) Priority Date :NA Address of Applicant :E/7, PRARTHNA ALOK, NEAR H. L. (33) Name of priority country :NA COLLEGE OF COMMERCE, NAVRANGPURA, AHMEDABAD-380009, Gujarat India (86) International Application No :NA Filing Date :NA (72)Name of Inventor : (87) International Publication No : NA 1)BAKERI KARTIK PRAFULL (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The principle proposed by the invention is fitting of the new energy efficient T5 fitting along with its own reflector into the exiting conventional T8/T12 fixture, without loss of power. The present invention consisting of T5 lamp, reflectors, electronic ballast and supply wire to be mounted in conventional used T8/T12 fitting wherein T5 lamp is mounted in the T5 holders and reflector is mounted on the ballast casing which also holds the T5 holders and supply wires coming out of the T5 casing. T5 fitting is retrofitted in such a way so, as to connect the supply wires to the old main terminals of the T8/T12 fitting and reflectors is provided between the casing and the lamp, which is not limited to T5 fitting to be fitted in the T8/T12 fitting, but also to be used in stand alone type T5 fitting.


5237





(54) Title of the invention : ALL IN ONE SHAVING TOOL :B26B21/00,B26B21/40 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)GAJANAN INVENTION AND ADVANCED RESEARCH (32) Priority Date :NA CENTRE (33) Name of priority country :NA Address of Applicant :SSGM COLLEGE OF (86) International Application No :NA ENGINEERING, SHEGAON, AT POST:SHEGAON, Filing Date :NA DIST:BULDHANA,444203, Maharashtra India (87) International Publication No : NA (72)Name of Inventor : (61) Patent of Addition to Application 1)NISHANT KUMAR :NA Number 2)R.D. PALHADE :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention discloses a all in one shaving tool (Numeral 10) which includes a razor (Numeral 48), a shaving brush chamber (Numeral 16) which holds shaving brush (Numeral 18), a shaving gel chamber (Numeral 12) which holds the shaving gel (Numeral 30) and a Alum strip chamber (Numeral 28) to hold an alum strip (Numeral 26) wherein the shaving gel from the shaving gel chamber is released by pushing the piston device (Numeral 22) which releases the shaving gel and which is diverted by various arrangements to come right into the shaving brush chamber and to the shaving brush where the user can start applying the shaving gel on the facial surface with the help of the shaving brash after which the razor is mounted at a specific angle on the housing is used to shave and thereafter the user could release the chamber for holding alum strip to use it as after shave to relieve him from abrasions and cuts caused during the shave.


5238





(54) Title of the invention : AN IMPROVED SOLAR POWERED STREET LIGHTING SYSTEM :F21S9/03,F21S9/04 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)GAJANAN INVENTION AND ADVANCED RESEARCH (32) Priority Date :NA CENTRE (33) Name of priority country :NA Address of Applicant :SSGM COLLEGE OF (86) International Application No :NA ENGINEERING, SHEGAON, AT POST:SHEGAON, Filing Date :NA DIST:BULDHANA-444203, Maharashtra India (87) International Publication No : NA (72)Name of Inventor : (61) Patent of Addition to Application 1)AJAY KUMAR DAMRAL :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention discloses an improved solar powered street lighting system which broadly consists of a photovoltaic array [10], an energy storage bank [13] and Solar Power Alternating Current Generator [12] & Energy Booster [11], and electrical lighting load [14] wherein the Photovoltaic array [10] typically consists of plurality of photovoltaic cells, which generate a potential upon absorption of radiation energy and these cells may be arranged and connected as desired to obtain whatever potential is necessary, typically, however, such photovoltaic arrays [10] are so connected as to provide approximately 12 volts D.C. output whereas the energy booster [11] typically consists of capacitors in parallel, is instant charging device, which provides the energy to system under low radiations.


5239





(54) Title of the invention : COMMON ADAPTOR FOR INSTRUMENTED STEERING WHEEL FITMENT FOR STEERING EFFORT MEASUREMENT (51) International classification :G01M17/04,G01M17/007 (71)Name of Applicant : (31) Priority Document No :NA 1)TATA MOTORS LIMITED (32) Priority Date :NA Address of Applicant :BOMBAY HOUSE, 24 HOMI MODY (33) Name of priority country :NA STREET, HUTATMA CHOWK, MUMBAI-400001, Maharashtra (86) International Application No :NA India Filing Date :NA (72)Name of Inventor : (87) International Publication No : NA 1)BHALERAO JITENDRA D. (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : This invention relates to an adaptor for instrumented steering wheel. The proposed adaptor is having a cylindrical in shape with central hole at the lower portion to hold a bush. The upper portion of the adaptor is having flanges to attach the instrumented steering wheel. Lateral holes are provided on the adaptor to fix the bush inside the central hole. The steering column is fixed inside the bush inside the bush; the splines of bush and steering column are interengaged to form a perfect fit.


5240





(54) Title of the invention : AN IMPROVED BATTEN HOLDER :H01R13/66 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)MUKESH JETHANAND MAKHIJA (32) Priority Date :NA Address of Applicant :1002, E-WING, ROYAL CLASSIC, (33) Name of priority country :NA NEAR FEME ADLABS, ANDHERI (W), MUMBAI-400068, (86) International Application No :NA Maharashtra India Filing Date :NA (72)Name of Inventor : (87) International Publication No : NA 1)MUKESH JETHANAND MAKHIJA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention provides an one piece batten holder for electric bulbs comprising a circular outwardly directed flange forming an inner cavity which forms the base to connect two connectors, said connectors are securably fastened by screwing from the bottom of the base by screws, said connectors are configured to be adapted at the front side of the said base having inner biasing means to depress the connectors when pressed by the bottom of the bulb having metal terminals, said terminals when pushed against the connectors so that the two pins configured therein moves down in the cut out of the outer periphery of the moulded projected area around the base and fastened by turning around.


5241





(54) Title of the invention : AN IMPROVED ANGLE HOLDER :H01R13/00 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)MUKESH JETHANAND MAKHIJA (32) Priority Date :NA Address of Applicant :1002, E-WING, ROYAL CLASSIC, (33) Name of priority country :NA NEAR FEME ADLABS, ANDHERI (W), MUMBAI-400068, (86) International Application No :NA Maharashtra India Filing Date :NA (72)Name of Inventor : (87) International Publication No : NA 1)MUKESH JETHANAND MAKHIJA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention provides an one piece batten holder for electric bulbs comprising a circular outwardly directed flange forming an inner cavity which forms the base to connect two connectors, said connectors are securably fastened by screwing from the bottom of the base by screws, said connectors are configured to be adapted at the front side of the said base having inner biasing means to depress the connectors when pressed by the bottom of the bulb having metal terminals, said terminals when pushed against the connectors so that the two pins configured therein moves down in the cut out of the outer periphery of the moulded projected area around the base and fastened by turning around.


5242





(54) Title of the invention : A DEVICE FOR MOUNTING AND REMOVING COIL SPRING OF SHOCK ABSORBER ASSEMBLY AND METHOD THEREOF (51) International classification :B23P21/00,B25B27/30 (71)Name of Applicant : (31) Priority Document No :NA 1)TATA MOTORS LIMITED (32) Priority Date :NA Address of Applicant :BOMBAY HOUSE, 24 HOMI MODY (33) Name of priority country :NA STREET, HUTATMA CHOWK, MUMBAI-400001, Maharashtra (86) International Application No :NA India Filing Date :NA (72)Name of Inventor : (87) International Publication No : NA 1)CHAWADIMANI CHETAN S (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : This invention relates to a device for mounting and removing coil spring of shock absorber assembly for automobiles comprising an upper support member mountable below the moving ram plate of a press, a lower support member having a connector to mount a shock absorber strut on the lower plate of said press, said upper support member having downwardly disposed vertical space members, a top plate connected to said vertical space members, said top plate holding a detachable cup shaped member with a central hole for holding the coil spring and the strut; locating means for vertical positioning of the strut when mounted and guide means to ensure that the axis of the top and bottom members are aligned. This invention also includes methods of mounting coil spring and removing the same with the above described device.


5243





(54) Title of the invention : LIGHT EMITTING DIODE BASED SIGNBOARD/ DISPLAY SYSTEM OPERABLE FROM GRID SUPPLY AND/OR RENEWABLE ENERGY SOURCE (51) International classification :G09F13/00 (71)Name of Applicant : (31) Priority Document No :NA 1)SHARADA INVENTIONS PVT. LTD. (32) Priority Date :NA Address of Applicant :94/1, M.I.D.C., SATPUR, NASHIK(33) Name of priority country :NA 422007, Maharashtra India (72)Name of Inventor : (86) International Application No :NA Filing Date :NA 1)OMPRAKASH GANPATRAO KULKARNI (87) International Publication No : NA 2)SURESH BABUBHAI KAPADIA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An Light Emitting Diode based signboard/display system operable from grid supply and/or renewable energy source comprising of a power generator using renewable energy sources; a power controller; a battery bank; and connection means to interconnection the aforesaid components.


5244

Publication After 18 Months : The following Patent Applications have been published under Section 11A (3) of The Patents (Amendment) Act, 2005. Any Person may file representation by way of opposition to the Controller of Patents at the appropriate office against the grant of the patent in the prescribed manner under section 25(1) of the Patents (Amendment) Act, 2005 read with the rule 55 of The Patents (Amendment) Rules, 2006: (12) PATENT APPLICATION PUBLICATION

(21) Application No.10000/DELNP/2007 A



(54) Title of the invention : QUERY-BY-IMAGE SEARCH AND RETRIEVAL SYSTEM (51) International classification :G06F 17/30 (71)Name of Applicant : (31) Priority Document No :11/170,267 1)MICROSOFT CORPORATION (32) Priority Date :29/06/2005 Address of Applicant :ONE MICROSOFT WAY, (33) Name of priority country :U.S.A. REDMOND, WASHINGTON 98052-6399 U.S.A. (86) International Application No :PCT/US2006/018548 (72)Name of Inventor : Filing Date :12/05/2006 1)BREWER, BRETT D (87) International Publication No :WO/2007/005118 2)WATSON, ERIC B (61) Patent of Addition to Application 3)MACBETH, RANDALL J :NA Number 4)WHYTE, NICHOLAS A :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An image query system, and associated method and computer program product are disclosed that enhance and accelerate image-based querying. To this end, the present invention presents a digital image query with implict and explicit associated metadata and retrieval of visually similar images or other pertinent information from a large collection of images stored on local, networked, or web-linked repositories.

No. of Pages : 19 No. of Claims : 12


5245





(54) Title of the invention : DIRECT WIRELESS CLIENT-TO-CLIENT COMMUNICATION (71)Name of Applicant : (51) International classification :H04Q 7/00 (31) Priority Document No :11/177,515 1)MICROSOFT CORPORATION Address of Applicant :ONE MICROSOFT WAY, (32) Priority Date :08/07/2005 REDMOND WASHINGTON 98052-6399. U.S.A. (33) Name of priority country :U.S.A. :PCT/US2006/026821 (72)Name of Inventor : (86) International Application No Filing Date :10/07/2006 1)KUEHNEL, THOMAS W (87) International Publication No : WO/2007/008857 2)ABHISHEK, AMER A (61) Patent of Addition to Application 3)HASSAN, AMER A :NA Number 4)HUITEMA, CHRISTIAN :NA Filing Date 5)ANDERSON, NOEL W (62) Divisional to Application Number :NA 6)RUAN, JIANDONG Filing Date :NA 7)DOUNG, FRANCIS (57) Abstract : A wireless station is connected to a wireless network through an access point and can establish a direct client-to-client connection to a second wireless station. The wireless station can communicate directly with the second wireless station without involving the access point. The wireless station communicates with the wired network and with other wireless stations through the access point. The second wireless station may have an infrastructure connection to the access point or may be independent.



5246





(54) Title of the invention : PRE-CONFIGURED SETTINGS FOR PORTABLE DEVICES (51) International classification :G06F 17/30 (71)Name of Applicant : (31) Priority Document No :11/166,715 1)MICROSOFT CORPORATION (32) Priority Date :27/06/2005 Address of Applicant :ONE MICROSOFT WAY, WASHINGTON 98052-6399 US U.S.A. (33) Name of priority country :U.S.A. :PCT/US2006/015667 (72)Name of Inventor : (86) International Application No Filing Date :26/04/2006 1)ROSENBLOOM, OREN (87) International Publication No :WO/2007/001606 2)SADOVSKY, VLADIMIR (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The technical features mentioned in the abstract do not include a reference sign between parentheses (PCT Rule 8.1 (d)). A system, method, and computer-readable media are disclosed for retrieving configuration files from host units to devices. The system, method, and computer-readable media can, through a media device, detect when surrounding condition has changed so that the media device can benefit from at least on configuration file. If the media device determines that change to surrounding condition has occurred, the media device can then retrieve a configuration file from a designed host unit.



5247





(54) Title of the invention : "RELATIVE SEARCH RESULTS BASED OFF OF USER INTERACTION" (71)Name of Applicant : (51) International classification :G06F 17/30 (31) Priority Document No :11/172,464 1)MICROSOFT CORPORATION Address of Applicant :ONE MICROSOFT WAY, (32) Priority Date :30/06/2005 REDMOND, WASHINGTON 98052-6399 US U.S.A. (33) Name of priority country :U.S.A. :PCT/US2006/018489 (72)Name of Inventor : (86) International Application No Filing Date :12/05/2006 1)JOHNSON, JEFFREY AUSTIN (87) International Publication No : WO/2007/005116 2)JEFFRIES, MATTHEW BRYAN (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A program product and method is disclosed that rely on user interaction in the ordering of search results returned by a search engine. Each of a plurality of records in a database is associated with a user-interaction parameter that is associated with the duration of time that a user accesses a particular record of the search result. Provided that the duration of time that the user accesses the record is greater than a predetermined relevant time period, the user-interaction parameter is weighted to increase the relevance of this record in relation to records that did were not accessed for the relevant time period used in ordering the records identified in a result set generated in response to a search request.



5248





(54) Title of the invention : MEETINGS NEAR ME (51) International classification :H04N 7/14 (71)Name of Applicant : (31) Priority Document No :11/175, 937 1)MICROSOFT CORPORATION (32) Priority Date :06/07/2005 Address of Applicant :ONE MICROSOFT WAY,REDMOND, WASHINGTON 98052-6399 U.S.A. (33) Name of priority country :U.S.A. :PCT/US2006/026373 (72)Name of Inventor : (86) International Application No Filing Date :05/07/2006 1)MANION, TODD R. (87) International Publication No :WO/2007/006010 2)FLANNERY, ELIOT (61) Patent of Addition to Application 3)RAO, RAVI :NA Number 4)CUNNINGHAM, AARON :NA Filing Date 5)SINGHAL, SANDEEP K (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A method for creating, discovering, and joining meetings over a peer-to-peer network involves creation of a graph of meetings on a local subnet. When a meeting is created a meeting record is added to the graph where it may be discovered by other potential meeting attendees. A user may select from a list of meetings displayed in a meeting management window and send requested showing the selected meaning. Credentials, such as a password, may be supplied with the request. When the request is validated, information is sent to the requester for use in joining the meeting. When an ad hoc wireless session is used to hold a meeting the discovery process may further include analyzing data traffic to determine which wireless sessions are meetings.



5249





(54) Title of the invention : AUTOMATED BANKING MACHINE CURRENCY DISPENSER ARRANGEMENT (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filed on

(71)Name of Applicant : :B65H 5/02 1)DIEBOLD, INCORPORATED, :60/453,609 Address of Applicant :5995 MAYFAIR ROAD, NORTH :10/03/2003 CANTON, OH 44720, UNITED STATES OF AMERICA. U.S.A. :U.S.A. (72)Name of Inventor : :PCT/US2004/007035 1)H. THOMAS GRAEF :09/03/2004 2)MICHAEL HARTY : WO/2004/081735 3)MICHAEL S. JOHNSON :NA 4)KENNETH KONTOR :NA 5)BRIAN JONES 6)JON E. WASHINGTON :3701/DELNP/2005 7)DAMON J. BLACKFORD :22/08/2005 8)THOMAS A. VANKIRK

(57) Abstract : An automated banking machine includes a currency note dispenser having a currency cassette, a note picker, a note transporter, and a note presenter. A cassette tambour door automatically opens during insertion of the cassette into the dispenser. The picker can pick notes through the opening. A spring loaded housing wall tab retains the picker shaft in mating connection with a drive pin. The transporter can move notes vertically and horizontally. The transporter includes belts between an idle shaft and a drive shaft. The idle shaft is vertically movable relative to a drive shaft to maintain belt tension. The transporter also includes convexly tapered rollers that automatically recenter a loose belt. A presenter gate is at a note dispensing o...



5250





(54) Title of the invention : AUTOMATED BANKING MACHINE CURRENCY DISPENSER ARRANGEMENT (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filed on

(71)Name of Applicant : :B65H 5/02 1)DIEBOLD,INCORPORATED, :60/453,609 Address of Applicant :5995 MAYFAIR ROAD, NORTH :10/03/2003 CANTON, OH 44720, USA U.S.A. :U.S.A. (72)Name of Inventor : :PCT/US2004/007035 1)H. THOMAS GRAEF :09/03/2004 2)MICHAEL HARTY : WO/2004/081735 3)MICHAEL S. JOHNSON :NA 4)KENNETH KONTOR :NA 5)BRIAN JONES 6)JON E. WASHINGTON :3701/DELNP/2005 7)DAMON J. BLACKFORD :22/08/2005 8)THOMAS A.VANKIRK

(57) Abstract : An automated banking machine includes a currency note dispenser having a currency cassette, a note picker, a note transporter, and a note presenter. A cassette tambour door automatically opens during insertion of the cassette into the dispenser. The picker can pick notes through the opening. A spring loaded housing wall tab retains the picker shaft in mating connection with a drive pin. The transporter can move notes vertically and horizontally. The transporter includes belts between an idle shaft and a drive shaft. The idle shaft is vertically movable relative to a drive shaft to maintain belt tension. The transporter also includes convexly tapered rollers that automatically recenter a loose belt. A presenter gate is at a note dispensing o...



5251





(54) Title of the invention : "ROLLING MILL PRODUCT HANDLING SYSTEM" (51) International classification :F27B9/02 (71)Name of Applicant : (31) Priority Document No :11/523,415 1)MORGAN CONSTRUCTION COMPANY (32) Priority Date :19/09/2006 Address of Applicant :15 BELMONT STREET, (33) Name of priority country :U.S.A. WORCESTER, MASSACHUSETTS 01605, USA U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)MICHAEL ELDREDGE (87) International Publication No :NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A product handling system comprises a support structure defining a pair of stationary inverted first channels with downwardly facing open sides. At least one cylindrical drum is interposed between each of the first channels and an underlying receiver. The drums are rotatable about their axes, with their surfaces arranged to close the open sides of the respective first channels. The drum surfaces are interrupted by second channels, with the first and second channels and the drum axes being arranged in a parallel relationship. Successive product lengths are alternately delivered longitudinally into one and then the other of the first channels. The drums are rotated about their axes resulting in the thus delivered product lengths being sequentially: (i) temporarily retained in the first channels by the rotating drum surfaces; (ii) deposited from the first channels into the second channels when the second channels rotate into radial alignment and communication with the first channels and (iii) downwardly deposited from the second channels to the receiver when the second channels rotate to discharge positions over the underlying receiver.



5252





(54) Title of the invention : AN OPTICAL PROBE DEVICE (51) International classification :G01J 3/02 (71)Name of Applicant : (31) Priority Document No :0003796.0 1)ASTRAZENECA AB, (32) Priority Date :20/10/2000 Address of Applicant :S-15185 SODERTALJE, SWEDEN. (33) Name of priority country :Sweden Sweden :PCT/SE01/02266 (72)Name of Inventor : (86) International Application No Filing Date :16/10/2001 1)STAFFAN FOLESTAD (87) International Publication No :WO 02/33381 2)JONAS JOHANSSON (61) Patent of Addition to Application Number :NA 3)INGELA NIKLASSON BJORN Filing Date :NA (62) Divisional to Application Number :585/DELNP/2003 Filed on :17/04/2003 (57) Abstract : The present invention relates to a method and apparatus for monitoring characteristics of a pharmaceutical composition during preparation thereof by in the process vessel (1) of a fluidized bed apparatus, wherein a measuring device (11, 11") performs a spectometric measurement on the pharmaceutical composition in a wetting zone (B) into which a processing fluid is injected. The method also comprises the generic use of an optical probe device in spectrometric measurements, the probe device being capable of transmitting a two-dimensional image of radiation emitted from a monitoring area in the process vessel (1).



5253





(54) Title of the invention : "A PROCESS FOR PREPARING A PHARMACEUTICAL COMPOSITION" (51) International classification :A61K 38/16 (71)Name of Applicant : (31) Priority Document No :0226105.5 1)HELPERBY THERAPEUTICS LIMITED (32) Priority Date :08/11/2002 Address of Applicant :135 GLOUCESTER ROAD, LONDON SW7 4TH, ENGLAND. U.K. (33) Name of priority country :U.K. :PCT/GB2003/004774 (72)Name of Inventor : (86) International Application No Filing Date :05/11/2003 1)ANTONY ROBERT MILNES COATES (87) International Publication No :WO 2004/041304 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :2184/DELNP/2005 Filed on :24/05/2005 (57) Abstract : A process for preparing a pharmaceutical composition comprising admixing head shock polypeptide or encoding nucleic acid thereof, with pharmaceutically or veterinarily acceptable adjuvent or diluent carrier, wherein the pharmaceutical composition is used in the relief of pain.



5254





(54) Title of the invention : "BARB CONFIGURATIONS FOR BARBED SUTURES" (51) International classification :A61B 17/04 (71)Name of Applicant : (31) Priority Document No :10/065,279 1)QUILL MEDICAL INC. (32) Priority Date :30/09/2002 Address of Applicant :2505 MERIDIAN PARKWAY, SUITE (33) Name of priority country :U.S.A. 150, RESEARCH TRIANGLE PARK, NC 2771 U.S.A. :PCT/US2003/030664 (72)Name of Inventor : (86) International Application No Filing Date :29/09/2003 1)LEUNG, JEFFREY (87) International Publication No : WO/2004/030704 2)RUFF, GREGORY (61) Patent of Addition to Application 3)MEGARO, MATTHEW :NA Number :NA Filing Date (62) Divisional to Application Number :1011/DELNP/2005 Filed on :15/03/2005 (57) Abstract : A barbed suture (1) for connecting tissue, and a combination surgical needle with a barbed suture (1). The suture includes an elongated body (2) and a plurality of barbs (7, 9) projecting from the body. Each barb (7, 9) causes the suture (1) to resist movement in an opposite direction from which the barb (7, 9) faces. The disposition of the barbs (7, 9) on the body (2) may be staggered, twist cut multiple spiral, overlapping, or random. Also, the configuration of the barbs (7, 9) may be a certain spirality angle a, barb cut angle, barb cut depth, barb cut length, barb cut distance, corrugated barb underside, arcuate barb base, or varying barb size.



5255





(54) Title of the invention : "NOVEL QUINUCLIDINE DERIVATIVES AND MEDICINAL COMPOSITIONS CONTAINING THE SAME" (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date

:C07D 453/02 (71)Name of Applicant : :P 9901580 1)ALMIRALL PRODESFARMA AG, :14/07/1999 Address of Applicant :LINDENHOF, DORFSTRASSE 38, :Spain CH-6341 BAAR, SWITZERLAND. Switzerland :PCT/EP00/06469 (72)Name of Inventor : :07/07/2000 1)DOLORS FERNANDEZ FORNER, : 2)MARIA PRAT QUINONES, (87) International Publication No WO/2001/004118 3)MARIA ANTONIA BUIL ALBERO, (61) Patent of Addition to Application Number :NA Filing Date :NA :IN/PCT/2002, (62) Divisional to Application Number 00049/DEL Filed on :11/01/2002 (57) Abstract : A compound according to formula (I) wherein z© is a phenyl ring, a C4 to C9 heteroaromatic compound containing one or more heteroatoms, or a naphthalenyl, 5,6,7,8-tetrahydronaphthalenyl or biphenyl group; which shows high affinity for muscarinic M3 receptors (Hm3).



5256





(54) Title of the invention : "POLYMORPHIC FORMS OF RIFAXIMIN, PROCESSES FOR THEIR PRODUCTION AND USE THEREOF IN MEDICINAL PREPARATIONS" (51) International classification :C07D 498/22 (71)Name of Applicant : (31) Priority Document No :MI2003A002144 1)ALFA WASSERMANN S. P. A. (32) Priority Date :07/11/2003 Address of Applicant :CONTRADA S. EMIDIO, I-65020 (33) Name of priority country :Italy ALANNO (PE), ITALY. Italy (86) International Application No :PCT/EP2004/012490 (72)Name of Inventor : Filing Date :04/11/2004 1)VISCOMI, GIUSEPPE, C. (87) International Publication No :WO 2005/044823 2)CAMPANA, MANUELA (61) Patent of Addition to Application 3)BRAGA, DARIO :NA Number 4)CONFORTINI, DONATELLA :NA Filing Date 5)CANNATA, VINCENZO (62) Divisional to Application Number :3181/DELNP/2005 6)RIGHI, PAOLO Filed on :18/07/2005 7)ROSINI, GOFFREDO (57) Abstract : Crystalline polymorphic forms of rifaximin (INN), referred to as rifaximin Î± and rifaximin Î², and a poorly crystalline form referred to as rifaximin Î³, useful in the production of medicaments containing rifaximin for the oral and topical use and obtained by means of a crystallization process carried out by hot-dissolving the raw rifaximin in ethyl alcohol and causing the crystallization of the product by addition of water at a fixed temperature and for a fixed period of time, followed by drying under controlled conditions until reaching a precise water content in the end product, are the object of the invention.



5257





(54) Title of the invention : "GASIFICATION REACTOR AND GAS TURBINE CYCLE IN IGCC SYSTEM" (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country

:C10J3 :10-20060087447 :11/09/2006 :Republic of Korea :NA :NA :NA :NA :NA :NA :NA

(71)Name of Applicant : 1)HYUN YONG KIM Address of Applicant :449-6, PYEONGCHANG-DONG JONGRO-KU, SEOUL, REPUBLIC OF KOREA Republic of Korea (72)Name of Inventor : 1)HYUN YONG KIM

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The present invention features gasification reactor and gas turbine cycle in an IGCC. A gas turbine is coupled to a gasification reactor and drives the gasification reaction. The gasification reactor includes a reduction reaction chamber, a feed stock inlet for introducing the feed stock into the reduction reaction chamber, a gas inlet for introducing an exhaust gas generated by the turbine into the reduction reaction chamber, and a gas outlet for releasing syngas generated by a reduction reaction of the feed stock and the exhaust gas in the reduction reaction chamber. The temperature of the reduction reaction chamber is maintained above 1200°C and below a non-fluid point of the non-carbonaceous component, such as slag in coal, included in the feed stock.



5258





(54) Title of the invention : "ACHROMATIC AND ABSORPTION REDUCING LIGHT COLLECTING SYSTEM, PARTICULARILY ADAPTED TO OPTICAL SPECTROMETRIC ANALYSIS" (51) International classification :G01J 3/28 (71)Name of Applicant : (31) Priority Document No :02/12467 1)COMMISSARIAT A L'ENERGIE ATOMIQUE Address of Applicant :31/33 RUE DE LA FEDERATION, F(32) Priority Date :08/10/2002 75752 PARIS 15TH, FRANCE France (33) Name of priority country :France (86) International Application No :PCT/FR2003/002947 (72)Name of Inventor : Filing Date :07/10/2003 1)HUBINOIS, JEAN-CHARLES (87) International Publication No :WO 2004/034119 2)LAVOINE, VINCENT (61) Patent of Addition to Application 3)CHOLLET, HERVE :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention concerns a achromatic and absorption reducing light collecting system, particularly adapted to optical spectrometric analysis. Said system collects light emitted by at least one light source (52) and focuses same on at least one light detecting device (54). It comprises preferably a first mirror (58) which collects light emitted by the source and focuses same on a second mirror (60) which in turn focuses it on the device. The system is equipped with a chamber which is opaque to any type of light, in particular to ultraviolet rays, and wherein are placed the light source, the light detecting device and the mirrors, and means for creating a vacuum in said chamber or for filling it with a gas which is transparent to ultraviolet r...



5259





(54) Title of the invention : "NEW FLUORENECARBOXYLIC ACID ESTERS, PROCESS FOR THE MANUFACTURE THEREOF AND USE THEREOF AS MEDICAMENTS"

(51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filed on

(71)Name of Applicant : :C07D 451/06 1)BOEHRINGER INGELHEIM PHARMA GMBH & CO. :102 03 741.8 KG., :31/01/2002 Address of Applicant :BINGER STRASSE 173, D-55216 :Germany INGELHEIM AM RHEIN, GERMANY. Germany :PCT/EP03/00534 (72)Name of Inventor : :21/01/2003 1)SABINE GERMEYER : WO/2003/064419 2)HELMUT MEISSNER 3)GERD MORSCHHAUSER :NA 4)SABINE PESTEL :NA 5)MICHAEL PIEPER :1833/DELNP/2004 6)GERALD POHL :18/06/2004 7)RICHARD REICHL 8)GEORG SPECK

(57) Abstract : The invention relates to novel fluorene carboxylic acid esters of general formula (I) wherein X- and the groups A, R, R1, R2, R3, R3", R4 and R4" have the designations cited in the claims and in the description. The invention also relates to methods for producing said novel fluorene carboxylic acid esters and to the use of the same as pharmaceuticals.



5260





(54) Title of the invention : "MOBILE WIRELESS COMMUNICATIONS DEVICE HAVING DUAL ANTENNA SYSTEM FOR CELLULAR AND WIFI" (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country

:G06F21/00 (71)Name of Applicant : :06119892.5 1)RESEARCH IN MOTION LIMITED :31/08/2006 Address of Applicant :295 PHILLIP STREET, WATERLOO, :EUROPEAN ONTARIO N2L 3W8, CANADA. Canada UNION (72)Name of Inventor : :NA 1)MAN YING TONG :NA 2)QI YIHONG :NA :NA :NA :NA :NA

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A mobile wireless communications device includes a housing and circuit board carried by the housing. Radio Frequency (RF) circuitry is mounted on the circuit board, A first antenna is supported by the circuit board within the housing and operatively connected to the RF circuitry and configured for cellular phone communications. A second antenna is supported by the circuit board within the housing and operatively connected to the RF circuitry and configured for WiFi communications. The second antenna comprises an inverted-F or monopole antenna having an opening gap that is pointed away from the first antenna.



5261





(54) Title of the invention : "BACKLIGHT STRUCTURE FOR KEYBOARD" (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country

:G06F3/02 :95216550 :15/09/2006 :Chinese Taipei :NA :NA :NA :NA :NA :NA :NA

(71)Name of Applicant : 1)SHENG HONG CO.LTD. Address of Applicant :NO.31, LANE 333, SINSHU RD., SINJHUANG CITY, TAIPEI COUNTY 242, TAIWAN R.O.C. Taiwan (72)Name of Inventor : 1)CHEN,YU-CHENG

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A backlight structure for keyboard includes a circuit board provided on an upper surface with spring leaves, between which LEDs are disposed depending on actual need; a light-pervious keyboard covered onto the upper surface of the circuit board and provided with a plurality of keys corresponding to the spring leaves; a reflective sheet fitly attached to the upper surface of the circuit board and provided with receiving holes corresponding to the LEDs; and a light-pervious light guide plate located between the keyboard and the reflective sheet, and provided with keyholes corresponding to the keys on the keyboard, and receiving holes corresponding to the LEDs. Each of the keyholes on the light guide plate is provided around any one of two ends with an annular processed area.



5262





(54) Title of the invention : "LOW DENSITY RIGID REINFORCED POLYURETHANES AND A PROCESS FOR THEIR PRODUCTION" (51) International classification :C08G18/08 (71)Name of Applicant : (31) Priority Document No :11/513,764 1)BAYER MATERIALSCIENCE LLC (32) Priority Date :31/08/2006 Address of Applicant :100 BAYER ROAD, PITTSBURGH, (33) Name of priority country :U.S.A. PA 15205-9741, USA. U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)USAMA E.YOUNES (87) International Publication No :NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Fiber-reinforced polyurethanes having densities no greater than 0.9 g/cc which are suitable for use as automotive components are produced from a polyurethane-forming reaction mixture in which carbon dioxide is dissolved in one or both of the reaction components. The amount of dissolved carbon dioxide is from 0.2 to 2.0 g/l. The isocyanate-reactive component is a polyol having a functionality of from 3 to 8 and a hydroxyl number of at least 600. Any fibrous material may be used but glass fiber, particularly glass fibers having lengths from 12.5 to 100 mm are particularly preferred.



5263





(54) Title of the invention : "RIGID POLYURETHANE FOAMS WITH LOW THERMAL CONDUCTIVITY AND A PROCESS FOR THEIR PRODUCTION" (51) International classification :C08G18/48 (71)Name of Applicant : (31) Priority Document No :11/513,767 1)BAYER MATERIALSCIENCE LLC., (32) Priority Date :31/08/2006 Address of Applicant :100 BAYER ROAD, PITTSBURGH, (33) Name of priority country :U.S.A. PA 15205-9741, USA. U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)V. MICHAEL MAUTINO (87) International Publication No :NA 2)STEVEN L. SCHILLING (61) Patent of Addition to Application Number :NA 3)EDWARD E. BALL Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Rigid closed-cell polyurethane foams with low k-factors are produced by reacting an organic polyisocyanate with an amine-based polyether polyol and a polyester polyol in the presence of a catalyst and a hydrofluorocarbon blowing agent, preferably, HFC-245fa. It is preferred that no water be added to the reaction mixture.



5264





(54) Title of the invention : "AN APPARATUS FOR STRIPPING ELECTRODEPOSITED METAL SHEETS" (51) International classification (31) Priority Document No

:C25C7/08 (71)Name of Applicant : :20061)NIPPON MINING & METALS CO.,LTD 266326 Address of Applicant :2-10-1 TORANOMON MINATO-KU :29/09/2006 TOKYO 1205-0001 JAPAN. Japan :Japan (72)Name of Inventor : :NA 1)SATOSHI NAMIKI :NA 2)TOSHIMASA FUKUOKA :NA 3)NAOKOI SUZUKI :NA 4)TADAATSU YOSHIDA :NA :NA :NA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : [Object] To provide an apparatus for stripping electrodeposited metal sheets able to complete the series of operations of flexing, chiseling. downending performed for stripping the electrodeposited metal sheets from a cathode plate in a single operation without performing flapping. [Solution] An apparatus for stripping electrodeposited metal sheets from a cathode plate characterized in stripping the electrodeposited metal sheets by retaining a cathode plate with metal deposited on its surfaces by electro-refining in an upright state, creating gaps in between said cathode plate and said electrodeposited metal sheets by pressing said cathode plate from its lateral sides, stripping said electrodeposited metal sheets by inserting chisels in between the produced gaps, and pulling down the stripped electrodeposited metal sheets on their bottom ends as base point to be fully stripped, wherein a base part on which said cathode plate is mounted being formed with protrusions on its both sides, said protrusions being arranged to contact the surfaces of the lower sections of said stripped electrodeposited metal sheets when they are pulled down so that at least the upper ends of said electrodeposited metal sheets be brought down to the level lower than said protrusions, said electrodeposited metal sheets thereby being separated from said cathode plate.



5265





(54) Title of the invention : LED ILLUMINATION APPARATUS (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country

:H01L33/00 :095215993 :08/09/2006 :Chinese Taipei :NA :NA :NA :NA :NA :NA :NA

(71)Name of Applicant : 1)AUGUX CO.,LTD. Address of Applicant :1F.-9, NO.40-2,SEC.1,MINSHENG N.RD., GUEISHAN TOWNSHIP, TAOYUAN COUNTY 333, TAIWAN Taiwan (72)Name of Inventor : 1)WANG PEI-CHOA

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : An LED illumination apparatus includes a lamp housing, an LED module, distal covers and a light-transmitting hood. The lamp housing has a base, a heat sink at the top of the base, a heat dissipating channel between two adjacent heat sinks, and a receiving portion on an internal side of the base. The LED module includes a fixing base, a lampshade on a side of the fixing base, a plurality of LED lamps in the lampshade, and a connecting portion on the fixing base and coupled to the corresponding receiving portion. Each distal cover seals the front and back of the lamp housing, and the light-transmitting hood is connected under the lamp housing, and a containing space enclosed by the lamp housing, distal cover and light-transmitting hood for installing the LED module. The invention can simplify the manufacturing processes and reduce the material cost and development time.



5266





(54) Title of the invention : "ROLLER CHAIN FOR DRIVING" (51) International classification (31) Priority Document No

:F01L1/02; (71)Name of Applicant : F02B77/00 1)HONDA MOTOR CO.,LTD :2006Address of Applicant :1-1, MINAMI-AOYAMA 2-CHOME, 193257 MINATO-KU, TOKYO 107-8556 JAPAN. Japan :13/07/2006 (72)Name of Inventor : :Japan 1)HIDEKI HONMA :NA 2)KAZUHISA MAEDA :NA 3)NOBU SASAKI :NA 4)MIJO ITO :NA :NA :NA :NA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : To provide a lightweight roller chain for driving by optimizing the shape of a link plate to minimize its weight. [Solving Means] An outer plate 7 has an almost rectangular outer window 11 formed between a pair of link pin apertures and an inner plate 4 has an almost rectangular inner window 10 formed between a pair of bush apertures 5. The outer and inner windows are each rounded at its corners. The outer plate 7 and inner plate 4 are each composed of a circular arc portion 41, 71 at lengthwise both ends thereof and a side 42, 72 extending almost linearly and widthwise outwardly thereof. The sides 72 are set so as to extend inwardly relative to the end-tangential directions of the circular arc portions 71 of the outer plate 7. [Selected Drawing] Fig. 1



5267





(54) Title of the invention : "FUEL INJECTION CONTROL DEVICE" (51) International classification (31) Priority Document No

:F02M1/00 (71)Name of Applicant : :20061)HONDA MOTOR CO., LTD. 232711 Address of Applicant :1-1,MINAMI-AOYAMA 2-CHOME, :29/08/2006 MINATO-KU, TOKYO 107-8556, JAPAN Japan :Japan (72)Name of Inventor : :NA 1)SHIRO KOKUBU :NA :NA :NA :NA :NA :NA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The present invention provides a fuel injection control device of a multiple-kind fuel internal combustion engine which can perform a stable optimum fuel supply control in response to mixing ratios of multiple-kind fuels and, at the same time, shortens the starting time and prevents the covering of the plug. [Means for Resolution] A ROM 23 of an ECU 10 stores a plurality of reference fuel injection quantity maps corresponding to mixture concentrations of multiple-kind fuels. A control program of the CUP 21 stores which map is used out of the plurality of reference fuel injection quantity maps in an EEP-ROM 24, performs a starting control of an engine using the reference fuel injection quantity map which is used immediately before stopping previous time at the time of initiating the starting based on the stored maps and, at the same time, performs the starting control by gradually increasing the fuel injection quantity until the starting of an engine is finished.



5268





(54) Title of the invention : "BUTYL ADHESIVE CONTAINING MALEIC ANHYDRIDE AND OPTIONAL NANOCLAY" :B32B15/08 (71)Name of Applicant : (51) International classification (31) Priority Document No :60/839,866 1)LANXESS INC, (32) Priority Date :24/08/2006 Address of Applicant :ONTARIO, CANADA N7T 7M2 (33) Name of priority country :U.S.A. Canada (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)AKHTAR OSMAN (87) International Publication No :NA 2)RAYNER KRISTA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An adhesive polymer comprising a maleic anhydride grafted butyl rubber and a polymer compound made from the adhesive polymer further comprising a functionalized siliceous nanoclay. The adhesive polymer and polymer compound exhibit greatly improved adhesion to certain substrate surfaces. Examples of substrate materials include stainless steel, glass, mylar or Teflon®. The greatest adhesion was observed in polymer compounds comprising maleic anhydride grafted butyl rubber produced according to a solution process and from 5 to 15 phr of a montmorillonite nanoclay. The adhesion is improved with increasing levels of nanoclay content in the compound up to a limit where filler-filler interactions occur.



5269





(54) Title of the invention : "PHOTOELECTROCHEMICAL METHOD OF SEPARATING WATER INTO HYDROGEN AND OXYGEN, USING MELANINS OR THE ANALOGUES, PRECURSORS OR DERIVATIVES THEREOF AS THE CENTRAL ELECTROLYSING ELEMAENT" (51) International classification :C25B1/04; C25B1/00 (71)Name of Applicant : (31) Priority Document No :GT/a/2005/000006 1)SOLIS HERRERA Arturo (32) Priority Date :09/06/2005 Address of Applicant :LOPEZ VELARDE #108, COLONIA (33) Name of priority country :Mexico CENTRO, AGUASCALIENTES,AGS. CP 20000 MEXICO. :PCT/MX2005/000092 Mexico (86) International Application No Filing Date :13/10/2005 (72)Name of Inventor : (87) International Publication No :WO 2006/132521 1)SOLIS HERRERA ARTURO (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Photoelectrochemical process to generate energy, that comprises; water, at least one water soluble electrolyzing material such as melanin, mobile electron carriers, and a source of energy; the electrons excited by the source of energy are taken from the exterior of the electrolyzing material to the interior, followed by the generation of high energy electrons, from low energy electrons; these high energy electrons go toward the reaction centers of the electrolyzing material through carriers, where they are caught by an acceptor and transferred onto another primary acceptor of electrons, these ionic interactions depending on pH, this electron transfer liberates energy which is used to establish a gradient of protons, i.e. a positively charged or oxidant agent and a negatively charged or reducing agent are formed; in this way the photoelectrolysis starts in a billionesimal of second after the excitement; the reaction is reversible, i.e. for the production of the molecule of 02 and 41-T, the photoelectrolysis requires the removal of four electrons coming from two water molecules, the removal of four water electrons requires the absorption of four photons, one for each electron; this reaction is exergonic and consumes energy; on the other hand, water is generated when the photons reduce oxygen atoms with hydrogen atoms forming water molecules and liberating energy; a better benefit of the reaction is obtained when the electrolyzing material is doped; the temperature of the process may range between 2 to 45°C.



5270





(54) Title of the invention : "A PHARMACEUTICAL COMPOSITION" (51) International classification :A61K 9/00 (71)Name of Applicant : (31) Priority Document No :02076897.4 1)TIBOTEC PHARMACEUTICALS LTD. (32) Priority Date :13/05/2002 Address of Applicant :LITTLE ISLAND, CO CORK, (33) Name of priority country :EPO IRELAND. Ireland (86) International Application No :PCT/EP03/50158 (72)Name of Inventor : Filing Date :13/05/2003 1)JENS [MARCEL] VAN ROEY (87) International Publication No :WO 03/094920 2)MARIE-PIERRE T.M.M.G. DE BETHUNE (61) Patent of Addition to Application 3)PAUL STOFFELS :NA Number :NA Filing Date (62) Divisional to Application Number :3779/DELNP/2004 Filed on :30/11/2004 (57) Abstract : The present invention concerns the microbicidal activity of certain pyrimidine or triazine containing non-nucleoside reverse transcriptase inhibitors. The compounds of the present invention inhibit the systemic infection of a human being with HIV, in particular, the present compounds prevent sexual HIV transmission in humans.



5271





(54) Title of the invention : MULTI-HEAD EMBROIDERY MACHINE (51) International classification (31) Priority Document No

:D05C3/02 :2006228755 :25/08/2006 :Japan :NA :NA :NA :NA :NA :NA :NA

(71)Name of Applicant : 1)KABUSHIKIKAISHA BARUDAN Address of Applicant :20, AZA-TSUKAGOSHI, JYOSUIJI,ICHINOMIYA-SHI, AICHI-KEN, 491-0004,JAPAN Japan (72)Name of Inventor : 1)MIKIO KATAOKA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The present invention provides a multi-head embroidery machine, in which 21 to 70 units of sewing machine heads, each including arranged 3 to 15 needles, are arranged in a line on a machine frame at a head center pitch of 135 to 400 mm, and a main spindle common to all the sewing machine heads is driven by two motors connected to both end portions of the main spindle.



5272





(54) Title of the invention : "BACKLIGHT STRUCTURE FOR KEYBOARD" (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country

:G01D11/28; :95216703 :19/09/2006 :Chinese Taipei :NA :NA :NA :NA :NA :NA :NA

(71)Name of Applicant : 1)SHENG HONG CO. LTD. Address of Applicant :NO.31,LANE 333, SINSHU RD., SINJHUANG CITY, TAIPEI COUNTY 242, TAIWAN R.O.C Taiwan (72)Name of Inventor : 1)CHEN, YU-CHENG

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A backlight structure for keyboard includes a circuit board provided on an upper surface with spring leaves, between which LEDs are disposed depending on actual need; a light-pervious keyboard covered onto the upper surface of the circuit board and provided with a plurality of keys corresponding to the spring leaves; a reflective sheet fitly attached to the upper surface of the circuit board and provided with receiving holes corresponding to the LEDs; and a light-pervious light guide plate located between the keyboard and the reflective sheet, and provided with keyholes corresponding to the keys on the keyboard, and receiving holes corresponding to the LEDs. And, a perforated area including a plurality of arrayed holes is provided around each of the keyholes on the light guide plate.



5273





(54) Title of the invention : "LINEAR TRACTOR DRY COAL EXTRUSION PUMP" (51) International classification

:C10J3/50; (71)Name of Applicant : C10J3/48 1)PRATT & WHITNEY ROCKETDYNE, INC. :11/520,154 Address of Applicant :6633 CANOGA AVENUE, P.O.BOX :13/09/2006 7922, CANOGA PARK, CA 91309, USA U.S.A. :U.S.A. (72)Name of Inventor : :NA 1)KENNETH M. SPROUSE :NA 2)DAVID R. MATTHEWS :NA :NA :NA :NA :NA

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A pump for transporting particulate material includes an inlet, an outlet, a passageway, a first and second load beam, a first and second scraper seal, and a first and second drive assembly. The inlet introduces the particulate material into the passageway and the outlet expels the particulate material from the passageway. The passageway is defined by a first belt assembly and a second belt assembly that are opposed to each other. The first and second load beams are positioned within the first belt assembly and the second belt assembly, respectively. The first scraper seal and a second scraper seal are positioned proximate the passageway and the outlet. The first drive assembly is positioned within an interior section of the first belt assembly and drives the first belt assembly and the second drive assembly is positioned within an interior section of the second belt assembly and drives the second belt assembly.



5274





(54) Title of the invention : "4-ACETOXY-2Alpha -BENZOYLOXY-5Beta ,20-EPOXY-1, 7Beta, 10Beta-TRIHYDROXY-9-OXOTAK-11-EN-13Alpha-YL(2R,3S)-3-TERT-BUTOXY-CARBONYLAMINO-2-HYDROXY-3-PHENYLPROPIONATE TRIHYDRATE" (51) International classification

:A60K 31/00 :NA :NA :NA :NA :NA :NA :NA :NA :NA :NA

(71)Name of Applicant : 1)AVENTIS PHARMA S.A. (FORMERLY KNOWN AS RHONE-POULENC RORER S.A.) Address of Applicant :20, AVENUE RAYMOND ARON, 92160 ANTONY, FRANCE. France (72)Name of Inventor : 1)JEAN RENE AUTHELIN 2)JACQUES DOVEZE 3)ELIE FOUQUE 4)BERNADETTE MANDARD 5)ISABELLE TAILLEPIED

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : 4-acetoxy-2α-benzoyloxy-5β ,20-epoxy-1,7 β , 10 β -trihydroxy-9-oxo-tax- 1 l-en-13α-yl (2R,3S)-3-tert-butoxy-carbonylamino-2hydroxy-3- phenylpropionate trihydrate whenever prepared by crystallizing 4- acetoxy-2α-benzoyloxy-5 β ,20-epoxy-1 ,7 β , 10 β -trihydroxy-9-oxo-tax-11-en- 13α-yl (2 R, 3S) -3 -tert-butoxycarbonylamino-2 -hydroxy-3-phenylpropionate from a mixture of water and an aliphatic alcohol containing 1 to 3 carbon atoms wherein the water: alcohol weight ratio is used is about 2:1, and then drying the product obtained under defined conditions of temperature, pressure and humidity.



5275





(54) Title of the invention : FORCE-MEASURING DEVICE AND REFERNCE UNIT (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country

:A61B5/22; (71)Name of Applicant : G01L1/00 1)METTLER-TOLEDO AG :06120100.0 Address of Applicant :IM LANGACHER CH-8606 :05/09/2006 GREIFENSEE, SWITZERLAND Switzerland :EUROPEAN (72)Name of Inventor : UNION 1)REBER, DANIEL :NA 2)BURKHARD, HANS-RUDOLF :NA :NA :NA :NA :NA :NA

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The force-measuring device (1000) includes a measuring unit (100) and a reference unit (100R), the latter serving to deliver a reference quantity, a reference current (IREF) or a reference voltage (UREF) , by means of which the force (FHO) of a measurement object which is to be determined can be measured by the measuring unit (100). According to the invention, the reference unit (100R) is a force-measuring device which is loaded with a reference mass (mREF) and which in accordance with the principle of electromagnetic force compensation generates a reference current (IRE?) that can be regulated by means of a measuring- and regulating device (3R, 4R) in such a way that in a first reference coil (1R; 1Ra) which is held by a reference lever (105R) the reference current (IREF) generates a magnetic field which cooperates with the magnetic field of a reference magnet (2R) in such a way that a magnetic force is brought to bear on the reference lever (105R) , wherein the force (FREF) of the reference mass (MREF) which is likewise acting on the reference lever can be compensated by said magnetic force.



5276





(54) Title of the invention : "A METHOD FOR PREPARING DRONEDARONE" (51) International classification :C07D 307/79 (71)Name of Applicant : (31) Priority Document No :00/16,070 1)SANOFI-SYNTHELABO (32) Priority Date :11/12/2000 Address of Applicant :174, AVENUE DE FRANCE, F-75013 (33) Name of priority country :France PARIS, FRANCE France :PCT/FR01/03899 (72)Name of Inventor : (86) International Application No Filing Date :10/12/2001 1)NOEL FINO (87) International Publication No :WO 02/48132 2)CORINNE LEROY (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :812/DELNP/2003 Filed on :26/05/2003 (57) Abstract : A method for preparing dronedarone, characterized in that, in an organic phase consisting of one or more solvents chosen from halogenated or nonhalogenated hydrocarbons, 2-butyl-5-(methanesulfonamido)benzofuran is reacted with 4-[3(dibutylamino)propoxy]benzoyl chloride hydrochloride, this being in the presence of a maximum of 5 molar equivalents of a Lewis acid as catalyst, and then hydrolysis is carried out so as to form dronedarone hydrochloride which is recovered in the organic phase, which is isolated and which is treated with a basic agent, to give the desired compound.



5277





(54) Title of the invention : ANCHOR BRACKET (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country

(71)Name of Applicant : :B60N2/02 :06020310.6 1)HALDEX BRAKE PRODUCTS AB Address of Applicant :BOX 501 26124 LANDSKRONA :27/09/2006 :EUROPEAN SWEDEN. Sweden UNION (72)Name of Inventor : :NA 1)MR. AKE OLSSON :NA :NA :NA :NA :NA :NA

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The present invention is relating to an anchor bracket (4) for a control arm arrangement for a brake lever of a road vehicle, in which the control arm is being pivotally connected to the brake lever The anchor bracket (4) is comprising a fastening section (9) for attachment to a frame part of the vehicle, a cooperating section (8) for connection to the control arm and an intermediate section (10) between the fastening section (9) and the cooperating section (8), whereby the cooperating section (8) comprises an axial dimension specifically selected with regard to the fastening section (9) and the intermediate section (10) so that several distances between the frame part (2) of the vehicle and the brake lever in different installations are covered.



5278





(54) Title of the invention : METHOD FOR PREPARATION OF FLUTICASONE PROPIONATE (71)Name of Applicant : (51) International classification :C07C 327/02 (31) Priority Document No :NA 1)SHANGHAI AURISCO INTERNATIONAL TRADING (32) Priority Date :NA CO.,LTD Address of Applicant :ROOM 1709-1710, HITECH PLAZA, (33) Name of priority country :NA :PCT/CN2005/001339 NO.488, SOUTH WUNING ROAD, JING AN DISTRICT, (86) International Application No SHANGHAI, CHINA 200042 China Filing Date :29/08/2005 (72)Name of Inventor : (87) International Publication No : WO/2007/012228 (61) Patent of Addition to Application 1)CHU, DINGJUN :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A method for preparing S-fluoromethyl-6Î±, 9Î±-difluoro-11Î²-hydroxy-16Î±-methyl-17Î±-propionyloxy-3-oxoandrosta-1, 4-diene17Î²-carbothioate (fluticasone propionate) was disclosed. The present method could be conduct simply and conveniently in mild conditions with high product purity, and be suitable for commercial process on a large scale.



5279





(54) Title of the invention : SPEED DEPENDENT DISPLAYING OF INFORMATION ITEMS IN GRAPHICAL USER INTERFACE (51) International classification :G06F (71)Name of Applicant : (31) Priority Document No :11/535,104 1)NOKIA CORPORATION (32) Priority Date :26/09/2006 Address of Applicant :KEILALAHDENTIE 4, FIN - 02150 (33) Name of priority country :U.S.A. ESPOO, FINLAND. Finland (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)REPONEN, ERIKA (87) International Publication No :NA 2)ELOMAA, TIMO (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Electronic device with a display screen and a navigational input device places information items in a string along a path on the display screen. The user can move the string of information items along the path at a variable speed by using the navigational input means. The shape of the path is changed in relation to the speed at which the string of information items is moved along the path. At low speeds the path is substantially rectangular and follows the outline of the rectangular display screen. At higher speeds the path becomes more and more curved. It is suggested that Fig. 4 is published with the abstract.



5280





(54) Title of the invention : "RING BINDER MECHANISM" (51) International classification :B42F1/00 (71)Name of Applicant : (31) Priority Document No :60/827,205 1)WORLD WIDE STATIONERY MFG.CO.LTD. (32) Priority Date :27/09/2006 Address of Applicant :19/F, KOON WAH MIRRORS (33) Name of priority country :U.S.A. FACTORY, 3RD INDUSTRIAL BUILDING, 5-9 KA HING (86) International Application No :NA RD.,KWAI CHUNG, NEW TERRITORY, HONG KONG Hongkong(China) Filing Date :NA (87) International Publication No :NA (72)Name of Inventor : (61) Patent of Addition to Application Number :NA 1)WING YIU NG Filing Date :NA 2)HUNG YU CHENG (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A ring mechanism for retaining loose leaf pages has a housing and hinge plates supported by the housing for pivoting motion relative to the housing. Ring members are mounted on the hinge plates and are moveable between a closed position and an open position. An actuator is mounted on the housing for movement relative to the housing for causing pivoting motion of the hinge plates. A locking element releasably locks the closed ring members in a locked position and releases the closed ring members to move to the open position in an unlocked position. An intermediate connector operably connects the locking element to the actuator. The intermediate connector is deformable during movement of the actuator.



5281





(54) Title of the invention : "RING BINDER MECHANISM" (51) International classification :B42F1/00 (71)Name of Applicant : (31) Priority Document No :60/827,205 1)WORLD WIDE STATIONERY MFG.CO.LTD. (32) Priority Date :27/09/2006 Address of Applicant :19/F, KOON WAH MIRRORS (33) Name of priority country :U.S.A. FACTORY, 3RD INDUSTRIAL BUILDING, 5-9 KA HING (86) International Application No :NA RD.,KWAI CHUNG, NEW TERRITORY, HONG KONG Hongkong(China) Filing Date :NA (87) International Publication No :NA (72)Name of Inventor : (61) Patent of Addition to Application Number :NA 1)JN BIAO PI Filing Date :NA 2)CHUN YUEN TO (62) Divisional to Application Number :NA 3)ZE YU ZHANG Filing Date :NA (57) Abstract : A ring binder mechanism includes a housing, a ring support, and rings for holding loose-leaf pages. Each ring includes a first ring member and a second ring member that are moveable between a closed position and an opened position. An actuator is mounted on the housing for moving the ring members from the closed position to the opened position. A travel bar has at least one locking element and is moveable between a locked position wherein the ring members are locked in the closed position and an unlocked position wherein the ring members are capable of being moved to the opened position. An intermediate connector operably connects the travel bar to the actuator. A biasing member is engageable with the intermediate connector and at least one of the travel bar and actuator for biasing the travel bar toward the locked position.



5282





(54) Title of the invention : "TRANSFER OF KINETIC ENERGY TO AND FROM FLUIDS" (51) International classification :F03D 5/06 (71)Name of Applicant : (31) Priority Document No :60/685,891 1)COLIN C. KERR (32) Priority Date :01/06/2005 Address of Applicant :46,FAIRBANKS STREET, DARTMOUTH, NOVA SCOTIA B3A 1C3, CANADA. Canada (33) Name of priority country :U.S.A. :PCT/US2006/021157 (72)Name of Inventor : (86) International Application No Filing Date :01/06/2006 1)COLIN C. KERR (87) International Publication No :WO 2006/130719 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Method and apparatus for converting the kinetic energy of a moving fluid stream into useful work by using a parallel cascade of aerofoils or hydrofoils positioned therein. The foils may be provided with at least two degrees of freedom and adjacent foils move in antiphase. The foils are subjected to resonant oscillations, known as flutter, induced by the fluid flow. Profiled inflow and outflow ducts may be positioned upstream and downstream, and the apparatus may be enclosed in a profiled duct, to increase efficiency by altering the fluid velocity and pressure. The foils are cantilevered, supported by vertical rods but are otherwise unattached. A cascade comprised of independent foil modules, each including a foil, a power conversion module ...



5283





(54) Title of the invention : "ENGINE-DRIVEN WORK MACHINE" (51) International classification (31) Priority Document No

:F02D9/02 (71)Name of Applicant : :20061)HONDA MOTOR CO.,LTD. 231010 Address of Applicant :1-1,MINAMI-AOYAMA 2-CHOME, :28/08/2006 MINATO-KU, TOKYO 107-8556, JAPAN Japan :Japan (72)Name of Inventor : :NA 1)TAKASHI ITO :NA 2)TAIYO ONODERA :NA :NA :NA :NA :NA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : An engine and a generator driven by the engine are resiliency supported on a frame. A duct member is integrally attached to the engine and the generator to define a continuous cooling-air passage between the duct member and outer peripheral surfaces of the engine and the generator. A cooling fan is disposed on an inlet side of the cooling-air passage. A silencing plate is integrally attached to the duct member and faces an inlet of the cooling-air passage with a ventilation gap defined therebetween. The silencing plate has an area opposing the inlet that is larger than an opening area of the inlet.



5284





(54) Title of the invention : "ENGINE-DRIVEN WORK MACHINE" (51) International classification (31) Priority Document No

:F02D9/02 (71)Name of Applicant : :20061)HONDA MOTOR CO.,LTD. 228912 Address of Applicant :1-1,MINAMI-AOYAMA 2-CHOME, :25/08/2006 MINATO-KU, TOKYO 107-8556, JAPAN Japan :Japan (72)Name of Inventor : :NA 1)HIROKO MURAKAMI :NA 2)TADAFUMI HIROSE :NA 3)TAIYO ONODERA :NA :NA :NA :NA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A duct member is disposed around outer peripheries of an engine and an engine-driven generator to define a continuous cooling-air passage between the duct member and the outer peripheries. A cooling fan is disposed in the cooling-air passage to generate a flow of cooling air from one end of the cooling-air passage to the other end during operation of the engine. An intake box is connected to one end of the cooling-air passage and has an air-intake port. A muffler box is connected to the other end of the cooling-air passage, has an air-discharge port, and accommodates an exhaust muffler of the engine. A sound-insulating housing is connected between the intake box and the muffler box to surround the duct member in order to insulate sound emitted from the duct member.



5285





(54) Title of the invention : "SECONDARY BATTERY HAVING ELECTRODE TERMINAL WHOSE POSITION IS ADJUSTABLE AND IMPROVED SAFETY" (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country

:H01M2/20 :10200600089907 :18/09/2006 :Republic of Korea :NA :NA :NA :NA :NA :NA :NA

(71)Name of Applicant : 1)LG CHEM, LTD. Address of Applicant :20, YOIDO-DONG, YOUNGDUNGPO-GU, SEOUL 150-721, REPUBLIC OF KOREA. Republic of Korea (72)Name of Inventor : 1)JUN HWAN JANG 2)HYUNG KU YUN 3)BYUNGJIN CHOI 4)HYANG MOK LEE

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : Disclosed herein is a secondary battery including a safety connection member constructed in a structure in which a horizontal connection terminal (a), which is connected to an electrode lead of a battery, is connected to one end of a safety element, and a vertical connection terminal (b) is connected to the other end of the safety element. The position of the electrode lead of the battery is easily adjusted due to the safety connection member. Also, the high-temperature safety of the battery is improved due to the safety element.



5286





(54) Title of the invention : "STARTER SYSTEM FOR INTERNAL COMBUSTION ENGINE" :F02N15/06 (71)Name of Applicant : (51) International classification (31) Priority Document No :11/532,119 1)FORD GLOBAL TECHNOLOGIES, LLC. (32) Priority Date :15/09/2006 Address of Applicant :330 TOWN CENTER DRIVE, SUITE (33) Name of priority country :U.S.A. 800, FPS, DEARBORN, MI 48126 USA U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)AL HENRY BERGER (87) International Publication No :NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : [0025] A starter system for a reciprocating internal combustion engine includes an input gear journaled for rotation upon a crankshaft in the engine, and a starter motor which applies a starting torque to an outer periphery of the input gear. A speed-sensitive clutch is interposed between the crankshaft and the input gear. The clutch selectively transmits torque between the input gear and the crankshaft by means of a series of pawls which are responsive to centrifugal force.



5287





(54) Title of the invention : "ANTI-MICROBIAL AGENTS THAT INTERACT WITH THE COMPLEMENT SYSTEM" (51) International classification :C07K 14/81 (71)Name of Applicant : (31) Priority Document No :60/702,049 1)NOVARTIS AG. (32) Priority Date :22/07/2005 Address of Applicant :LICHTSTRASSE 35, CH-4056 BASEL SWITZERLAND. Switzerland (33) Name of priority country :U.S.A. :PCT/US2006/028804 (72)Name of Inventor : (86) International Application No Filing Date :24/07/2006 1)SCHIRM SABINE (87) International Publication No :WO 2007/014199 2)HARDY STEPHEN (61) Patent of Addition to Application 3)DAI YUMIN :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Anti-microbial therapeutic agents that act via a novel method to treat infection are compounds which may comprise a peptide with natural or non-natural amino acids, or a small molecule. The agent can bind to the surface of a microorganism and productively fix complement in order to cause lysis of the microorganism via the assembly of a membrane attack complex, thereby triggering removal of the microbe by phagocytosis. The agents may be fragments of TFPI e.g. from the C-terminus region.



5288





(54) Title of the invention : "METHOD FOR THE ALLOYING OF ALUMINIUM TO FORM COMPONENTS" (51) International classification :C23C 10/48 (71)Name of Applicant : (31) Priority Document No :10 2005 033 073.8 1)GKN SINTER METALS HOLDING GMBH (32) Priority Date :15/07/2005 Address of Applicant :KREBSOGE 10, 42477 RADEVORMWALD, GERMANY. Germany (33) Name of priority country :Germany :PCT/EP2006/005938 (72)Name of Inventor : (86) International Application No Filing Date :21/06/2006 1)LI, ZI (87) International Publication No :WO 2007/009547 2)ENRICO MAHLIG (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : To achieve the object of providing a method by which the disadvantages entailed in the production of components from materials that contain aluminium are avoided, a method for alloying aluminium to form components is proposed, the alloying of aluminium taking place by adding an aluminium-containing material, the component being surrounded by at least one means receiving aluminiumcontaining material and the element that is formed in such a way being sintered. With preference, the component is wrapped in at least one metal nonwoven, an aluminium foil being arranged between the nonwoven and the component.



5289





(54) Title of the invention : "CATHODE MATERIAL CONTAINING TWO TYPES OF CONDUCTIVE MATERIALS AND LITHIUM SECONDARY BATTERY COMPRISING THE SAME" (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date

(71)Name of Applicant : :C25B1/04 1)LG CHEM, LTD. :10-2006Address of Applicant :20, YOIDO-DONG, 0081412 YOUNGDUNGPO-GU, SEOUL 150-721, REPUBLIC OF :28/08/2006 KOREA. Republic of Korea :Republic (72)Name of Inventor : of Korea 1)SEUNG WOO CHU :NA 2)SUNG-PIL YOON :NA 3)DOHYUN LEE :NA 4)DONGMYUNG KIM :NA 5)JOO-HWAN SUNG :NA 6)YONG JEONG KIM :NA 7)HYUNGOOK YOON :NA 8)JONG HEE KIM

(57) Abstract : Provided is a cathode mix for a lithium secondary battery, comprising a cathode active material, a conductive material and a binder, wherein the cathode mix uses a mixture of a flake-like carbon material (a), and a spherical chain-like carbon material (b) in a weight ratio (a/b) of 0.01 to 1 as the conductive material; and a lithium secondary battery comprising the same. Use of the conductive material according to the present invention can achieve simultaneous improvements in conductivity and loading density of the cathode mix, provide excellent discharge characteristics even with increased loading amounts of the cathode mix, and secure performance uniformity between the battery cells.



5290





(54) Title of the invention : "LIGHT-GUIDE BOARD" (51) International classification

:G02F1/13357; G02F1/13 :095215994 :08/09/2006 :China :NA :NA :NA :NA :NA :NA :NA

(71)Name of Applicant : 1)KUN DIAN PHOTOELECTRIC ENTERPRISE CO. Address of Applicant :1F, NO.26, LANE 2 YONGKANG, STREET, LUJHOU CITY 247. TAIWAN REPUBLIC OF CHINA. China (72)Name of Inventor : 1)LEE, CHENG SHENG 2)LIN, FU NAN

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A light-guide board includes a light guide plate made out of an optically transmissive material and having a transparent layer and a back reflecting layer formed integral with the back side of the transparent layer, and a plurality of reflecting baffles respectively extending from the back reflecting layer and embedded in the transparent layer for reflecting light to enhance the intensity of light and the uniformity in light intensity.



5291





(54) Title of the invention : "MOTOR HAVING THRUST SYSTEM" (51) International classification :HO2K (71)Name of Applicant : (31) Priority Document No :11/467,986 1)EMERSON ELECTRIC CO. (32) Priority Date :29/08/2006 Address of Applicant :8000 WEST FLORISSANT AVENUE, (33) Name of priority country :U.S.A. ST.LOUIS, MISSOURI 63136, USA U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)BARRY M.NEWBERG (87) International Publication No :NA 2)L.RANNEY DOHOGNE (61) Patent of Addition to Application Number :NA 3)PHILIP S. JOHNSON Filing Date :NA 4)GARY W.BORCHERDING (62) Divisional to Application Number :NA 5)JAMES R.GORE Filing Date :NA (57) Abstract : An electric motor includes a stator, a rotor including a rotor shaft having a locating groove formed therein, a thrust system mounted on the rotor shaft, and a locator disposed in the groove for locating the thrust system in a predetermined position.



5292





(54) Title of the invention : "WINDSHIELD DEVICE" (51) International classification (31) Priority Document No

:B62J17/02 (71)Name of Applicant : :20061)HONDA MOTOR CO.,LTD. 167117 Address of Applicant :1-1,MINAMI-AOYAMA 2-CHOME, :29/09/2006 MINATO-KU, TOKYO 107-8556, JAPAN Japan :Japan (72)Name of Inventor : :NA 1)YUKIYA UEDA :NA 2)YUKINORI KURAKAWA :NA 3)YOHEI KAWASAKI :NA :NA :NA :NA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : [Problem] To provide a windshield device which can obtain a favorable screen effect also with respect to a traveling wind from sides of a screen while suppressing large-sizing of the screen in the vehicle width direction. [Means for Resolution] In a front cowling 16 which includes: a screen unit 25 which is mounted on a front portion of a vehicle body and has a screen 26; an air introducing opening 37 which is formed in a front portion of the screen unit 25 and opens forwardly; an air blow-off opening 36 which is formed in an upper portion of the screen unit 25 and opens upwardly; and an air duct 27 which allows the screen unit 25 and the air blow-off opening 36 to communicate with each other, air discharge ports 41a, 41b, 41c which open outwardly and sideward from the vehicle are formed in a side of the air duct 27. [Selected drawing]



5293





(54) Title of the invention : "STAPLER" (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date

(71)Name of Applicant : :B25C5/00 1)MAX CO., LTD. :2006Address of Applicant :6-6, NIHONBASHIHAKOZAKI-CHO, 254861 CHUO-KU, TOKYO 103-8502, JAPAN Japan :20/09/2006 (72)Name of Inventor : :Japan 1)JUN MAEMORI :NA 2)SHU EZAKI :NA 3)TOMOHIRO IRAGO :NA 4)TSUKASA OHASHI :NA 5)KATSUYA NAKAMURA :NA 6)YOICHI MURAOKA :NA 7)TOSHIHIDE MIWA :NA 8)TAKEO HATTORI

(57) Abstract : A stapler is provided with: a magazine 3 accommodating a plurality of staples; a handle 5 having a driver plate, which drives the staples accommodated in the magazine 3 toward sheets of paper to be bound, at the front end thereof; a base 1 having at the front end thereof a clincher groove 6 for bending leg portions of the respective staples driven from the magazine 3. The magazine and the handle are swingably supported by a supporting shaft formed at the rear end of the base. A protective cover 14 made of a synthetic resin is attached to a base portion of the handle 5. The top surface of the handle and side surfaces of the handle, from which end faces of the supporting shaft 2 is exposed are, covered with the protective cover 14.



5294





(54) Title of the invention : "MULTIPLE-KIND FUEL ENGINE FUEL INJECTION CONTROL DEVICE" (51) International classification (31) Priority Document No

:F02M7/00 :2006(71)Name of Applicant : 259501 1)HONDA MOTOR CO.,LTD. :25/09/2006 Address of Applicant :1-1, MINAMI-AOYAMA 2-CHOME, :Japan MINATO-KU,TOKYO 107-8556, JAPAN Japan (72)Name of Inventor : :NA :NA 1)SHIRO KOKUBU :NA :NA :NA :NA :NA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : [Problem] To provide a multiple-kind fuel engine fuel injection control device which includes a plurality of maps for determining a basic fuel injection time corresponding to a state of an engine and changes over the map corresponding to alcohol concentration. [Means for Resolution] A fuel injection control device used in a multiple-kind fuel engine 1 is configured to include: a memory region 26 which stores a plurality of fuel injection control maps 30 in which a state of an engine 1 and a basic fuel injection time Ti are made to correspond to each other in response to the concentration of alcohol contained in the fuel; an 02 sensor 15 which is arranged in an exhaust pipe 4 and detects the oxygen concentration in an exhaust gas; a basic fuel injection time determination part 22 which determines the basic fuel injection time Ti using the currently selected fuel injection control map 30 of the concentration of alcohol; a correction coefficient determination part 24 which determines an air-fuel ratio correction coefficient K02 for correcting the basic fuel injection time Ti such that an air-fuel ratio of the engine I becomes a target air-fuel ratio in response to a detection value of the 02 sensor 15; a fuel injection quantity determination part 25 which determines a fuel injection quantity based on the basic fuel injection time Ti and the air-fuel ratio correction coefficient K02; and a map changeover part 21 which selects the fuel injection control map 30 of the concentration of alcohol close to the concentration of alcohol of the fuel based on the air-fuel ratio correction coefficient K02 [Selected Drawing] Fig. 1



5295





(54) Title of the invention : "DISPLAY CONTROL APPARATUS, METHOD AND PROGRAM" (51) International classification (31) Priority Document No

:H04N1/00 (71)Name of Applicant : :P20061)SONY CORPORATION 223891 Address of Applicant :1-7-1 KONAN, MINATO:21/08/2006 KU,TOKYO, 108-0075,JAPAN. Japan :Japan (72)Name of Inventor : :NA 1)SEIGO FUKUSHIMA :NA 2)MAKOTO YAMADA :NA 3)OSAMU DATE :NA :NA :NA :NA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A display control apparatus which controls display of information about a group of data having a predetermined relevance, the apparatus includes: a means for generating a three dimensional model for display in accordance with a first item of information of the information about the group; and a means for controlling display of a second item of information that is the information about the group and different from the first item of information so as to be overlaid on a three dimensional image displayed based on the model.



5296





(54) Title of the invention : "COMMUNICATION SYSTEM & COMMUNICATION APPARATUS" (51) International classification (31) Priority Document No

:H04M3/00 (71)Name of Applicant : :P20061)SONY CORPORATION 245615 Address of Applicant :1-7-1 KONAN, MINATO-KU, :11/09/2006 TOKYO 108-0075, JAPAN. Japan :Japan (72)Name of Inventor : :NA 1)WASHIRO TAKANORI :NA :NA :NA :NA :NA :NA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A communication system includes the following elements: a transmitter including a transmission circuit unit configured to generate an RF signal for transmitting data and an electric-field-coupling antenna configured to transmit the RF signal as an electrostatic field; a receiver including an electric-field-coupling antenna and a reception circuit unit configured to receive and process the RF signal received by the electric-field-coupling antenna; and a surface-wave propagation medium configured to provide a surface-wave transmission line to transmit a surface wave emanating from the electric-field-coupling antenna of the transmitter with low propagation loss.



5297





(54) Title of the invention : "CO-POLYMERIZATION OF AN ISOOLEFIN WITH A HALOGENATED CO-MONOMER" :C08G18/62 (71)Name of Applicant : (51) International classification (31) Priority Document No :60/839,454 1)LANXESS INC, (32) Priority Date :23/08/2006 Address of Applicant :ONTARIO, CANADA N7T 7M2 (33) Name of priority country :U.S.A. Canada (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)JUDITH ARONHIME (87) International Publication No :NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A co-polymer of isobutene and 4-bromo-3-methyl-1-butene formed by direct co-polymerization in a single-step process. A continuous process for forming the co-polymer preferably comprises periodic or semi-continuous addition of catalyst to a mixed monomer solution. Semi-continuous reverse addition of the mixed monomer solution to a pre-provided catalyst solution may also be employed. The co-polymer exhibits allylic bromide functionality and is advantageously curable by either ZnO curing systems or sulfur-based curing systems.



5298





(54) Title of the invention : "POUCH-SHAPED SECONDARY BATTERY WITH IMPROVED SAFETY" (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country

:H01M2/10 :10-20060089906 :18/09/2006 :Republic of Korea :NA :NA :NA :NA :NA :NA :NA

(71)Name of Applicant : 1)LG CHEM, LTD. Address of Applicant :20. YOIDO-DONG, YOUNGDUNGPO-GU,SEOUL 140-013, REPUBLIC OF KOREA Republic of Korea (72)Name of Inventor : 1)JUN HWAN JANG 2)HYUNG KU YUN 3)BYUNGJIN CHOI 4)HYANG MOK LEE

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : Disclosed herein is a secondary battery constructed in a structure in which an electrode assembly having a cathode/separator/anode structure is mounted in a sheet-type battery case having a receiving part defined therein, the sheet-type battery case is sealed by thermal welding, and sealing parts are formed entirely along the edge of the receiving part by the thermal welding. The sealing parts are perpendicularly bent such that the sealing parts are brought into tight contact with a side wall of the receiving part. Cathode and anode terminals are positioned at two different sealing parts about the receiving part, respectively. When external forces are applied to the secondary battery, the safety of the secondary battery is improved, and the occurrence of a short circuit is effectively prevented.



5299





(54) Title of the invention : "GEL-TYPED POLYMER ELECTROLYTE CONTAINING DIACRYL AMIDE-BASED POLYMERIC MATERIAL AND ELECTROCHEMICAL DEVICE COMPRISING THE SAME" (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country


(71)Name of Applicant : 1)LG CHEM, LTD. Address of Applicant :20-YOIDO-DONG, YOUNGDUNGPO-GU, SEOUL 150-721, REPUBLIC OF KOREA Republic of Korea (72)Name of Inventor : 1)SUYOUNG RYU 2)EUN YOUNG KIM 3)JOO HWAN SUNG 4)DONGMYUNG KIM

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : Provided is a gel polymer electrolyte comprising a diacrylamide compound as a precursor for formation of a crosslinked polymer.The gel polymer electrolyte in accordance with the present invention enables improvements of the battery safety by significant reduction of thickness swelling of the battery to thereby prevent the electrolyte leakage, while simultaneously preventing deterioration of chargedischarge rate characteristics and cycle characteristics which may occur upon use of a gel-type electrolyte.



5300





(54) Title of the invention : "AIR-CONDITIONING AND ELECTRIC POWER GENERATING SYSTEM AND CONTROL METHOD FOR THE SAME" (51) International classification (31) Priority Document No

:H01M8/10 (71)Name of Applicant : :20061)SANYO ELECTRIC CO. LTD., 230574 Address of Applicant :5-5, KEIHAN HONDORI 2-CHOME, :28/08/2006 MORIGUCHI-SHI, OSAKA 570-8667,JAPAN Japan :Japan (72)Name of Inventor : :NA 1)NAOKI SAKAMOTO :NA 2)HIROSHI KANAI :NA 3)YOSHIHITO MIZUNO :NA :NA :NA :NA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : An air-conditioning and electric power generating system including a gas heat pump type air conditioner, an electric power generator that is driven by a gas engine and has electric power generating capacity corresponding to the driving power oft he gas engine when a compressor is separated from the gas engine by a clutch, a system interconnection type inverter that is connected to the electric power generator and outputs power to a commercial system, a waste heat using portion for using waste heat of the gas engine, and an engine controller having a first control mode and a second control mode as a driving mode to control the driving of the gas engine. The engine controller controls the gas engine to serve as a gas engine for driving both the compressor 5- and the electric power generator in the first control mode while controlling the gas engine to serve as a gas engine for driving only the electric power generator in the second control mode.



5301





(54) Title of the invention : WIRE AND CABLE INSULATION (51) International classification :H01B3/44 (71)Name of Applicant : (31) Priority Document No :0616631.8 1)TYCO ELECTRONICS UK LTD. (32) Priority Date :22/08/2006 Address of Applicant :FARADAY ROAD, DORCAN, (33) Name of priority country :U.K. SWINSON SN3 5HH, UK U.K. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)RODWAY, GILES (87) International Publication No :NA 2)STEADMAN, STUART (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A zero-halogen wire or cable insulation comprising at least an inner layer and an outer layer; the outer layer comprising uncoated magnesium hydroxide, wherein the insulation is applied to the wire or cable by co-extrusion or sequential extrusion of the layers.



5302





(54) Title of the invention : "SYSTEM FOR WELDING MOTOR-VEHICLE BODIES" (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country

:B62D65/00; (71)Name of Applicant : :06425622.5 1)COMAU S.P.A., Address of Applicant :VIA RIVALTA 30, 1-10095 :07/09/2006 :EUROPEAN GRUGLIASCO(TORINO)ITALY. Italy UNION (72)Name of Inventor : :NA 1)MONTI DENNY, :NA 2)BOSSOTTO PIERO :NA :NA :NA :NA :NA

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : In a welding system comprising a welding station and various pairs of side frames (3), which can be positioned selectively in the welding station for clamping in the welding position bodies of different types, are provided magazines of side frames (3) both upstream and downstream of the welding station. There are moreover provided auxiliary guide means (70), which connect directly together at least one magazine upstream of the welding station and at least one magazine downstream of the welding station so as to enable transfer of pairs of side frames (3) directly from a magazine upstream to a magazine downstream or vice versa, without passing through the welding station.



5303





(54) Title of the invention : "A METHOD FOR THE MANUFACTURE OF A MOULDING COMPOSITION" (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country

:C08L77/00; (71)Name of Applicant : A63C5/00 1)SULZER CHEMTECH AG :06119390.0 Address of Applicant :SULZER-ALLE 48, CH-8404 :23/08/2006 WINTERTHUR, SWITZERLAND Switzerland :EUROPEAN (72)Name of Inventor : UNION 1)CHRISTIAN SCHLUMMER :NA 2)SASAN HABIBI-NAINI :NA :NA :NA :NA :NA :NA

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A method for the manufacture of a moulding composition from a raw material melt which is charged with an additive includes the steps: charging a conveyor apparatus (4) with a raw material which includes a liquid or gooey pasty composition or a granulate, with the conveyor apparatus in particular including a cylinder (5) in whose interior space a conveyor means, in particular a screw (6) is arranged; converting the raw material into a raw material melt by heat supply to the raw material, in particular via a heating apparatus which is in particular arranged at the outer wall of the cylinder 5; charging the raw material melt with an additive; mixing of the raw material melt with the additive to produce a moulding composition, with the moulding composition being present as a homogeneous mixture the raw material melt with the additive; discharge out of the moulding composition from the conveyor apparatus. The charging of the raw material melt with the additive takes place in a metering device (3) which is arranged in a passage section (29, 30) of the conveyor apparatus (4) and/or subsequent to the conveyor apparatus (4), with the raw material rnelt (29, 30) flowing through and/or around the passage section. The metering device includes at least one metering element (31) which is arranged in a recess (32) of the passage section (29, 30).



5304





(54) Title of the invention : "A METERING DEVICE" (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country

:B05B11/00; (71)Name of Applicant : B05B11/00 1)SULZER CHEMTECH AG :06119392.6 Address of Applicant :SULZER-ALLEE 48, CH-8404 :23/08/2006 WINTERTHUR, SWITZERLAND. Switzerland :EUROPEAN (72)Name of Inventor : UNION 1)CHRISTIAN SCHLUMMER :NA 2)SASAN HABIBI-NAINI :NA :NA :NA :NA :NA :NA

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A metering device (3) for the feeding of additives to a gooey fluid or a pasty composition, in particular to a plastic melt, includes a passage section (29) receiving the fluid, with the fluid flowing through the passage section (29), and/or a further passage section (30) around which the fluid can flow. The passage section (29) through which flow takes place and/or the passage section (30) around which flow takes place contains/contain at least one metering element (31). The passage section (29, 30) contains a recess (32) for the reception of the metering element (31), with the recess (32) being bounded at all sides by the passage section (29, 30) and the metering element (31) being held in the recess (32).



5305





(54) Title of the invention : "NANOWIRES IN THIN-FILM SILICON SOLAR CELLS" :H01L31/18 (71)Name of Applicant : (51) International classification (31) Priority Document No :11/509,886 1)GENERAL ELECTRIC COMPANY (32) Priority Date :25/08/2006 Address of Applicant :ONE RIVER ROAD, (33) Name of priority country :U.S.A. SCHENECTADY, NEW YORK 12345, U.S.A. U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)KOREVAAR BASTIAN ARIE (87) International Publication No :NA 2)TSAKALAKOS LOUCAS (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : In some embodiments, the present invention is directed to photovoltaic (PV) devices 100, 200 and 1400 comprising silicon (Si) nanowires 101 as active PV elements, wherein such devices are typically thin film Si solar cells. Generally, such solar cells are of the p-i-n type and can be fabricated for front and/or backside (i.e., top and/or bottom) illumination. Additionally, the present invention is also directed at methods of making and using such devices, and to systems and modules (e.g., solar panels) employing such devices.



5306





(54) Title of the invention : "METHODS AND SYSTEMS FOR OPERATING A GAS TURBINE" (51) International classification :F01D5/16 (71)Name of Applicant : (31) Priority Document No :11/467,016 1)GENERAL ELECTRIC COMPANY (32) Priority Date :24/08/2006 Address of Applicant :ONE RIVER ROAD, (33) Name of priority country :U.S.A. SCHENECTADY, NEW YORK 12345, U.S.A. U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)ZIMINSKY WILLY STAVE (87) International Publication No :NA 2)FOSSUM ARTHU JAMES (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A method of operating a gas turbine is provided, wherein the gas turbine engine (100) is coupled to an electrical grid operating at a standardized grid frequency value, and the gas turbine includes a combustor (104) coupled in flow communication with a plurality of independent fuel circuits and a compressor (102). The method includes determining a deviation of a grid frequency from the standardized grid frequency value and adjusting fuel flow from a portion of the plurality of fuel circuits (110) while maintaining a substantially constant air flow from the compressor to facilitate controlling a fuel to compressor discharge pressure ratio such that a combustor state does not lag changes in airflow when the combustor responds to the grid frequency deviation.



5307





(54) Title of the invention : "SEALING TEST METHOD, TEST SPECIMEN AND TEST BENCH" (51) International classification (31) Priority Document No

:G01N11/14 (71)Name of Applicant : :20061)GAZTRANSPORT ET TECHNIGAZ Address of Applicant :1,ROUTE DE VERSAILLES, 78470 228914 :25/08/2006 SAINT REMY-LES-CHEVREUSE, FRANCE. France :Japan (72)Name of Inventor : :NA 1)JACQUES DHELLEMMES :NA 2)NICOLAS LEFEBRE :NA 3)SOPHIE PREATO-PAVRET DE LA ROCHEFORDIERE :NA 4)CHRISTOPHE HUON DE KERMADEC :NA :NA :NA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : Method for testing the sealing of a test specimen (21) comprising a sealing film and two fibrous reinforcing layers, one on each side of the said sealing film, the said method comprising the steps of: -connecting the said test specimen to a test bench (22), -conducting a first test of behaviour under pressure, -subjecting the said test specimen to at least a first thermal shock, and -conducting at least a second test of behaviour under pressure, characterized in that the said method comprises at least the steps of: -removing the said test specimen from the said test bench after the said first test of behaviour under pressure, and subjecting the said test specimen to the said first thermal shock remotely from the said test bench, and -refixing the said test specimen to the said test bench to conduct the said second test of behaviour under pressure.



5308





(54) Title of the invention : "ENGINE-DRIVEN WORK MACHINE SYSTEM" (51) International classification (31) Priority Document No

:A01D34/00 (71)Name of Applicant : :20061)HONDA MOTOR CO.,LTD. Address of Applicant :1-1, MINAMI-AOYAMA 2-CHOME, 228913 :25/08/2006 MINATO-KU,TOKYO 107-8556,JAPAN. Japan :Japan (72)Name of Inventor : :NA 1)MAKOTO UCHMI :NA 2)YOSHIO TANAKA :NA :NA :NA :NA :NA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : An engine-driven work machine system includes an engine; a work machine driven by the engine; a frame supporting the engine and the work machine; and a sound-insulating housing provided on the frame. The sound-insulating housing includes a bottom plate; a pair of opposing sidewall plates extending from the bottom plate with the engine and the work machine therebetween; and a fuel tank connecting upper ends of the sidewall plates. A mounting flange formed around an outer periphery of the fuel tank is superposed on a flat tank-supporting portion formed at the upper ends of the sidewall plates. A downward-facing collar is formed at an outer end of the mounting flange. An upward-facing collar is formed in the tank-supporting portion and arranged inwardly of the downward-facing collar with respect to the sound-insulating housing. A seal member is provided outwardly of the upward-facing collar and between the mounting flange and tank-supporting portion.



5309





(54) Title of the invention : HIGH STIFFNESS LIGHT WEIGHT BOARD AND PREPARING METHOD (51) International classification (31) Priority Document No

:B29C70/88 (71)Name of Applicant : :KR 101)HANYANG ADVANCED MATERIALS CO., LTD. Address of Applicant :7-1, CHAAM-DONG, CHEONAN2006CITY, CHUNG-NAM-DO, 330-200 KOREA. Republic of Korea 0079999 :23/08/2006 (72)Name of Inventor : :Kazakhstan 1)PAL YOUNG, PARK :NA 2)DEOK KI, JOO :NA :NA :NA :NA :NA :NA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The present invention relates to a high stiffness light weight board used in interior materials for automobiles that requires a high stiffness such as a luggage cover or a seat back having heavy material loaded thereon and a preparing method thereof, more specially, to a high stiffness light weight board and preparing method thereof in which the material of tight weight such as honeycomb, corrugated sheet or bubble sheet of hollow structure having space part is used as a base layer, and upper/lower plastic sheets of light weight as a predetermined thickness of composite sheet are accumulated in the upper/lower portions of the base layer.



5310





(54) Title of the invention : "A METHOD FOR PREPARING DRONEDARONE" (51) International classification :C07D 307/79 (71)Name of Applicant : (31) Priority Document No :00/16,070 1)SANOFI-SYNTHELABO (32) Priority Date :11/12/2000 Address of Applicant :174, AVENUE DE FRANCE, F-75013 (33) Name of priority country :France PARIS, FRANCE France (86) International Application No :PCT/FR01/3899 (72)Name of Inventor : Filing Date :10/12/2001 1)NOEL FINO (87) International Publication No :WO 02/48132 2)CORINNE LEROY (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :812/DELNP/2003 Filed on :26/05/2003 (57) Abstract : A method for preparing dronedarone, characterized in that, in an organic phase consisting of one or more solvents chosen from halogenated or nonhalogenated hydrocarbons, 2-butyl-5-(methanesulfonamido)bonzofuran is reacted with 4-[3(dibutylamino)propoxy]benzoyl chloride hydrochloride, this being in the presence of a maximum of 5 molar equivalents of a Lewis acid as catalyst, and then hydrolysis is carried out in order to obtain transiently, and without isolation, dronedarone hydrochloride which is recovered in the organic phase and which is treated with a basic agent, giving the desired compound.



5311





(54) Title of the invention : "A METHOD FOR PREPARING DRONEDARONE" (51) International classification :C07D 307/79 (71)Name of Applicant : (31) Priority Document No :00/16,070 1)SANOFI-SYNTHELABO (32) Priority Date :11/12/2000 Address of Applicant :174, AVENUE DE FRANCE, F-75013 (33) Name of priority country :France PARIS,FRANCE France (86) International Application No :PCT/FR01/03899 (72)Name of Inventor : Filing Date :10/12/2001 1)NOEL FINO (87) International Publication No :WO 02/48132 2)CORINNE LEROY (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :812/DELNP/2003 Filed on :26/05/2003 (57) Abstract : A method for preparing dronedarone, characterized in that: a) 2-butyl-5-nitrobenzofuran is hydrogenated in the presence of an appropriate catalyst, to form 5-amino-2-butylbenzofuran, b) the compound thus obtained is reacted with methanesulfonyl chloride or methanesulfonic anhydride, the reaction taking place in the presence of an acid acceptor, to form 2-butyl-5(methanesulfonamido)benzofuran, c) the methanesulfonamido derivative thus obtained is reacted, in an organic phase consisting of one or more solvents chosen from halogenated or nonhalogenated hydrocarbons, with 4-[3-(dibutylamino)propoxy]benzoyl chloride hydrochloride, this being in the presence of a maximum of 5 molar equivalents of a Lewis acid as catalyst, and then hydrolysis is carried out in order to obtain transiently, and without isolation, dronedarone hydrochloride which is recovered in the organic phase and which is treated with a basic agent, giving the desired compound.



5312





(54) Title of the invention : "CONSTRUCTIVE LAY-OUTS APPLIED IN TELECOMMUNICATIONS CABINETS" (51) International classification (31) Priority Document No

:H05K5/00; (71)Name of Applicant : H05K5/00; 1)NILKO METALURGIA LTD. :MU8601764Address of Applicant :AVENIDA MARINGA 1900,VILA 0 PERNETA PR 83325360 BRAZIL Brazil :25/08/2006 (72)Name of Inventor : :Brazil 1)FRAIMUNDO HUSCHER :NA :NA :NA :NA :NA :NA :NA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : "CONSTRUCTIVE LAY-OUTS APPLIED IN A TELECOMMUNICATIONS CABINET", describes the present patent in the technical field of telecommunications cabinets in general, as a cabinet (1) for telecommunications that in accordance to its general characteristics has, as basic principle, the manufacturing of modular cabinets, either standardized or personalized, of easy installation and assembly, made of a structure of extruded profiles (4), which allows a series of combinations of shapes and sizes, besides having a system of sliding fittings for the closing panels (16).



5313





(54) Title of the invention : "METHOD AND COMPOSITION FOR ELIMINATING ODORS IN ION EXCHANGE RESINS" (51) International classification :A61L9/00 (71)Name of Applicant : (31) Priority Document No :60/842,000 1)ROHM AND HAAS COMPANY, (32) Priority Date :01/09/2006 Address of Applicant :100 INDEPENDENCE MALL WEST, (33) Name of priority country :U.S.A. PHILADELPHIA, PENNSYVANIA, 19106-2399, USA U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)LYN HUGHES (87) International Publication No :NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A method for reducing undesirable odor of an anion exchange resins by pi'epITrrrfg, composition comprising an admixture comprising an anion exchange resin having an undesirable odor and a cation exchange resin; and converting the mixture to form the composition.



5314





(54) Title of the invention : "POLISHING PAD WITH OVERLAID CONSTANT AREA SPIRAL GROOVES" :F01N3/037 (71)Name of Applicant : (51) International classification (31) Priority Document No :11/512,699 1)ROHM AND HAAS ELECTRONIC MATERIAL CMP (32) Priority Date :30/08/2006 HOLDINGS, INC., (33) Name of priority country :U.S.A. Address of Applicant :451 BELLEVUE ROAD, NEWARK, (86) International Application No :NA DE 19713, USA; U.S.A. (72)Name of Inventor : Filing Date :NA (87) International Publication No :NA 1)CAROLINA L. ELMUFDI (61) Patent of Addition to Application Number :NA 2)GREGORY P. MULDOWNEY Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A circular chemical mechanical polishing pad that includes a polishing surface having a concentrically located origin. The polishing surface includes groove sets each containing grooves arranged in a pattern in which ones of the grooves in one groove set cross ones of the grooves in another set. The grooves in each groove set are configured and arranged so that the fraction of the polishing surface that is grooved, as measured along any circle that is concentric with the origin and crosses the grooves, is substantially constant, i.e., within about 25% of its average.



5315





(54) Title of the invention : "REINFORCEING FIBROUS STRUCTURE FOR A COMPOSITE MATERIAL AND A PART CONTAINING SAID STRUCTURE" (51) International classification :B29C 70/24 (71)Name of Applicant : (31) Priority Document No :0506441 1)SNECMA Address of Applicant :2 BOULEVARD DU GENERAL (32) Priority Date :24/06/2005 MARTIAL VALIN, 75015 PARIS, FRANCE. France (33) Name of priority country :France (86) International Application No :PCT/FR2006/050617 2)SNECMA PROPULSION SOLIDE Filing Date :21/06/2006 (72)Name of Inventor : (87) International Publication No :WO 2006/136755 1)DOMINIQUE COUPE (61) Patent of Addition to Application 2)BRUNO DAMBRINE :NA Number 3)JEAN NOEL MAHIEU :NA Filing Date 4)ERIC BOUILLON (62) Divisional to Application Number :NA 5)FRANCOIS CHARLEUX Filing Date :NA (57) Abstract : A woven fibrous structure embodied in one piece, used for producing a composite material part and comprising an internal part or a core (72) and a part adjacent to the external surface thereof or a skin (74, 76), is formed by three-dimensional core weaving with at least one weave selected from interlock and multilayer weaves and by skin weaving with a weave which differs from the core weave and selected from a multilayer weave and a two-dimensional weave. It can be also formed by three-dimensional weaving with at least one core interlock weave (72) and weaving with a fabric-, satin or skin twill-type weave, wherein skin weaving is of a multilayer or two-dimensional type. .



5316





(54) Title of the invention : "METHOD AND SYSTEM FOR AUTOMATIC IDENTIFICATION USING DIGITAL IIMAGES" :G06K 9/46 (71)Name of Applicant : (51) International classification (31) Priority Document No :11/232,454 1)BRIGHTEX BIO-PHOTONICS, LLC (32) Priority Date :20/09/2006 Address of Applicant :SAN JOSE BIO CENTER, 5941 (33) Name of priority country :U.S.A. OPTICAL CT. SAN JOSE, CA 95138, U.S.A U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)RAJESHWAR CHHIBBER (87) International Publication No : NA 2)SHEFALI SHARMA (61) Patent of Addition to Application Number :NA 3)SHIVANJLI SHARMA Filing Date :NA 4)ASHUTOSH CHHIBBER (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention provides a method and system for automatic identification (auto-identification). In one embodiment, a method for automatically identifying a person comprises acquiring white-light and UV images of a portion of the person's skin, generating a skin mask from the white-light image, and comparing the skin mask with a pre-stored skin mask of the person. If a substantial match is not found between the two skin masks, the person is not identified, and an error message such as "wrong person" or "person unknown" is returned. Otherwise, the method proceeds to obtain results associated with certain skin conditions using at least the UV image. The results are compared with pre-stored results to determine if the person is the right person or wrong person.



5317





(54) Title of the invention : "SYSTEM FOR CREATING A DIGITAL WORK HAVING CONTENT AND USAGE RIGHTS" (51) International classification :G06F 21/00 (71)Name of Applicant : (31) Priority Document No :09/867,747 1)CONTENTGUARD HOLDINGS,INC. (32) Priority Date :31/05/2001 Address of Applicant :SUITE 200-M, 103 FOULK ROAD, (33) Name of priority country :U.S.A. WILMINGTON, DE 19803, USA U.S.A. (86) International Application No :PCT/US02/15201 (72)Name of Inventor : Filing Date :15/05/2002 1)TADAYON, BIJAN (87) International Publication No :WO 02/098042 2)NAHIDIPOUR, ARAM (61) Patent of Addition to Application 3)WANG, XIN :NA Number 4)RALEY,MICHAEL,C :NA Filing Date 5)LAO, GUILLERMO (62) Divisional to Application Number :02068/DELNP/2003 6)TA, THANH,T. Filed on :02/12/2003 (57) Abstract : Usage rights for a digital work are established prior to creation of the corresponding content. The rights can be associated with the content after the content is created. A content creation, such as a video recorder or a still camera, device can store labels of the rights and can associate usage rights with content in real time as the content is created.



5318





(54) Title of the invention : METHOD AND APPARATUS FOR EVALUATING OPERATIONAL INTEGRITY OF A DATA PROCESSING SYSTEM USING MOMENT BOUNDING (51) International classification :G01S 1/00 (71)Name of Applicant : (31) Priority Document No :10/255.029 1)RAYTHEON COMPANY Address of Applicant :870 WINTER STREET WALTHAM, (32) Priority Date :25/09/2002 MA 02451 USA. U.S.A. (33) Name of priority country :U.S.A. (86) International Application No :PCT/US2003/030787 (72)Name of Inventor : Filing Date :23/09/2003 1)RUBIN, ARTHUR, LEONARD (87) International Publication No :WO 2004/029807 2)SCHEMPP, TIMOTHY, ROBERT (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Mechanisms and techniques provide a system to evaluate operational integrity of a data processing system such as an area augmentation system by obtaining at least one set of distribution data related to information processed by the data processing system. The set(s) of distribution data can include corrections information and integrity bounds information related to corrections information. The system applies a moment generating function to the set of distribution data to produce a moment bounded distribution data result and compares the moment bounded distribution data result to an integrity limit to determine if the data processing system operates within an acceptable integrity threshold. The system can be used in real-time or non-real tim...



5319





(54) Title of the invention : SKIN CARE COMPOSITION COMPRISING INTERFERENCE PIGMENTS (51) International classification :A61K 8/18 (71)Name of Applicant : (31) Priority Document No :11/228,766 1)THE PROCTER & GAMBLE COMPANY (32) Priority Date :16/09/2005 Address of Applicant :ONE PROCTER & GAMBLE PLAZA, CINCINNATI, OHIO 45202, U.S.A. U.S.A. (33) Name of priority country :U.S.A. (86) International Application No :PCT/IB2006/053325 (72)Name of Inventor : Filing Date :15/09/2006 1)ELSBROCK., ROBERT, JOHN (87) International Publication No :WO 2007/031970 2)TANNER, PAUL, ROBERT (61) Patent of Addition to Application 3)JONES, JULIET, ANN :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Skin care composition comprising a plurality of interference pigments and a dermatologically acceptable carrier. The plurality comprises at least a first interference pigment which reflects a first color, and at least a second interference pigment which reflects a second, complementary color. The total amount of interference pigments is from about 0.1% to about 10%.



5320





(54) Title of the invention : "ANGEL WING ABRADABLE SEAL AND SEALING METHOD" (51) International classification

:B22F3/26; (71)Name of Applicant : B22F7/00 1)GENERAL ELECTRIC COMPANY :11/507,562 Address of Applicant :ONE RIVER ROAD, :22/08/2006 SCHENECTADY, NEW YORK 12345, USA. U.S.A. :U.S.A. (72)Name of Inventor : :NA 1)CHENG YINGUO :NA 2)FANG BIAO :NA 3)MCGOVERN TARA EASTER :NA 4)WOLFE CHRISTOPHER EDWARD :NA :NA :NA

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : An abradable seal (40) is provided to improve turbine performance by physically reducing the clearance between a flange portion (28, 30, 32) of the nozzle (34, 36) and an opposed angel wing/seal plate member (14, 16, 18) of the bucket (10). The provision of an abradable seal also mitigates angel wing/seal plate tooth or fin (22,24,26) wear by providing for abradable contact without metal to metal hard rub.



5321





(54) Title of the invention : "SYSTEMS FOR MOISTURE REMOVAL IN STEAM TURBINE ENGINES" :F01K23/10 (71)Name of Applicant : (51) International classification (31) Priority Document No :11/511,598 1)GENERAL ELECTRIC COMPANY (32) Priority Date :28/08/2006 Address of Applicant :ONE RIVER ROAD, (33) Name of priority country :U.S.A. SCHENECTADY, NEW YORK 12345, USA.. U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)BURDGICK STEVEN S. (87) International Publication No :NA 2)IVANOVITCH FROLOV BORIS (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A system in a steam turbine for removing water droplets from the flowpath of a steam turbine that may include a groove (115) for collecting water droplets, and a plurality of moisture removal holes (116) originating within the groove (115). The groove (115) may run in a circumferential manner around an outer sidewall (108) of the steam turbine, be axially positioned upstream and in close proximity to the leading edge of a nozzle (104), and have a gradual slope at a leading edge and a steep wall at a trailing edge. The moisture removal holes (116) may be a channel through the outer sidewall (108) through which the water droplets that collect in the groove may flow.



5322





(54) Title of the invention : "METHODS AND APPARATUS FOR COOLING GENERATORS" (51) International classification :H02K1/22 (71)Name of Applicant : (31) Priority Document No :11/467,689 1)GENERAL ELECTRIC COMPANY (32) Priority Date :28/08/2006 Address of Applicant :ONE RIVER ROAD, (33) Name of priority country :U.S.A. SCHENECTADY, NEW YORK 12345 USA. U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)ROBIN REBINTH J. (87) International Publication No :NA 2)SALAMAH SAMIR ARMANDO (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A baffle (24) for guiding cooling fluids (20) in a power generator (10) cooled by a cooling fluid and having a flange (18), a stator (12), and an end stator (16) is provided. The baffle (24) includes an inclined surface (36) configured to direct a first portion (28) of the cooling fluid flow towards the flange and a second portion (30) of the cooling fluid flow towards the end stator.



5323





(54) Title of the invention : PRINTED ARTICLE WITH SPECIAL EFFECT COATING :B41M5/26 (71)Name of Applicant : (51) International classification (31) Priority Document No :60/823,774 1)JDS UNIPHASE CORPORATION (32) Priority Date :29/08/2006 Address of Applicant :430 N.MCCARTHY BOULEVARD, (33) Name of priority country :U.S.A. MILPITAS, CA 95035 USA U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)WILFRED C.KITTLER, JR (87) International Publication No :NA 2)NEIL TEITELBAUM (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A printed article is disclosed having a light transmissive substrate having a reverse printed region on a surface thereof in the form of a plurality of very closely spaced printed lines or regions. The printed regions and spaces therebetween are subsequently flood coated with special effect ink such as optically variable ink wherein the ink particle size is on average greater than the gap between reverse printed regions. The image is viewed from the non-printed side of the substrate and very fine lines of the special effect flood coated special effect ink appear as very clear sharp lines having a fine resolution. This eliminates the typical jagged edges that would otherwise be seen if the inked region was not present. This effect is due to the first printed inked regions or lines forming a mask through which the flood coated ink is seen.



5324





(54) Title of the invention : "METHOD FOR REGISTERING RIGHTS ISSUER AND DOMAIN AUTHORITY IN DIGITAL RIGHTS MANAGEMENT AND METHOD FOR IMPLEMENTING SECURE CONTENT EXCHANGE FUNCTIONS USING THE SAME" (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country

:G06F :10-20060079078 :21/08/2006 :Republic of Korea :NA :NA :NA :NA :NA :NA :NA

(71)Name of Applicant : 1)PANTECH CO.,LTD. Address of Applicant :PANTECH R&D CENTER, I-2,DMC SANGAM-DONG, MAPO-GU, SEOUL, REPUBLIC OF KOREA. Republic of Korea 2)PANTECH&CURITEL COMMUNICATIONS,INC (72)Name of Inventor : 1)JEONG,SO-YOUNG 2)KIM, GUN-WOOK 3)PARK, KYUNG

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A method for registering a Domain Authority (DA) and a Rights Issuer (RI) for Digital Rights Management includes exchanging information between the DA and the RI. The DA and RI are registered by the exchanging of information before executing other protocol, and the method for registering can be incorporated into the following methods for implementing Digital Rights Management (DRM) with Secure Content Exchange features: (1) acquiring user domain Rights Objects (RO) by a DRM agent; (2) using the user domain RO by a 2.0 DRM agent; and (3) using imported user domain RO by a 2.0 DRM agent.



5325





(54) Title of the invention : "METHODS AND APPARATUS FOR FABRICATING A ROTOR FOR A STEAM TURBINE" (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date

(71)Name of Applicant : :F01D5/06 1)GENERAL ELECTRIC COMPANY :11/466,986 Address of Applicant :ONE RIVER ROAD, :24/08/2006 SCHENECTADY, NEW YORK 12345, USA U.S.A. :U.S.A. (72)Name of Inventor : :NA 1)BRACKEN ROBERT JAMES :NA 2)MURPHY JOHN THOMAS :NA 3)GAZZILLO CLEMENT :NA 4)LAVASH JOHN CLELAND :NA 5)SWAN STEPHEN ROGER :NA 6)KORZUN RONALD WAYNE :NA 7)SIMKINS JEFFREY ROBERT

(57) Abstract : A rotor (200) for a turbine (100) is provided. The rotor includes a plurality of substantially cylindrical disks (220), each disk including a substantially cylindrical body having a bore (230) extending substantially concentrically therethrough, at least two of the disks coupled together such that the bore extends generally axially through the rotor.



5326





(54) Title of the invention : SINGLET WELDED NOZZLE HYBRID DESIGN FOR A TURBINE" (51) International classification :FO1D (71)Name of Applicant : (31) Priority Document No :11/508,170 1)GENERAL ELECTRIC COMPANY (32) Priority Date :23/08/2006 Address of Applicant :ONE RIVER ROAD, (33) Name of priority country :U.S.A. SCHENECTADY, NEW YORK 12345, U.S.A. U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)BURDGICK STEVEN SEBASTIAN (87) International Publication No :NA 2)CRALL THOMAS WILLIAM (61) Patent of Addition to Application Number :NA 3)DUCLOS LARRY Filing Date :NA 4)RUSSO THOMAS PATRICK (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A singlet welded nozzle hybrid design that includes a singlet, that is, a single airfoil with respective inner and outer sidewall components. The outer sidewall component is received in a radial and circumferential groove of an outer carrier. The connection of the inner sidewall can be achieved by mechanically fitting and welded the inner sidewalls to either a seal carrier or a small ring, or a small radial weld may be provided between the sidewall endfaces of circumferentially adjacent singlets.



5327





(54) Title of the invention : "ROBOTIC PROGRAMMING CONTROL USING MULTIPLE BINARY INPUT" (51) International classification

(71)Name of Applicant : : G05B15/00 1)GENERAL ELECTRIC COMPANY :11/513,349 Address of Applicant :ONE RIVER ROAD, :31/08/2006 SCHENECTADY, NEW YARK 12345, USA. U.S.A. :U.S.A. (72)Name of Inventor : :NA 1)SASSATELLI JOHN MATTHEW :NA 2)BURNETT MARK EDWARD :NA 3)NOLAN JOHN FRANCIS :NA 4)CUTLER JEFFREY PAUL :NA 5)COOK CARTER STEVEN :NA 6)PARKER DAVID ROY :NA

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A method of programming robotic control includes the steps of defining executable actions in a control loop, and establishing subprograms that effect modifications of or additions to the executable actions. The sub-programs are executed according to external binary inputs. The external binary inputs are provided during execution of the control loop so that the sub-programs can be executed as part of the control loop.



5328





(54) Title of the invention : TRUNCATED DIFFRACTIVE INTRAOCULAR LENSES (51) International classification :G02C7/02 (71)Name of Applicant : (31) Priority Document No :11/444,112 1)ALCON MANUFACTURING, LTD. (32) Priority Date :23/08/2006 Address of Applicant :6201 SOUTH FREEWAY, FORT (33) Name of priority country :U.S.A. WORTH, TEXAS 76134, USA U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)SIMPSON, MICHAEL J. (87) International Publication No :NA 2)KARAKELLE, MUTLU (61) Patent of Addition to Application Number :NA 3)VANNOY, STEVE Filing Date :NA 4)ZHANG, XIAOXIAO (62) Divisional to Application Number :NA 5)HONG, XIN Filing Date :NA 6)XIE, JIHONG (57) Abstract : In one aspect, the present invention provides a method of designing a diffractive ophthalmic lens (e.g., an intraocular lens (IOL)) that includes providing an optic having an anterior refractive surface and a posterior refractive surface, wherein the optic provides a farfocus power (e.g., in a range of about 18 to about 26 Diopters (D)). A truncated diffractive structure can be disposed on at least one of the surfaces for generating a near-focus add power (e.g., in a range of about 3 D to about 4 D). And the diffractive structure can be adjusted so as to obtain a desired distribution of optical energy between the near and far foci for a range of pupil sizes,



5329





(54) Title of the invention : "IMPROVED WALL SMOOTHNESS, FEATURE ACCURACY AND RESOLUTION IN PROJECTED IMAGES VIA EXPOSURE LEVELS IN SOLID IMAGING" (51) International classification :H04Q (71)Name of Applicant : (31) Priority Document No :11/468,090 1)3D SYSTEMS INC. (32) Priority Date :29/08/2006 Address of Applicant :333 THREE D SYSTEMS CIRCLE (33) Name of priority country :U.S.A. ROCK HILL, SC 29730, USA. U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)THOMAS ALAN KEREKES (87) International Publication No :NA 2)JOUNI P.PARTANES (61) Patent of Addition to Application Number :NA 3)YONG CHEN Filing Date :NA 4)CHARLES W.HULL (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A solid imaging apparatus and method employing levels of exposure varied with gray scale or time or both of digitally light projected image of a cross-section of a three-dimensional object on a solidifiable photopolymer build material. The gray scale levels of exposure of projected pixels permits the polymerization boundaries in projected boundary pixels to be controlled to achieve preserved image features in a three-dimensional object and smooth out rough or uneven edges that would otherwise occur using digital light projectors that are limited by the number of pixels in an image projected over the size of the image. Software is used to control intensity parameters applied to pixels to be illuminated in the image projected in the cross-section being exposed in the image plane.



5330





(54) Title of the invention : "APPARATUS AND ASSOCIATED METHOD, FOR SETTING THE NUMBER OF PAGE INDICATIONS PER PAGE TO BE INCLUDED IN A QUICK PAGE MESSAGE" (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country

:H04 (71)Name of Applicant : :06119334.8 1)RESEARCH IN MOTION LIMITED :22/08/2006 Address of Applicant :295 PHILLIP STREET, WATERLOO, :EUROPEAN ONTARIO N2L 3W8, CANADA Canada UNION (72)Name of Inventor : :NA 1)WILLEY WILLIAM DANIEL :NA :NA :NA :NA :NA :NA

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : Apparatus, and an associated method, for paging an access terminal in a radio communication system. A page indication count setter selects the page indication count, i.e., the number of page indications per page, to be included in a quick page message. The set page indication count is dependent upon communication activity, e.g., the system paging load, identified by a communication activity input indicia identifier.



5331





(54) Title of the invention : METHOD AND DEVICE FOR APPLYING IMAGES ON A BEVERAGE CAN LID (71)Name of Applicant : (51) International classification :B21D 51/38 (31) Priority Document No :60/595,325 1)MRC DESIGN STOCKHOLM Address of Applicant :C/O FASTH LAW OFFICES, 26 (32) Priority Date :23/06/2005 PINECREST PLAZA,SUITE 2, SOUTHERN PINES, NORTH (33) Name of priority country :U.S.A. :PCT/US2006/022046 CAROLINA 28387-4301 (US) U.S.A. (86) International Application No (72)Name of Inventor : Filing Date :07/06/2006 (87) International Publication No : WO/2007/001766 1)RONNBERG, MAGNUS (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The method is for adding images or text on a beverage can lid. A beverage can lid (136) is provided that has a handle member (134), the handle member (134) attached to a top surface of the beverage can lid (136). An image (120) is printed on the foil member. The printed foil member (100) is placed on top of the top surface of the beverage can lid so that a first cut out segment (114) is placed above the handle member and a second cut out segment (116) is aligned with a weakened segment (131) of the beverage can lid (136). With the foil member (100) placed on top of the weakened segment (131), the handle member (132) is lifted to engage the weakened segment (131) and push the second cut out segment (116) and a portion of the weakened segment...



5332





(54) Title of the invention : "IMAGE PROCESSING APPARATUS AND IMAGE PROCESSING METHOD, COMPUTER PROGRAM, AND IMAGING APPARATUS" (51) International classification (31) Priority Document No

:H04N7/00 (71)Name of Applicant : :P20061)SONY CORPORATION 238917 Address of Applicant :1-7-1 KONAN, MINATO:04/09/2006 KU,TOKYO, JAPAN, Japan :Japan (72)Name of Inventor : :NA 1)YUICHI HASEGAWA :NA :NA :NA :NA :NA :NA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : An image processing apparatus is disclosed. The image processing apparatus includes: detecting means for detecting a center of gravity of each of plural images of interest, which are images to which attention is paid among images included in an original image; calculating means for calculating an overall center of gravity, which is a center of gravity of all the plural images of interest, from the center of gravity of each of the plural images of interest; and determining means for determining an area in the original image such that a ratio of a distance from one edge of opposed edges of the area to the overall center of gravity to a distance from the other edge of the opposed edges of the area to the overall center of gravity takes a value decided in advance so as to arouse an aesthetic sense.



5333





(54) Title of the invention : "COVER RELEASE MECHANISM FOR A DISPENSER" :B65D88/00 (71)Name of Applicant : (51) International classification (31) Priority Document No :11/515,078 1)JOSEPH S. KANFER (32) Priority Date :01/09/2006 Address of Applicant :4445 EVERETT ROAD, RICHFIELD, (33) Name of priority country :U.S.A. OHIO 44286, USA U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)MARK E. ROSENKRANZ (87) International Publication No :NA 2)AARON R. REYNOLDS (61) Patent of Addition to Application Number :NA 3)ROBERT L. QUINLAN Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A dispenser includes a cover pivotally secured to a backplate to move between an open position, at which the dispenser can be refilled, and a closed position, at which the dispenser may be actuated. The cover includes a latch that engages a catch held on the backplate. An elongate bar secured to the backplate is provided to engage the latch and remove it from the catch to permit the cover to be moved to the open position. The elongate bar includes a yoke extending to left and right terminal ends that are accessible outside of a dispensing zone of the dispenser. This invention is particularly applicable to dispensers that employ sensors to sense the presence of a hand at a dispensing zone.



5334





(54) Title of the invention : "PEROXIDE CURED THERMOPLASTIC VULCANIZATES COMPRISING BUTYL RUBBER" (51) International classification

:C08L23/16; (71)Name of Applicant : C08L23/10 1)LANXESS INC Address of Applicant :SARNIA,IN THE PROVINCE OF :60/843,161 :08/09/2006 ONTARIO, CANADA N7T 7M2. Canada :U.S.A. (72)Name of Inventor : :NA 1)RUI RESENDES :NA 2)JON BEILBY :NA 3)JUDY PUGSLEY :NA 4)RAYNER KRISTA :NA 5)LORENZO PERRARI :NA :NA

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The invention relates to peroxide cured thermoplastic vulcanizates comprising a thermoplastic and an isomonoolefin-multiolefin elastomer, such as butyl rubber. More particularly, the invention relates to peroxide cured thermoplastic vulcanizates wherein the elastomer comprises at least 3.5 mol% of multiolefin in order to facilitate peroxide curing. The thermoplastic vulcanizates according to the present invention are useful in the preparation of shaped articles for high purity applications, such as condenser caps, medical components and fuel cell components.



5335





(54) Title of the invention : "PROTECTION AND CONTROL SYSTEM FOR ELECTRIC POWER NETWORKS WITH SIGNAL AND COMMAND INTERFACES AT THE PRIMARY EQUIPMENT" (51) International classification :H02H 1/00 (71)Name of Applicant : (31) Priority Document No :11/470,867 1)GENERAL ELECTRIC COMPANY (32) Priority Date :07/09/2006 Address of Applicant :ONE RIVER ROAD, (33) Name of priority country :U.S.A. SCHENECTADY, NEW YORK 12345, USA U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)KASZTENNY BOGDAN Z (87) International Publication No :NA 2)FINNEY DALE (61) Patent of Addition to Application Number :NA 3)MAZEREEUW JEFFREY Filing Date :NA 4)MARUSCA LOAN (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A system (100) for protection, control, metering, and monitoring of the delivery of electrical power is disclosed. Embodiments of the system provide input/output devices called bricks 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124 to receive analog and binary field data from primary equipment 102 located in a power substation switchyard 150. The bricks are linked via fiber-optic patch cables and patch panels with one or more intelligent electronic devices ("IEDs") 190. In operation, the bricks convert the received binary and/or analog field data into digital signals, and transmit the digital signals synchronously to their associated lEDs using clock signals provided by each IED to the individual bricks. The bricks may accept a computer software code download from each of its master IED(s). Multiple code implementations, each tailored to the requirements of its master IED(s) can therefore co-exist on a single brick.



5336





(54) Title of the invention : SURGICAL SYSTEM HAVING A CASSETTE WITH AN ACOUSTIC AIR REFLECTOR :A61B19/00 (71)Name of Applicant : (51) International classification (31) Priority Document No :11/510,903 1)ALCON, INC. (32) Priority Date :28/08/2006 Address of Applicant :P.O. BOX 62,BOSCH 69, CH-6331 (33) Name of priority country :U.S.A. HUNENBERG, SWITZERLAND, Switzerland (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)GOA, SHAWN X. (87) International Publication No :NA 2)NAZARIFAR, NADER (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A surgical cassette have a rigid fluid channel formed into a rigid plastic component or housing. The piezoelectric crystals of an ultrasonic flow meter are positioned on one side of the fluid channel. The side wall of the fluid channel opposite the piezoelectric crystals is exposed to fluid in the flow channel on its' interior side and is exposed to ambient air on its exterior side. The interface between the wall and the air acts as an acoustic reflector for the operation of the ultrasonic flow meter.



5337





(54) Title of the invention : "METHOD FOR ASSIGNING MULTIMEDIA DATA TO DISTRIBUTED STORAGE DEVICES" (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country

:G06F12/00 (71)Name of Applicant : :0612013.6.4 1)THOMSON LICENSING Address of Applicant :46, QUAI A.LE GALLO, 92100 :05/09/2006 :EUROPEAN BOULOGNE-BILLANCOURT, FRANCE France UNION (72)Name of Inventor : :NA 1)LAURENT MASSOULIE :NA 2)CHRISTOPHE NEUMANN :NA 3)MARY-LUC CHAMPEL :NA :NA :NA :NA

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The invention concerns a method for assigning parts of multimedia files to distributed storage devices, the number of said devices being an integer n, characterized in that it comprises the following steps: a step consisting in dividing each multimedia file in windows, which represent data for contiguous playback of a given duration ; a step consisting, for each multimedia file, In determining a number k so that any original window of file can be recovered from any k distinct symbols ; a step consisting, for each window of each said multimedia files, in assigning n corresponding symbols to said devices, one to each device, the n distinct symbols being created using erasure coding ; and a step consisting in partially or totally filling the storage memory left on each device after said first steps with prefix windows of said multimedia files.



5338





(54) Title of the invention : METHODS FOR PREPARING AND COAGULATING GRAFT RUBBER LATEX HAVING HIGH THERMAL STABILITY (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country

:C08F12/08; C08F12/00 :10-20060078956 :21/08/2006 :Republic of Korea :NA :NA :NA :NA :NA :NA :NA

(71)Name of Applicant : 1)LG CHEM,LTD. Address of Applicant :20, YOIDO-DONG, YOUNGDUNGPO-GU, SEOUL 150-721, REPUBLIC OF KOREA. Republic of Korea (72)Name of Inventor : 1)CHAI, JOO-BYUNG 2)YOO, KEUN-HOON 3)LEE,JIN-HYOUNG 4)HAN, WON-DEOK

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The present invention relates to a preparation method of a graft rubber latex, more precisely to a preparation method of a graft rubber latex by polymerization of a monomer mixture comprising one or more compounds selected from the group consisting of a rubber latex, an aromatic vinyl compound, a vinyl cyan compound and an acrylate compound, characterized by using a first hydrophobic peroxide-based polymerization initiator before the polymerization conversion rate of the monomer mixture reaches 50% and a second hydrophobic peroxide-based polymerization initiator thereafter. The graft rubber latex prepared by the method of the present invention has excellent thermal stability without using an additional thermo-stabilizer and increased efficiency in applying to a screw type dewatering machine.



5339





(54) Title of the invention : "APERTURE VARIABLE INSPECTION OPTICAL SYSTEM AND COLOR FILTER EVALUATION PROCESS" (51) International classification (31) Priority Document No

:G03B (71)Name of Applicant : 13/36 1)OTSUKA ELECTRONICS CO.,LTD. :2006Address of Applicant :26-3, SHODAI-TAJIKA 3-CHOME, 234057 HIRAKATA-SHI, OSAKA 573-1132, JAPAN Japan :30/08/2006 (72)Name of Inventor : :Japan 1)KENJI NAKAMURA :NA 2)HISASHI SHIRAIWA :NA :NA :NA :NA :NA :NA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : Disclosed is an aperture variable inspection optical system including a variable aperture unit 13 having a polygonal light transparent section and light collecting systems 12a, 12b for forming an irradiation spot U of light passing through the variable aperture unit 13 at the position of a sample S. The variable aperture unit 13 is capable of changing the shape/size of the polygon. The size of the irradiation spot U can be changed without rearranging the aperture unit.



5340





(54) Title of the invention : "APPARATUS FOR ESTIMATING QUANTITY OF HEAT GENERATION OF CLUTCH" (51) International classification (31) Priority Document No

:F16F15/123 :2006235757 :31/08/2006 :Japan :NA :NA :NA :NA :NA :NA :NA

(71)Name of Applicant : 1)KABUSHIKI KAISHA F.C.C. Address of Applicant :7000-36, NAKAGAWA, HOSOECHO, KITA-KU, HAMAMATSU-SHI, SHIZUOKA, JAPAN Japan (72)Name of Inventor : 1)ASAO KUMAOKA 2)KAZUYOSHI MIYACHI 3)SHIGEKI KAWASHIMA 4)SATORU KASHIWAGI 5)HIDEYUKI OISHI

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : An object of the present invention is to provide an apparatus for estimating the quantity of heat generation of a friction clutch of vehicle which can objectively determine the quantity of heat generation of the clutch to prevent it from being seized or burned using various existing sensors usually provided on a vehicle and thus suppress increase of manufacturing cost of a vehicle. According to the present invention, there is provided an apparatus for estimating the quantity of heat generation of a friction clutch of vehicle comprising; means (4) for estimating the quantity of heat generation of a friction clutch (12) from the product of a difference in rotation of the friction clutch (12) between its input and output sides and a shaft torque of the clutch (12), said difference in rotation of the friction clutch being calculated from a detected value in an input side sensor (2) arranged on an input side power train from an engine (E) to the friction clutch (12) for obtaining parameters relating to the rotational speed of the input side power train, and from a detected value in an output side sensor (3) arranged on an output side power train from the friction clutch (12) to a wheel (or wheels) (15) for obtaining parameters relating to the rotational speed of the output side power train, and said clutch shaft torque being calculated from a detected value obtained by other sensor (or sensors).



5341





(54) Title of the invention : EQUIPMENT FOR THE PRODUCTION OF MULTILAYER EXTRUDED SHEET AND MULTILAYER EXTRUDED SHEET (51) International classification (31) Priority Document No

:B29C45/14 (71)Name of Applicant : :KR 101)HANYANG ADVANCED MATERIALS CO., LTD. Address of Applicant :7-1, CHAAM-DONG, CHEONAN2006CITY, CHUNG-NAM-DO, 330-200 KOREA. Republic of Korea 0080016 :23/08/2006 (72)Name of Inventor : :Kazakhstan 1)PAL YOUNG, PARK :NA 2)DEOK KI, JOO :NA :NA :NA :NA :NA :NA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The present invention relates to an equipment for the production of multilayer extruded sheet and multilayer extruded sheet (functional multi-layer extruded sheet and an equipment for manufacturing the same) in which an extruded sheet of a multi-layer structure as a functional multi-layer extruded sheet is used for a component member for a car such as a trunk component, a wheel guard, a door trim and a baggage rack, more particularly, when using the porosity filler or excessive amount of filler during mixing process of the composition of the base layer 10', bubbles generate between a surface layer and back layer accumulated in the upper/lower portions of a base layer, the extruded sheet that formed in the thickness of 2.0 to 3.0 mm for the surface layer and back layer is manufactured for using in the states that the bubbles are generated, accordingly, which solves the problems of drop in operation efficiency, a rise in the cost, a reduction of fuel ratio for cars, and a hanging state in use of the extruded sheet due to heavy weight, the manufacturing equipment/method of functional multi-layer extruded sheets becomes light in its weight and improves the properties of matter such as a stiffness, a sound absorbing/proofing property, weathering property since the assistant material as glass fiber or non-woven fabric is formed with multi-layers in the inner/outer side of an extruded sheet. The present invention provides a functional multi-layer extruded sheet and an equipment for manufacturing the same, which improves the properties of matter such as a stiffness, a sound absorbing/proofing property, weathering property and reduces the weight of the extruded sheet since the assistant material as glass fiber or non-woven fabric is formed with multi-layers in the inner/outer sides of an extruded sheet for improving properties of matter such as a stiffness and sound proofing property.



5342





(54) Title of the invention : "CONTROL METHODS FOR PULSE WIDTH MODULATION (PWM)" (51) International classification

(71)Name of Applicant : :H03K 3/017 1)CONVERTEAM LTD :0617371.0 Address of Applicant :BOUGHTON ROAD, RUGBY, :02/09/2006 WARWICKSHIRE CV21 1BU, UNITED KINGDOM. U.K. :U.K. (72)Name of Inventor : :NA 1)RODNEY JONES :NA 2)ROBERT VERNON FULCHER :NA 3)ERIC ANTHONY LEWIS :NA :NA :NA :NA

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The present invention provides a method of controlling a power converter that can be used to interface to a power grid or supply network operating at a frequency (Fnet) that is nominally fixed (say at 50 Hz, for example) but which can be varied as a way of controlling power imbalanced within the network as a whole. The power converter can include a network bridge that operates in accordance with the pulse width modulation (PWM) strategy having a switching frequency (Fpwm), a nominal switching frequency (Fpwm_nom) and a number of pulses per period (Pulse Number). The method comprising the step of varying the switching frequency (Fpwm) of the PWM strategy in accordance with the time-varying frequency (Fnet) of the supply network to achieve only integer odd harmonics of the time-varying frequency (Fnet) and adjusting the number of pulses per period (Pulse_Number) in accordance with the time-varying frequency (Fnet) of the supply network to maintain a switching frequency (Fpwm) that is less than, or equal to, the nominal switching frequency (Fpwm nom).



5343





(54) Title of the invention : "IMAGE- PROCESSING APPARATUS, IMAGE PROCESSING METHOD AND IMAGE PROCESSING PROGRAM" (51) International classification (31) Priority Document No

:G06F (71)Name of Applicant : 15/16 1)SONY CORPORATION :P2006Address of Applicant :1-7-1 KONAN, ,MINATO-KU, 236145 TOKYO, JAPAN. Japan :31/08/2006 (72)Name of Inventor : :Japan 1)TAKANOBU UJISATO :NA 2)NOBUHIRO TSUNASHIMA :NA :NA :NA :NA :NA :NA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : Disclosed herein is an image-processing apparatus including: an image holding section configured to store an input image; an image division section configured to divide the input image stored in the image holding section into a plurality of image portions having the same size and the same shape; a characteristic-quantity computation section configured to compute a characteristic quantity of each of the image portions generated by the image division section; and a difference computation section configured to carry out a difference computation process of computing a difference between the characteristic quantity computed by the characteristic-quantity computation section as the characteristic quantity of each individual one of the image portions generated by the image division section and a value determined in advance as well as a determination process of producing a result of determination as to whether or not the individual image portion is a portion of a background of the input image on the basis of the difference.



5344





(54) Title of the invention : "BATTERY CELL WITH SMALL GROOVE AT SURFACE AND BATTERY PACK INCLUDING THE SAME" (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country


(71)Name of Applicant : 1)LG CHEM, LTD., Address of Applicant :20, YOIDO-DONG, YOUNGDUNGPO-GU, SEOUL 150-721,REPUBLIC OF KOREA Republic of Korea (72)Name of Inventor : 1)JUN HWAN JANG 2)BYUNGJIN CHOI 3)HYANG MOK LEE

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : Disclosed herein is a battery cell including an electrode assembly of a cathode/separator/anode structure mounted in a receiving part of a battery case (cell case). The cell case is provided, at a predetermined region of the cell case corresponding to the upper end interface of the electrode assembly while the electrode assembly is mounted in the receiving part, with a small groove for pressing against the upper end of the electrode assembly to prevent the upward movement of the electrode assembly. The small groove is continuously formed in parallel with the upper end of the electrode assembly.



5345





(54) Title of the invention : "COMMUNICATION SYSTEM, COMMUNICATION APPARATUS, AND ELECTRIC-FIELDCOUPLING ANTENNA" (51) International classification (31) Priority Document No

:H01Q9/04; (71)Name of Applicant : H01Q1/38 1)SONY CORPORATION :P2006Address of Applicant :1-7-1 KONAN, MINATO-KU, 245614 TOKYO 108-0075, JAPAN. Japan :11/09/2006 (72)Name of Inventor : :Japan 1)TAKANORI WASHIRO :NA :NA :NA :NA :NA :NA :NA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : ABSTRACT OF THE DISCLOSURE A communication system includes the following elements: a transmitter including a transmission circuit unit configured to generate an RF signal for transmitting data and an EFC antenna configured to transmit the RF signal as an electrostatic field or an induced electric field; a receiver including an EFC antenna and a reception circuit unit'configured to receive and process the RF signal received by the EFC antenna; and an impedance matching unit configured to make an impedance of the EFC antenna of the transmitter equal to an impedance of the EFC antenna of the receiver. The RF signal is transmitted by electric-field coupling between the EFC antennas, facing each other, of the transmitter and the receiver.



5346





(54) Title of the invention : "CARD PRODUCT DISPLAY SYSTEM" :G09F 1/08 (71)Name of Applicant : (51) International classification (31) Priority Document No :11/510,188 1)E2INTERACTIVE,INC. D/B/A E2INTERACTIVE,INC. (32) Priority Date :25/08/2006 Address of Applicant :250 WILLIAMS STREET, SUITE M(33) Name of priority country :U.S.A. 100, ATLANTA, GEORGIA 30303 USA. U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)WASHER WAYNE (87) International Publication No :NA 2)BERNSTEIN DAVID (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A display unit for hanging products comprising a substantially planar base having a front side, a back side, a left edge, and a right edge. The display unit may further comprise an elongated hook extending forwardly from the front side of the base, the hook having a proximal end joined to the base and a distal end. In addition, the display unit may comprise a securing mechanism attached to the back side of the base, the securing mechanism being adapted to selectively secure the display unit to a vertical surface.



5347





(54) Title of the invention : "APPARATUS AND ASSOCIATED METHOD, FOR PAGING AN ACCESS TERMINAL IN A RADIO COMMUNICATION SYSTEM" (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country

:H04Q (71)Name of Applicant : :06119332.2 1)RESEARCH IN MOTION LIMITED :22/08/2006 Address of Applicant :295 PHILLIP STREET, WATERLOO, :EUROPEAN ONTARIO N2L 3W8,CANADA. Canada UNION (72)Name of Inventor : :NA 1)WILLEY WILLIAM DANIEL :NA :NA :NA :NA :NA :NA

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : Apparatus, and an associated method, for paging an access terminal in a radio communication system. A message generator generates a quick paging message formed of page indication locations. Page indication values are populated in selected page indication locations of the message. A hash generator generates hash values that are determinative of the page indication locations that are populated with the page indication values.



5348





(54) Title of the invention : "METHOD FOR INTER-CELL INTERFERENCE MITIGATION FOR A MOBILE COMMUNICATION SYSTEM" (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country

:H04Q 7/20 :10-20060082991 :30/08/2006 :Republic of Korea :NA :NA :NA :NA :NA :NA :NA

(71)Name of Applicant : 1)PANTECH CO.,LTD. Address of Applicant :PANTECH R&D CENTER, 1-2, DMC SANGAM-DONG, MAPO-GU, SEOUL 121-270, REPUBLIC OF KOREA. Republic of Korea (72)Name of Inventor : 1)DAN KEUN SUNG 2)BANG CHUL JUNG

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A method for reducing inter-cell interference (ICI) in a mobile communication system controls transmission signal power of an uplink signal from a terminal based on signal power measurement for a signal received from a base station of a neighboring cell. A terminal receives a signal from a base station of a neighboring cell via a wireless channel, measures a channel response against a threshold value across an applicable frequency band by using the received signal, determines a transmission signal power for each frequency band used for data transmission based on the measured channel response, and transmits data to a home cell base station according to the transmission signal power for each frequency band. The terminal may measure a channel response based on signals received from multiple base stations in multiple neighboring cells, and may also evaluate signal power of a signal transmitted from the home cell.



5349





(54) Title of the invention : "A STEAM TURBINE NOZZLE BOX AND METHODS OF FABRICATING" (51) International classification :F01D9/04 (71)Name of Applicant : (31) Priority Document No :11/470,322 1)GENERAL ELECTRIC COMPANY (32) Priority Date :06/09/2006 Address of Applicant :ONE RIVER ROAD, (33) Name of priority country :U.S.A. SCHENECTADY, NEW YORK 12345, USA U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)HAMLIN MICHAEL THOMAS (87) International Publication No :NA 2)CARUSO DAVID ALAN (61) Patent of Addition to Application Number :NA 3)O'CLAIR CHARLES T. Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A method of fabricating a steam turbine nozzle box (200) is provided, wherein the method includes forming an annular chamber (202) defined by a radially outer wall and a radially inner wall and coupling a plurality of inlets (204) in flow communication with the annular chamber such that steam is discharged from each of the plurality of inlets into the chamber at an oblique discharge angle with respect to an inlet axial centerline.



5350





(54) Title of the invention : NOVEL VINYL PYRIDIENE LATEX AND PROCESS FOR PREPARING THE SAME (51) International classification

:A01G (71)Name of Applicant : 13/02 1)JUBILANT ORGANOSYS LIMITED :NA Address of Applicant :PLOT 1A, SECTOR 16 A, NOIDA:NA 201301, UP, INDIA. Uttar Pradesh India :NA (72)Name of Inventor : :NA 1)SANTRA RABIN :NA 2)MOHANTY SUBHRA :NA :NA :NA :NA :NA

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : Disclosed herein is a novel vinyl pyridine latex with 50 % solid comprising a composition having a mixture of monomers as 2-vinyl pyridine, styrene, 1,3 butadiene, an unsaturated carboxylic acid and Polymerizable ally/vinyl sulphonates along with a synthetic anionic surfactant as base emulsifier, without using any conventional fatty acid soaps as post stabilizer. The process for preparing the same and use thereof is also disclosed in the present invention.



5351





(54) Title of the invention : "SHAFT SEAL USING SINGLE COMPLIANT-PLATE MEMBERS" :F04D29/12 (71)Name of Applicant : (51) International classification (31) Priority Document No :11/519,044 1)GENERAL ELECTRIC COMPANY (32) Priority Date :12/09/2006 Address of Applicant :ONE RIVER ROAD, (33) Name of priority country :U.S.A. SCHENECTADY, NEW YORK 12345, USA. U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)AWTAR SHORYA (87) International Publication No :NA 2)ADIS WILLIAM EDWARD (61) Patent of Addition to Application Number :NA 3)KOWALCZYK MARK WILLIAM Filing Date :NA 4)TURNQUIST NORMAN ARNOLD (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A shaft seal reduces leakage between a rotating shaft such as a rotor (12) and a stator (14,15). The shaft seal or shingle seal includes a plurality of compliant-plate members (16) attached to the stator in facing relation. The compliant-plate members define a sealing ring between the stator and the rotating shaft. Each of the compliant-plate members includes a plurality of shingles (18), where adjacent compliant-plate members are disposed relative to each other such that the shingles are at least partially staggered in a direction of axial leakage.



5352





(54) Title of the invention : "QUINAZOLINONE LINKED PYRROLO [2,1-C][1,4] BENZODIAZEPINE HYBRIDS AND A PROCESS FOR THE PREPARATION THEREOF" (51) International classification

:C04B 28/02 :NA :NA :NA :NA :NA :NA :NA :NA :NA :NA

(71)Name of Applicant : 1)COUNCIL OF SCIENTIFIC & INDUSTRIAL RESEARCH Address of Applicant :ANUSANDHAN BHAWAN, RAFI MARG, NEW DELHI - 110 001, INDIA. Delhi India (72)Name of Inventor : 1)AHMED KAMAL 2)ADHI VENKATA RAMANA 3)ANKATI HARI BABU

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The present invention provides quinazolinone linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid of general formula 5 , wherein, R is alkyl group selected from H, Cl, F or CH3 and n=1 to 3 useful for antitumour/anticancer activity. The present invention also provides a process for the preparation of quinazolinone linked pyrrolo[2,1-c][1,4]benzodiazepine hybrid general formula 5.



5353





(54) Title of the invention : BENZOPHENONE LINKED PYRROLO [2,1-C][1,4]BENZODIAZEPINE HYBRIDS ADN A PROCESS FOR THE PREPARATION THEREOF (51) International classification


(71)Name of Applicant : 1)COUNCIL OF SCIENTIFIC & INDUSTRIAL RESEARCH Address of Applicant :ANUSANDHAN BHAWAN, RAFI MARG, NEW DELHI-110001, INDIA Delhi India (72)Name of Inventor : 1)AHMED KAMAL 2)BANDARI RAJENDRA PRASAD

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The present invention provides a compound of general formula 5, useful as potential antitumour agents against human cancer cell lines. The present invention further provides a process for the preparation of pyrrolo [2,1-c][1,4] benzodiazepine hybrids of general formula 5 wherein, X1, X2, X3 is selected from H or Cl or CH3, Y is selected from O or NH, Z is selected from C =O or CH2 and n=1 to 4.



5354





(54) Title of the invention : A METHOD FOR THE PREPARATIONOF REFRESHING DRINK AND USE THEREOF

(51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date

(71)Name of Applicant : 1)COUNCIL OF SCIENTIFIC & INDUSTRIAL RESEARCH :C04B Address of Applicant :ANUSANDHAN BHAWAN, 2, RAFI 28/02 MARG, NEW DELHI-110001 Delhi India :NA (72)Name of Inventor : :NA 1)PUSHPITO KUMAR GHOSH :NA 2)MAHESHCHANDRA RAMESHCHANDRA :NA RAJYAGURU :NA 3)KARUPPANAN ESWARAN : NA 4)PEDDI VENKATA SUBBARAO :NA 5)MUKESH TRIBHOVANBHAI SHAH :NA 6)SUDHAKAR TUKARAM ZODAPE :NA 7)MISS SHARDA VITTHALDAS JOSHI :NA 8)ALAMURU VENKATA RAMI REDDY 9)DEVMURARI CHHAGANLAL VITHALDAS 10)SIBDAS BANDYOPADHYAY 11)GANESH CHANDRA SAHOO

(57) Abstract : The present invention discloses a nutritious, tasty and affordable drink made from the sap of Kappaphycus alvarezii seaweed which is readily cultivable. The drink resembles coconut water in appearance and taste and is rich in potassium. It also contains an adequate proportion of the daily requirement of iodine besides many other useful minerals such as magnesium, calcium, sodium, zinc, phosphorous and iron while having low concentrations of toxic elements such as lead and chromium. The process of refining sap, which enables the seaweed drink to be palatable and widely acceptable, besides bestowing adequate shelf life, is also described. The process of preparation is integrated with preparation of carrageenan and plant nutrient thereby making optimum use of the seaweed and minimizing waste.



5355





(54) Title of the invention : "CMP PAD HAVING UNEVENLY SPACED GROOVES" (51) International classification

:B24D 11/00 :11/512,994 :30/08/2006 :U.S.A. :NA :NA :NA :NA :NA :NA :NA

(71)Name of Applicant : 1)ROHM AND HAAS ELECTRONIC MATERIALS CMP HOLDINGS, INC., Address of Applicant :451 BELLEVUE ROAD, NEWARK, DE 19713, USA; U.S.A. (72)Name of Inventor : 1)CAROLINA L. ELMUFDI 2)GREGORY P. MULDOWNEY

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A chemical mechanical polishing pad (100) having a circular polishing track (124) and a concentric center (116). The polishing pad (100) includes a polishing layer (104) having a groove pattern containing a plurality of grooves (128) each extending through the polishing track (124). The plurality of grooves have an angular pitch that varies in a circumferential direction about the concentric center (116) of the pad (100) and the radial pitch between all adjacent grooves (128) within the wafer track (124) is unequal.



5356





(54) Title of the invention : DOSAGE-DISPENSING DEVICE FOR POWDERS OR PASTES (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country

:A61M11/00 (71)Name of Applicant : :06121165.2 1)METTLER-TOLEDO AG Address of Applicant :IM LANGACHER CH-8606 :25/09/2006 :EUROPEAN GREIFENSEE, SWITZERLAND. Switzerland UNION (72)Name of Inventor : :NA 1)LUCHINGER, PAUL :NA 2)EHRBAR, SANDRA :NA :NA :NA :NA :NA

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A dosage-dispensing device for substances in powder- or paste form includes a drive device and a source container that can be set into the drive device, wherein a dosage-dispensing head with a closure body that can be set into rotation by a drive mechanism and is connected to a closure shaft which is movably constrained in the source container is arranged at the underside of the source container when the latter is in its operating position. The closure shaft has a coupler part in a passage area where it passes through the topside of the source container. The coupler part is configured to be coupled to and uncoupled from a drive shaft of the drive device. The source container has a first form element which is designed for form-fitting engagement with a first counterpart element formed on the drive device and serves to precisely position the coupler part in relation to the drive shaft in a plane that is orthogonal to the axis of rotation of the drive shaft. The source container further has a second form element which is designed for form-fitting engagement with a second counterpart element formed on the drive device (150) and which, when in operating position, serves to precisely position the dosage-dispensing head in relation to a target container which is arranged below the dosage-dispensing head. Figure 2 is representative Figure.



5357





(54) Title of the invention : "TURBINE NOZZLE ASSEMBLIES" :F01D 5/00 (71)Name of Applicant : (51) International classification (31) Priority Document No :11/518,708 1)GENERAL ELECTRIC COMPANY (32) Priority Date :11/09/2006 Address of Applicant :ONE RIVER ROAD, (33) Name of priority country :U.S.A. SCHENECTADY, NEW YORK 12345, USA. U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)BURDGICK STEVEN S. (87) International Publication No :NA 2)CRALL THOMAS W (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A nozzle assembly for a turbine that may include: (1) a nozzle blade (43) having inner sidewall (44) and outer sidewall (46) and, in part, defining a flowpath upon assembly into the turbine; (2) an outer ring (20); (3) a flowsplitter (11) having a horizontal extension (21); (4) an interface between the outer ring (20) and the outer sidewall (46) having at least one of (i) a radial interlock (48), (76), (78); (ii) a male/female interface (54), (82), (84); or (iii) a female recess (106) flanked by radially projecting male steps (108) at both a leading and a trailing edge of the outer sidewall (46); and (5) an interface between the horizontal extension (21) and the inner sidewall (44) having at least one of (i) the radial interlock (48), (76), (78); (ii) the male/female interface (54), (82), (84); or (iii) the female recess (106) flanked by radially projecting male steps (108) at both a leading and a trailing edge of the inner sidewall (44).



5358





(54) Title of the invention : "PROCESS FOR CATALYTICALLY PREPARING AROMATIC OR HETEROAROMATIC NITRILES" (51) International classification (31) Priority Document No

:C07B43/08 (71)Name of Applicant : :10 2006 1)SALTIGO GMBH 042 439.5 Address of Applicant :KATZBERGSTRASSE 1, D-40764 :09/09/2006 LANGENFELD, GERMANY. Germany :Germany (72)Name of Inventor : :NA 1)NIKOLAUS MULLER :NA 2)WOLFGANG MAGERLEIN :NA 3)MATTHIAS BELLER :NA 4)THOMAS SCHAREINA :NA 5)ALEXANDER ZAPF :NA :NA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The present invention relates to a process for preparing optionally substituted aromatic or heteroaromatic nitriles starting from haloaromatics. These are reacted in a copper-catalysed reaction with potassium hexacyanoferrate(H) or potassium hexacyanoferrate (III) in the presence of heteroaromatic amines.



5359





(54) Title of the invention : AN IMPROVED PROCESS FOR THE PREPARATION OF CARVEDILOL (51) International classification :C07D209/88 (71)Name of Applicant : (31) Priority Document No :NA 1)MOREPEN LABORATORIES LIMITED (32) Priority Date :NA Address of Applicant :VILLAGE-MASULKHANA, DISTT.(33) Name of priority country :NA SOLAN, PARWANOO (HP), INDIA. Himachal Pradesh India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)SURI SANJAY (87) International Publication No :NA 2)KASHYAP TAPAN (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention provides a more simplified, cost effective, commercially feasible process for the manufacture of Carvedilol (I) comprising a step of reacting 4-hydroxy carbazole (II) with epichlorohydrin and directly isolating the intermediate 4-(2,3epoxypropoxy) carbazole (III) which on purification followed by reaction with 2-(2-methoxyphenoxy) ethylamine (IV) yields crude Carvedilol (I). The crude Carvedilol (I) is converted to pure product either through solvent crystallization (without salt formation) or through salt formation followed by salt cleavage and solvent crystallization resulting in highly pure (i.e. ICH grade) Carvedilol.



5360





(54) Title of the invention : "PROCESSES FOR THE PRODUCTION OF DIARYL CARBONATES AND TREATMENT OF ALKALICHLORIDE SOULUTIONS RESULTING THEREFROM" (51) International classification :C07C68/06 (71)Name of Applicant : (31) Priority Document No :102006041465.9 1)BAYER MATERIALSCIENCE AG (32) Priority Date :02/09/2006 Address of Applicant :51368 LEVERKUSEN,GERMANY. (33) Name of priority country :Germany Germany (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)ANDREAS BULAN (87) International Publication No :NA 2)PIETER OOMS (61) Patent of Addition to Application Number :NA 3)RAINER WEBER Filing Date :NA 4)JOHANN RECHNER (62) Divisional to Application Number :NA 5)MARC BUTS Filing Date :NA 6)JOHAN VANDEN EYNDE (57) Abstract : Processes comprising: (a) reacting phosgene and a monohydroxyl aryl compound in the presence of a suitable catalyst to form a diaryl carbonate and a solution comprising an alkali chloride; (b) separating the diaryl carbonate from the solution; (c) adjusting the pH of the solution to a value of less than or equal to 8 to form a pH-adjusted solution; (d) treating the pH-adjusted solution with an adsorbent to form a treated solution; (e) subjecting at least a portion of the treated solution to electrochemical oxidation to form chlorine and an alkali hydroxide solution; and (f) recycling at least a portion of one or both of the chlorine and the alkali hydroxide solution.



5361





(54) Title of the invention : A HERBAL INSECTICIDAL COMPOSITION FOR CONTROLLING INSECT PEST AND A PROCESS FOR THE PREPARATION THEREOF


(71)Name of Applicant : :C04B 1)COUNCIL OF SCIENTIFIC & INDUSTRIAL 28/02 RESEARCH :NA Address of Applicant :ANUSANDHAN BHAWAN, RAFI :NA MARG NEW DELHI-110 001, INDIA. Delhi India :NA (72)Name of Inventor : :NA 1)BEHL HARI MOHAN :NA 2)KUMAR VISHAL :NA 3)KRISHNAPPA CHANDRASHEKAR :NA 4)LEHRI ALOK :NA 5)SINGH NANDITA :NA 6)SIDHU OM PRAKASH :NA 7)SHUKLA VINOD KUMAR

(57) Abstract : The present invention relates to the extraction of bioactive from non edible vegetable oil from tree species, combining the said fraction with residual waste material of plant essential oils and extract of tobacco dust generated by not restricted to but more particularly chewing tobacco industry. Synergistic combination not previously used as active ingredients has been used to develop a pesticidal formulation. Storage stable formulation with a suitable carrier and optionally, with a suitable surface active agent is prepared in concentrate form for pesticidal use. The invention also relates to controlling pests by applying pesticidal effective amount of the above formulation with Synergistic effects to loci where pest control is desired.



5362





(54) Title of the invention : "A CONNECTOR" (51) International classification (31) Priority Document No

:H01R 3/00 (71)Name of Applicant : :JP20061)SUMITOMO WIRING SYSTEMS,LTD. 234220 Address of Applicant :1-14, NISHISUEHIRO-CHO, :30/08/2006 YOKKAICHI-CITY, MIE 510-8503, JAPAN. Japan :Japan (72)Name of Inventor : :NA 1)HIROSHI NAKANO :NA :NA :NA :NA :NA :NA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : An object of the present invention is to provide a circuit board connector having an improved durability against forces acting on a housing to separate the housing from a circuit board. [Solution] Engaging portions 24 are so bent as to increase the areas of engaging surfaces 25 in the thickness direction thereof. Since contact areas of the engaging portions 24 and restricting surfaces 14 increase in this way, forces acting on the contact surfaces are distributed to become smaller. Accordingly, even if large separating forces repeatedly act on a housing 10, the damage and the like of the engaging portions 24 and restricting surfaces 14 can be presented, with the result that durability against the separating forces can be improved. Further, according to this embodiment, an improvement in the durability of this circuit board connector 1 is realized without enlarging the housing (Figer Removed)



5363





(54) Title of the invention : "METHOD FOR CONTROLLING INTER-CELL INTERFERENCE IN A MOBILE COMMUNICATION SYSTEM" (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country

:H04Q 7/20 :10-20060082992 :30/08/2006 :Republic of Korea :NA :NA :NA :NA :NA :NA :NA

(71)Name of Applicant : 1)PANTECH CO.,LTD. Address of Applicant :PANTECH R&D CENTER, 1-2, DMC SANGAM-DONG, MAPO-GU, SEOUL 121-270, REPUBLIC OF KOREA Republic of Korea (72)Name of Inventor : 1)DAN KEUN SUNG 2)BANG CHUL JUNG

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A method for controlling inter-cell interference (ICI) in a mobile communication system by transmitting uplink control information from a base station in a home cell to a terminal of a neighboring cell based on ICI amount information measured at the base station. The ICI control method includes receiving an uplink signal at a base station and extracting inter-cell interference amount information from the uplink signal, generating uplink control information based on the extracted inter-cell interference amount information, and transmitting the uplink control information to a terminal in a neighboring cell. The terminal schedules an uplink resource including selecting frequency bands for an uplink signal by referring to the uplink control information.



5364





(54) Title of the invention : "ACOUSTIC TRANSDUCER" :H05K 5/00 (71)Name of Applicant : (51) International classification (31) Priority Document No :11/511,170 1)TECHNOLOGY PROPERTIES LIMITED (32) Priority Date :28/08/2006 Address of Applicant :20400 STEVENS CREEK (33) Name of priority country :U.S.A. BOULEVARD, SUITE 500,CUPERTINO, 95014, USA. U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)ROGER ADELMAN (87) International Publication No :NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An acoustic transducer comprises, within a housing (300), a diaphragm (350) at least a portion of which is of magnetically permeable material (358). The diaphragm is held by upper and lower support rings between pole pieces (380 and 320). A magnet (340) is between the pole pieces. The diaphragm has a portion (356) of magnetically permeable material magnetically coupled to an electromagnetic coil (360). Acoustic cavities (326) are defined between the pole pieces and the diaphragm. Passages in the housing and in at least one of the pole pieces allow movement of air in and out of at least one of the cavities.



5365





(54) Title of the invention : "METHOD FOR PREPARING STRAIN TOLERANT COATINGS FROM A GREEN MATERIAL" (51) International classification :C25D7/00 (71)Name of Applicant : (31) Priority Document No :11/521,033 1)GENERAL ELECTRIC COMPANY (32) Priority Date :14/09/2006 Address of Applicant :ONE RIVER ROAD, (33) Name of priority country :U.S.A. SCHENECTADY, NEW YORK 12345, USA. U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)BURIN DAVID L. (87) International Publication No :NA 2)O'CONNELL MATTHEW J (61) Patent of Addition to Application Number :NA 3)DIMASCIO PAUL Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Methods for coating substrates are provided. A method for coating a substrate comprises disposing a coating on a substrate, where the coating exhibits a first strain tolerance; and treating the coating to enhance the strain tolerance of the coating to a second strain tolerance. The second strain tolerance is more strain tolerant strain than the first strain tolerance. Further, the step of treating comprises at least one of mechanical treating, chemically treating, thermally treating, and combinations thereof.



5366





(54) Title of the invention : "ULTRASONIC TRANSDUCER DRIVING CIRCUIT AND ULTRASONIC DIAGNOSTIC APPARATUS" (51) International classification (31) Priority Document No

:H01L41/00 :2006248830 :14/09/2006 :Japan :NA :NA :NA :NA :NA :NA :NA

(71)Name of Applicant : 1)GE MEDICAL SYSTEMS GLOBAL TECHNOLOGY COMPANY LLC Address of Applicant :300 NORTH GRANDVIEW BOULEVARD-W-710, WAUKESHA, WI 53188 USA. U.S.A. (72)Name of Inventor : 1)AMEMIYA SHINICHI

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : With the aim of quickly returning the voltage of an output line (W) to an ultrasonic transducer (E) from a positive voltage or a negative voltage to the ground voltage and reducing the circuit size, immediately after turning on and turning off of a positive FET (IIP) in accordance with a positive pulse signal, a negative FET (11N) goes on for only a pull-back period allowing for the output line (W) to return to the ground voltage. Also, immediately after turning on and turning off of the negative FET (11N) in accordance with a negative pulse signal, the positive FET (IIP) goes on for only a pull-back period allowing for the output line (W) to return to the ground voltage.



5367





(54) Title of the invention : "RESISTANCE OF PLANTS TO BIOTIC AND ABIOTIC STRESSES BY OVER EXPRESSION OF PROTOCHLOROPHYLLIDE OXIDE REDUCTASE C AND ITS OTHER ISOFIRMS (51) International classification :C12N (71)Name of Applicant : (31) Priority Document No :NA 1)DEPARTMENT OF BIOTECHNOLOGY (32) Priority Date :NA Address of Applicant :BLOCK-2, 7TH FLOOR C.G.O. (33) Name of priority country :NA COMPLEX, LODHI ROAD, NEW DELHI, INDIA. Delhi India (86) International Application No :NA 2)JAWAHARLAL NEHRU UNIVERSITY Filing Date :NA (72)Name of Inventor : (87) International Publication No :NA 1)BAISHNAB CHARAN TRIPATHY (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A process for the construction of plant transformation vector comprising: digesting a binary vector pCAMBIA1304 with EcoRI and Sal I; subjecting the digested binary vector to the step of end filling by Klenow; re-ligating the said binary vector by known method; obtaining CaMV 35 s promoter cassette with Ω enhancer from pSH9; incorporating the said Camv35S prometer cassette into the Hind III site of the said binary vector to obtain modified pCAMBIA 1304 vetor; subjecting pore DNA fragment (1206 bp) to the step of amplification using a pair of primers; introducing EcoRI restriction sites to both the primers; ligating the said amplified cDNA fragment to pGEM T-easy; extracting EcoRI digested porC cDNA fragment from cloned pGEM T-easy; inserting said EcoRI digested porC cDNA fragment into modified pCAMBIA 1304 plant transformation vector to produce recombinant plasmids construct (pCAMBIA 1304-AtporC).



5368





(54) Title of the invention : "APPARATUS FOR ESTIMATING A SLIPPAGE AMOUNT OF CLUTCH" (51) International classification (31) Priority Document No

:F16F15/123 :2006235756 :31/08/2006 :Japan :NA :NA :NA :NA :NA :NA :NA

(71)Name of Applicant : 1)KABUSHIKI KAISHA F.C.C. Address of Applicant :7000-36, NAKAGAWA, HOSOECHO, KITA-KU, HAMAMATSU-SHI, SHIZUOKA, JAPAN Japan (72)Name of Inventor : 1)ASAO KUMAOKA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : An object of the present invention is to provide an apparatus for estimating a slippage amount of clutch which can objectively determine the timing of exchanging a friction clutch by estimating the slippage amount of clutch using various existing sensors usually provided on a vehicle and thus suppress increase of manufacturing cost of a vehicle. According to the present invention, there is provided an apparatus for estimating a slippage amount of a friction clutch (12) of vehicle comprising; means (4) for estimating a slippage amount by calculating a difference in rotation of the friction clutch (12) between its input and output sides from a detected value in an input side sensor (2) arranged on an input side power train from an engine (9) to the friction clutch (12) for obtaining parameters relating to the rotational speed of the input side power train, and from a detected value in an output side sensor (3) arranged on an output side power train from the friction clutch (12) to a wheel (or wheels) (15) for obtaining parameters relating to the rotational speed of the output side power train.



5369





(54) Title of the invention : "RUGGEDIZED RADIATION DETECTOR" (51) International classification :G01T1/20 (71)Name of Applicant : (31) Priority Document No :11/518,774 1)GENERAL ELECTRIC COMPANY (32) Priority Date :11/09/2006 Address of Applicant :ONE RIVER ROAD, (33) Name of priority country :U.S.A. SCHENECTADY, NEW YORK 12345, USA U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)JONES KEITH (87) International Publication No :NA 2)CLARKE LUCAS (61) Patent of Addition to Application Number :NA 3)PALMER BRIAN Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A radiation detector assembly 10 is provided. The radiation detector assembly 10 includes a radiation detector element 15 and a light detection element 27 operationally connected. The radiation detector element 15 is seated within a radiation detector housing 20. The radiation detector assembly 10 also includes a plurality of continuous wave formed springs 50 located along the outer periphery of the radiation detector element 15, radially between the housing 20 and the radiation detector element 15.



5370





(54) Title of the invention : ORAL PHARMACEUTICAL FORMULATION OF VALSARTAN AND USE THEREOF :A61K (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)JUBILANT ORGANOSYS LIMITED (32) Priority Date :NA Address of Applicant :PLOT 1A, SECTOR 16A, NOI8DA (33) Name of priority country :NA 201 301, UP, INDIA Uttar Pradesh India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)DANG, SHWETA (87) International Publication No :NA 2)SHAH, R. CHIRAG (61) Patent of Addition to Application Number :NA 3)KUMAR, P. MANOJ Filing Date :NA 4)BHASKAR, RAJESH (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention discloses a solid oral pharmaceutical formulation having a side aspect ratio of more than about 3.0 comprising valsartan or pharmaceutically acceptable salts thereof, optionally in combination with HCTZ and one or more pharmaceutically acceptable excipients, wherein said formulation is prepared by dry granulation using a compaction force of about 12 to 20 KN. The present invention further discloses that the said solid oral pharmaceutical formulation comprising valsartan is characterized by having lesser variation in bioavailability and better efficacy.



5371





(54) Title of the invention : "ANTENNA DEVICE FOR PORTABLE TERMINAL" (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country

:H01Q1/24 :10-20060084665 :04/09/2006 :Republic of Korea :NA :NA :NA :NA :NA :NA :NA

(71)Name of Applicant : 1)SAMSUNG ELECTRONICS CO.,LTD. Address of Applicant :416, MAETAN-DONG, YEONGTONG-GU, SUWON-SI, GYEONGGI-DO, REPUBLIC OF KOREA. Republic of Korea (72)Name of Inventor : 1)JOUNG-SUB SIN 2)YONG-JIN KIM 3)JAE-HO LEE 4)YOUNG-HWAN KIM

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : An antenna device for a portable terminal. The antenna device includes a carrier mounted in a housing of the portable terminal, at least one support extending from the carrier, a main radiator attached onto the carrier and an auxiliary radiator extending from the main radiator and fixed to ends of the supports while being spaced apart from the carrier. Since the antenna device includes the supports extending from the carrier to support the auxiliary radiator extending from the main radiator, the auxiliary radiator can be spaced apart from the carrier and the inner side of the housing of the portable terminal when the antenna device is mounted in the portable terminal. Thus, by reducing interference from a user"s body or structures in the housing of the portable terminal, stable radiation performance can be secured. Moreover, the shape of the carrier can be easily changed suitably for a slim portable terminal by supporting the auxiliary support using the supports, whereby the antenna device can be easily installed in a small mounting space in a compact and slim portable terminal and an effective area of the antenna device can be minimized and an antenna gain can be improved in the same size space.



5372





(54) Title of the invention : "METHOD FOR IMPPORTING DIGITAL RIGHTS MANAGEMENT DATA FOR USER DOMAIN" (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country

:G06F :10-20060079066 :21/08/2006 :Republic of Korea :NA :NA :NA :NA :NA :NA :NA

(71)Name of Applicant : 1)PANTECH CO.,LTD. Address of Applicant :PANTECH R&D CENTER,I-2,DMC SANGAM-DONG, MAPO-GU, SEOUL, REPUBLIC OF KOREA Republic of Korea 2)PANTECH&CURITEL COMMUNICATIONS,INC (72)Name of Inventor : 1)JEONG, SO-YOUNG 2)KIM, GUN-WOOK 3)PARK, KYUNG

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A method for importing Digital Rights Management (DRM) data converts non-Open Mobile Alliance (OMA) DRM data to OMA DRM data for a user domain in DRM solutions. The method includes registering a local rights manager (LRM) to a domain authority or a Rights Issuer and exchanging user domain information, and creating a DRM content format (DCF) and a rights object(RO) that conform to Open Mobile Alliance (OMA) DRM standard from non-OMA DRM data based on the user domain information. A method for using DRM data includes registering the LRM, creating DCF conforming to OMA DRM standard from non-OMA DRM data, creating an RO, and transferring the DCF and RO to a DRM agent of a device.



5373





(54) Title of the invention : "ETHERNET CHAINING NETWORK AND METHOD" (51) International classification :H04Q (71)Name of Applicant : (31) Priority Document No :11/515,025 1)GENERAL ELECTRIC COMPANY (32) Priority Date :05/09/2006 Address of Applicant :ONE RIVER ROAD, (33) Name of priority country :U.S.A. SCHENECTADY ,NEW YORK 12345 USA U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)NELSON MATTHEW ALLEN (87) International Publication No :NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A method for interconnecting modules using a local area network daisy chained architecture is disclosed. The architecture includes point-to-point connections between the module and the two modules preceding and/or the two modules following such module in the chain. This architecture allows the chain to be extended and for modules to be removed from the chain without interrupting service to the other modules. A microprocessor and additional Ethernet port provide an additional gateway for connection to an external device.



5374





(54) Title of the invention : IMAGE NAVIGATION DEVICE (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country

:H04N5/225; (71)Name of Applicant : G01C21/00 1)TEKOM TECHNOLOGIES, INC. :095215936 Address of Applicant :9FA., NO.150, JIANYI RD., JUNGHE :09/09/2006 CITY, TAIPEI, TAIWAN 235, R.O.C Taiwan :Chinese (72)Name of Inventor : Taipei 1)TIEN-CHIN TSAI :NA :NA :NA :NA :NA :NA :NA

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : na A navigation device obtains realtime coordinates of an image for positioning. Data of the image are then transferred by a terminal to be analyzed. A route is thus obtained for navigation between position of the image and position of the terminal. The navigation device is able to navigate without a pre-installed map; but by using a route data from the Internet.



5375





(54) Title of the invention : "METHOD AND SYSTEM FOR MANAGING OBJECTS IN A COMMUNICATION NETWORK" :H04 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)MOTOROLA, INC. (32) Priority Date :NA Address of Applicant :1303 E. ALGONQUIN ROAD, (33) Name of priority country :NA SCHAUMBURG, IL 60196, U.S.A. U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)ALEXANDR SMIRNOV (87) International Publication No :NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A method and system for managing one or more objects (102), (104), (106), (108), (110), and (112) in a communication network (100) is provided. The method includes determining (304) a time interval since a last message was received from an object of the one or more objects for at least one object of the one or more objects. The last message received by the at least one object is not a network monitoring message. The network monitoring message is used monitor status of the object. The method also includes determining (306) status of the object, based on the time interval and a threshold time.



5376





(54) Title of the invention : A NOVEL SOIL IMPROVING SYNERGISTIC COMPOSITION USEFUL FOR THE RECLAMATION OF DEGRADED LAND/SOIL


(71)Name of Applicant : :C04B 1)COUNCIL OF SCIENTIFIC & INDUSTRIAL 28/02 RESEARCH :NA Address of Applicant :ANUSANDHAN BHAWAN, RAFI :NA MARG, NEW DELHI-110001, INDIA Delhi India :NA (72)Name of Inventor : :NA 1)BEHL HARI MOHAN :NA 2)SINHA ARPITA :na 3)SINGH NANDITA :NA 4)KRISHNAPPA CHANDRASHEKAR :NA 5)SIDHU OM PRAKASH :NA 6)KUMAR VISHAL :NA 7)SHUKLA VINOD KUMAR

(57) Abstract : The invention provides an ecological method of reclamation of saline and alkaline soils using a novel organic composition consists of tobacco dust generated from tobacco industry and Jatropha cake generated by Bio-diesel industry after oil extraction. More particularly the invention relates to a method of using the effective amount of organic composition followed by proper irrigation and turning or ploughing the affected degraded soils. The method of the present invention can be adopted to reclaim saline and alkaline soils. Besides improving physical properties of soil it also enhances availability of nutrients present in soil. Plants grown on such soil show higher growth and are resistance to pest and disease attack. In addition being a source of organic matter it also stimulates the biotic activity of the soil. The method is cost efficient and well suited for ameliorating soil on a large scale commercial basis.



5377





(54) Title of the invention : AUTOMOTIVE HEADLIGHT MECHANICAL LEVELING DEVICE :B60Q1 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)GUPTA AMIT MAHIPAL (32) Priority Date :NA Address of Applicant :8, TARA NAGAR, CIVIL LINES, (33) Name of priority country :NA AJMER ROAD, JAIPUR Rajasthan India (86) International Application No :NA 2)GUPTA DHARAM PAL Filing Date :NA (72)Name of Inventor : (87) International Publication No :NA 1)GUPTA AMIT MAHIPAL (61) Patent of Addition to Application Number :NA 2)GUPTA DHARAM PAL Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to an automotive mechanical headlamp leveler which is used for aiming of headlamps of vehicles during night under adverse conditions such as rain , snow, storm etc. or while driving a automobile in hilly or zigzag roads. The invention helps the driver to have a visible illuminated road ahead of the vehicle for safe driving.



5378





(54) Title of the invention : SWAP PROCESS FOR INTERCHANGE AND TRAFFIC MANAGEMENT. (51) International classification

:E03B (71)Name of Applicant : 3/00 1)FANI BHUSHAN :NA Address of Applicant :C-4-F/215, Ground Floor, Janakpuri, :NA N.Delhi-110058 Delhi India :NA (72)Name of Inventor : :NA 1)FANI BHUSHAN :NA : NA :NA :NA :NA :NA

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : Flyovers and under passes at the traffic junctions have remained a long standing process for reduction of vehicular conflict points at intersections and thus obtaining a better flow of traffic. The fly over geometric designs and structural designs got innovations but no attempt at altering or innovating the process itself has been taken. In the given innovation the inter changes /or part of it are provided away from the intersection. Also the parts are detached. The most radical part is that the traffic of two sides of divided carriage ways are swapped with the help of a rotary or flyover or underpass etc. as required .the assimilated effect of such steps result in a process that is far more efficient and less land consuming. Not only has this it taken care of many other traffic related problems. The process introduced here will generate a new generation of interchange designs and traffic management techniques.



5379





(54) Title of the invention : "TEA BOILER" :B01 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)SAINI PREMSINGH BAKHTAWARSINGH (32) Priority Date :NA Address of Applicant :VILLAGE:- PASIYALA DISTRICT:(33) Name of priority country :NA AMBALA HARYANA, INDIA. Haryana India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)SAINI PREMSINGH BAKHTAWARSINGH (87) International Publication No :NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An electromechanical apparatus and method of operation thereof, comprising of a timer, an electronic switch, heating means, sensor means and heating mean control system further containing voice transmitters and solenoids wherein, when the electronic switch is made ON, the heating mean is ignited, the liquid boils, the sensors means senses the effect, so sensed effect is perceive by voice transmitters and transmitted to operator either in the form of speaking human voice in receiver-cum-speaker kept close him or a SMS (short service message) or voice message in a remote phone kept with the operator, like that "YOUR LIQUID IS BOILED", the solenoids simultaneously act to turn OFF the power supply to heating mean to stop further heating of the boiling appliance, so as to save time,labour and energy.



5380





(54) Title of the invention : TOPOSIOMERASE 6 GENES FROM RICE FOR CONFERRING STREES TOLERANCEIN PLANTS :C12N9/90 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)UNIVERSITY OF DELHI SOUTH CAMPUS, (32) Priority Date :NA INTERDISCIPLINARY CENTRE FOR PLANT GENOMICS (33) Name of priority country :NA & DEPARTMENT OF PLANT MOLECULAR BIO. (86) International Application No :NA Address of Applicant :UNIVERSITY OF DELHI SOUTH CAMPUS, BENITO JUAREZ ROAD, NEW DELHI-110 021, Filing Date :NA (87) International Publication No :NA INDIA. Delhi India (61) Patent of Addition to Application Number :NA (72)Name of Inventor : Filing Date :NA 1)KHURANA, JITENDRA PAUL (62) Divisional to Application Number :NA 2)TYAGI, AKHILESH KUMAR Filing Date :NA 3)JAIN, MUKESH (57) Abstract : The invention relates to isolation and characterization of cDNAs encoding topoisomerase 6 (TOP6) subunits A and B from rice (Oryza sativa ssp. indica). The invention further provides the transgenic plants over-expressing the topoisomerase genes, OsTOP6A3, OsTOP6B and OsTOP6Al and conferring the reduced sensitivity to abiotic stresses.



5381





(54) Title of the invention : "MISTING FAN" :B01F13/00 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)CHANG MAO-KUN (32) Priority Date :NA Address of Applicant :407, CHUNG-SHAN ROAD, TA-SHE, (33) Name of priority country :NA KAOHSIUNG HSEIN, TAIWAN, R.O.C. Taiwan (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)CHANG MAO-KUN (87) International Publication No :NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A misting fan mainly contains a fan device and a mist generation member. The fan device has an eccentric wheel mounted on the axle of the fan motor. The mist generation member, positioned at a side to the axle of the fan motor, has a piston against the rim of the eccentric wheel. As the fan motor spins, the eccentric wheel drives the piston into reciprocal motion which draws water into the mist generation member and pressurizes the water through a nozzle to produced water vapors. The water vapors are then blown into the air by the fan device so as to reduce the room temperature.



5382





(54) Title of the invention : "DISABLING OPERATION OF FEATURES ON A HANDHELD MOBILE COMMUNICATION DEVICE BASED UPON LOCATION" (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country

:H02M1/00 (71)Name of Applicant : :06119998.0 1)RESEARCH IN MOTION LIMITED :01/09/2006 Address of Applicant :295 PHILLIP STREET, WATERLOO, :EUROPEAN ONTARIO N2L 3W8, CANADA Canada UNION (72)Name of Inventor : :NA 1)BOCKING ANDREW DOUGLAS :NA 2)VANDEN HEUVEL DAVID :NA 3)PLESTID THOMAS LEONARD TREVOR :NA :NA :NA :NA

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : Methods and devices for implementing subsystem or functional aspect restrictions on a wireless handheld communication device. Data defining geographical boundaries of a restricted operating area is stored on the device. The present position of the device is ascertained and a determination is made whether the device is located within the restricted operating area. A restriction on the subsystem or functional aspect is imposed when it is determined the device is within the restricted operating area. The subsystem or functional aspect restriction can be communicated to the device via a wireless communication network. Additionally, the restrictions and boundaries can be communicated to the device as part of an IT security policy.



5383





(54) Title of the invention : "PROCESS FOR THE PREPARATION OF 3-AMINO-4-(ISOBUTYLAMINO) QUINOLINE" :A61K (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)RANBAXY LABORATORIES LIMITED. (32) Priority Date :NA Address of Applicant :12TH FLOOR, DEVIKA TOWER, 6, (33) Name of priority country :NA NEHRU PLACE, NEW DELHI - 19, INDIA. Delhi India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)SURESH BABU JAYACHANDRA (87) International Publication No :NA 2)JIGAR BHAKARBHAI SHAH (61) Patent of Addition to Application Number :NA 3)SAILU CHIGURU Filing Date :NA 4)CHANDRA HAS KHANDURI (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to a process for the preparation of 3-amino-4-(isobutylamino)quinoline compound. This compound serves as an intermediate for the preparation of 1-(2-methylpropyl)-1H-imidazo [4,5-c]quinoline-4-amine; an immune response modifier.



5384





(54) Title of the invention : A KIT FOR PROVIDING AN IMAGE ON A SUBSTRATE (51) International classification :H04N1/00 (71)Name of Applicant : (31) Priority Document No :11/535,618 1)JDS UNIPHASE CORPORATION (32) Priority Date :27/09/2006 Address of Applicant :430 N.McCARTHY BOULEVARD, (33) Name of priority country :U.S.A. MILPITAS, CA 95035 USA U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)ALBERTO ARGOITIA (87) International Publication No :NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A kit for producing optically variable images is disclosed wherein the kit includes a special effect pigment having particles that are magnetically alignable, a magnet for aligning the particles and a scribing tool for personalizing an image. Alternatively or in addition the kit can include e-field responsive flakes in a carrier vehicle and an electric field source for aligning said flakes. A stylus may be included for moving or changing the alignment of a portion of the flakes that have been aligned in the magnetic or electric field. Figure 1 is the representative Figure.



5385





(54) Title of the invention : "PROCESS FOR THE PURIFICATION OF NUCLEOSIDE ANALOGUES" :A61K (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)RANBAXY LABORATORIES LIMITED. (32) Priority Date :NA Address of Applicant :12TH FLOOR, DEVIKA TOWER, 6, (33) Name of priority country :NA NEHRU PLACE, NEW DELHI - 19, INDIA. Delhi India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)SANTOSH RICHHARIYA (87) International Publication No : NA 2)SURENDER DHINGRA (61) Patent of Addition to Application Number :NA 3)KAPTAN SINGH Filing Date :NA 4)MOHAN PRASAD (62) Divisional to Application Number :NA 5)JOYDEEP KANT Filing Date :NA (57) Abstract : The present invention relates to a process for the purification of nucleoside analogues which does not employ chromatographic techniques.



5386





(54) Title of the invention : "A HERBAL FORMULATION EFFECTIVE AGAINST COUGH AND PROCESS FOR PREPARATION THEREOF" (51) International classification :A61K (71)Name of Applicant : (31) Priority Document No :NA 1)THE DIRECTOR, CENTRAL COUNCIL FOR (32) Priority Date :NA RESEARCH IN UNANI MEDICINE (CCRUM) (33) Name of priority country :NA Address of Applicant :61-65, INSTITUTIONAL AREA, D(86) International Application No :NA BLOCK, JANAKPURI, NEW DELHI - 58, INDIA. Delhi India Filing Date :NA (72)Name of Inventor : (87) International Publication No :NA 1)MOHAMMAD KHALID SIDDIQUI (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : This invention relates to a herbal formulation effective against cough comprising of roots of Rubbus Soos (Glycyrrhiza glabra Linn.) 100-150 mg, seeds of Maghz Behidana (Cydonia oblonga Mill.) 100-150 mg, finely powdered Sugar 200-275 mg and further accorded to this invention there is provided a process for preparing the formulation comprising the step of 100-150 mg of dried roots of Rubbus soos, are taken and coarsely powdered and subjected to hydro-alcoholic (70:30) extraction by refluxing method and dry extract is prepared by evaporation under reduced pressure, 100-150 mg of dried Behidana seeds are coarsely powdered and subjected to hydro-alcoholic (70:30) extraction by refluxing method and dry extract is prepared by evaporation under reduced pressure, 200-275 gm sugar is finely powdered, Powder from step i, ii and iii are transferred to mass mixture, mixing the mixture for half hour to ensure thorough mixing, the total mass is transferred to the fluid bed drier for drying at 105°C for three hours, the dried mass is passed through granulator, granules so obtained are mixed with lubricants and preservative after thorough mixing, compressed in tableting machine to get tablets.



5387





(54) Title of the invention : "WIRELESS COMMUNICATION SYSTEM AND METHOD" (51) International classification :H04Q7/34 (71)Name of Applicant : (31) Priority Document No :60/842,675 1)INDUSTRIAL TECHNOLOGY RESEARCH (32) Priority Date :07/09/2006 INSTITUTE (33) Name of priority country :U.S.A. Address of Applicant :NO.195,SECTION 4,CHUNG HSING (86) International Application No :NA ROAD, CHUTUNG, HSINCHU, TAIWAN, REPUBLIC OF CHINA. China Filing Date :NA (87) International Publication No :NA (72)Name of Inventor : (61) Patent of Addition to Application Number :NA 1)LIN, TZU-MING Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A method for processing wireless data in a wireless communication network, the wireless communication network including a plurality of intermediary nodes and a plurality of destination devices. The method includes determining at least one transmission path to each of the plurality of intermediary nodes. The at least one transmission path includes data associated with every intermediary node along the at least one transmission path. The method also includes determining a transmission path identifier for each of the at least one transmission paths and sending transmission data to at least one destination device of the plurality of destination devices. The transmission data is sent based on at least one of the transmission path identifiers.



5388





(54) Title of the invention : "PROTECTIVE COATING CONTAINING ACETYLENE COMPOUND" (51) International classification (31) Priority Document No

:C23C22/28 (71)Name of Applicant : :20061)NISSIN CHEMICAL INDUSTRY CO.,LTD. Address of Applicant :17-33, KITAGO 2-CHOME, 243783 :08/09/2006 ECHIZEN-SHI, FUKUI-KEN, JAPAN. Japan :Japan (72)Name of Inventor : :NA 1)TORU MIZUSAKI :NA 2)NORIO NAKAMURA :NA 3)SHUICHIRO SHINOHARA :NA :NA :NA :NA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A protective coating is provided. This protective coating comprises a synthetic resin solid content (A); and a mixture of (B-l) acetylene glycol represented by the following general formula (1): and/or an ethoxylated derivative of the acetylene glycol represented by the following general formula (2): (B-2) at least one member selected from polyoxy(ethylene propylene) block polymers represented by the following formula (3) :



5389





(54) Title of the invention : "PROCESS FOR THE PREPARATION OF AMORPHOUS ATAZANAVIR OR SALT THEREOF " :A61K (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)RANBAXY LABORATORIES LIMITED. (32) Priority Date :NA Address of Applicant :12TH FLOR, DEVIKA TOWER, 6, (33) Name of priority country :NA NEHRU PLACE, NEW DELHI - 19, INDIA. Delhi India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)RAKESH SINGH (87) International Publication No : NA 2)MAHAVIR SINGH KHANNA (61) Patent of Addition to Application Number :NA 3)KESHAV DEO Filing Date :NA 4)MOHAN PRASAD (62) Divisional to Application Number :NA 5)JOYDEEP KANT Filing Date :NA (57) Abstract : The present invention relates to process for preparation of amorphous form of a HIV protease inhibitor compound which is atazanavir bisulfate.



5390





(54) Title of the invention : "CONTAINER FOR FORCED IRRIGATION, PARTICULARLY FOR OCULAR SURGERY INTERVENTION" (51) International classification :E02B13/02 (71)Name of Applicant : (31) Priority Document No :RM2006A000477 1)OPTIKON 2000 S.P.A. (32) Priority Date :11/09/2006 Address of Applicant :VIA DEL CASALE DI SETTEBAGNI (33) Name of priority country :Italy 13-00138 ROME, ITALY. Italy (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)ANGELINI GIAMPIERO (87) International Publication No :NA 2)LONGO DARIO (61) Patent of Addition to Application Number :NA 3)DI FLORIO ARMANDO Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to a container (1) for forced irrigation, particularly for ocular surgery intervention, comprised of three elements (2, 3, 4), provided side by side, coupled each other along their perimetral edge, so as to realise a first (5) and a second (6) pocket, said pockets (5, 6) being provided with independent substance introduction and withdrawal means (8, 9), contents of the two pockets (5, 6) not being physically in communication each other.



5391





(54) Title of the invention : AN IMPROVED ANAEROBIC REACTOR FOR EFFICENT WASTEWATER TREATMENT AND BIOGAS RECOVERY (51) International classification


(71)Name of Applicant : 1)COUNCIL OF SCIENTIFIC & INDUSTRIAL RESEARCH Address of Applicant :ANUSANDHAN BHAWAN, RAFI MARG, NEW DELHI-110 001, INDIA. Delhi India (72)Name of Inventor : 1)BODKHE SANDEEP YESHWANT

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The invention relates to an anaerobic reactor for efficient wastewater treatment and biogas recovery. This reactor is successful in promoting efficient and consistent performance by virtue of its capability to maintain sufficient quantum of viable biomass and rigorous mixing conditions enabling maximum contact of wastewater with biomass in the system ensuring efficient substrate biodegradation. In the proposed reactor configuration the arrangement of chambers is made in an innovative way so that the preliminary, primary and biological treatment operations/processes take place in the same reactor vessel under anaerobic conditions. The simultaneous occurrence of the different processes yield improved performance efficiency of the reactor at lower hydraulic retention time making the treatment economical.



5392





(54) Title of the invention : ROTARY WRENCHING TOOL WITH A DRIVING HEAD (51) International classification


(71)Name of Applicant : 1)CHENG CHIN-SHUN Address of Applicant :NO. 4, LANE 326, PENG-YI RD, TAIPING CITY, TAICHUNG HSIEN, TAIWAN, REPUBLIC OF CHINA. China (72)Name of Inventor : 1)CHENG CHIN-SHUN

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : This invention relates to a driving head of rotary wrenching tools, the driving head can be a sleeve or directly implemented on the wrench, the driving head has an opening with grooves, forefront surfaces and concavities implemented inside the opening, the forefront surfaces are implemented individually in-between the grooves, and one concavity is implemented on each forefront surface, with which varieties of work pieces in different shapes can be tightly fitted into.



5393





(54) Title of the invention : "A REED-SOLOMON METHOD, DECODER, AND RECEIVER " :H03M13/00 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)MOTOROLA, INC. (32) Priority Date :NA Address of Applicant :1303 E. ALGONQUIN ROAD, (33) Name of priority country :NA SCHAUMBURG, IL 60196, U.S.A. U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)RAGHAVENDRA PRASAD N. (87) International Publication No :NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A Reed-Solomon (RS) decoder and a method are provided for decoding an RS-encoded code word, which comprises n code symbols. The RS decoder includes a processor (304), a buffer (306), and a modn look-up table (310). The decoding includes calculation of the syndromes by using the processor (304), the buffer (306), and the modn look-up table (310). The processor (304) is coupled to the modn lookup table (310) and calculates n sums. Each sum is based on the n code symbols and is input to the modn look-up table (310), which then outputs a remainder. This remainder is based on the division of each sum by n. Thereby, n remainders are obtained that correspond to the n sums. The buffer (306) can store n buffer values. These n remainders arc then stored in the corresponding n buffer values, for use during the next iteration for calculating the next syndrome. At ith iteration, the Galois field sum of n buffer values gives the ith syndrome.



5394





(54) Title of the invention : AN IMPROVED TAP WATER ALARM (51) International classification :F16K37/00 (71)Name of Applicant : (31) Priority Document No :NA 1)DHEERAJ BHATT (32) Priority Date :NA Address of Applicant :70-C, POCKET-2, SECTOR-6, DWARKA NEW DELHI-110075. Delhi India (33) Name of priority country :NA (72)Name of Inventor : (86) International Application No :NA Filing Date :NA 1)DHEERAJ BHATT (87) International Publication No :NA (61) Patent of Addition to Application Number :609/DEL/2004 Filed on :29/03/2004 (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Improved tap water alarm has a bell unit and corresponding activating unit. The activating unit in a preferred embodiment consists of a small water container inside a housing where in the incoming fluid gets collected. A float, sliding inside a cylinder is held vertically inside this container. When fluid gets collected in the container the float rises up from its normal position and closes a set of contacts which in turn close a series circuit between a battery and a limited range radio transmitter, transmitting a signal to cause operation of the bell unit. A modification of the instant invention includes a bell or buzzer directly mounted on the activating unit in place of radio transmitter to form a non-remote tap water alarm apparatus.



5395





(54) Title of the invention : "A SYSTEM AND METHOD FOR ALIGNING AND SEALING A TURBINE SHELL ASSEMBLY" :F01D11/00 (71)Name of Applicant : (51) International classification (31) Priority Document No :11/533,159 1)GENERAL ELECTRIC COMPANY (32) Priority Date :19/09/2006 Address of Applicant :ONE RIVER ROAD, (33) Name of priority country :U.S.A. SCHENECTADY, NEW YORK 12345, USA. U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)HAMLIN MICHAEL THOMAS (87) International Publication No :NA 2)MONTGOMERY MICHAEL EARL (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Disclosed is a system (10) for aligning and sealing a turbine shell assembly an first shell assembly (12) including at least one first shell segment (14a-b), a second shell assembly (20) including a tongue (18) extending therefrom, a groove (16) defined by the first shell assembly (12), the groove (16) configured to mate with the tongue (18) extending from the second shell assembly (20), at least one key structure (28) disposable in the groove (16), the at least one key structure (28) being associable with at least one surface (21) of the at least one first shell segment (14a-b), and at least partially scalable with a sealing surface (21) of the tongue (18), and a tapered surface (26) of the groove (16) that is associable with at least a portion of the at least one key structure (28).



5396





(54) Title of the invention : "A NOVEL HERBAL COMPOSITION AND A PROCESS FOR PREPARATION THEREOF EFFECTIVE AGAINST GENERAL WEAKNESS " (51) International classification :A61K (71)Name of Applicant : (31) Priority Document No :NA 1)CENTRAL COUNCIL FOR RESEARCH IN UNANI (32) Priority Date :NA MEDICINE (33) Name of priority country :NA Address of Applicant :61-65, INSTITUTIONAL AREA, D(86) International Application No :NA BLOCK JANAKPURI, NEW DELHI - 110058, INDIA. Delhi Filing Date :NA India (87) International Publication No :NA (72)Name of Inventor : (61) Patent of Addition to Application Number :NA 1)MOHAMMAD KHALID SIDDIQUI Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : This invention relates to a novel herbal composition effective against general weakness comprising of for example 75-85 mg of Kuchla Mudabbar (Shiyahnos mix-vomica Linn.), 70-85 mg ofQaranfal (Syzygium aramaticum Merr.), 70-85 mg of Ood Saleeb (Faeonia officinals Linn.), 70-85 mg of Darchini (Cinnamomum zeylanicum Blume.), 70-90 mg of Jauzbuwa (Myristiaca fragrans Hautt.) and 75-90 mg of Bisbasa (Myristica fragrans Hautt.). Further this invention also relates to a process for preparation of a. novel herbal composition effective against general weakness comprising steps of:- detoxification of Kuchla seeds followed by pulverization forming first part, - pulverization of Qaranfal (Syzygium aramaticum Merr.), Ood Saleeb (Faeonia officinals Linn.), Darchini (Cinnamomum zeylanicum Blume.), Jauzbuwa (Myristiaca fragrans Hautt.) and Bisbasa (Myristica fragrans Hautt.) forming second part, and -mixing of both parts thus obtained which is subjected to drying.



5397





(54) Title of the invention : A SUPRAMOLECULAR FLUORESCENT MARKER FOR THE DETECTION AND QUANTIFICATIONOF GTP AND ATP IN BUFFER AND BIOLOGICAL FLUIDS (51) International classification :C07H (71)Name of Applicant : (31) Priority Document No :NA 1)COUNCIL OF SCIENTIFIC & INDUSTRIAL (32) Priority Date :NA RESEARCH (33) Name of priority country :NA Address of Applicant :ANUSANDHAN BHAWAN, RAFI (86) International Application No :NA MARG, NEW DELHI-110001, INDIA. Delhi India Filing Date :NA (72)Name of Inventor : (87) International Publication No :NA 1)DANABOYINA RAMAIAH (61) Patent of Addition to Application Number :NA 2)PRAKASH P. NEELAKANDAN Filing Date :NA 3)MAHESH HARIHARAN (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention provides a supramolecular fluorescent marker comprising of a cyclic conjugate containing two aryl groups, one of which is anthracene, linked together by suitable spacer moieties, represented by Formula 1 and highly fluorescent indicator HPTS, for the detection and quantification of GTP and ATP under physiological pH conditions and in biological fluids. This supramolecular marker is highly soluble in aqueous medium, extremely stable in the dark and under irradiation conditions and exhibit favorable absorption and fluorescence emission properties. The cyclic conjugate of Formula 1 forms an effective complex with the highly fluorescent indicator; HPTS resulting in the formation of a supramolecular marker. The supramolecular marker thus formed is found to be effective in differentiating selectively GTP and ATP from other nucleotides and recognizes GTP and ATP through "turn-on" fluorescence mechanism. Accordingly, the supramolecular marker comprising of cyclic conjugate with the general Formula 1 and the fluorescent indicator, HPTS, is extremely useful as a visual fluorescent marker for the detection and quantification of GTP and ATP under physiological pH conditions and in biological fluids.



5398





(54) Title of the invention : SUPER FAST CONSTRUCTION SYSTEM. :E04B (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)SURESH CHAWLA (32) Priority Date :NA Address of Applicant :B-1/411, Janak Puri, New Delhi-110058 (33) Name of priority country :NA Delhi India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)SURESH CHAWLA (87) International Publication No :NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : This invention relates to providing a system which can deliver constructions at super fast speed as compared to present systems which take long time and process of construction is labor oriented and cumbersome, the super fast construction system characterized as one Which uses frames or structures made out of light weight or heavy steel sections as per requirements of the design of construction, the panels are joined by appropriate means to create out lines of actual construction structure , the panels carry all reinforcement in the frames as per design, the panels also have all the concealed items like concealed electric conduits, G.I. Pipes, rain water pipes, door window frames, other services as required at appropriate positions, the frames have nuts bolts attached to the frames which can join or attach the frames as well as shuttering sheets or plates to the frame. The thickness of the bolt provides space between the frame and the shuttering plates or sheets to act as cover for the frames when the cement concrete mix is filled manually or by machines after all frames are in place for all the items of construction like wall frames, foundation frames and roof frames etc as per thickness and dimensions, the frames get merged with the construction once cement concrete mix is poured and only shuttering and scaffolding sheets or plates are removed, once one level of construction is over another level is initiated by again joining the frames after curing period.



5399





(54) Title of the invention : "FILM SCANNER AND DETECTION APPARATUS THEREFOR" (51) International classification (31) Priority Document No

:H04N1/00 (71)Name of Applicant : :10 2006 1)THOMSON LICENSING 043956.2 Address of Applicant :46, QUAI A.LE GALLO, 92100 :14/09/2006 BOULOGNE-BILLANCOURT, FRANCE France :Germany (72)Name of Inventor : :NA 1)ANDREAS LOEW :NA :NA :NA :NA :NA :NA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A detection apparatus for detecting perforation holes (3) of a cinematographic film (1) comprises at least one light source (6, 6", 6""), at least one scanning sensor (7, 7", 7""), which is arranged so as to receive light (8) emitted by the light source (6, 6", 6"") after interaction with a perforation zone of the film (1), and an evaluation circuit (13, 14; 13, 13", 14, 16; 13"", 14"") for detecting, by means of an output signal (L) of the scanning sensor (7, 7", 7""), when an edge of a perforation hole (3) passes through between light source (6, 6", 6"") and scanning sensor (7, 7", 7""). The light source (6, 6", 6"") emits light which is polarized with a first polarization and the scanning sensor (7, 7", 7"") is sensitive selectively to light with a second polarization.



5400





(54) Title of the invention : "A GROWTH PROMOTER USED FOR CALVES AND A PROCESS FOR PREPARATION THEREOF" (51) International classification

:A24B15/10; A24B15/00 :NA :NA :NA :NA :NA :NA :NA :NA :NA :NA

(71)Name of Applicant : 1)G.B. PANT UNIVERSITY OF AGRICULTURE AND TECHNOLOGY Address of Applicant :PANTNAGAR-263 145, UNIVERSITY OF UTTARANCHAL INDIA. Uttaranchal India (72)Name of Inventor : 1)RAJAN KUMAR TRIPATHI 2)S.S. CHAUHAN 3)R.J. SHARMA

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : "A growth promoter used for calves and a process for preparation thereof. This invention relates to a growth promoter used for calves and a process for preparation thereof. The growth promoter comprising of condensed urine/condensed urine having a herbal additive wherein the herbs are selected from KRishnasariva, Mugdaparni and Ashwagandha. New born corssbred calves were tested for growth, with cow urine collected from heifers i.e. before calving of indigenous breed of Sahiwal. Significant weight gains were obtained in the claves after 100 days of treatment. This significant weight gain results in faster growth of calves and early maturity which is an advantage for early lactation and meat purposes. This growth promoter is effective in enhancing growth of calves of any breed.



5401





(54) Title of the invention : "METHODS AND APPARATUS FOR FABRICATING TURBINE ENGINES" :F01D5/28; (71)Name of Applicant : (51) International classification (31) Priority Document No :11/534,434 1)GENERAL ELECTRIC COMPANY (32) Priority Date :22/09/2006 Address of Applicant :ONE RIVER ROAD, (33) Name of priority country :U.S.A. SCHENECTADY, NEW YORK 12345, USA. U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)MOORS THOMAS MICHAEL (87) International Publication No :NA 2)WILLIAMS DAVID SCOTT (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An airfoil bucket (46) for a turbine engine (10) is provided. The airfoil bucket (46) includes a tip shroud (60) extending from the airfoil, and at least one cutter tooth (80) extending from the tip shroud, the at least one cutter tooth is fabricated from a material configured to wear away during operation of the turbine engine.



5402





(54) Title of the invention : ROTABLE BUILDING STRUCTURE (51) International classification

:E04B5/18; (71)Name of Applicant : E04B5/10 1)LAURA MICOL FISHER :NA Address of Applicant :VIA CAPO DI MONDO 25 50100 :NA FLORENCE ITALY Italy :NA (72)Name of Inventor : :NA 1)DAVID H. FISHER :NA : NA :NA :NA :NA :NA

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A rotatable building structure contains a vertical central core for supporting suspended floor units surrounding the core. An annular platform extends from the core at corresponding floor units for providing accessibility to and from the central core. The floor units contain a drive mechanism for rotational displacement. The wind load on the exterior side of each floor, and/or horizontal wind mill that turn around the core but is a separate part of the floor itself, solar panels situated as a roof cover on top of each floor and A wind tool deployable from the floor unit provides alternative wind power assist for rotating the floor units.



5403





(54) Title of the invention : "METHOD AND SYSTEM FOR DEVELOPING GEOGRAPHIC INFORMATION WEB SERVICE FRAMEWORK" (51) International classification :G06F19/00 (71)Name of Applicant : (31) Priority Document No :NA 1)RMSI PVT. LTD. (32) Priority Date :NA Address of Applicant :A-7, Sector-16, Noida 201 301, India. (33) Name of priority country :NA Uttar Pradesh India (72)Name of Inventor : (86) International Application No :NA Filing Date :NA 1)PUNEET SHARMA (87) International Publication No :NA 2)MUDIT BOHRA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A method, a system and a computer program product developing a geographic Information System (GIS) web service framework for a user is provided. The method includes developing the GIS web service framework using a database that comprises spatial data. Further, the GIS web service framework provides a GIS web service to the user. A GIS function is incorporated with the GIS web service. The user accesses the GIS function using this GIS web service.



5404





(54) Title of the invention : "SHUT-OFF VALVE FOR CONTROLLING THE FLOW RATE OF A FUEL PUMP FOR AN INTERNAL COMBUSTION ENGINE" (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country

:F02D41/00 (71)Name of Applicant : :06425612.6 1)MAGNETI MARELLI POWERTRAIN S.p.A. :04/09/2006 Address of Applicant :20011 CORBETTA (ITALY)VIALE :EUROPEAN ALDO BORLETTI, 61/63 Italy UNION (72)Name of Inventor : :NA 1)SANDRA RANALDO :NA 2)PASQUALE DRAGONE :NA 3)ANDREA COBIANCHI :NA :NA :NA :NA

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A shut-off valve (21) of the flow rate of a fuel pump (6) for an internal combustion engine (2); the shut-off valve (21) is provided with: a tubular cylindrical body (25), which is closed on top, displays a cylindrical seat (26), the lower portion of which performs the function of fuel pipe, and comprises a number of radial through holes (27) to allow the introduction of fuel within the cylindrical seat (26); a lower plate (28), which is arranged within the tubular cylindrical body (25) and underneath the radial holes (27) and has a central through hole which defines an outlet opening (24) of the fuel; and a cylindrical shutter (29), which is coupled to the lower plate (28) and is mobile between an open position, in which the outlet opening (24) is in communication with the radial holes (27), and a closed position, in which the outlet opening (24) is isolated from the radial holes (27).



5405





(54) Title of the invention : HYDRAULICALLY ASSISTED GEARSHIFT :B60W10/10 (71)Name of Applicant : (51) International classification (31) Priority Document No :0617365.2 1)J.C. BAMFORD EXCAVATORS LIMITED (32) Priority Date :02/09/2006 Address of Applicant :ROCESTER, UTTOXETER, (33) Name of priority country :U.K. STAFFORDSHIRE ST14 5JP, UK. U.K. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)WRIGHT, THOMAS OWEN (87) International Publication No :NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A power-assisted gearshift mechanism for a manual transmission, comprising, a shift rail mounted for axial movement to select one or more gears, a control arm engageable with the shift rail to cause axial movement of the shift rail in response to operation of a operator control, and a fluid pressure actuator, the fluid pressure actuator comprising a piston moveable in a cylinder, wherein fluid pressure in the cylinder causes force to be applied to the shift rail, the cylinder having a fluid supply connection and a fluid exit connection, and wherein the fluid exit connection is closeable to cause the fluid pressure within the cylinder to change, and the fluid exit connection comprising a bore within the shift rail, wherein movement of the control linkage is operable to open or close the bore.



5406





(54) Title of the invention : "SLIDING ELEMENT PROCEDURE AND DEVICE FOR ITS PRODUCTION" (51) International classification (31) Priority Document No

:A61F2/38 (71)Name of Applicant : :10 2006 1)FEDERAL-MOGUL DEVA GMBH 043 Address of Applicant :SCHULSTRASSE 20, 35260 065.443 STADTALLENDORF, GERMANY. Germany :14/09/2006 (72)Name of Inventor : :Germany 1)UDO ROOS :NA 2)KAMRAN LAAL RIAHI :NA 3)ARMIN LINKER :NA :NA :NA :NA :NA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The invention relates to a method and a device for producing a flat or arc-shaped sliding element with a very large radius of curvature. The sliding element has a sliding layer based on a fibre reinforced plastic with a plastic matrix and a reinforcing element containing at least one thread (36). The reinforcing element is deposited on a polygonal winding core (12) by means of a guide (24) with the addition of a synthetic resin forming the plastic matrix. The flat or arc-shaped segments formed between the edges are separated from the tubular, polygonal winding body thus formed after it has set. The invention also relates to a sliding element produced by this method.



5407





(54) Title of the invention : "PLASTIC GLIDE LAYER AND SLIDING ELEMENT WITH SUCH" (51) International classification (31) Priority Document No

:B32B1/08 (71)Name of Applicant : :10 2006 1)FEDERAL-MOGUL DEVA GMBH 043 Address of Applicant :SCHULSTRASSE 20, 35260 065.443 STADTALLENDORF, GERMANY. Germany :14/09/2006 (72)Name of Inventor : :Germany 1)UDO ROOS :NA 2)KAMRAN LAAL RIAHI :NA 3)ARMIN LINKER :NA :NA :NA :NA :NA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The invention relates to a sliding layer (22) and a sliding element (20) with such a sliding layer (22) based on a fibre reinforced plastic with a plastic matrix and a plastic thread (10) as a reinforcing element. The plastic thread (10) has polyester filaments (12) into which are worked PTFE particles (14) by process engineering.



5408





(54) Title of the invention : "UNIVERSAL JOINT BEARING WITH PLASTIC OUTER RING AND PROCEDURE FOR ITS PRODUCTION" (51) International classification (31) Priority Document No

:F16D3/16 (71)Name of Applicant : :10 2006 1)FEDERAL-MOGUL DEVA GMBH 043 Address of Applicant :SCHULSTRASSE 20, 35260 065.443 STADTALLENDORF, GERMANY. Germany :14/09/2006 (72)Name of Inventor : :Germany 1)KAMRAN LAAL RIAHI :NA 2)AUGUST STADLMAYR :NA :NA :NA :NA :NA :NA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The invention relates to an outer race for a rocker bearing with an internal sliding layer and an external support layer, wherein the sliding layer and the bearing layer are formed from a wound composite fibre material. The outer race is identified by exactly one parting line. The invention also relates to a rocker bearing with such an outer race and a method for its production, in which a sliding layer and a support layer of synthetic resin impregnated fibres are wound in succession onto a winding mandrel, and outer races are formed after setting on the winding body thus produced. The sliding layer and the support layer are wound according to the invention onto a cylindrical winding mandrel, the outer race is provided with exactly one parting line opening it, and sliding layer material on its inside is removed to such an extent that a partially spherical contour is obtained for receiving a complementary inner race.



5409





(54) Title of the invention : "METHOD AND APPARATUS FOR CONTROLLING THE OPERATION OF A STEAM TURBINE" (51) International classification :F01D1/00 (71)Name of Applicant : (31) Priority Document No :11/534,170 1)GENERAL ELECTRIC COMPANY (32) Priority Date :21/09/2006 Address of Applicant :ONE RIVER ROAD, (33) Name of priority country :U.S.A. SCHENECTADY, NEW YORK 12345 USA U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)BURDGICK STEVEN SEBASTIAN (87) International Publication No :NA 2)FROLOV BORIS IVANOVITCH (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A steam turbine (10) is provided. The steam turbine (10) includes a rotor and a plurality of bucket stages (46) coupled to the rotor, each bucket stage including a plurality of circumferentially spaced buckets coupled to the rotor, and each bucket including a base portion and a tip portion (72). The steam turbine (10) further includes a diaphragm assembly (50) surrounding the rotor and the bucket stages, and an outer casing (22) disposed about the rotor and diaphragm assembly. The diaphragm assembly includes a plurality of nozzle stages (44) located between the bucket stages and a circumferentially extending groove (54), the groove located upstream of one of the bucket stages and between the bucket stage and an adjacent nozzle stage. The diaphragm assembly further includes a circumferentially extending extraction chamber (56) and at least one first bore (58) extending from the groove to the extraction chamber, the at least one first bore providing fluid communication between the groove and the extraction chamber. The diaphragm assembly further includes at least one second bore (60) extending from the extraction chamber through an outer surface (62) of the diaphragm assembly, the at least one second bore providing fluid communication between the extraction chamber and an area between the outer surface of the diaphragm assembly and the outer casing.



5410





(54) Title of the invention : A PROCESS FOR THE PREPARATION OF LOW SOUR PULP FROM HIGHLY ACIDIC FRUITS USEFUL FOR PREPARATION OF FOOD PRODUCTS (51) International classification :A23L (71)Name of Applicant : (31) Priority Document No :NA 1)COUNCIL OF SCIENTIFIC & INDUSTRIAL (32) Priority Date :NA RESEARCH (33) Name of priority country :NA Address of Applicant :ANUSANDHAN BHAWAN, RAFI (86) International Application No :NA MARG, NEW DELHI-110001, INDIA Delhi India :NA (72)Name of Inventor : Filing Date (87) International Publication No :NIL 1)SILA BHATTACHARYA (61) Patent of Addition to Application Number :NA 2)MUKUNDA BALASARASWATHI Filing Date :NA 3)SUVENDU BHATTACHARYA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A process for the removal of excess sourness from highly acidic fruit pulps to make them suitable for confectionery products has been described. Usually, high sour fruit pulps from tamarind, gooseberry and kokkum are widely used as a souring agent in curries, sauces, chutneys and certain beverages. Because of high sourness in the pulp (pH about 1.5 to 2.5), it is difficult to make confectionery products like jam/jelly, fruit bar and paste with appropriate sourness and pleasant natural fruit flavour. In the present invention, blocking and buffering agents were used to prepare low sour fruit pulp and extract that can be used in developing food products with an attractive texture/consistency and natural taste.



5411





(54) Title of the invention : A DEVICE FOR MEASURING ROOF CONVERGENCE IN UNDER-GROUND COAL MINES/TUNNELS (51) International classification :E21F5/00 (71)Name of Applicant : (31) Priority Document No :NA 1)COUNCIL OF SCIENTIFIC & INDUSTRIAL (32) Priority Date :NA RESEARCH (33) Name of priority country :NA Address of Applicant :ANUSANDHAN BHAWAN, RAFI MARG, NEW DELHI-110001, INDIA. Delhi India (86) International Application No :NA Filing Date :NA (72)Name of Inventor : (87) International Publication No : NA 1)KUSHWAHA ANGAD (61) Patent of Addition to Application Number :NA 2)KASHYAP SUDHIR KUMAR Filing Date :NA 3)SINGH SATYENDRA KUMAR (62) Divisional to Application Number :NA 4)TIWARI SUBHASHIS Filing Date :NA 5)BHATTACHARJEE RANA (57) Abstract : The device consists of a vertical holding frame, which has means for fixing on the vertical side of a mine tunnel roadway wall / pillar. A horizontal frame is movably fixed at the bottom of the vertical frame by means of a bolt in such a manner as to allow the horizontal frame to freely swing horizontally for alignment. The horizontal frame has a slot in which a graduated vertical scale can move freely. A free swinging link rod of fixed length is hinged at one end to the horizontal frame. The other end of the hinged link rod is provided with a socket head. To this socket one end of a length adjustable graduated extension rod such as a telescopic extension rod is removably fixed. The other end of the telescopic rod is provided with means such as a nearly L-shaped socket head which can be fixed in the mine tunnel roof. The device enables easy and economical measuring of convergence of the roof in a mine tunnel, quickly and accurately.



5412





(54) Title of the invention : A PCR BASED METHOD FOR DETECTION AND IDENTIFICATION OF VEGETATIVE INSECTICIDAL PROTEIN [VIP] GENE


(71)Name of Applicant : 1)COUNCIL OF SCIENTIFIC & INDUSTRIAL :C12Q1/68 RESEARCH :NA Address of Applicant :ANUSANDHAN BHAWAN, RAFI :NA MARG, NEW DELHI-110001, INDIA. Delhi India :NA 2)INTERNATIONAL CENTER FOR GENETIC :NA ENGINEERING & BIOTECHNOLOGY :NA 3)DEPARTMENT OF BIOTECHNOLOGY, MINISTRY :NA OF SCIENCE AND TECHNOLOGY GOVERMENT OF :NA INDIA :NA (72)Name of Inventor : :NA 1)KACHRU DEVENDRA NATH :NA 2)SINGH CHANDRA KUMAR 3)OJHA ABHISHEK 4)BHATNAGAR, RAJ KAMAL

(57) Abstract : The present invention deals with detection of vip gene expressing vegetative insecticidal protein in genetically modified organisms and in natural isolates of Bacillus thuringiensis by PCR assay. The present invention involves using a PCR assay, using a novel set of primer pairs, under optimal conditions, for the detection of vip gene in genetically modified (GM) plants or food or food products, natural isolates of Bacillus thuringiensis, for screening of new vip bearing Bt isolates and their recombinant clones.



5413





(54) Title of the invention : "HEAT-STABLE ANION EXCHANGERS" (51) International classification (31) Priority Document No

:G21F9/30 (71)Name of Applicant : :10 2006 1)LANXESS DEUTSCHLAND GMBH 045 504.5 Address of Applicant :D-51369 LEVERKUSEN, GERMANY :27/09/2006 Germany :Germany (72)Name of Inventor : :NA 1)PIERRE VANHOORNE :NA 2)WOLFGANG PODSZUN :NA 3)REINHOLD KLIPPER :NA 4)MICHAEL SCHELHAAS :NA :NA :NA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The present invention relates to heat-stable anion exchangers based on at least one aromatic monomer and at least one crosslinker having structural elements of the general formula whereAk, Ak", Ak" are in each case independently of one another identically or differently a alkyl radicalis an even number between 5 and 18, X is Cl, Br, OH, HCO,, HSO4, 1/2 (SO4), "/a CO3, N03, F, H2PO4, 1/2 HPO4, "/3 P04 with the result that these anion exchangers, preferably in the OH form, withstand a working temperature of at least 60°C, preferably of at least 80°C, over a relatively long time, a process for production thereof and also use thereof.



5414





(54) Title of the invention : "UN-BREAKABLE NECK ROAD-SIDE DELINEATORS". :G09F (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)RAMESH CHANDER VARMA (32) Priority Date :NA Address of Applicant :R/O H.NO. 852, SECTOR -8, (33) Name of priority country :NA PANCHKULA-134109, HARYANA, INDIA Haryana India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)RAMESH CHANDER VARMA (87) International Publication No :NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : This invention particularly relates to road-side delineators equipped with glowing/reflective head-devices mostly made from plastic mouldings over steel pipe posts.



5415





(54) Title of the invention : METHOD AND APPARATUS FOR CONFORMING INTEGRITY OF A CLIENT DEVICE (51) International classification

:H04L 1/00 :NA :NA :NA :NA :NA : NA :NA :NA :NA :NA

(71)Name of Applicant : 1)MOTOROLA INC. Address of Applicant :1303 E. ALGONQUIN ROAD, SCHAUMBURG IL 60196, UNITED STATES OF AMERICA U.S.A. (72)Name of Inventor : 1)JOHN D. BRUNER 2)VENU M. CHUKKAPALLI

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The present invention describes a method for conforming integrity of a client device (106). The method includes receiving (304) a trusted token. The trusted token can identify an integrity state of the client device, wherein the integrity state comprises a first value capable of identifying a set of integrity measurements. Further, the method includes storing (306) the trusted token. Furthermore, the method includes transmitting (308) the trusted token during a network access attempt.



5416





(54) Title of the invention : "SYSTEMS AND METHODS FOR BALANCING OF DC LINK IN THREE LEVEL PWM POWER CONVERSION EQUIPMENT" (51) International classification :H02M (71)Name of Applicant : (31) Priority Document No :11/535,954 1)GENERAL ELECTRIC COMPANY (32) Priority Date :27/09/2006 Address of Applicant :1 RIVER ROAD, SCHENECTADY, (33) Name of priority country :U.S.A. NEW YORK 12345, USA. U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)RITTER ALLEN MICHAEL (87) International Publication No :NA 2)D'ATRE JOHN DOUGLAS (61) Patent of Addition to Application Number :NA 3)HARBOURT CYRUS DAVID Filing Date :NA 4)BEDIA RAFAEL LGNACIO (62) Divisional to Application Number :NA 5)BEDIA RAFAEL IGNACIO Filing Date :NA (57) Abstract : A power converting apparatus and method providing for the addition of a fourth power connection wire to the neutral point of the normal three phase load circuit (105). This allows delivery of combined current from the center of the DC link voltage to load. The added control enables a third harmonic injection to flow and allows for increased power rating per peak amp handled by the conversion system. Limiting of faults to the positive half versus the negative half of the DC system allows for more robust behavior when encountering these fault conditions.



5417





(54) Title of the invention : "SELF MIXED ANAEROBIC DIGESTER FOR THE TREATMENT OF ORGANIC SOLID WASTE" :C02F (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)COUNCIL OF SCIENTIFIC AND INDUSTRIAL (32) Priority Date :NA RESEARCH (33) Name of priority country :NA Address of Applicant :ANUSANDHAN BHAWAN, RAFI (86) International Application No :NA MARG, NEW DELHI - 110 001, INDIA. Delhi India Filing Date :NA (72)Name of Inventor : (87) International Publication No :NA 1)ANUPOJU GANGAGNI RAO (61) Patent of Addition to Application Number :NA 2)JOHNY JOSEPH Filing Date :NA 3)SUNKAVALLI SURYA PRAKASH (62) Divisional to Application Number :NA 4)ANNAPURNA JETTY Filing Date :NA 5)PONNAPALLI NAGESWARA SARMA (57) Abstract : Application of anaerobic digestion for the treatment of organic solid waste is increasing as the methane and bio-manure can be generated as by-products. Presently, anaerobic digestion is being carried out in conventional batch type digesters in which HRT is high, solid loading rate is low, scum formation is severe and these could not be scaled up beyond a certain level. In this context, a simple, reliable, inexpensive and efficient anaerobic digester known as Self Mixing Anaerobic Digester (SMAD) for treating organic solid wastes is developed. It is based on mixing of slurry in the digester due to the pressure developed by biogas produced in the digester. Solid organic wastes are treated at an HRT of 15 days, with 50% VS reduction and TS loading rates of 6.7 kg TS/ m3.day using the SMAD. The main advantages of the SMAD are possibility for scaling upto any level, elimination of scum formation, increase in the biogas production and methane content of the biogas.



5418





(54) Title of the invention : 'DIGITAL RADIO FREQUENCY (RF) MODULATOR (51) International classification

:C07D 239/94 :NA :NA :NA :NA :NA :NA :NA :NA :NA :NA

(71)Name of Applicant : 1)STMICROELECTRONICS PVT. LTD. Address of Applicant :PLOT NO. 1, KNOWLEDGE PARK III, GREATER NOIDA - 201308, U.P. INDIA. Uttar Pradesh India (72)Name of Inventor : 1)VIVEK MOHAN SHARMA 2)SHEETAL KUMAR JAIN

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The present invention provides a digital radio frequency (RF) modulator for providing modulation for base-band TV signals. The RF modulator provides direct conversion of digital base-band audio and video signals to a desired RF channel frequency, without any analogue up conversion. The RF modulator in the present invention includes an audio module, a video module, and a RF converter. The audio module includes a pre-emphasis filter, a multi-stage audio interpolator and a complex frequency modulator to generate frequency modulated (FM) audio signals. The video module includes a complex VSB filter, a group-delay compensation filter and some processing logic to generate a filtered output video signal. The RF converter includes a complex adder, a complex multiplier and a RF interpolator to construct the base band TV signals and to shift the base band TV signals in a frequency domain to the desired RF channel frequency. The exponential video carrier is generated at baseband and has a frequency whose value is in the range of +/13.5MHz. The RF interpolator includes a zero pad logic followed by a quadrature band pass filter (BPF), and an optional second stage of another zero-pad logic followed by a real band pass filter (BPF). The second stage is optional in the sense that it is required only if the desired RF channel is in the higher VHF band.



5419





(54) Title of the invention : "COATING COMPOSITION FOR A METAL, AND METAL MATERIAL HAVING A COATING OF SUCH COATING COMPOSITION" (51) International classification (31) Priority Document No

:C23C22/28 (71)Name of Applicant : :20061)NISSIN CHEMICAL INDUSTRY CO.,LTD 243762 Address of Applicant :17-33, KITAGO 2-CHOME :08/09/2006 ECHIZEN-SHI, FUKUI-KEN, JAPAN. Japan :Japan (72)Name of Inventor : :NA 1)TORU MIZUSAKI :NA 2)NORIO NAKAMURA :NA 3)SHUICHIRO SHINOHARA :NA :NA :NA :NA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A coating composition for a metal is provided. The. coating composition comprises a coating composition for a metal comprising a synthetic resin solid content (A); a filler (B); and a mixture of (C-l) acetylene glycol represented by the following general formula (1): and/or an ethoxylated derivative of the acetylene glycol represented by the following general formula (2): and (C-2) at least one member selected from polyoxy(ethylene -propylene) block polymer represented by the following formula.



5420





(54) Title of the invention : OLIGONUCLEOTIDE PROBE FOR DETECTION AND ENUMERATION OF VIBRIO SPP. IN AQUACULTURE SYSTEMS. (51) International classification :C12Q1/68 (71)Name of Applicant : (31) Priority Document No :NA 1)DEPARTMENT OF BIOTECHNOLOGY (32) Priority Date :NA Address of Applicant :BLOCK - 2, 7TH FLOOR, CGO (33) Name of priority country :NA COMPLEX, LODHI ROAD, NEW DELHI - 110 003. Delhi India (86) International Application No :NA 2)KARNATAKA VETERINARY ANIMAL AND Filing Date :NA FISHERIES SCIENCES UNIVERSITY (87) International Publication No :NA (72)Name of Inventor : (61) Patent of Addition to Application Number :NA 1)DR. IDDYA KARUNASAGAR Filing Date :NA 2)DR. INDRANI KARUNASAGAR (62) Divisional to Application Number :NA 3)DR. H. SANATH KUMAR Filing Date :NA (57) Abstract : This invention relates to a genus specific oligonucleotide probe for detection and enumeration of Vibrio spp in aqua-culture systems and shrimp processing industries by colony hybridization technique having sequence based on gene coding for the enzyme DNA gyrase, gyr B having certain unique, sequence that are conserved in members of a genus, wherein the probe has been conjugated with the enzyme alkaline phosphatase (C6) 5' TGTCAGGAAAAAGATCCTGCACTGTC TGA ACT 3' and a protocol for performing colony hybridization using the said oligonucleotide probe.



5421





(54) Title of the invention : "COATING COMPOSITION FOR A METAL, AND METAL MATERIAL HAVING A COATING OF SUCH COATING COMPOSITION" (51) International classification (31) Priority Document No

:C23C22/28 :2006243740 :08/09/2006 :Japan :NA :NA :NA :NA :NA :NA :NA

(71)Name of Applicant : 1)NISSIN CHEMICAL INDUSTRY CO.,LTD. Address of Applicant :C/O NISSIN CHEMICAL INDUSTRY CO.,LTD.,17-33, KITAGO 2-CHOME, ECHIZEN-SHI, FUKUIKEN, JAPAN. Japan (72)Name of Inventor : 1)TORU MIZUSAKI 2)SHUICHIRO SHINOHARA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : ABSTRACT A coating composition for a metal is provided. The coating composition comprises a synthetic resin solid content (A) ; a filler (B); and a mixture of (C-l) at least one member selected from an acetylene glycol represented by the following general formula ( 1 ) : an ethylene oxide - propylene oxide block adduct of an acetylene glycol represented by the following general formula (2): and an ethylene oxide - propylene oxide random adduct of an acetylene glycol represented by the following general formula (3): and (C-2) a polyoxyalkylene alkyl ether having an HLB of 8 to 18 represented by the following general formula ( 4 ) :



5422





(54) Title of the invention : "COLOUR DETECTOR PAPER FOR THE DETECTION OF PERSISTENT CHEMICAL WARFARE AGENTS AND PROCESS THEREOF" (51) International classification :B41M3/00 (71)Name of Applicant : (31) Priority Document No :NA 1)DIRECTOR GENERAL, DEFENCE RESEARCH & (32) Priority Date :NA DEVELOPMENT ORGANISATION (33) Name of priority country :NA Address of Applicant :DIRECTORATE OF ER & IPR, III FLOOR, B WING, ROOM NOS 348 & 349, DRDO BHAWAN, (86) International Application No :NA Filing Date :NA RAJAJI MARG, DHQ PO, NEW DELHI 110011. Delhi India (87) International Publication No :NA (72)Name of Inventor : (61) Patent of Addition to Application Number :NA 1)SAXENA, AMIT Filing Date :NA 2)SINGH, BEER (62) Divisional to Application Number :NA 3)KRISHNAMURTHY, SEKHAR Filing Date :NA (57) Abstract : The invention discloses a three color detector paper, Mark-II for the detection of persistent chemical warfare agents. The invention further discloses a process for preparation of the three color detector paper, Mark-II. The color detector paper disclosed in the invention shows excellent water repellency and color development with appropriate persistent warfare agents. The color detector paper disclosed in the invention has the shelf life of more than five years.



5423





(54) Title of the invention : "A METHOD AND SYSTEM FOR CAPTURING A PART OF VIDEO FROM A MAIN WINDOW OF A DISPLAY DEVICE." (51) International classification :G09G5/00 (71)Name of Applicant : (31) Priority Document No :NA 1)SAMSUNG INDIA ELECTRONICS PVT. LTD. (32) Priority Date :NA Address of Applicant :B-1, SECTOR-81, PHASE II NOIDA(33) Name of priority country :NA 201 305, INDIA. Uttar Pradesh India (72)Name of Inventor : (86) International Application No :NA Filing Date :NA 1)RISHI AGRAWAL (87) International Publication No :NA 2)K. SARVANA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A method for capturing a part of a video from a main window of a display device and displaying the captured video on another window of the same display device, the method comprising the steps of: setting and ascertaining an enabling/disabling mechanism for said capture and display of the video image; starting a timer in case said mechanism is enabled; checking the status of the timer; disabling said mechanism in case no action is taken for a predetermined time set by said timer; splitting the first display into a plurality of areas and selecting a predetermined area from said plurality of areas; activating a navigation key and navigates the selected area according to the navigation key activated; activating an output key and captures the selected area; and displaying the captured area on the second display of said display device.



5424





(54) Title of the invention : "DUAL PORT SRAM WITH DEDICATED READ AND WRITE PORTS FOR A HIGH SPEED READ OPERATION AND A LOW LEAKAGE" (51) International classification :G11C0/00 (71)Name of Applicant : (31) Priority Document No :NA 1)STMICROELECTRONICS PVT. LTD. (32) Priority Date :NA Address of Applicant :PLOT NO. 1, KNOWLEDGE PARK (33) Name of priority country :NA III, GREATER NOIDA - 201 308, UP, INDIA. Uttar Pradesh India (86) International Application No :NA Filing Date :NA (72)Name of Inventor : (87) International Publication No :NA 1)YOGESH LUTHRA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention provides a dual port static random access memory (SRAM) having dedicated read and write ports to provide a high speed read operation with reduced leakages. A dual port SRAM includes at least one write word line, at least one read word line, at least one pair of write bit line and read bit line, a plurality of rows and columns. Each rows and columns have at least one cell. The cell includes at least one pair of memory element cross coupled to form a latch for storing data, a pair of write access semiconductors and a pair of read access semiconductors. The static random access memory (SRAM) includes an inverter circuit and a pull down circuit. The inverter circuit and the pull down circuit is configured to at least one cell to increase the read operation and to eliminate leakages.



5425





(54) Title of the invention : 'SELF PROGRAMMABLE SHARED BIST FOR TESTING MULTIPLE MEMORIES' (51) International classification

:B65D (71)Name of Applicant : 83/14 1)STMICROELECTRONICS PVT. LTD., :NA Address of Applicant :PLOT NO 1, KNOWLEDGE PARK :NA III, GREATER NOIDA-201308 U.P. Uttar Pradesh India :NA (72)Name of Inventor : :NA 1)SWAPNIL BAHL, :NA :NA :NA :NA :NA :NA

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The present invention provides a built-in self-test (BIST) device for testing multiple embedded memories of different characteristics. The BIST includes a BIST controller, a delay generator, multiple interface modules, and a memory wrapper. The BIST controller generates an initialization sequence and a memory test algorithm. The delay generator provides a delay of an expected data, a valid signal, a BBAD signal, a BEND signal, and a BFAIL signal. The multiple interface modules provide signal pipelining for multiple memories through a bus. The bus carries signals form the BIST device to multiple memories and vice-versa. The memory wrapper decodes a selected memory for decompressing a memory data signal generated by said BIST device and further compresses a memory output signal.



5426





(54) Title of the invention : "THIN FILM DRESSING" (51) International classification

:A61F13/02; (71)Name of Applicant : A61F13/02 1)TYCO HEALTHCARE GROUP LP Address of Applicant :15 HAMPSHIRE STREET, :60/844,008 :12/09/2006 MANSFIELD, MASSACHUSETTS 02048, USA. U.S.A. :U.S.A. (72)Name of Inventor : :NA 1)RONALD F.VITARIS :NA :NA :NA :NA :NA :NA

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : Multi-layer articles are provided which are suitable for use as medical dressings.. The articles include a hydrophilic layer, a hydrophobic layer, a delivery layer, and a release layer. In embodiments, the articles may also include adhesive tapes, stabilizer layers, and absorbent materials which may be included in an existing layer or applied as a separate absorbent layer.



5427





(54) Title of the invention : A UPS MONITORING AND CONTROLLING SOFTWARE EMBEDDED INTO A DSP BASED ONLINE UPS EQUIPMENT

(51) International classification

:G06F12/14; (71)Name of Applicant : G06F11/00; 1)SUKAM POWER SYSTEMS LIMITED G06F11/30 Address of Applicant :WZ-1401/2, NANGAL RAYA, NEW :NA DELHI - 110046, INDIA Delhi India :NA (72)Name of Inventor : :NA 1)MR. KUNWER SACHDEV :NA 2)MR. NARENDER NEGI :NA 3)MR. SASHI KUMAR : NA 4)MR. AJAY LAKHANPAL :NA 5)MR. DEVENDER SINGH :NA :NA :NA

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : This invention relates to a novel UPS monitoring and controlling software embedded into a DSP based online UPS equipment for monitoring and controlling the Online UPS. The novel software displays UPS parameters in digital as well as in graphical form in specific intervals ranging from 10 seconds to 60 seconds to keep a track of its performance. The software system provides capabilities of generating a unique log in and a password having the facility to send an email to Single/Multiple users on different conditions including a SMS sending facility to Single/Multiple users on different conditions such as "battery voltage low", "battery voltage high", output over voltage", "output under voltage". The system also provides auto saving of files on computer, before shutdown providing the flexibility to the end user to toggle off the server and UPS shutdown.



5428





(54) Title of the invention : "BOLTABLE STEM TO ROAD STUDS" (51) International classification

:E01F (71)Name of Applicant : 9/00 1)RAMESH CHANDER VARMA :NA Address of Applicant :H. NO. 852, SECTOR-8, :NA PANCHKULA-134109, HARYANA,(INDIA) Haryana India :NA (72)Name of Inventor : :NA 1)RAMESH CHANDER VARMA :NA :NA :NA :NA :NA :NA

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : This invention relates to an improved road-safety device which can be bolted with the Road-stud for fixing the road-stud by imbedding this stem in the road with the help of any adhesive, epoxy or cement.



5429





(54) Title of the invention : "INTEGRATED WATER TURBINES COMBINED WITH WIND TURBINES" :F03D9/00 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)ASHA SINGH (32) Priority Date :NA Address of Applicant :S-5/112, R-1, Laxmanpur Post Office (33) Name of priority country :NA Shivpur Varanasi -221 003,( U.P.) India. Uttar Pradesh India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)REETESH KUMAR SINGH (87) International Publication No :NA 2)RAJIV SHANKAR SINHA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to an integrated Water and wind energy generation system having at least two horizontal water turbine units and two dynamos installed one at each end of- the integrated system, supporting pillars, a gear box which is used to fix the shaft of turbine with supporting pillars as well as to integrate the horizontal water turbines and wind turbines at top of the pillars.



5430





(54) Title of the invention : "A SCHOTTKY-GATE BMFET DEVICE AND METHOD OF OPERATION THEREOF" :H01L29/12 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)INDIAN INSTITUTE OF TECHNOLOGY NEW DELHI (32) Priority Date :NA Address of Applicant :HAUZ KHAS, NEW DELHI-110 016, (33) Name of priority country :NA INDIA. Delhi India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)JAGADESH KUMAR MAMIDALA (87) International Publication No :NA 2)BAHL HARSH (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A new Schottky-gate Bipolar Mode Field Effect Transistor (SBMFET) is deviced and verified by two-dimensional work and analysis, the present device uses the Schottky gate formed on the silicon planar surface for injecting minority carriers into the drift region. -D) modeling.



5431





(54) Title of the invention : "A PURIFIED SALIVARY P. ARIASI POLYPEPTIDE"

(51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filed on

(71)Name of Applicant : 1)THE GOVERNMENT OF THE UNITED STATES OF :A61K 38/00 AMERICA :60/412,327 Address of Applicant :NATIONAL INSTITUTES OF :19/09/2002 HEALTH, OFFICE OF TECHNOLOGY TRANSFER, 6011 :U.S.A. EXECUTIVE BOULEVARD, SUITE 325, ROCKVILLE, MD :PCT/US2003/029833 20852-3804, USA U.S.A. :18/09/2003 2)MERIAL LIMITED :WO 2004/027041 (72)Name of Inventor : 1)JESUS G. VALENZUELA :NA 2)JOSE M.C. RIBEIRO :NA 3)SHADEN KAMHAWI :1390/DELNP/2005 4)YASMINE BELKAID :06/04/2005 5)LAURENT FISCHER 6)JEAN-CHRISTOPHE AUDONNET 7)FRANCIS MILWARD

(57) Abstract : Substantially purified salivary P. ariasi and P. perniciosus polypeptides, and polynucleotides encoding these polypeptides are disclosed. Vectors and host cells including the P. ariasi and P. perniciosus polynucleotides are also disclosed. In one embodiment, a method is disclosed for inducing an immune response to sand fly saliva. In other embodiments, methods for treating or preventing Leishmaniasis are disclosed.



5432





(54) Title of the invention : "PROTECTIVE COATING CONTAINING ACETYLENE COMPOUND" (51) International classification (31) Priority Document No

:C23C22/28 (71)Name of Applicant : :20061)NISSIN CHEMICAL INDUSTRY CO.,LTD. Address of Applicant :17-33, KITAGO 2-CHOME, 243773 :08/09/2006 ECHIZEN-SHI, FUKUI-KEN, JAPAN. Japan :Japan (72)Name of Inventor : :NA 1)TORU MIZUSAKI :NA 2)SHUICHIRO SHINOHARA :NA :NA :NA :NA :NA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A protective coating is provided. The protective coating comprises a synthetic resin solid content (A); and a mixture of (B-l) at least one member selected from an acetylene glycol represented by the following general formula (1) an ethylene oxide - propylene oxide block adduct of an acetylene glycol represented by the following general formula (2) and an ethylene oxide - propylene oxide random adduct of an acetylene glycol represented by the following general formula (3) (B-2) at least one member selected from a polyoxyalkylene alkyl ether having an HLB of 8 to 18 represented by the following general formula (4) R70(C3H60)v(C2H40)w(C3H60)x(C2H40)y(C3H60)zH (4) and sulfur-containing surfactants represented by the following general formula ( 5 ) or general formula (6) and (B-3) water and/or a water soluble organic solvent.



5433





(54) Title of the invention : "A KIT FOR DETECTION OF DETERGENT IN MILK" (51) International classification

:H04R (71)Name of Applicant : 1/10 1)INDIAN COUNCIL OF AGRICULTURAL RESEARCH :NA (ICAR) :NA Address of Applicant :NEW DELHI, INDIA. Delhi India :NA (72)Name of Inventor : :NA 1)DR. Y.S. RAJPUT :NA 2)DR. RAJAN SHARMA :NA 3)SUMANDEEP :NA :NA :NA :NA

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : This invention relates to a kit for detection of detergent in milk comprising of a solution of Methylene blue dye, solution of Ferric Chloride, a solution of Ethylenediamine tetra acetic acid and Chloroform. Kit can be used for detection of adulteration of milk with 'synthetic milk'.



5434





(54) Title of the invention : "METHOD FOR SOLVING SOME TPYES OF DISCONTINUITY IN THE ACOUSTIC-FLUIDDYNAMIC COMPUTATION BY USING THE METHOD OF CHARACTERISTICS" (51) International classification :G01F (71)Name of Applicant : (31) Priority Document No :NA 1)B.R.D. DI BOCCHI ING. GIUSEPPE & C.S.R.L. (32) Priority Date :NA Address of Applicant :STRADA INZANI, 18-43040 (33) Name of priority country :NA VICOFERTILE (PR), ITALY Italy (86) International Application No :NA (72)Name of Inventor : :NA Filing Date 1)B.R.D. DI BOCCHI ING. GIUSEPPE & C.S.R.L. (87) International Publication No : NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention deals with a process for solving some types of discontinuities in the acoustic-fluid-dynamic computation by using the method of characteristics. Next to discontinuities present in ducts, it imposes the pressure and flow continuity and obtains, being the Riemann variables λ1 and β2 values known, the unkonwn λ2 and β1 values. In particular, the process takes into account discontinuities next to ducts with nozzles communicating with the outside environment, sudden section variations and the case of introducing fluid dynamics power consuming machines (ex. turbocharger).



5435





(54) Title of the invention : "METHOD FOR DETERMINING THE PROFILE OF A CAM" (51) International classification

:B65D (71)Name of Applicant : 83/14 1)B.R.D. DI BOCCHI ING. GIUSEPPE & C.S.R.L. :NA Address of Applicant :STRADA INZANI, 18-43040 :NA VICOFERTILE (PR), ITALY. Italy :NA (72)Name of Inventor : :NA 1)BOCCHI, GIUSEPPE :NA :NA :NA :NA :NA :NA

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : Disclosed herein is a form panel system that is capable of constructing a frame structure including a wall of a concrete-based building and a concrete structure including various retaining walls for civil-engineering works. The form panel system comprises compression cement boards disposed opposite to each other while being spaced a predetermined distance from each other, the compression cement boards being reinforced with fiber materials, reinforcing boards obtained by forming the compression cement boards in predetermined shapes, or foamed plastic heat insulating panels, and metal plate studs disposed between the compression cement boards. The metal plate studs are composed of metal plates having predetermined thicknesses and distances therebetween, which are selected depending on the durability off concrete. Each of the metal plate studs has at least one opening formed therein. Each of the metal plate studs is provided at both opposite side ends thereof with bent parts. The metal plate stud is fixed to the respective compression cement boards by means of fixing pieces, and concrete is injected and cured into the space between the compression cement boards, to which the metal plate studs are fixed and the foamed plastic heat insulating panels are attached. According to the present invention, the fiberreinforced compression cement boards, the foamed plastic heat insulating panels, the metal plate studs having the openings are vertically or horizontally arranged without limits.



5436





(54) Title of the invention : "MUSTARD OIL BASED HARD SURFACE CLEANER FORMULATION AND PROCESS FOR MANUFACTURE." (51) International classification :A23L1/225 (71)Name of Applicant : (31) Priority Document No :NA 1)PURI OIL MILLS LTD. (32) Priority Date :NA Address of Applicant :PURI OIL MILLS LTD302, JYOTI (33) Name of priority country :NA SHIKHAR BUILDING, DISTRICT CENTER, JANAKPURE, NEW DELHI-11005 Delhi India (86) International Application No :NA Filing Date :NA (72)Name of Inventor : (87) International Publication No : NA 1)SANJAY TICKOO (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A process for manufacturing the mustard oil containing hard surface cleaner formulation comprising the steps of: (a) mixing mustard oil, alcohol and metallic salt in the ratio of 1-20:1-20:0.1-15 and excess of water, (b) heating the mixture with stirring in the reactor at temperature of 50-110°C and at pressure of 10-25 psi for 30 -120 minutes, (c) adding ammonium salt and sodium sulphate of lauric acid to the reaction mixture in the ratio of 0.5-10 : 0.5-15 respectively, (d) heating the reaction mixture at 50-100°C for 30 -120 minutes with addition of water, (e) mixing the whole mixture with air and agitating the tank to form consistent gel.



5437





(54) Title of the invention : "AN IMPROVED TEMPER PROOF SEAL FOR SEALING ELECTRICAL INSTALLATIONS" :H05B (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)GENUS ELECTRONICS LIMITED (32) Priority Date :NA Address of Applicant :SPL-3, RICCO INDUSTRIAL AREA, (33) Name of priority country :NA SITAPURA, JAIPUR, INDIA. Rajasthan India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)R.K. MISHRA (87) International Publication No :NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : This invention relates to an improved temper proof seal for sealing electrical installations comprises a male and a female part connected to each other provided with double locking system for fitting male part into the female part wherein the female part is provided with atleast one hole and the male part is provided with atleast two holes for insertion of a seal wire therethrough.



5438





(54) Title of the invention : "AIR SHAFT" :B65H18/04 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)MING-HSIANG KUO (32) Priority Date :NA Address of Applicant :NO.9, ALLEY 22, LANE 22, SHEXIH (33) Name of priority country :NA STR., SHIHLIN DISTRICT, TAIPEI, TAIWAN, REPUBLIC OF (86) International Application No :NA CHINA China Filing Date :NA (72)Name of Inventor : (87) International Publication No :NIL 1)MING-HSIANG KUO (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention is to provide an air shaft comprising a hollow cylinder and a plurality of curved members provided on an outer surface of the hollow cylinder and between both ends thereof, wherein the curved members are adapted to move radially relative to the hollow cylinder and are spaced each other with a gap formed between any two adjacent ones of the curved members. As such, no continuous straight gaps are formed on an outer surface of the hollow cylinder while pushing the curved members. By utilizing the present invention, a web material can be wound on the air shaft directly without the need of mounting a roll on an outer surface of the air shaft, thereby eliminating the drawbacks of the prior art air shaft.



5439





(54) Title of the invention : "A MECHANICAL SYSTEM FOR CHOPPING AND CRUSHING OF WATER HYACINTH" (51) International classification

:H04N (71)Name of Applicant : 13/04 1)INDIAN COUNCIL OF AGRICULTURAL RESEARCH :NA Address of Applicant :KIRSHI BHAVAN, DR. RAJENDRA :NA PRASAD ROAD, NEW DELHI-110 001. Delhi India :NA (72)Name of Inventor : :NA 1)SHAILENDRA MOHAN MATHUR :NA 2)PRATAP SINGH : NA 3)PRAMOD MOHNOT :NA :NA :NA :NA

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : This invention relates to a mechanical system for chopping and crushing of water hyacinth in a single machine comprises a frame accommodating a hopper disposed with a cutting cylinder and a shear plate at its bottom for cutting the plants, a crushing cylinder and a pressing roller provided under the hopper for crushing of the plants and a delivery conveyor for deliveiy of the chopped and crushed plants to a transporting unit. The system is capable of chopping and crushing of water hyacinth in a single pass and reduces its volume up to 65-70 percent, which results in reduction of cost for transportation.



5440





(54) Title of the invention : "METHOD AND APPARATUS FOR CALL HANDLING" (51) International classification

:A43B 7/06 :NA :NA :NA :NA :NA :NA :NA :NA :NA :NA

(71)Name of Applicant : 1)MOTOROLA INC. Address of Applicant :1303 E. ALGONQUIN ROAD, SCHAUMBURG, IL 60196, UNITED STATES OF AMERICA. U.S.A. (72)Name of Inventor : 1)SUBODH K. SOHI

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A call handling apparatus comprises a receiver which receives an incoming call and associated call intent data for a plurality of call intents. An action processor determining a plurality of call actions in response to the call intent data and a user call action preference profile. The user call action preference profile can specifically comprise call intent rules specifying specific call actions if associated call intent conditions are met. An action controller then performs the identified call actions. The invention may allow a more flexible and improved call handling.



5441





(54) Title of the invention : "A SYSTEM AND METHOD FOR EXCLUDING NARROW BAND NOISE FROM A COMMUNICATION CHANNEL" (51) International classification :H04B7/14 (71)Name of Applicant : (31) Priority Document No :11/220,870 1)DEKOLINK WIRELESS LTD. (32) Priority Date :06/09/2006 Address of Applicant :16 BAZEL ST., QIRYAT-ARIEH, (33) Name of priority country :U.S.A. PETACH-TIKVA 49510, ISRAEL. Israel (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)HASARCHI ABRAHAM (87) International Publication No :NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A signal Filtering system and method that may be used in conjunction with a repeater 01 an input stage of a base-station. The system may include an analog to digital converter adapted to sample a received signal and to produce a data stream corresponding to the received signal in the time domain, a filtering block having one or mats digital fillet elements, wherein each of said one or more filter elements is adapted to filler one or mote sets of frequency bands associated with one or more communication channel, and a controllet adapted to configure said one or more digital filter elements based on parameters stored on a database and/or based on parameters raceived via a modem



5442





(54) Title of the invention : "DETERMINING THE PRESENCE OF A PRE-SPECIFIED STRING IN A MESSAGE" (51) International classification

:C07K (71)Name of Applicant : 14/705 1)INTEL CORPORATION :NA Address of Applicant :2200 MISSION COLLEGE :NA BOULEVARD, SANTA CLARA, CA 95052, USA U.S.A. :NA (72)Name of Inventor : :NA 1)K.P. MURUKANANDAM :NA 2)NITHISH MAHALINGAM : NA :NA :NA :NA :NA

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A network device determines the presence of the pre-specified string in a message based on a sequence matching rule. A sequence represents non-contiguous portions of the message. A combination of content addressable memory, programmable processing units, and the programmable control unit may determine the presence of the pre-specified string in the message by comparing the noncontiguous portions of the message. Such an approach may reduce the computational resources required for searching the prespecified string in the message.



5443





(54) Title of the invention : "EXPRESSION OF VIRULENCE FACTORS OF M. LEPRAE IN HOST DURING INFELCTION BY FUNCTIONAL GENOMIC APPROACHES"


(71)Name of Applicant : 1)INDIAN COUNCIL OF MEDICAL RESEARCH :A61K38/00 Address of Applicant :V. RAMALINGASWAMI BHAWAN, :NA ANSARI NAGAR, POST BOX 4911, NEW DELHI-110 029 :NA Uttar Pradesh India :NA (72)Name of Inventor : :NA 1)VISHWA MOHAN KATOCH :NA 2)UTPAL SENGUPTA : NA 3)KIRAN KATOCH :NA 4)KRISHNAMURTHY VENKATESAN :NA 5)VISHNU DATT SHARMA :NA 6)DEVENDRA SINGH CHAUHAN :NA 7)HIRAWATI 8)RAHUL SHARMA

(57) Abstract : A DNA Chip for the identification of differential expression virulence genes of Mycobacterium leprae during the disease spectrum in the human host. It also assesses their role as a future drug target/ vaccine production for the mycobacterial diseases by using comparative and structural genomic approaches. The partial DNA -chip, by targeting virulence genes [encoding major heat shock protein (HSPs viz. 10, 18, 36, 65, 70 KDa), important regulatory proteins, entry proteins, bacterial toxins, iron storage proteins] and genes targeting key enzymes of metabolic pathways of M.leprae.



5444





(54) Title of the invention : "DEVICE FOR OPENING OF CONTACTS OF A CIRCUIT BREAKER" :H01H71/10 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)AUTOMETERS ALLIANCE LTD. (32) Priority Date :NA Address of Applicant :C-63, SECTOR-57, NOIDA-201307, (33) Name of priority country :NA UTTAR PRADESH, INDIA Uttar Pradesh India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)DIGAMBAR PRASAD BHATT (87) International Publication No :NA 2)RANDHIR SINGH (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Present invention discloses a device for opening contacts of a circuit breaker. The circuit breaker of the present invention is an electropneumatic system which is energy efficient and simple in construction. The present invention overcomes the drawbacks or difficulties present in the prior existing circuit breaker; particularly present invention overcome problems during the opening of contacts. The present invention uses lesser number of electrical and mechanical components as compared to the prior existing systems. Simple construction provides ease of manufacturing economical in cost and reliable operation.



5445





(54) Title of the invention : "DEVICE FOR CLOSING OF CONTACTS OF A CIRCUIT BREAKER" :H01H71/00 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)AUTOMETERS ALLIANCE LTD. (32) Priority Date :NA Address of Applicant :C-63, SECTOR 57, NOIDA-201307, (33) Name of priority country :NA UTTAR PRADESH, INDIA Uttar Pradesh India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)DIGAMBAR PRASAD BHATT (87) International Publication No :NA 2)RANDHIR SINGH (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Accordingly, the present invention provides an energy efficient device for closing of contacts of a circuit breaker that is based on the principal of pneumatic closing, pneumatic holding and spring opening. In addition to being energy efficient, the device of the present invention eliminates substantial number of mechanical components and also eliminates substantial active and passive components in the electronic control unit thereby improving the reliability of the operation of the device, reducing the manufacturing cost and enhancing ease of manufacturing.



5446





(54) Title of the invention : "A SYSTEM FOR GENERATION OF ELECTRICITY USING A SUGAR MILL DURING OFF SEASON" (51) International classification :F03D (71)Name of Applicant : (31) Priority Document No :NA 1)CHEEMA BOILERS LIMITED (32) Priority Date :NA Address of Applicant :SCO 66, PHASE 382, MOHALI, (33) Name of priority country :NA PUNJAB-160 059, INDIA. Punjab India (86) International Application No :NA (72)Name of Inventor : :NA Filing Date 1)HARJINDER SINGH CHEEMA (87) International Publication No :NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : This invention relates to a system for generation of electricity using a sugar mill during off season comprising of a plurality of fluidized bed chambers mounted on a grate furnace and a fuel feeder for feeding a fuel into the chambers wherein a low pressure turbine is connected to the system for generation of electricity.



5447





(54) Title of the invention : "AN IMPROVED FIELD TENSIOMETER FOR IRRIGATION WATER MANAGEMENT OF CROPS" (51) International classification

:F42B (71)Name of Applicant : 12/78 1)PUNJAB AGRICULTURAL UNIVERSITY :NA Address of Applicant :LUDHIANA-141 004, AN INDIAN :NA UNIVERSITY INDIA. Punjab India :NA (72)Name of Inventor : :NA 1)G.S. HIRA :NA 2)S.S. KUNAL :NA 3)A.S. SIDHU :NA :NA :NA :NA

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : This invention relates to An improved field tensiometer for irrigation water management of crops comprises a tube housing another tube wherein the inner tube is fitted to a cup at its lower end and the outer tube is fitted to a cork at its upper end in which both the tubes and cup are filled with a liquid and the outer tube is provided with a plurality of indication marks.



5448





(54) Title of the invention : "INSERT FOR AN OPENING OF AN APPLIANCE" (51) International classification

:A01H (71)Name of Applicant : 1/00 1)LAPP ENGINEERING & CO. :NA Address of Applicant :INDUSTRIESTRASSE 47, 6300 ZUG, :NA SWITZERLAND. Switzerland :NA (72)Name of Inventor : :NA 1)ROLF DROTLEFF :NA 2)MARTIN ZANKL : NA :NA :NA :NA :NA

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : In order to improve an insert for an opening in a wall area of an appliance comprising a housing socket, an assembly device provided on the housing socket, with an assembly section which can be guided through the opening in the wall area and has snap elements which engage behind an edge of the opening as well as with a pressure ring which is arranged on the housing socket at a distance from the snap elements and can be adjusted in the direction of the snap elements by means of an advancing guide as a result of a rotary movement about the central axis, in such a manner that a secure assembly of the housing socket is possible, it is suggested that the pressure ring be rotatable in a first direction of rotation in order to secure the housing socket and that the housing socket be adapted to be fixed against any co-rotation in the first direction of rotation by means of a holding section element.



5449





(54) Title of the invention : ECO-FRIENDLY PROCESS FOR RECOVERY OF PYRIDINE AND /OR ITS DERIVATIVES :C07D211/14 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)JUBILANT ORGANOSYS LIMITED (32) Priority Date :NA Address of Applicant :PLOT 1, A SECTOR 16A, NOIDA(33) Name of priority country :NA 201301, UP, INDIA Uttar Pradesh India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)KUMAR, MAHENDRA (87) International Publication No : NA 2)DIXIT, SANJEEV KUMAR (61) Patent of Addition to Application Number :NA 3)SINGH, SHAILENDRA KUMAR Filing Date :NA 4)AGARWAL, ASHUTOSH (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Disclosed herein is a process for recovery of pyridine and/or its derivatives from their aqueous mass and/ or manufacturing reaction mass by liquid-liquid extraction employing an environmentally non-hazardous organic solvent. The process further comprising effective recovering and recycle of solvents from the aqueous phase and the other waste obtained during the process.



5450





(54) Title of the invention : "TETRACYCLIC COMPOUNDS, A PROCESS FOR THEIR PREPARATION OF PHARMACEUTICAL COMPOSITIONS CONTAINING THEM" (51) International classification

:A61K9/28; (71)Name of Applicant : A61K31/18 1)LES LABORATORIES SERVIER :06.08413 Address of Applicant :12, PLACE DE LA DEFENSE, 92415 :26/09/2006 COURBEVOIE CEDEX, FRANCE. France :France (72)Name of Inventor : :NA 1)JEAN-LOUIS PEGLION :NA 2)CHRISTOPHE POITEVIN :NA 3)MARK, MILLAN :NA 4)MAURICETTE BROCCO :NA :NA :NA

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : Compounds of formula I, of trans relative configuration: wherein: * X represents an oxygen atom or an NR2 group, * Y represents a group selected from -CH2-, -(CH2)2- and -CH=CH-, * RI and R2, which may be the same or different, each represents a hydrogen atom or group selected from alfcyl, cycloalkyl and cycloalkylalkyl, in racemic form or in the form of optical isomers, and also addition salts thereof with a phannaceutically acceptable acid, and hydrates thereof- Medicaments.



5451





(54) Title of the invention : TOPICAL ANTI-ACNE COMPOSITION :A61K7/48 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)SANJAY BANERJI (32) Priority Date :NA Address of Applicant :117/L/334, NAVEEN NAGAR, (33) Name of priority country :NA KANPUR-208025 Uttar Pradesh India (86) International Application No :NA 2)MINI BANERJI Filing Date :NA (72)Name of Inventor : (87) International Publication No :NA 1)SANJAY BANERJI (61) Patent of Addition to Application Number :NA 2)MINI BANERJI Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : This invention relates to a topical drug delivery system for treatment of Acne and other Acneform dermatoses comprising of a pharmaceutical and/or cosmetic product comprising of one or more of the active ingredients for administration to an individual in need ,wherein said product includes formulations dispensed together with dispense means which permits said formulations to be dispensed from said storage system wherein one such storage system contains a carrier system in form of a pad or pledget impregnated with one or more of the active ingredients in dry form readily soluble in the accompanied liquid phase which may or may not contain another active ingredient stored and dispensed together to make freshly prepared solution by soaking the pad and allowing the impregnated material to get dissolved in an accurately measured amount of the liquid in a measuring device



5452





(54) Title of the invention : 'CIRCUIT FOR SUPRESSING RINGING IN HIGH SPEED CMOS OUTPUT BUFFER DRIVING TRANSMISSION LINE LOAD' (51) International classification

:G02B (71)Name of Applicant : 6/38 1)STMICROELECTRONICS PVT. LTD :NA Address of Applicant :PLOT NO. 1, KNOWLEDGE PARK :NA III, GREATER NOIDA - 201308, UP, Uttar Pradesh India :NA (72)Name of Inventor : :NA 1)ANKIT SRIVASTAVA :NA 2)AMIT KUMAR RATHI :NIL 3)PARAS GARG :NA :NA :NA :NA

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The present invention discloses an output buffer circuit for improving an output of such buffers during state transitions. The circuit generates variable output impedance proportional to the load transmission line impedance. The buffer includes an output stage, such as pull up / pulls down drivers for receiving an input signal and generating an output signal. The pull up/ pull down drivers are biased by a circuit that generates a control signal and varies its conductivity according to the control signal. The pull up / pull down driver initially provide a relatively low impedance to reach a desired level during the initial transition period of the output and then slowly varies its impedance in response to the control signal to suppress the ringing effect. The control circuit coupled to the input node, output node and the power supply node to generate a control signal that biases the pull up / pulls down driver.



5453





(54) Title of the invention : "METAL CONTAINING DIAMOND LIKE CARBON COATING COMPOSITIONS" :H01L21/762 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)UNITED TECHNOLOGIES CORPORATION (32) Priority Date :NA Address of Applicant :UNITED TECHNOLOGIES (33) Name of priority country :NA BUILDING, ONE FINANCIAL PLAZA, HARTFORD, (86) International Application No :NA CONNECTICUT 06101, U.S.A. U.S.A. Filing Date :NA (72)Name of Inventor : (87) International Publication No :NA 1)CLARK V. COOPER (61) Patent of Addition to Application Number :NA 2)BRUCE D. HANSEN Filing Date :NA 3)KLAUS BEWILOGUA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A substrate includes a metal diamond-like-carbon coating composed of a first layer and second layer deposited thereupon and having a thickness of about 0.5 micrometer to 10 micrometers. The first layer is composed of a transition metal and includes a first surface and a second surface in contact with the substrate. The second layer is composed of carbon and a transition metal selected from the group consisting of tungsten, niobium, titanium and combinations thereof, and also includes a first surface and a second surface in contact with the first surface of the first layer. The metal-containing diamond-like-carbon coating compositions possesses an abrasive wear rate of no more than about 10 x 10-15 m3m-1N-1 over a negative biasing potential range of about -50 volts to -750 volts.



5454





(54) Title of the invention : LIPOSOMES AS DELIVERY VEHICLES IN PLANT CELL TISSUE CULTURES :A61K9/127 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)DEPARTMENT OF BIOTECHNOLOGY (32) Priority Date :NA Address of Applicant :BLOCK - 2, 7TH FLOOR, C.G.O. (33) Name of priority country :NA COMPLEX, LODHI ROAD, NEW DELHI 110 003. Delhi India (86) International Application No :NA 2)GURU NANAK DEV UNIVERSITY Filing Date :NA (72)Name of Inventor : (87) International Publication No :NA 1)NEELU SOOD (61) Patent of Addition to Application Number :NA 2)GAJENDRA SINGH Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A process for preparing IIposomes comprising the step of. separating egg yolk from the egg white, washing the said yolk with a solvent to obtain a white solid material; drying the said white solid material and dissolving it in absolute alcohol; subjecting the said white material diesolved in alcohol to the step of extraction evaporating the alcohol to obtain a sticky mass; subjecting the said sticky mass to the step of crystallization in petroleum ether and pouring the said ethereal solution in chilled acetone for precipitation to obtain white sticky mass; subjecting the said sticky mass to the step of column chromatography to obtain the fraction containing phosphatidyl choline (PC) for making liposomes; subjecting the said PC to the step of making liposomes(both hollow and hormone containing)



5455





(54) Title of the invention : "A METHOD FOR PREPARATION OF CROSS LINKED PROTEIN MICROCRYSTALS" :C07K1/107 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)INDIAN INSTITUTE OF TECHNOLOGY (32) Priority Date :NA Address of Applicant :INDIAN INSTITUTE OF (33) Name of priority country :NA TECHNOLOGY DELHI, HAUZ KASH, NEW DELHI-110016. (86) International Application No :NA Delhi India Filing Date :NA (72)Name of Inventor : (87) International Publication No :NA 1)MUNISHWAR NATH GUPTA (61) Patent of Addition to Application Number :NA 2)SHWETA SHAH Filing Date :NA 3)APARNA SHARMA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to immobilization technology. More, particularly, it relates to the method for preparation of Cross Linked Protein Coated Microcrystals and their use as catalysts in chemical reactions in non-aqueous media. CLPCMC provides increased reaction rate which makes the enzymes less prone to organic solvent denaturation and provides increase stability towards thermal denaturation and having potential to be a useful biocatalyst design for resolution of chiral compounds and in production of biodiesel.



5456





(54) Title of the invention : 'HIGH SPEED LEVEL SHIFTER' :G11C7/00 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)STMICROELECTRONICS PVT. LTD. (32) Priority Date :NA Address of Applicant :PLOT NO. 1, KNOWLEDGE PARK (33) Name of priority country :NA III, GREATER NOIDA-201308, UP Uttar Pradesh India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)SOURAV JANDIAL (87) International Publication No :NA 2)ANKIT SRIVASTAVA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention provides a level shifter circuit capable of high frequency operations. The level shifter circuit utilizes a dynamic charge injection device, which diminishes a capacitive coupling effect between a gate and a drain of input NMOS devices, when the input signal switches from a high logic level to a low logic level. The dynamic charge injection device is incorporated at output nodes to provide initial thrust to the level shifter circuit, which triggers a positive regenerative feedback of cross-coupled pull up PMOS devices enabling a rapid transition and hence the high frequency operations.



5457





(54) Title of the invention : A NOVEL SLEEPER FOR REINFORCING HAULAGE TRACK IN A MINE/TUNNEL :E01B9/18 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)D.M. VISHWAKARMA (32) Priority Date :NA Address of Applicant :M/S D.M. VISHWAKARMA BR. OFF (33) Name of priority country :NA -B-4/157 SAFDEARGAUNGE ENCLAVE, NEW DELHI(86) International Application No :NA 110029, REGD. OFF. Putkee. Near Krishna Talkies PO-Kusunda Distt-Dhanbad, Jharkhand. Jharkhand India Filing Date :NA (87) International Publication No :NA (72)Name of Inventor : (61) Patent of Addition to Application Number :NA 1)VISHWAKARMA DASRATH MISTRY Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Title: A novel sleeper for reinforcing a haulage track in a mine / tunnel. In the present invention there is a sleeper for reinforcing a haulage track in a mine / tunnel which comprises in combination a specially designed tie bar, a pair of cleat, two pairs of nut & bolt, a pair of netting and a pair of concrete blocks in which the tie bar is grouted at both ends. The said combination consisting of an elongated tie bar in which a pair of C-shaped bar is welded at both the ends, the said C-shaped bars are having two holes to receive the bolts to get tightened by the cleats and the lower part of the rail. There are two pairs of webs welded at the sides of the tie bar just below the C-shaped bar to provide a reinforcement and uniform distribution of the concrete around the tie bar and net covering. Both the ends of the tie bar along with the C-shaped bar is grouted by a trapezoidal concrete block to provide stability over the ballast. This sleeper ensures higher load capacity, longer durability, inert with the ballast material, easy manufacture and easy maintenance, cheaper than other concrete sleeper and eco-friendly in nature.



5458





(54) Title of the invention : "POLE MOUNTABLE DEVICE FOR MONITORING FLOW OF ENERGY" (51) International classification :G07F17/24 (71)Name of Applicant : (31) Priority Document No :NA 1)KLG SYSTEL LTD. (32) Priority Date :NA Address of Applicant :UNIT 3-6, TOWER-A, GROUND (33) Name of priority country :NA FLOOR, UNITECH BUSINESS PARK, F-BLOCK, SOUTH (86) International Application No :NA CITY-1, SECTOR41, GURGAON 122001, HARYANA, INDIA Filing Date :NA Haryana India (87) International Publication No :NA (72)Name of Inventor : (61) Patent of Addition to Application Number :NA 1)KANHAIYA LAL GOEL Filing Date :NA 2)KUMUD GOEL (62) Divisional to Application Number :189/DEL/2005 Filed on :31/01/2005 (57) Abstract : The present invention provides a method for converting any type of conventional meter into an electronic metering apparatus compatible for communicating with a server. The present invention also relates to an optoelectronic device mountable upon a meter for detecting / measuring the readings of the same and communicating to a server, said optoelectronic device comprising an optoelectronic sensor locatable upon the meter for sensing the optical pulses generated by the meter and generating / producing corresponding electrical pulse; the output of the optoelectronic sensor being coupled to an amplifying circuit for amplifying the electrical pulse thus generated and the output of the amplifying circuit being coupled to a counter for counting the electrical pulses thereby measuring / detecting the readings of the meter.



5459





(54) Title of the invention : "ELECTRONIC METERING APPARATUS COMPATIBLE FOR COMMUNICATION WITH A SERVER" (51) International classification :G07F17/24 (71)Name of Applicant : (31) Priority Document No :NA 1)KLG SYSTEL LTD. (32) Priority Date :NA Address of Applicant :UNIT 3-6 TOWER -A GROUND (33) Name of priority country :NA FLOOR, UNITECH BUSINESS PARK, F-BLOCK SOUTH (86) International Application No :NA CITY-1 SECTOR 41 GURGAON 122001, HARYANA, INDIA. Filing Date :NA Haryana India (87) International Publication No :NA (72)Name of Inventor : (61) Patent of Addition to Application Number :NA 1)KANHAIYA LAL GOEL Filing Date :NA 2)KUMUD GOEL (62) Divisional to Application Number :189/DEL/2005 Filed on :31/01/2005 (57) Abstract : The present invention belongs to the field of power (electricity) management in its distribution network. More particularly the invention pertains towards curtailing power revenue loss in the industry as well as increasing efficiency in the whole system.



5460





(54) Title of the invention : "PREPAID METERING APPARATUS" (51) International classification :G07F17/24 (71)Name of Applicant : (31) Priority Document No :NA 1)KLG SYSTEM LTD. (32) Priority Date :NA Address of Applicant :UNIT 3-6 TOWER-A, GROUND (33) Name of priority country :NA FLOOR,UNITECH BUSINESS PARK, F-BLOCK, SOUTH (86) International Application No :NA CITY-1, SECTOR 41, GURGAON, 122001, HARYANA, Filing Date :NA INDIA. Haryana India (87) International Publication No :NA (72)Name of Inventor : (61) Patent of Addition to Application Number :NA 1) KANHAIYA LAL GOEL Filing Date :NA 2)KUMUD GOEL (62) Divisional to Application Number :189/DEL/2005 Filed on :31/01/2005 (57) Abstract : The present invention belongs to the field of power (electricity) management in its distribution network. More particularly the invention pertains towards curtailing power ,



5461





(54) Title of the invention : A PERSONAL TOKEN COMPRISING A COMPRESSION AGENT :H04L9/00 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)AXALTO CARDS & TERMINALS INDIA LTD. (32) Priority Date :NA Address of Applicant :4TH FLOOR A WING, BERJAYA (33) Name of priority country :NA HOUSE COMMUNITY CENTER, NEW FRIENDS COLONY, (86) International Application No :NA NEW DELHI 110 065, INDIA. Delhi India Filing Date :NA (72)Name of Inventor : (87) International Publication No : NA 1)BAJANEMANE, SANTHOSH (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to a personal token (11,15) comprising a microprocessor and a memory, characterized in that it comprises a compression agent (12,16) for compressing data before the data are stored into the memory of the personal token (11,15).



5462





(54) Title of the invention : MICRO/NANO MIXING SYSTEM. :C08F2/44 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)DR. MARSHAL (32) Priority Date :NA Address of Applicant :VPO MADHOPURA, VIA(33) Name of priority country :NA BALARAN DISTT. SIKAR, RAJASTHAN, INDIA. Rajasthan (86) International Application No :NA India Filing Date :NA (72)Name of Inventor : (87) International Publication No :NA. 1)DR. MARSHAL, (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : In this present invention the micro/nano mixing system is depends on deposition of thin film on micro/nano channels based on silicon/glass/polymer substrate by plasma polymerisation process. These thin films can change the surface properties from hydrophobic to hydrophilic and vice versa. Hence, by controlling the surface properties of micro/nano channels (such as different hydrophilic and hydrophobic nature of the surface), the fluid flow velocity can be controlled accordingly. Therefore by tailoring the surface properties of these micro/nano channels in micro/nano devices it is possible to control the fluid velocity and hence we can control the mixing ratio. In addition in this system the reaction time of these fluids can also be controlled and a complete analysis system can be incorporated in it.



5463





(54) Title of the invention : A NOVEL BIO-ERODIBLE INSERT FOR OPHTHALMIC APPLICATIONS AND A PROCESS FOR THE PREPARATION THEREOF (51) International classification :A61K31/00 (71)Name of Applicant : (31) Priority Document No :NA 1)COUNCIL OF SCIENTIFIC & INDUSTRIAL (32) Priority Date :NA RESEARCH (33) Name of priority country :NA Address of Applicant :ANUSANDHAN BHAWAN, RAFI MARG, NEW DELHI-110001, INDIA. Delhi India (86) International Application No :NA Filing Date :NA (72)Name of Inventor : (87) International Publication No :NA 1)JANUMALA HADASSAH (61) Patent of Addition to Application Number :NA 2)PRAVEEN KUMAR SEHGAL Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention provides a novel bio-erodible ophthalmic insert a process for the preparation of the said bio-erodible insert. In the said process collagen is treated with organic polar solvents, hydrophilic polymers and therapeutically active substances under controlled conditions. The resulting solution is air dried in a dust free chamber to make collagen film. This film is cut into shape to obtain insert, which is subjected to cross-linking with UV irradiation followed by conventional sterilization. The prepared inserts are very effective for temporary punctal occlusion in various corneal conditions and are very effective to treat dry eye syndrome due to occupational conditions.



5464





(54) Title of the invention : 'CNS EFFECTIVE THYROTROPIN-RELEASING HORMONE ANALOGS'


(71)Name of Applicant : 1)NATIONAL INSTITUTE OF PHARMACEUTICAL EDUCATION AND RESEARCH (NIPER) :A61K9/02 Address of Applicant :SECTOR-67, S.A.S. NAGAR, :NA PUNJAB-160062, INDIA. Punjab India :NA (72)Name of Inventor : :NA 1)RAHUL JAIN :NA 2)VIKRAMDEEP MONGA :NA 3)NAVNEET KAUR :NA 4)SHYAM SUNDER SHARMA :NA 5)NILANJAN ROY :NA 6)SATYENDRA KUMAR :NA 7)JAIMEEN MAJUMDAR :NA 8)SANCHITA AGARWAL 9)CHANDRASHEKHAR PAWAR 10)RAMESHWAR U. KADAM 11)ARCHANA CHAVAN

(57) Abstract : The present invention provides novel TRH peptides of general formula (I) for the treatment and prevention of various CNS disorders including epilepsy, Parkinson, Alzheimer"s disease, cognition enhancement, cerebral ischemia and Motor Neuron Disease. These peptide also exhibit very high selectivity to one of two TRH receptor subtypes. It has been proposed by us that if analogues were developed with high selectivity for TRH-R2 receptor subtype, they could probably demonstrate more specific and selective profiles of CNS effects. Many of the peptides reported display promising and very high selectivity to TRH-R2. It is expected that development of these peptides as an ideal and effective CNS agents will add to already existing armament for the treatment of various CNS disorders.



5465





(54) Title of the invention : "PRILLING METHOD" :B29B9/00 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)HONEYWELL INTERNATIONAL INC. (32) Priority Date :NA Address of Applicant :101 COLUMBIA ROAD, P.O. BOX (33) Name of priority country :NA 2245, MORRISTOWN, NEW JERSEY 07960, U.S.A. U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)JAMES A. KWEEDER (87) International Publication No :NA 2)ARTHUR RAY SHIRLEY, JR. (61) Patent of Addition to Application Number :NA 3)KEITH D. COCHRAN, Filing Date :NA 4)TIMOTHY G. HOLT, (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A prilling method comprising the steps of: providing a molten first component, mixing at least a second component with the molten first component. reacting the components to form a shear-thinnable mixture: and prilling the shear-thinnable mixture wherein the prilling comprises mechanically agitating in the prill head to shear thin the sear-thinnable mixture sufficiently to permit prilling. The inventive method can be used to produce fertilizer product comprising ammonium sulfate nitrate.



5466





(54) Title of the invention : GLUCOCORTICOID RECEPTOR TARGETING FORMULATIONS FOR DELIVERING GENES TO CANCER CELLS (51) International classification :A61K (71)Name of Applicant : (31) Priority Document No :NA 1)COUNCIL OF SCIENTIFIC & INDUSTRIAL (32) Priority Date :NA RESEARCH (33) Name of priority country :NA Address of Applicant :ANUSANDHAN BHAWAN, RAFI (86) International Application No :NA MARG, NEW DELHI-11001, INDIA Delhi India Filing Date :NA (72)Name of Inventor : (87) International Publication No : NA 1)AMARNATH MUKHERJEE (61) Patent of Addition to Application Number :NA 2)RAJKUMAR BANERJEE Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Glucorticoid receptors (GR) express in various normal and cancer cells. A lot of ligand activated physiological functions are known involving GR but its role in cancer progression (if any) is not clearly understood. Synthetic GR antagonist, dexamethasone (Dex) finds use as anti-inflammatory drug and is known to induce apoptosis in cancer cells. This Dex is included in a cationic lipid-based formulation as a co-lipid to deliver to and express genes specifically in cancer cells possibly through expressed GR. Gene delivery to cancer cells is independent of the gene construct, and tumor cell line. Normal transformed cells expressing GR but with no cancer lineage show much smaller level of transfection. The composition of the formulation is optimized. The formulation may have particular application to the enhanced delivery of anticancer genetic constructs to cancer, with the synergistic effect of Dex in inducing apoptosis as such.



5467





(54) Title of the invention : 'BIASED SENSING MODULE' :H04J3/04 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)STMICROELECTRONICS PVT. LTD. (32) Priority Date :NA Address of Applicant :PLOT NO. 1, KNOWLEDGE PARK (33) Name of priority country :NA III, GREATER NOIDA-201308, U.P. Uttar Pradesh India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)TANMOY ROY (87) International Publication No :NA 2)NASIM AHMAD (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention provides a circuit and method for improving matching characteristics with an improved response time. The circuit includes a first pre-charge module, a first multiplexer module, a second pre-charge module, a second multiplexer module, a sense amplifier circuit, a third pre-charge module, an output module. The circuit is operatively coupled to a first core block and a second core block to provide the desired matching characteristics. The first core block and the second core block are memory blocks used for storing data bits for read-write operations. The circuit utilizes a unique operational coupling with one of the core blocks to provide the matching characteristics.



5468





(54) Title of the invention : "SOLDIER GEAR-THE MILITARY SUIT." :F41H1/02 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)SHADAV AHMAD ANSARI (32) Priority Date :NA Address of Applicant :121-A, Kandhari Bazar, Near (33) Name of priority country :NA Sudarshan Colony, Lal Bagh, Lucknow.-226001(UTTAR (86) International Application No :NA PRADESH) Uttar Pradesh India Filing Date :NA (72)Name of Inventor : (87) International Publication No :NA 1)SHADAV AHMAD ANSARI (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention of ours aims at saving the lives of Indian soldiers at War. Situations like maximum mobilization like Kargil War could have been avoided if we had the technology to know the position & strength of the enemy. Our project is designed to do just that.



5469





(54) Title of the invention : "IMPROVED PROCESS FOR THE PREPARATION OF SUBSTITUTED BENZOPYRAN IMIDAZOLIDINE DIONES" (51) International classification :C07D405/04 (71)Name of Applicant : (31) Priority Document No :NA 1)PANACEA BIOTEC LIMITED (32) Priority Date :NA Address of Applicant :B-1 EXTN.A/27 MOHAN CO(33) Name of priority country :NA OPERATIVE INDUSTRIAL ESTATE, MATHURA ROAD,NEW DELHI-110044 Delhi India (86) International Application No :NA Filing Date :NA (72)Name of Inventor : (87) International Publication No :NA 1)JAIN (61) Patent of Addition to Application Number :NA 2)RAJESH JINDAL Filing Date :NA 3)KOUR CHAND SINGH (62) Divisional to Application Number :NA 4)JASPAL Filing Date :NA (57) Abstract : Provided in the present invention is an improved, environment friendly and industrially viable process for the preparation of substituted benzopyran imidazolidine diones preferably 2-substituted-6-substituted-2,3-dihydrospiro-[4H-l-benzopyran-4,4"imidazolidine]-2,5'-diones represented by formula-I as described herein, or their pharmaceutically acceptable salts, derivatives, intermediates, esters, amides, solvates, hydrates, analogues, enantiomers, or mixtures thereof. More preferably the improved process describes the preparation of (2S,4S)-6-fluoro-2,3-dihydro-2\5'-dioxospiro-[4H-l-benzopyran-4,4'-imidazolidine]-2-carboxamide or its pharmaceutically acceptable salts, derivatives, intermediates, solvates, hydrates, analogues, enantiomers, or mixtures thereof represented by formula-II as described herein. The process of preparation is safe and efficient, and involves the use of cheaper and non-hazardous chemicals.



5470





(54) Title of the invention : "A NOVEL REFRIGERATION AND AIR-CONDTIONING SYSTEM" :F25B (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)ANINDA SIRCAR (32) Priority Date :NA Address of Applicant :91/26, Jadunath Sanyal Road, Lucknow, (33) Name of priority country :NA India Uttar Pradesh India (86) International Application No :NA 2)SUPARNA SIRCAR Filing Date :NA (72)Name of Inventor : (87) International Publication No :NA 1)ANINDA SIRCAR (61) Patent of Addition to Application Number :NA 2)SUPARNA SIRCAR Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to a novel refrigeration and air conditioning system. The said system comprises a container of compressed fuel gas, expansion valve, refrigeration unit and an engine / oven. More particularly, the said system is useful in application in vehicles and cold storages. (Figure 1)



5471





(54) Title of the invention : "ABRADING DEVICE AND SYSTEM AND METHOD OF USING" :F01L (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)3M INNOVATIVE PROPERTIES COMPANY (32) Priority Date :NA Address of Applicant :3M CENTER, POST OFFICE BOX (33) Name of priority country :NA 33427, SAINT PAUL, MINNESOTA 55133-3427,U.S.A. U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)KRISHNA KUMAR G. (87) International Publication No :NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A device for inducing a particle removal vacuum for an abrading tool is described, the device comprising a a housing defining a first air passageway and a second air passageway, an air regulator operable on the second air passageway, and an air splitter with at least three openings. The housing includes a first end, a second end and a third end. The first air passageway extends from the first end to the second end, and wherein the second air passageway extends from the third end of the housing to a cylindrical passageway encircled around a sleeve between the first end and the second end of the housing. The first air splitter opening is adapted to be coupled to an air source and a second air splitter opening is adapted to be coupled to the air regulator, and a third air splitter opening is adapted to be attached to an abrading tool. An abrading system comprising an abrading tool, a device coupled to the abrading tool, an air splitter, and an abraded particle collection bag coupled to the device, is also described. The air splitter includes a first air splitter opening, a second air splitter opening and a third air splitter opening, and the air splitter diverts a portion of the air from an air source to the device prior to the air from the air source entering the abrading tool. Also described, is a method of removing abraded particles from a surface comprising the steps of using an abrading tool to abrade a surface, providing pressurized air to drive the abrading tool, diverting a portion of the pressurized air to a device including a housing configured to induce a venturi-effect vacuum prior to the pressurized air entering the abrading tool, creating a vacuum in the housing of the device with the diverted pressurized air; and collecting at least a portion of the abraded particles with the vacuum.



5472





(54) Title of the invention : AURAL SKIMMING AND SCROLLING. :G01 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)YAHOO! INC. (32) Priority Date :NA Address of Applicant :701 FIRST AVENUE SUNNYVLE, (33) Name of priority country :NA CALIFORNIA 94089-0703 U.S. U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)SRINIVASAN H. SENGAMEDU (87) International Publication No :NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Computer-based skimming and scrolling of aurally presented information is described. Different levels of skimming are achieved in aural presentations with allowing a user to navigate an aural presentation according to significant points identified within an information source. The significant points are identified using various indicia that suggest logical arrangements for the information contained within the source, such as semantics, sjntax, typography, formatting, named entities, and markup tags. The identified significant points signal changes in playback mode for the audio presentation, such as different tones, pitches, volumes, or voices. Similar indicia may be used to generate identifying markers from the information source that can be aurally presented in lieu of the information source itself to allow for aural scrolling of the information.



5473





(54) Title of the invention : "BIO-DIESEL FROM FATTY ACIDS" :B01D17/02 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)PURI OIL MILLS LTD (32) Priority Date :NA Address of Applicant :JYOTI SHIKHAR BULIDING, (33) Name of priority country :NA DISTRICT CENTER, JANAKPURI, NEW DELHI-110058 Delhi (86) International Application No :NA India Filing Date :NA (72)Name of Inventor : (87) International Publication No :NIL 1)SANJAYTICKOO ,C/O PURI OIL MILLS LTD (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A process and system for obtaining bio-diesel from fatty acids acid catalyst, which is eco-friendly, with minimum losses and low level of hazards during the process. The biodiesel obtained from the process is very clean and pure and conforms to the BIS standards.



5474





(54) Title of the invention : 'PROCESS FOR THE PREPARATION OF AMINE DERIVATIVES AS CALCIMMETICS' :C07B57/00 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)IND-SWIFT LABORATORIES LIMITED (32) Priority Date :NA Address of Applicant :S.C.O NO 850 SHIVALIK (33) Name of priority country :NA ENCLAVE,NAC MANIMAJRA CHANDIGARH 160 101 (86) International Application No :NA INDIA Punjab India Filing Date :NA (72)Name of Inventor : (87) International Publication No :NIL 1)CHIDAMBARAM VENTESWARAN SRINIVASAN (61) Patent of Addition to Application Number :NA 2)PERMINDER SINGH JOHAR Filing Date :NA 3)LALIT WADHWA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to a novel process for preparing amine derivatives of formula I, as calcimimetics, wherein Ar/ or Ar2 is either naphthyl or phenyl optionally substituted with 0 to 5 substituents each independently selected from the group consisting of lower alkyl, halogen, lower alkoxy, lower thioalkyl, methylene dioxy, lower haloalkyl, lower haloalkoxy, OH, CH2OH, CONH2, CN, acetoxy; q is 0-2; and R is H, and pharmaceutically acceptable salts and complexes thereof, by reducing novel amide intermediates of formula II wherein Ar1 Ar2 and q are same as described above. Particularly the present invention relates to an industrially advantageous process for the preparation of cinacalcet hydrochloride using novel intermediate of formula VIII. wherein X is H, halo like chloro, bromo or iodo.



5475





(54) Title of the invention : SYNTHETIC GENE ENCODING A CHIMERIC ENDOTOXIN OF BACILLUS THURINGIENSIS :C12N15/09 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)INDIAN AGRICULTURAL RESEARCH INSTITUTE (32) Priority Date :NA Address of Applicant :NEW DELHI-110012 Delhi India (33) Name of priority country :NA (72)Name of Inventor : (86) International Application No :NA 1)POLUMETLA ANANDA KUMAR Filing Date :NA (87) International Publication No :NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention provides a means for plant protection against damage by a broad spectrum of insect pests. The invention comprises a chemically synthesized gene encoding a unique chimeric insecticidal protein (δ-endotoxin) of Bacillus thuringiensis. The chimeric δ-endotoxin comprises of Domain I of CrylAal, Domain II of CrylAbl and part of Domain III of CrylAcl and a part of Domain III of Cryl Fal. The unique chimeric protein is 624 amino acids in length. A synthetic gene was constructed based on DNA sequences of the native Bt structural genes (crylAal, crylAbl, crylAcl and crylFal). The sequences were modified in order to contain codons preferred by plant genes, to attain an A+T content in nucleotide base composition found in plants, and to eliminate sequences that cause destabilization. polyadenylation, degradation and termination of RNA and to avoid sequences that constitute RNA splice sites. In the synthetic gene codons used to specify a given amino acid were selected with regard to the distribution frequency of codon usage employed by plant genes to specify that amino acid. In addition, consideration was given to the percentage G+C content of the degenerate third base. The Bt gene designed for enhanced expression in plants was synthesized in fragments and assembled within a DNA plasmid vector. The synthetic Bt gene was then introduced into a tobacco plant and expressed. The chimeric insecticidal protein produced upon expression of the synthetic Bt gene in tobacco plants exhibited toxicity to Cotton bollworm and Tobacco caterpillar.



5476





(54) Title of the invention : "SYNTHETIC GENE ENCODING CRY 1 FAL δ- ENDOTOXIN OF BACILLUS THURINGIENSIS :C12N15/09 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)INDIAN AGRICULTURAL RESEARCH INSTITUTE (32) Priority Date :NA Address of Applicant :I.A.R.I., NEW DELHI 110 012, INDIA. (33) Name of priority country :NA Delhi India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)POLUMETLA ANANDA KUMAR (87) International Publication No :NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention provides a means for plant protection against aarrrage to crops, especially to tobacco and brinjal by insect pests, especially Spodoptera litura and Leucinodes orbonalis. The invention comprises a chemically synthesized gene encoding an insecticidal protein namely Cry lFal (endotoxin). The CrylFal 5-endotoxin protein is 616 amino acids in length. A synthetic gene was constructed based on DNA sequences of the native Bt structural genes (crylFal). The sequences were modified in order to contain codons preferred by plant genes, to attain an A+T content in nucleotide base composition found in plants, and to eliminate sequences that cause destabilization, polyadenylation, degradation and termination of RNA and to avoid sequences that constitute RNA splice sites. In the synthetic gene codons used to specify a given amino acid were selected with regard to the distribution frequency of codon usage employed by plant genes to specify that amino acid. In addition, consideration was given to the percentage G+C content of the degenerate third base. The Bt gene designed for enhanced expression in plants was synthesized in fragments and assembled within a DNA plasmid vector. The synthetic Bt gene was then introduced into tobacco and brinjal plants and expressed. The CrylFal insecticidal protein produced upon expression of the synthetic Bt gene in tobacco and brinjal plants exhibited toxicity to Tobacco caterpillar and Brinjal Shoot and Fruit borer.



5477





(54) Title of the invention : "NOVEL PHARMACEUTICAL COMPOSITION AND THE PROCESS FOR THE PREPARATION THEREOF" (51) International classification :A61K49/04 (71)Name of Applicant : (31) Priority Document No :NA 1)PANACEA BIOTEC LIMITED (32) Priority Date :NA Address of Applicant :B-1 Extn.A/27 Mohan Co-operative, (33) Name of priority country :NA Industrial Estate, Mathura Road, New Delhi 110044 Delhi India (72)Name of Inventor : (86) International Application No :NA Filing Date :NA 1)JAIN, (87) International Publication No :NA 2)RAJESH SINGH (61) Patent of Addition to Application Number :NA 3)SUKHJEET Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention describes novel pharmaceutical compositions for oral administration comprising eplerenone as an active agent or its pharmaceutically acceptable salts, polymorphs, solvates, hydrates, analogues, enantiomers, tautomeric forms or mixtures thereof, optionally with one or more pharmaceutically acceptable excipient(s) wherein the said composition comprises the said active agent in a dispersed or dissolved state. The present invention also provides process of preparing such novel compositions and therapeutic methods of using them.



5478





(54) Title of the invention : "NEEDLE LOOM WITH AUTOMATIC CHANGE OF THE WEFT THREAD." (51) International classification :D03D35/00 (71)Name of Applicant : (31) Priority Document No :NA 1)ZORINI LUIGI OMODEO (32) Priority Date :NA Address of Applicant :VIA DEI MILLE, 71, 27024 (33) Name of priority country :NA CILAVEGNA (PAVIA), ITALY. Italy (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)ZORINI LUIGI OMODEO (87) International Publication No :NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to a needle loom comprising a bearing structure (2), at least one textile-product (P) forming head (3) installed on the bearing structure (2), at least two heddle frames (6) capable of intercepting a plurality of wrap threads (O), at least one sickle (9) to bring at least two weft threads (T) transversely between the wrap threads (O), at least two movable guides (11) each of which is adapted to intercept one of the weft threads (T), actuator means (13) to shift the movable guides (11) and change the weft threads (T) carried by the sickle (9), at least one needle (18) to temporarily retain at least one of said at least two weft threads (T) carried by the sickle (9), and a reed (20) to compact the weft threads (T) against the already formed textile product (P). The acutator means (13) comprises at least two electric motors (21), each of which is connected to a respective guide (11) and motion-transmitting means (24) interposed between each electric motor (21) and the respective movable guide (11) to actively move the respective guide (11) in a first way (X) or in second way (Y) along the predetermined direction (D), upon command of the respective motor (21).



5479





(54) Title of the invention : "VEHICLE BUMPER STRUCTURE" (51) International classification (31) Priority Document No

:B60R (71)Name of Applicant : 19/02 1)TOYOTA JIDOSHA KABUSHIKI KAISHA :2006Address of Applicant :1,TOYOTA-CHO, TOYOTA-SHI, 262142 AICHI-KEN, 471-8571 JAPAN. Japan :27/09/2006 (72)Name of Inventor : :Japan 1)SAMPAIO SERGIO :NA :NA :NA :NA :NA :NA :NA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : In a vehicle bumper structure, a rear bumper absorber (20) of a rear bumper (10) and rear arms (14) are connected to each other by using a fitting unit instead of using bolts. In addition, a pipe member (38) is used instead of a rear bumper reinforcement member (60), and the pipe member (38) is placed in a recess (28) that is formed with the rear bumper absorber (20). As a result, the rear bumper absorber (20) and the pipe member (38), in cooperation, offer higher energy absorption performance. The fitting step is employed instead of the bolting step, which makes the assembly work easier. In addition, because the rear bumper reinforcement member is no longer necessary, a lighter bumper is provided.



5480





(54) Title of the invention : AN IMPROVED PROCESS FOR THE ALKYLATION OF PHENOLS (51) International classification

:C07C39/06; B01J31/00 :NA :NA :NA :NA :NA :NA :NA :NA :NA :NA

(71)Name of Applicant : 1)SECRETARY, DEPARTMENT OF SCIENCE AND TECHNOLOGY Address of Applicant :Technology Bhawan, New Mehrauli Road, New Delhi-110016 Delhi India (72)Name of Inventor : 1)PATEL, ANJALI, UDAY 2)BHATT, NIKUNJ, BHAGWATIPRASAD

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : I ABSTRACT Title : AN IMPROVED PROCESS FOR THE ALKYLATION OF PHENOLS. The present invention relates to an improved process for the selective alkylation of phenols using heteropolyacid catalyst supported onto zirconia under mild conditions. The process is economically viable since the catalyst regenerated after the initial reaction on further use gives the product in high yield.



5481





(54) Title of the invention : USING PLASMA POLYMERISED ACRYLIC ACID THIN FILMS FOR ROOM TEMPERATURE RECYCLABLE SUBSTRATE BONDING (51) International classification :G01N33/49 (71)Name of Applicant : (31) Priority Document No :NA 1)DR. MARSHAL (32) Priority Date :NA Address of Applicant :VPO- MADHOPURA, VIA(33) Name of priority country :NA BALARAN, DIST-SIkAR RAJASTHAN INDIA-332401 Rajasthan India (86) International Application No :NA Filing Date :NA (72)Name of Inventor : (87) International Publication No :NIL 1)DR. MARSHAL (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Abstract The plasma polymerized acrylic acid (ppAc) thin films were used for bonding of any types of substrate materials (such as polymer/silicon/glass) with and without micro/nuno structures. The plasma polymerised acrylic acid film show a good biocompatibilities for cell/tissue engineering therefore particularly using ppAc films for bonding micro/nano devices (such as micro fluidic, bio-MEMS etc.) can have additional advantages to biological applications of these micro/nano structured materials/devices. The substrate with ppAc thin films can also bond with any type of substrates without any coatings. This bonding process allows recycling and reusing the materials/devices/substrate.



5482





(54) Title of the invention : A PROCESS FOR GROWING PROBIOTIC LACTIC ACID BACTERIA AS A SOURCE OF BGALACTOSIDASE (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date

:A61K35/74 :NA :NA :NA :NA :NA :NA :NA :NA :NA :NA

(71)Name of Applicant : 1)DIRETOR GENERAL,MINISTRY OF DEFENCE RESEARSH & DEVELOPMENT ORGANIZATION Address of Applicant :DIRECTOEATE OF EXTRAMUNAL RES &IPR GROUP IIIRD FLOOR B WING ROOM NOS. 348 & 349, DRDO BHAWAN, RAJAJI MARG DHQPO, NEW DEHLI110011 Delhi India (72)Name of Inventor : 1)KARNA VENKATA RAMANA, 2)AJAY PAL 3)MAHANTESH MALLIKARJUN PATIL 4)AMARINDER SINGH BAWA

(57) Abstract : "A process for growing probiotic lactic acid bacteria as a source of 6-galactosidase". This invention relates to a process for the preparation of biofilm consisting of fe-galactosidase producing lactic acid bacteria, wherein Soypeptone 2.5-3 gm, Yeast extract 5-6 gm, lactose 15-17.5 gm, Sodium acetate 5-6 gm, magnesium sulphate 0.1-0.2 gm, dipotassium hydrogen phosphate 3-4 gm, protein hydrolysate 100-125 ml dissolved in 1000 ml distilled water, pH adjusted to 5.8-6.5, sterilized, cooled, 10-15 ml of 96 hr old lactobacillus sp. Inoculum added, incubated at 30-35°C in a temperature controlled incubator for a period of 96-120 hrs, the bacterial biofilm removed by decanting; the growth medium used as inoculum for fresh hatches in the ratio of this broth: fresh medium around 1:3, wherein the biofilm weighing 5-5.5 gm was suspended in 100 ml of phosphate buffer pH 6.5 (0.1-0.05 M), centrifuged at 1000012000 rpm for 15-20 minutes each time, then suspended in 50 ml of phosphate buffer to which added 50 ml of cold ethanol and the mixture allowed to stand at 30-35°C for 60-90 mins, centrifuged at 10000-12000 rpm for 15-20 mins. (MONA SAINI) OFL.S.DAVAR&CO., APPLICANTS ATTORNEY.



5483





(54) Title of the invention : DETERMINING LOGICALLY-RELATED SUB-STRINGS OF A STRING. :G01 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)Yahoo! Inc. (32) Priority Date :NA Address of Applicant :701 First Avenue Sunnyvale, California (33) Name of priority country :NA 94089-0703 US. U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)Jignashu G. Parikh (87) International Publication No :NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Techniques are provided for determining which sub-strings of a string are logically related to the string. In one embodiment, substrings of a string are considered logically related to the string if the sub-strings frequently appear as queries in the same sessions in which the string itself appears as a query. Information about strings and their logically-related sub-strings is stored in a "splitsdictionary". Once generated, the splits-dictionary may be used by the search engine for a variety of purposes, including the suggestion of alternative queries. The splits-dictionary may also be used by the search engine for other purposes, such as to affect the ranking of search results.



5484





(54) Title of the invention : METHOD AND SYSTEM OF EXECUTING A SOFTWARE APPLICATION IN HIGHLY CONSTRAINED MEMORY SITUATION. (51) International classification :G06F17/30 (71)Name of Applicant : (31) Priority Document No :NA 1)FREESCALE SEMICONDUCTOR, INC (32) Priority Date :NA Address of Applicant :6501 WILLIAM CANNON DRIVE (33) Name of priority country :NA WEST, AUSTIN, TEXAS 78735,U.S.A. U.S.A. (72)Name of Inventor : (86) International Application No :NA Filing Date :NA 1)SINHA, RAJESH KUMAR (87) International Publication No :NIL 2)PANDAY VIVEK (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : ABSTRACT A method and system for executing a software application having a binary size that is larger than an available memory space in an embedded system from which the software application will execute. The software application is split into one or more initialization sequences and a main code sequence. The method includes loading (302) each initialization sequence of the one or more initialization sequences in the memory space prior to its execution, and executing (304) each initialization sequence of the one or more initialization sequences out of the memory space. Further, the method includes loading (306) the main code sequence in the memory space after the execution of the one or more initialization codes and then executing (308) the main code sequence out of the memory space.



5485





(54) Title of the invention : "A SENSE AMPLIFIER PROVIDING LOW CAPACITANCE WITH REDUCED RESOLUTION TIME" (51) International classification :H03K19/003 (71)Name of Applicant : (31) Priority Document No :NA 1)STMICROELECTRONICS PVT. LTD (32) Priority Date :NA Address of Applicant :PLOT NO 1, KNOWLEDGE PARK (33) Name of priority country :NA III, GREATER NOIDA -201308, UP, INDIA Uttar Pradesh India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)ANKUR GOEL (87) International Publication No :NIL 2)MUDIT BHARGAVA (61) Patent of Addition to Application Number :NA 3)SHISHIR KUMAR Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : ABSTRACT The present invention provides a sense amplifier circuit for providing a high speed sensing with a high speed read operation, with a low capacitance and a low resolution time. The sense amplifier circuit includes a latch circuit having a first inverter circuit and a second inverter circuit cross coupled with each other. The amplifier circuit includes a first discharge device and a second discharge device operatively coupled to the first inverter circuit and the second inverter circuit respectively. The amplifier circuit further includes a first PMOS transistor operatively coupled between the first discharge device and a bit line, and a second PMOS transistor operatively coupled between the second discharge device and a complementary bit line. The amplifier circuit further includes a first NMOS transistor operatively coupled between the first discharge device and a ground voltage, a second NMOS transistor operatively coupled between the second discharge device and the ground voltage. The amplifier further includes a pull down circuit and a delay circuit. The delay circuit produces delay between two control signals. The circuit includes a first NOT gate and a second NOT gate operatively coupled to a first latch output node and a second latch output node respectively to provide an output data corresponding to a data stored in a memory cell.



5486





(54) Title of the invention : "LOW DENSITY SPREADING METHODS FOR SOMATIC EMBRYOGENESIS" :C12N15/82 (71)Name of Applicant : (51) International classification (31) Priority Document No :60/827,376 1)WEYERHAEUSER COMPANY (32) Priority Date :28/09/2006 Address of Applicant :POST OFFICE BOX 9777 FEDERAL (33) Name of priority country :U.S.A. WAY, WASHINGTON 98063-9777,USA. U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)JAMES A GROB (87) International Publication No :NA 2)STEPHANIE A BRUSIG (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : In one aspect, the present invention provides methods of producing conifer cotyledonary somatic embryos from pre-cotyledonary embryos. The methods of this aspect of the invention include the step of (a) dispensing a plurality of pre-cotyledonary embryos onto a porous material horizontally disposed over a non-porous surface in a volume of sterile dilution medium sufficient to submerge at least the surface of the porous material, thereby uniformly dispersing the pre-cotyledonary embryos; (b) removing the sterile dilution medium from the non-absorbent porous material, thereby trapping the uniformly dispersed pre-cotyledonary embryos on the porous material; and (c) contacting the pre-cotyledonary embryos trapped on the porous material with development medium for a period of time sufficient to produce conifer cotyledonary somatic embryos.



5487





(54) Title of the invention : "A PROCESS FOR MANUFACTURE OF DE-GUMMED CRUDE MUSTARD OIL" :A23K1/00 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)PURI OIL MILLS LTD. (32) Priority Date :NA Address of Applicant :302, JYOTI SHIKHAR BUILDING, (33) Name of priority country :NA DISTRICT CENTER, JANAKPURI, NEW DELHI-110 058, (86) International Application No :NA INDIA. Delhi India Filing Date :NA (72)Name of Inventor : (87) International Publication No :NA 1)SANJAY TICKOO (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to a process and system for obtaining degummed mustard oil directly from mustard seeds in a natural way by applying aqueous solution of edible food grade weak acid to seeds to degum it and sending the grind material to a series of expellers for further extraction. Silica gel is added to the oil to remove remaining moisture and lecithin. The oil is then passed through press filter and micro filter successively to obtain natural degummed mustard oil and lecithin containing cake.



5488





(54) Title of the invention : HERBAL COMPOSITION FOR MAINTAINING/CARING THE SKIN AROUND THE EYE, METHODS OF PREPARING THE SAME AND USES THEREOF (51) International classification :B60J7/00 (71)Name of Applicant : (31) Priority Document No :NA 1)MMI CORPORATION (32) Priority Date :NA Address of Applicant :Bank of Nova Scotia Building, P.O. (33) Name of priority country :NA Box 30088, S. M. B. George Town, Grand Cayman, Cayman Islands, British West Indies Cayman Island (86) International Application No :NA Filing Date :NA (72)Name of Inventor : (87) International Publication No :NILL 1)MITRA, SHANKAR KUMAR (61) Patent of Addition to Application Number :NA 2)SAXENA, EKTA Filing Date :NA 3)BABU, UDDAGIRI VENKANNA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Disclosed is a novel herbal composition for maintaining/caring the skin around the eye, the composition comprising extracts of Saxifraga ligulata syn. Bergenia ligulata, Cipadessa baccifera and Emblica officinalis and cosmeceutical excipients thereof. Also disclosed is a method of extraction, delivery system comprising the same and use thereof.



5489





(54) Title of the invention : "METHOD AND SYSTEM FOR CREATING DIGITAL CONTENT TO RECONSTRUCT A VIDEO FRAME" (51) International classification :H04N5/91 (71)Name of Applicant : (31) Priority Document No :NA 1)MOTOROLA, INC (32) Priority Date :NA Address of Applicant :1303 E. ALGONQUIN ROAD , (33) Name of priority country :NA SCHAUMBURG, IL 60196, UNITED STATES OF AMERICA U.S.A. (86) International Application No :NA Filing Date :NA (72)Name of Inventor : (87) International Publication No :NIL 1)ANURAG GOEL (61) Patent of Addition to Application Number :NA 2)SHAILESH RAMAMURTHY Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A method and system for creating digital content in a video frame is provided. The method comprises generating (304) a first interpolation data for the plurality of pixel positions and the plurality of neighboring sub-pixel positions by computing a plurality of customized filtered values in the video frame during a motion-estimation process. Further, the method comprises determining (306) a motion vector by using the plurality of filtered values. Moreover, the method comprises generating (308) a second interpolation data for the plurality of pixel position and the plurality of sub-pixel positions in the video frame during a motion-compensation process and using (310) the plurality of customized compensated filtered values, along with the results obtained from an adjusting filter, to generate a plurality of adjusted compensated filtered values.



5490





(54) Title of the invention : "ORGANIC LIGHT EMITTING MATERIALS WITH ANIONIC LIGAND" (51) International classification :C07F 15/00 (71)Name of Applicant : (31) Priority Document No :60/404,087 1)THE UNIVERSITY OF SOUTHERN CALIFORNIA (32) Priority Date :16/08/2002 Address of Applicant :3716 SOUTH HOPE STREET, SUITE 313, LOS ANGELES, CALIFORNIA 90007-4344, USA U.S.A. (33) Name of priority country :U.S.A. :PCT/US2003/025936 (72)Name of Inventor : (86) International Application No Filing Date :18/08/2003 1)MARK E.THOMPSON (87) International Publication No :WO 2004/017043 2)PETER I. DJUROVICH (61) Patent of Addition to Application 3)JIAN LI :NA Number :NA Filing Date (62) Divisional to Application Number :631/DELNP/2005 Filed on :17/02/2005 (57) Abstract : Emissive phosphorescent organometallic compounds that produce electroluminescence and organic light emitting devices employing such emissive phosphorescent organometallic compounds are provided. More specifically the present invention is directed to novel primarily non-emitting ligands which produce a blue shift in emitted light when associated with a cyclometallated ligand.



5491





(54) Title of the invention : "NEGATIVE WOUND THERAPY SYSTEM" (51) International classification

:A61B18/18; (71)Name of Applicant : A61B18/18 1)TYCO HEALTHCARE GROUP LP Address of Applicant :15 HAMPSHIRE STREET :60/847,886 :28/09/2006 MANSFIELD, MASSACHUSETTS 02048, U.S.A. U.S.A. :U.S.A. (72)Name of Inventor : :NA 1)SHARON MULLIGAN :NA 2)DAVID FINK :NA 3)DAVID HEAGLE :NA :NA :NA :NA

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A portable system for subatmospheric pressure therapy in connection with healing a surgical wound, includes a wound dressing dimensioned for positioning relative to a wound bed of a subject, a portable subatmospheric pressure mechanism dimensioned to be carried or worn by the subject and a container for collecting exudates from the wound bed removed under the subatmospheric pressure supplied by the subatmospheric pressure mechanism. The portable subatmospheric pressure mechanism includes a housing, a subatmospheric pressure source disposed within the housing and in fluid communication with the wound dressing to supply subatmospheric pressure to the wound dressing and a power source mounted to or within the housing for supplying power to actuate the subatmospheric pressure source.



5492





(54) Title of the invention : 'A HIERACHRICAL CODING/DECODING DEVICE' (51) International classification :G10L 19/14 (71)Name of Applicant : (31) Priority Document No :0552199 1)FRANCE TELECOM (32) Priority Date :13/07/2005 Address of Applicant :6,PLACE D’ALLERARY, 75015 PARIS, FRANCE. France (33) Name of priority country :France :PCT/FR2006/050690 (72)Name of Inventor : (86) International Application No Filing Date :07/07/2006 1)STEPHANE REGOT (87) International Publication No :WO 2007/007001 2)DAVID VIRETTE (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention concerns a hierarchical encoding system for an audio signal, comprising, at least one core parametric encoding core layer by analysis by synthesis in a first frequency band, a band extending layer designed to enlarge said first frequency band into a second frequency band, called extended band. The invention is characterized in that the system further comprises a layer for enhancing the audio encoding quality in the extended band, based on a transform encoding using a spectral parameter derived from said band extending layer. The invention is applicable to the transmission of speech and/or audio signals on packet networks.



5493





(54) Title of the invention : "A RING BINDER MECHANISM WITH A SLIDING HINGE PLATE" (51) International classification

:E05D7/12; E05D7/00 :11/536,486 :28/09/2006 :U.S.A. :NA :NA :NA :NA :NA :NA :NA

(71)Name of Applicant : 1)WORLD WIDE STATIONERY MFG.CO.LTD Address of Applicant :19/F, KOON WAH MIRRORS FACTORY, 3RD INDUSTRIAL BUILDING, 5-9 KA HING RD., KWAI CHUNG, NEW TERRITORY, HONG KONG Hongkong(China) (72)Name of Inventor : 1)HUNG YU CHENG

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A ring binder mechanism for retaining loose-leaf pages comprises a housing and first and second hinge plates supported by the housing for pivoting movement. Ring members are mounted on the hinge plates for movement with the hinge plates between closed and open positions. Hook-shaped formations on fee ends of the ring members lock the ring members together when closed. The first hinge plate is slidable relative to the second hinge plate in a direction along a longitudinal axis of the housing for disengaging the hook-shaped formations and allowing the ring members to open. An actuator may be mounted on the housing for moving the first hinge plate to disengage the hook-shaped formations. In addition, friction buffers may be positioned between the hinge plates for aiding the sliding movement of the first hinge plate relative to the second hinge plate.



5494





(54) Title of the invention : "AIR DISTRIBUTION DUCT IN THE PASSENGER COMPARTMENT OF A MOTOR VEHICLE" (51) International classification :B62D 25/14 (71)Name of Applicant : (31) Priority Document No :05 51596 1)RENAULT S.A.S. (32) Priority Date :14/06/2005 Address of Applicant :13-15,QUAI LE GALLO,F-92100 BOULOGNE BILLANCOURT, FRANCE France (33) Name of priority country :France :PCT/FR2006/050462 (72)Name of Inventor : (86) International Application No Filing Date :19/05/2006 1)JEREMIE COIFFIER (87) International Publication No :WO 2006/134285 2)XAVIER BILLARD (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to an air circulation device for a motor vehicle passenger compartment comprising at least one rigid hollow cross member (1) for reinforcing the vehicle structure and an air distribution duct (2), wherein said device is characterised in that said cross member (1) is provided with a hollow section (1a) and a tubular section (1b) which are interconnected by a connecting piece (1c) fitting the shapes of the parts (1a, 1b) of the cross member (1) and assuring the rigidity of said assembly.



5495





(54) Title of the invention : EDGE BASED COMMUNICATION (51) International classification :H04L 12/66 (71)Name of Applicant : (31) Priority Document No :11/173,281 1)MICROSOFT CORPORATION (32) Priority Date :01/07/2005 Address of Applicant :ONE MICROSOFT WAY, REDMOND WASHINGTON 98052-6399 U.S.A. (33) Name of priority country :U.S.A. :PCT/US2006/024956 (72)Name of Inventor : (86) International Application No Filing Date :27/06/2006 1)CHURCH, KENNETH, W. (87) International Publication No :WO 2007/005413 2)WANG, KUANSAN (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An edge-based gateway (102) is employed to provide communication data routing and filtering via a plurality of communication mechanisms (108 and 110), selected independently of central authority. The communication mechanisms (108 and 110) include POTS, cellular networks and Internet. Each user (112) can constrain the gateway functionality.



5496





(54) Title of the invention : "COOLING DEVICES HAVING A PLURALITY OF CONTROLLABLE COOLING ELEMENTS TO PROVIDE A PREDETERMINED COOLING PROFILE" (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date

:A61F7/00 (71)Name of Applicant : :11/528,225 1)JUNIPER MEDICAL INC :26/09/2006 Address of Applicant :4698 WILLOW ROAD, SUITE 100, :U.S.A. PLEASANTON, CALIFORNIA 94565, USA U.S.A. :PCT/US07/64018 (72)Name of Inventor : :14/03/2007 1)MITCHELL LEVINSON : 2)JESSE NICASIO ROSEN (87) International Publication No WO/2008/039557 3)WILLIAM PENNYBACKER (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A cooling device for removing heat from subcutaneous lipid-rich cells of a subject having skin is provided. The cooling device includes a plurality of cooling elements movable relative to each other to conform to the contour"s of the subject"s skin. The cooling elements have a plurality of controllable thermoelectric coolers. The cooling elements can be controlled to provide a time-varying cooling profile in a predetermined sequence, can be controlled to provide a spatial cooling profile in a selected pattern, or can be adjusted to maintain constant process parameters, or can be controlled to provide a combination thereof.



5497





(54) Title of the invention : "METHOD AND DEVICE FOR WATERMARKING TIMESTAMPS, METHOD AND DEVICE FOR DECODING TIMESTAMPS" (51) International classification :G06T 1/00 (71)Name of Applicant : (31) Priority Document No :0507872 1)THOMSON LICENSING (32) Priority Date :22/07/2005 Address of Applicant :46 QUAI ALPHONSE LE GALLO, F(33) Name of priority country :France 92100 BOULOGNE-BILLANCOURT, FRANCE. France (86) International Application No :PCT/EP2006/064495 (72)Name of Inventor : Filing Date :21/07/2006 1)SEVERINE BAUDRY AND PHILIPPE NGUYEN (87) International Publication No : WO/2007/010030 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to a method for watermarking at least one time stamp in a support data set consisting, for each time stamp, in associating (11) at a given time a value of a reference data timestamping signal to the time stamp, which is embodied in the form of a deterministic time-varying signal in a given time point and in writing s(t), wherein t is incremented according to an increment pitch equal to a predetermined time unit and in watermarking (12) said value in the support data set. The invention also relates to a corresponding decoding method consisting in reading in the support data set at least one value of a dephased time stamp signal which has the same shape that said reference data time stamp signal, but comprising, with res...



5498





(54) Title of the invention : AUTOMATICALLY GENERATING RULES FOR CONNECTION SECURITY (51) International classification :H04K 1/00 (71)Name of Applicant : (31) Priority Document No :11/183,317 1)MICROSOFT CORPORATION (32) Priority Date :15/07/2005 Address of Applicant :ONE MICROSOFT WAY, REDMOND,WASHINGTON 98052-6399 USA. U.S.A. (33) Name of priority country :U.S.A. :PCT/US2006/027263 (72)Name of Inventor : (86) International Application No Filing Date :13/07/2006 1)BASSETT, CHARLES D (87) International Publication No :WO 2007/011673 2)BAHL,PRADEEP (61) Patent of Addition to Application 3)CARBAUGH, IAN M :NA Number 4)KOPPOLU, LOKESH SRINIVAS :NA Filing Date 5)NOY, MAKSIM (62) Divisional to Application Number :NA 6)WAHLERT, SARAH A Filing Date :NA 7)YARIV,ERAN (57) Abstract : A method and system for creating security policies (1 12) for firewall (122) and connection policies in an integrated manner is provided The security system provides a user interface through which a user can define a security rule that specifies both a firewall policy and a connection policy After the security rule is specified, the security system automatically generates a firewall rule and a connection rule to implement the security rule The security system provides the firewall engine that is responsible for enforcing the firewall rules and provides the connection rule to an IPsec engine that is responsible for enforcing the connection rules



5499





(54) Title of the invention : ACTIVE CONTENT TRUST MODEL (51) International classification :G06F 17/30 (71)Name of Applicant : (31) Priority Document No :11/647,448 1)MICROSOFT CORPORATION (32) Priority Date :27/06/2005 Address of Applicant :ONE MICROSOFT WAY, REDMOND, WASHINGTON 98502-6399 USA. U.S.A. (33) Name of priority country :U.S.A. :PCT/US2006/17583 (72)Name of Inventor : (86) International Application No Filing Date :08/05/2006 1)REDDISH, ANDREW DOUGLAS (87) International Publication No :WO/2007/001635 2)ROGERSON, DALE ELTON (61) Patent of Addition to Application 3)MCROBERTS,JUSTIN SHANE :NA Number 4)CHAVDA, PRAFUL PRATAP :NA Filing Date 5)CHANDRASHEKAR,SRIDHAR (62) Divisional to Application Number :NA 6)DONG, WENLONG Filing Date :NA (57) Abstract : A computer-implemented method of providing security in a help system includes receiving a call from a calling application to access active content. A determination is made, based on predetermined criteria, which execution mode to use to access the active content. The active content is then accessed in the determined execution mode.



5500





(54) Title of the invention : GRAMMATICAL PARSING OF DOCUMENT VISUAL STRUCTURES (51) International classification :G06K 9/72 (71)Name of Applicant : (31) Priority Document No :11/173,280 1)MICROSOFT CORPORATION (32) Priority Date :01/07/2005 Address of Applicant :ONE MICROSOFT WAY, REDMOND WASHINGTON 98052-6399 U.S.A. (33) Name of priority country :U.S.A. (86) International Application No :PCT/US2006/026140 (72)Name of Inventor : Filing Date :30/06/2006 1)VIOLA, PAUL A (87) International Publication No :WO 2007/005937 2)SHILMAN, MICHAEL (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A two-dimensional representation of a document is leveraged to extract a hierarchical structure that facilitates recognition of the document. The visual structure is grammatically parsed utilizing two-dimensional adaptations of statistical parsing algorithms. This allows recognition of layout structures (e.g., columns, authors, titles, footnotes, etc.) and the like such that structural components of the document can be accurately interpreted. Additional techniques can also be employed to facilitate document layout recognition. For example, grammatical parsing techniques that utilize machine learning, parse scoring based on image representations, boosting techniques, and/or "fast features" and the like can be employed to facilitate in docume...



5501





(54) Title of the invention : RADIO LABELED TRIPEPTIDE AND ITS PROCESS THEREOF (51) International classification :C12N15/09 (71)Name of Applicant : (31) Priority Document No :NA 1)DIRECTOR GENERAL (32) Priority Date :NA Address of Applicant :Ministry of Defence, DRDO lll Floor, (33) Name of priority country :NA 'B' Wing, Room:348 & 349, DRDO Bhawan, Rajaji Marg,DHQ (86) International Application No :NA PO, New Delhi-110011 Delhi India Filing Date :NA (72)Name of Inventor : (87) International Publication No :NIL 1)MITTAL GAURAV (61) Patent of Addition to Application Number :NA 2)CHUTTANI KRISHNA Filing Date :NA 3)SHARMA RAJNISH (62) Divisional to Application Number :NA 4)SHARMA RAKESH KUMAR Filing Date :NA 5)MISHRA ANIL KUMAR (57) Abstract : RADIO LABELED TRIPEPTIDE AND ITS PROCESS THEREOF ABSTRACT The invention relates to an infection imaging agent comprising of aZadjb 1 glycosylated-tripeptide and method of preparing such peptides. Specifically the invention relates to Technetium-99m labeled glycosylated-tripeptide having amino acid sequence Leu-His-Ile and capable of acting as an effective infection imaging agent for an early diagnosis of microbial infections in mammalian bodies by using gamma scintigraphy. The radiolabeled glycosylated tri-peptide is stable in vitro even after 24 hours of the formulation under physiological conditions.



5502





(54) Title of the invention : "NOVEL ANTI-IGF-IR ANTIBODIES AND USES THEREOF" (51) International classification :C07K 16/28 (71)Name of Applicant : (31) Priority Document No :0507829 1)PIERRE FABRE MEDICAMENT (32) Priority Date :22/07/2005 Address of Applicant :45,PLACE ABEL GANCE, 92100 BOULOGNE-BILLANCOURT,FRANCE France (33) Name of priority country :France :PCT/EP2006/064543 (72)Name of Inventor : (86) International Application No Filing Date :21/07/2006 1)LILIANE GOETSCH (87) International Publication No :WO 2007/012614 2)NATHALIE CORVAIA (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to novel antibodies capable of binding specifically to the human insulin-like growth factor I receptor (IGF-IR). The invention likewise comprises the use of these antibodies as a medicament for the prophylactic and/or therapeutic treatment of cancers overexpressing IGF-IR, stimulated either by IGF1 and/or IGF2, or any pathology connected with the overexpression of said receptor as well as in processes or kits for diagnosis of illnesses connected with the overexpression of the IGFIR and/or the IGF-I / Insulin hybrid receptor.



5503





(54) Title of the invention : "DETERMINING USABILITY OF A CODED FILE FOR AN APPLICATION" (51) International classification :G06T 9/00 (71)Name of Applicant : (31) Priority Document No :02019211.8 1)SONY ERICSSON MOBILE COMMUNICATIONS AB (32) Priority Date :27/08/2002 Address of Applicant :S-221 88 LUND, SWEDEN. Sweden (72)Name of Inventor : (33) Name of priority country :EPO :PCT/EP2003/009395 1)HENRIK SUNDSTROM (86) International Application No Filing Date :25/08/2003 (87) International Publication No :WO 2004/021283 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention is directed towards a method and an electronic device for determining usability of a coded file in an application as well as to a computer program product and a computer program medium including program code for performing the method. The electronic device comprises at least one file matching unit associated with an application, which receives (50) at least one property of a code file, matches (52) the property against the application, generates (54) an indication indicating if the file can be used in the application or not based on the matching, and associates (56) the indication with the coded file for later enabling fast decision about use of the file in the application.



5504





(54) Title of the invention : "METHOD AND APPARATUS FOR MANAGING DISC DEFFECTS USING TEMPORARY DEFECT MANAGEMENT INFORMATION (TDFL) AND TEMPORARY DEFECT MANAGEMENT INFORMATION (TDDS), AND DISC HAVING THE TDFL AND TDDS" (51) International classification :G11B 7/0037 (71)Name of Applicant : (31) Priority Document No :PCT/KR2003/001931 1)SAMSUNG ELECTRONICS CO.,LTD (32) Priority Date :22/09/2003 Address of Applicant :416, MAETAN-DONG, YEONGTON(33) Name of priority country :PCT GU, SUWON-SI, GYEONGGI-DO 442-742, REPUBLIC OF (86) International Application No :PCT/KR2003/001931 KOREA Republic of Korea Filing Date :22/09/2003 (72)Name of Inventor : (87) International Publication No :WO 2004/036561 1)HWANG, SUNG-HEE (61) Patent of Addition to Application 2)KO, JUNG-WAN :NA Number 3)LEE, KYUNG-GEUN :NA Filing Date (62) Divisional to Application Number :1294/DELNP/2005 Filed on :31/03/2005 (57) Abstract : A disc having an updatable defect management area used by an apparatus for managing defects on the disc, the disc including a user data area which includes user data, a spare area that is a substitute area for a defect existing in the user data area, and an area in which are recorded an address of data that is last recorded in the user data area and an address of a replacement data recorded in the spare area. Accordingly, the disc defect management method and apparatus are applicable to a recordable disc such as a write-once disc while effectively using a defect management area of the disc.



5505





(54) Title of the invention : "SYSTEM OF DIVERSITY DIPOLE ANTENNAS" (71)Name of Applicant : (51) International classification :H01Q 1/12 (31) Priority Document No :0552401 1)THOMSON LICENSING Address of Applicant :46 QUAI ALPHONSE LE GALLO, F(32) Priority Date :01/08/2005 92100 BOULOGNE-BILLANCOURT, FRANCE. France (33) Name of priority country :France :PCT/EP2006/064415 (72)Name of Inventor : (86) International Application No Filing Date :19/07/2006 1)PHILIPPE MINARD (87) International Publication No : WO/2007/014855 2)JEAN-FRANCOIS PINTOS (61) Patent of Addition to Application 3)ALI LOUZIR :NA Number 4)PHILIPPE GILBERTON :NA Filing Date 5)JEAN-LUC ROBERT (62) Divisional to Application Number :NA 6)CORINNE NICOLAS Filing Date :NA (57) Abstract : The invention relates to a system of diversity antennas comprising at least two dipole antennas each formed of a first and of a second conducting arm with differential supply, in which the two antennas comprise a common arm (10) called the first arm forming at least one cover for an electronic card and each comprise a second arm (11, 12) rotationally mounted at one end of the first arm.



5506





(54) Title of the invention : "NOVEL EXTENDED RELEASE PHARMACEUTICAL COMPOSITION AND PROCESS OF PREPARATION THEREOF." (51) International classification :A61K9/20 (71)Name of Applicant : (31) Priority Document No :NA 1)PANACEA BIOTEC LIMITED (32) Priority Date :NA Address of Applicant :B-1 Extn.A/27 Mohan Co-operative, (33) Name of priority country :NA Industrial Estate,Mathura Road,NEW DELHI-110044 Delhi India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)JAIN (87) International Publication No :NA 2)RAJESH JINDAL (61) Patent of Addition to Application Number :NA 3)KOUR CHAND Filing Date :NA 4)DEVARAJAN (62) Divisional to Application Number :NA 5)SAMPATH KUMAR Filing Date :NA (57) Abstract : Novel extended release pharmaceutical compositions are provided comprising a core, wherein the core comprises a water soluble active agent which is venlafaxine or alfuzosin or pramipexole or rivastigmine, or its pharmaceutically acceptable salts, derivatives, isomers, polymorphs, solvates, hydrates, analogues, enantiomers, tautomeric forms or mixtures thereof; at least one water insoluble non-swellable polymer(s), at least one hydration inhibitor(s), at least one lubricant(s), and optionally one or more pharmaceutically acceptable excipient(s); and at least one coat; wherein the said composition provides therapeutic concentrations of active agent for extended periods of time. Also provided are process of preparation of such compositions and methods of using them.



5507





(54) Title of the invention : "METHODS AND SYSTEM FOR FAST SESSION ESTABLISHMENT BETWEEN EQUIPMENT USING H.324 AND RELATED TELECOMMUNICATIONS PROTOCOLS" (51) International classification :H04L 29/06 (71)Name of Applicant : (31) Priority Document No :60/433,252 1)DILITHIUM NETWORKS PTY LIMITED (32) Priority Date :12/12/2002 Address of Applicant :LEVEL 7,3 SMAIL (33) Name of priority country :U.S.A. STREET,BROADWAY,NSW 2007,AUSTRALIA Australia (86) International Application No :PCT/AU2003/001662 (72)Name of Inventor : Filing Date :12/12/2003 1)MARWAN JABRI (87) International Publication No :WO 2004/054221 2)CRAIG SOUTHEREN (61) Patent of Addition to Application 3)ROBERT JONGBLOED :NA Number 4)DAVID JACK :NA Filing Date 5)DAVID MYERS (62) Divisional to Application Number :2234/DELNP/2005 6)ALBERT WONG Filed on :26/05/2005 (57) Abstract : Methods of establishing multimedia telecommunication (a multimedia "call") between equipment ("terminals"). More particularly, the invention provides methods for reducing the time required to establish calls between terminals that implement the ITU-T H.324 Recommendation and other Standards and Recommendations derived from or related to this such as the 3G-324M recommendation developed and adopted by the Third Generation Partnership Projects (3GPP and 3GPP2). More specifically, it relates to (i) a method and apparatus for concatenating the H.245 messages that are required to pass between the terminals at the start of the call to establish the capabilities of both terminals and agree on the type and format of media and data to be exchanged (...



5508





(54) Title of the invention : "SYSTEM FOR MEASURING DIMENSIONS INSIDE A HOLLOW SHAFT,PARTICULARLY ONE BELONGING TO AN AERONAUTICAL TURBOMASHINE" (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : NA.

:B25B (71)Name of Applicant : 23/14 1)SNECMA :0650864 Address of Applicant :2 BOULEVARD DU GENERAL :14/03/2006 MARTIAL VALIN, 75015 PARIS,FRANCE. France :France (72)Name of Inventor : :NA 1)ALAIN FEILLIAS :NA 2)DOMINIQUE LOURDIN : NA 3)BERNARD PAILLARSE :NA 4)CHRISTOPHE PINCHON :NA :NA :NA



5509





(54) Title of the invention : "METHODS AND SYSTEM FOR FAST SESSION ESTABLISHMENT BETWEEN EQUIPMENT USING H.324 AND RELATED TELECOMMUNICATIONS PROTOCOLS" (51) International classification :H04L 29/06 (71)Name of Applicant : (31) Priority Document No :60/433,252 1)DILITHIUM NETWORKS PTY LIMITED (32) Priority Date :12/12/2002 Address of Applicant :LEVEL 7,3 SMAIL STREET, (33) Name of priority country :U.S.A. BROADWAY, NSW 2007,AUSTRALIA Australia (86) International Application No :PCT/AU2003/001662 (72)Name of Inventor : Filing Date :12/12/2003 1)MARWAN JABRI (87) International Publication No :WO 2004/054221 2)CRAIG SOUTHEREN (61) Patent of Addition to Application 3)ROBERT JONGBLOED :NA Number 4)DAVID JACK :NA Filing Date 5)DAVID MYERS (62) Divisional to Application Number :2234/DELNP/2005 6)ALBERT WONG Filed on :26/05/2005 (57) Abstract : Methods of establishing multimedia telecommunication (a multimedia "call") between equipment ("terminals"). More particularly, the invention provides methods for reducing the time required to establish calls between terminals that implement the ITU-T H.324 Recommendation and other Standards and Recommendations derived from or related to this such as the 3G-324M recommendation developed and adopted by the Third Generation Partnership Projects (3GPP and 3GPP2). More specifically, it relates to (i) a method and apparatus for concatenating the H.245 messages that are required to pass between the terminals at the start of the call to establish the capabilities of both terminals and agree on the type and format of media and data to be exchanged (...



5510





(54) Title of the invention : "AIR FILTER ASSEMBLY FOR FILTERING AN AIR STREAM TO REMOVE PARTICULATE MATTER ENTRAINED IN THE STREAM" (51) International classification :B01D 39/16 (71)Name of Applicant : (31) Priority Document No :NA 1)DONALDSON COMPANY,INC. (32) Priority Date :Address of Applicant :1400 WEST 94TH STREET,P.O.BOX (33) Name of priority country : 1299, MINNEAPOLIS,MINNESOTA 55440-1299,USA U.S.A. (86) International Application No :PCT/US01/25111 (72)Name of Inventor : Filing Date :10/08/2001 1)COGINS,MARK A (87) International Publication No :WO 02/20133 2)WEIK,THOMAS M (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :00278/DELNP/2003 Filed on :03/03/2003 (57) Abstract : Filter arrangements for industrial air cleaners include a barrier media, usually pleated, treated with a deposit of fine fiber. The media is particularly advantageous in high temperature (greater than 140 °F) operating environments.



5511





(54) Title of the invention : "BEARING POSITIONING STRUCTURE FOR MOTOR" (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country

:F16C19/50 :095132909 :06/09/2006 :Chinese Taipei :NA :NA :NA :NA :NA :NA :NA

(71)Name of Applicant : 1)SUNONWEALTH ELECTRIC MACHINE INDUSTRY CO.,LTD. Address of Applicant :12TH FLOOR, 120 CHUNG CHENG 1ST ROAD, LING YA DT., KAOHSIUNG CITY, TAIWAN,REPUBLIC OF CHINA China (72)Name of Inventor : 1)ALEX HORNG 2)LU,YU-YUAN 3)SAN,TO-NIEN

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A bearing positioning structure for a motor includes an axial positioning member. The positioning member includes a pressing portion and a coupling portion. The coupling portion of the positioning member is engaged with a coupling section of the axial tube for securely mounting the positioning member to the axial tube, with the pressing portion of the positioning member pressing against a bearing to position the bearing in the axial tube. In another example, the coupling portion of the positioning member engages with a coupling section on a stator.



5512





(54) Title of the invention : A SUSPENSION MECHANISM FOR A MULTI-AXLE VEHICLE. :G01P15/00 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)DOLEY JYOTI KUMAR (32) Priority Date :NA Address of Applicant :DG II, 49A VIKASPURI, NEW DELHI (33) Name of priority country :NA Delhi India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)DOLEY JYOTI KUMAR (87) International Publication No :NILL (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : ABSTRACT OF THE INVENTK A suspension mechanism for a multi axle vehicle consisting of a hydraulic cylinder (3.) having shaft keys (4.) on its outer surface, is mounted in between assy lever (6.) and link shackles (13.) which in turn is being connected to the rear suspension (1.). The spring bracket (5a.) is placed just below the shaft keys (4.). The leaf spring (14.) containing two rods (15.) at both of its ends, is placed in between the suspension (1.) and rear axle (17.).The connecting rods (15.) execute a scissoring action at (16.) on the chassis (10.). By using this mechanism at each sides of rear axle of the vehicle improvement in fuel efficiency & speed are achieved.



5513





(54) Title of the invention : "A DEVICE FOR FINALLY ESTIMATING SYMBOLS IN A RADIO SYSTEM" (51) International classification :G06F7/00 (71)Name of Applicant : (31) Priority Document No :9602999.6 1)TELEFONAKTIEBOLAGET LM ERICSSON (PUBL) (32) Priority Date :16/08/1996 Address of Applicant :S-164 83 STOCKHOLM, SWEDEN. (33) Name of priority country :Sweden Sweden (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)KARLSSON, JONAS (87) International Publication No :NA 2)TEDER, PAUL (61) Patent of Addition to Application Number :NA 3)EWERBRING, LARS-MAGNUS Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A receiver device (703) downspreads signals from a band spreading signal, which generates downspread symbol sequences (803). A vector generator (704) generates symbol vectors (805) which include a symbol from each downspread symbol sequence (803). An auxiliary receiver (705) detects symbol vectors (805) in a first window (809) with the length of one symbol time. The auxiliary receiver (705) generates provisional estimates of the symbol vectors (805) with the help of a device with a first window algorithm (811). A delaying module (706) delays the symbol vectors (805) from the vector generator (704) by one symbol time before they reach a main receiver (707). The main receiver (707) detects in a second window (806) the symbol vectors (805) with the length of one symbol time. The main receiver (707) uses a device with a second window algorithm (808) in order to estimate the received symbol vectors (805) with reference taken to the previously estimated symbol vectors in the main receiver (705) and the provisional estimates of the symbol vectors (805) from the auxiliary receiver (705). A component generator (710) divides up the estimated symbol vectors (807) from the main receiver into separate components (815). Publication Figure: Figure 8.



5514





(54) Title of the invention : "SECURE TUNNEL OVER HTTPS CONNECTION" :H04L29/06 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)MICROSOFT CORPORATION (32) Priority Date :NA Address of Applicant :ONE MICROSOFT WAY (33) Name of priority country :NA REDMOND, W A 98052 USA U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)VIKAS JAIN (87) International Publication No :NIL 2)MADAN APPIAH (61) Patent of Addition to Application Number :NA 3)KADIRVEL CHOCKALINGAM VANNIARAJAN Filing Date :NA 4)SAMIR JAIN (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : SECURE TUNNEL OVER HTTPS CONNECTION ABSTRACT OF THE DISCLOSURE Many secure tunnels require protocols that require special handling, authorization or security certificates, such as L2TP and PPTP. This often eliminates them for use between a corporate or agency network and outside, public networks. A secure socket tunnel protocol (SSTP) adds drivers in both the kernel and user mode to route standard protocol traffic, such as PPP, over a common HTTPS port. In the event of network interruptions, an exchange of a session cookie allows fast reconnection of the underlying HTTPS connection without affecting higher level applications.



5515





(54) Title of the invention : "A LONG-SHELF LIFE PAROTHA WITH BETTER SENSORY ATTRIBUTES" :B02C4/06 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)DIRECTOR GENERAL (32) Priority Date :NA Address of Applicant :348, B-Wing, DRDO Bhawan, Rajaji (33) Name of priority country :NA Marg, New Delhi-110 011. Delhi India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)MOHAMMED AYUB KHAN (87) International Publication No : NA 2)ANIL DUTT SEMWAL (61) Patent of Addition to Application Number :NA 3)GOPAL KUMAR SHARMA Filing Date :NA 4)MOHAMMED KHALID (62) Divisional to Application Number :NA 5)KADABA ANANTHARAMAN SRIHARI Filing Date :NA 6)AMRINDER SINGH BAWA (57) Abstract : ABSTRACT "A long shelf-life parotha with better sensory attributes" This invention relates to a long shelf-life parotha with better sensory attributes comprising of:- lOOgm of wheat flour, 0.075-0.125% of sorbic acid, 0.001-0.01% of Nisin, 0.125-0.175% of chelating agent, 1.7-1.9% of salt, 2.5-3.5% of sugar, 1.5-2.5% of skimmed milk powder, and 12-18% of lipid. (MONA SAINI) OFL.S.DAVAR&CO., APPLICANTS ATTORNEY



5516





(54) Title of the invention : "BACK GROUND MUSIC (BGM)." (51) International classification

:G10K15/04; H04H1/00 :NA :NA :NA :NA :NA : NA :NA :NA :NA :NA

(71)Name of Applicant : 1)M/S CELLEBRUM.COM PVT LTD Address of Applicant :M/S Cellebrum.com Pvt Ltd, First Floor, Himuda Commercial Complex, Opposite Hotel Shiwalik, Kalka-Shimla Highway, Parwanoo, District: Solan (H.P.)-173220 Himachal Pradesh India (72)Name of Inventor : 1)SAKET AGGARWAL

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The invention relates to a call environment system that allows a subscriber to selectively create an environment during a call. The environment may be background music or sounds and may be predefined by the subscriber or may be selected both before and during the call. The invention also provides for a call environment system that allows the subscriber to predefine background music for a specific caller or a group of callers



5517





(54) Title of the invention : "ALLOCATING BURST DATA UNITS TO AVAILABLE TIME-SLOTS." (51) International classification

:H04B7/26, H04J3/00 :NA :NA :NA :NA :NA :NIL :NA :NA :NA :NA

(71)Name of Applicant : 1)INTEL CORPORATION Address of Applicant :2200 MISSION COLLEGE BOULEVARD, SANTA CLARA CA 95052, UNITED STATES OF AMERICA U.S.A. (72)Name of Inventor : 1)UDAYA SHANKARA

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : ABSTRACT A network device of a network environment may support burst switched technology. The network device may comprise a burst generator, a scheduler, and a content addressable memory to allocate the bursts to earliest available time slots. The burst generator may generate bursts, which may comprise packets having a common destination address. The scheduler may generate one or more content addressable memory entries comprising bits, which represent the time slots, generate key based on the size of the burst, and allocating the bursts to the earliest available time slots. The available time slots may be determined by comparing the key with the content addressable memory entries.



5518





(54) Title of the invention : "METHOD, APPARATUS AND COMPUTER SYSTEM FOR AIR MOVER LID COOLING" :G06F1/20 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)INTEL CORPORATION (32) Priority Date :NA Address of Applicant :2200 MISSION COLLEGE (33) Name of priority country :NA BOULEVARD,SANTA CLARA,CA 95052,UNITED STATES (86) International Application No :NA OF AMERICA U.S.A. Filing Date :NA (72)Name of Inventor : (87) International Publication No :NILL 1)KRISHNAKUMAR VARADARAJAN (61) Patent of Addition to Application Number :NA 2)ANANDAROOP BHATTACHARYA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : METHOD, APPARATUS AND COMPUTER SYSTEM FOR AIR MOVER LID COOLING ABSTRACT Some embodiments of a method, apparatus and computer system are described for cooling a lid with an air mover. A computer system may include a frame and a display with a heat spreader and one or more air movers. In some embodiments, the one or more air movers may include a piezoelectric fan, a synthetic jet, a centrifugal fan, a coaxial fan, an axial fan, or a propeller fan. Moreover, in some embodiments, the air movers may be integrated into or formed as part of the heat spreader"s structure. Other embodiments are described.



5519





(54) Title of the invention : METHOD APPARATUS AND COMPUTER SYSTEMS FOR LID COOLING (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date

(71)Name of Applicant : :G06F1/20 1)INTEL CORPORATION :NA Address of Applicant :2200 MISSION COLLEGE :NA BOULEVARD SANTA CLARA , CA 95052 USA U.S.A. :NA (72)Name of Inventor : :NA 1)KRISHNAKUMAR VARADARAJAN :NA 2)HIMANSHU POKHARNA :NIL 3)NA :NA 4)NA :NA 5)NA :NA 6)NA :NA 7)NA

(57) Abstract : METHOD, APPARATUS AND COMPUTER SYSTEM FOR LID COOLING ABSTRACT Some embodiments of a method, apparatus and computer system are described for cooling a lid. A computer system may include a frame and a display with a heat spreader and one or more thermoconductive conduits. In some embodiments, the one or more thermoconductive conduits may include a heat pipe, a sealed tube, or a graphite spreader. Furthermore, the one or more conduits may be constructed from aluminum, copper, or graphite. In some . embodiments, the one or more thermoconductive conduits may be round, flat, curved, zigzagged, bent, or flexible, and positioned to provide increased thermal conductivity. Moreover, in some embodiments, the conduits may be integrated into or formed as part of the heat spreader"s structure. Other embodiments are described.



5520





(54) Title of the invention : METHOD OF MAKING A HARDCOVER BOOK AND HARDCOVER APPARATUS (51) International classification :B42C 11/04 (71)Name of Applicant : (31) Priority Document No :10/262,721 1)POWIS PARKAR INC. (32) Priority Date :02/10/2002 Address of Applicant :775 HEINZ AVENUE, BERKELEY, CA 94710 (US) U.S.A. (33) Name of priority country :U.S.A. :PCT/US2003/029337 (72)Name of Inventor : (86) International Application No Filing Date :15/09/2003 1)PARKER, KEVIN, P. (87) International Publication No :WO 2004/030927 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A method of fabricating a book from a bound stack of sheets (15) and a hardcover assembly (18) having first (18A) and second (18B) relatively rigid cover sections separated by a spine region (18C). A layer of pressure sensitive adhesive (30) is disposed over the inner surfaces of the cover sections, with there being a pair of release liners (36) covering both the pressure sensitive adhesive layers (30). The book is assembled by placing the hardcover assembly (18) on a surface and removing one of the release liners (36) from one of the pressure sensitive adhesive layers (30). The bound stack (15) is then positioned on the hardcover assembly (18), preferably using a guide apparatus (40) to ensure proper positioning, so that the one end sheet ...



5521





(54) Title of the invention : "METHODS AND SYSTEM FOR FAST SESSION ESTABLISHMENT BETWEEN EQUIPMENT USING H.324 AND RELATED TELECOMMUNICATIONS PROTOCOLS" (51) International classification :H04L 29/06 (71)Name of Applicant : (31) Priority Document No :60/433,252 1)DILITHIUM NETWORKS PTY LIMITED (32) Priority Date :12/12/2002 Address of Applicant :LEVEL 7,3 SMAIL (33) Name of priority country :U.S.A. STREET,BROADWAY,NSW 2007,AUSTRALIA. Australia (86) International Application No :PCT/AU2003/001662 (72)Name of Inventor : Filing Date :12/12/2003 1)MARWAN JABRI (87) International Publication No :WO 2004/054221 2)CRAIG SOUTHEREN (61) Patent of Addition to Application 3)ROBERT JONGBLOED :NA Number 4)DAVID JACK :NA Filing Date 5)DAVID MYERS (62) Divisional to Application Number :2234/DELNP/2005 6)ALBERT WONG Filed on :26/05/2005 (57) Abstract : Methods of establishing multimedia telecommunication (a multimedia "call") between equipment ("terminals"). More particularly, the invention provides methods for reducing the time required to establish calls between terminals that implement the ITU-T H.324 Recommendation and other Standards and Recommendations derived from or related to this such as the 3G-324M recommendation developed and adopted by the Third Generation Partnership Projects (3GPP and 3GPP2). More specifically, it relates to (i) a method and apparatus for concatenating the H.245 messages that are required to pass between the terminals at the start of the call to establish the capabilities of both terminals and agree on the type and format of media and data to be exchanged (...



5522





(54) Title of the invention : "SYSTEM AND METHOD FOR PREVENTING ACCESS TO DATA ON A COMPROMISED REMOTE DEVICE" (51) International classification :G06F 11/30 (71)Name of Applicant : (31) Priority Document No :60/402,287 1)VISTO CORPORATION Address of Applicant :275 SHORELINE DRIVE, SUITE 300, (32) Priority Date :09/08/2002 REDWOOD SHORES, CA 94065, USA. U.S.A. (33) Name of priority country :U.S.A. (86) International Application No :PCT/US2003/025795 (72)Name of Inventor : Filing Date :09/08/2003 1)MENDEZ, DANIEL (87) International Publication No :WO 2004/015576 2)NG, MASON (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :875/DELNP/2005 Filed on :07/03/2005 (57) Abstract : This invention discloses a system (100) and method for selective erasure, encryption and or copying of data (121) on a remote device (120) if the remote device has been compromised or the level of authorization of a roaming user in charge of the remote device (120) has been modified.



5523





(54) Title of the invention : "A PROCESS FOR JOINING TWO OR MORE METAL PARTS" (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filed on

:B23K 1/00 (71)Name of Applicant : :60/233755 1)METGLAS,INC. :15/09/2000 Address of Applicant :440 ALLIED DRIVE, CONWAY, :U.S.A. SOUTH CAROLINA 29526, USA. U.S.A. :PCT/US01/28651 (72)Name of Inventor : :14/09/2001 1)ANATOL RABINKIN :WO 02/22299 :NA :NA :IP 406/DELNP/2003 :18/03/2003

(57) Abstract : Methods for the manufacture of assemblies which included brazed components and in which nickel/chromium-based filler metals are used wherein the manufactured assemblies are characterized by low leaching rates of nickel in water and water-based fluids, are disclosed. More specifically, there are disclosed methods for the manufacture of a heat exchanger or other assembly which method includes a brazing step, as well as a post-brazing conditioning step for treating the heat exchanger or other assembly. The manufactured heat exchangers and other assemblies are particularly useful in the handling of materials intended for human consumption such as water, beverages or food as the manufactured heat exchangers or other assemblies are characterized ...



5524





(54) Title of the invention : FIRE EXTINGUISHING DEVICE AND EXTINGUISHING HEAD (51) International classification :A62C 5/02 (71)Name of Applicant : (31) Priority Document No :P.375521 1)TELESTO SP. Z O.O. (32) Priority Date :05/06/2005 Address of Applicant :UL. LUDWINOWSKA 17, 02-856 WARSZAWA, POLAND. Poland (33) Name of priority country :Poland :PCT/PL2006/000037 (72)Name of Inventor : (86) International Application No Filing Date :29/05/2006 1)DUDA, LUDOMIR (87) International Publication No :WO 2006/132557 2)TARNOGRODZKI, ANTONI (61) Patent of Addition to Application 3)LADA, ZYGMUNT :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The fire extinguishing device is equipped with double-flow extinguishing head including side and central header, water pump /P/ connected to an extinguishing liquid source, particularly to water tank /Wl/ auxiliary tank /W2/ including the proportioning system, particularly for foaming agent, connected to the water pump /P/ circuit, compressor /S/, and a dual-line fire-hose whose water-line is connected to the side header and delivery side of the water pump /P/ and the gas-line is connected to the central header and the compressor /S/, The water pump /P/ is connected to hose water-line through two- way shut-off valve /ZA4/, whose second pass is connected, by connecting conduit, to the fire-hose gas-line through the first non-return valve /ZZ...



5525





(54) Title of the invention : PROVIDING A MULTICAST SERVICE USING A MULTICAST GROUP-SOURCE KEY (71)Name of Applicant : (51) International classification :H04L 9/00 (31) Priority Document No :11/137,597 1)CISCO TECHNOLOGY, INC. Address of Applicant :170 WEST TASMAN DRIVE, SAN (32) Priority Date :22/05/2005 JOSE, CA 95134 (US). U.S.A. (33) Name of priority country :U.S.A. :PCT/US2006/016918 (72)Name of Inventor : (86) International Application No Filing Date :01/05/2006 1)OSWAL, ANAND K. (87) International Publication No : WO/2006/127220 2)IYER, JAYARAMAN R. (61) Patent of Addition to Application 3)WEI, LIMING :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Providing a multicast service to a mobile node includes receiving a first request to join a multicast group from a first cell site. The first request requests that a first mobile node be permitted to join the multicast group. A first multicast source operable to provide content to the first mobile node is identified. The multicast group and the first multicast source are associated to yield a first group-source combination. A first key is assigned to the first group-source combination, and the first key is provided to the first cell site.



5526





(54) Title of the invention : "EXTENDED RELEASE TABLET OF PREGABALIN" :A61K9/22 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)RANBAXY LABORATORIES LIMITED (32) Priority Date :NA Address of Applicant :1956 Head Office at 12th Floor, Devika (33) Name of priority country :NA Tower, 6 Nehru Place, New Delhi-110019, India Delhi India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)SUNIL KHATAK (87) International Publication No :NA 2)SUBHASIS DAS (61) Patent of Addition to Application Number :NA 3)ANUPAM TREHAN Filing Date :NA 4)VINOD KUMAR ARORA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to an extended release tablet of pregabalin comprising pregabalin, at least one rate controlling polymer and other pharmaceutically acceptable excipients; and process for the preparation thereof.



5527





(54) Title of the invention : "INHIBITORS OF PHOSPHODIESTERASE TYPE-IV"


(71)Name of Applicant : 1)RANBAXY LABORATORIES LIMITED Address of Applicant :12th FLOOR, DEVIKA TOWER,6,NEHRU PLACE, NEW DELHI-110019, INDIA Delhi India :C07D417/14 (72)Name of Inventor : :NA 1)SONALI RUDRA :NA 2)NIDHI GUPTA :NA 3)LALIT KUMAR BAREGAMA :NA 4)RITU AGARWAL :NA 5)VINAYAK VASANTRAO KHAIRNAR :NIL 6)SASWATI CHAKLADAR :NA 7)MANDADAPU RAGHU RAMAIAH :NA 8)NAGARAJAN MUTHUKAMAL :NA 9)SARALA BALACHANDEAN :NA 10)SARIKA RAMNANI 11)VENKATA P PALLE 12)SUNANDA G. DASTIDAR 13)ABHIJIT RAY 14)LALITHA VIJAYKRISHNAN

(57) Abstract : The present invention relates to catechol derivatives, which can be used as selective inhibitors of phosphodiesterase (PDE) type IV. Compounds disclosed herein can be useful in the treatment of CNS disorders, inflammatory diseases such as, AIDS, asthma, arthritis, bronchitis, chronic obstructive pulmonary disease (COPD), psoriasis, allergic rhinitis, shock, atopic dermatitis, Crohn"s disease, adult respiratory distress syndrome (ARDS), eosinophilic granuloma, allergic conjunctivitis, osteoarthritis, ulcerative colitis and other inflammatory diseases especially in humans. Processes for the preparation of disclosed compounds are provided, as well as pharmaceutical compositions containing the disclosed compounds, and their use as phosphodiesterase (PDE) type IV inhibitors.



5528





(54) Title of the invention : "PHOSPHODIESTERASE INHIBITORS" :C07D473/04 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)RANBAXY LABORATORIES LIMITED (32) Priority Date :NA Address of Applicant :12th FLOOR, DEVIKA TOWER,6 (33) Name of priority country :NA NEHRU PLACE, NEW DELHI-110019 INDIA Delhi India (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)SARALA BALACHANDRAN (87) International Publication No : NA 2)NIDHI GUPTA (61) Patent of Addition to Application Number :NA 3)VINAYAK VASANTRAO KHAIRNAR Filing Date :NA 4)SONALI RUDRA (62) Divisional to Application Number :NA 5)VENKATA P PALLE Filing Date :NA 6)SUNANDA G. DASTIDAR (57) Abstract : The present invention relates to phosphodiesterase (PDE) type IV selective inhibitors. Compounds disclosed herein can be useful in the treatment of CNS diseases, AIDS, asthma, arthritis, bronchitis, chronic obstructive pulmonary disease (COPD), psoriasis, allergic rhinitis, shock, atopic dermatitis, Crohn"s disease, adult respiratory distress syndrome (ARDS), eosinophilic granuloma, allergic conjunctivitis, osteoarthritis, ulcerative colitis and other inflammatory diseases especially in humans. Processes for the preparation of disclosed compounds, pharmaceutical compositions containing the disclosed compounds, and their use as PDE type IV selective inhibitors, are provided.



5529





(54) Title of the invention : "METHOD OF PROTECTING ANIMAL HIDES AND LEATHER FROM MICROBIAL ATTACK, BY TREATING THE HIDES OR THE LEATHER WITH A MIXTURE CONTAINING AT LEAST ONE FUNGICIDAL REACTIVE ACTIVE COMPOUND" (51) International classification :A01N 31/08 (71)Name of Applicant : (31) Priority Document No :100 46 265.0 1)BAYER AKTIENGESELLSCHAFT (32) Priority Date :19/09/2000 Address of Applicant :D-51368 LEVERKUSEN, GERMANY. (33) Name of priority country :Germany Germany (86) International Application No :PCT/EP01/10303 (72)Name of Inventor : Filing Date :07/09/2001 1)HEINZ-JOACHIM ROTHER (87) International Publication No : WO/2002/023985 2)HARTMUT-REHBEIN (61) Patent of Addition to Application 3)MARTIN KUGLER :NA Number :NA Filing Date (62) Divisional to Application Number :00333/DELNP/2003 Filed on :10/03/2003 (57) Abstract : The invention relates to the use of combinations of active ingredients, containing phenolic and fungicidal active ingredients, for preserving animal skins and leather.,



5530





(54) Title of the invention : "AUTOMATIC INITIATION OF COMMUNICATIONS" (51) International classification :G06F 17/30 (71)Name of Applicant : (31) Priority Document No :11/137,475 1)NOKIA CORPORATION (32) Priority Date :26/05/2005 Address of Applicant :KEILALAHDENTIE 4, FIN-02150 ESPOO, FINLAND. Finland (33) Name of priority country :U.S.A. :PCT/IB2006/001291 (72)Name of Inventor : (86) International Application No Filing Date :16/05/2006 1)NURMINEN, JUKKA K. (87) International Publication No :WO 2006/126052 2)IVANFI,ZOLTAN (61) Patent of Addition to Application 3)BAKOS, BALAZS :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A selection of a contact is received from a user. This contact is within a content item, such as a word processing document, a hypertext document, an e-mail, a spreadsheet, or an electronic presentation. The user receives an indication of one or more connection channels associated with the contact and the user makes a selection a designated connection channel from the one or more connection channels. Upon this selection a device (such as a portable communications device) is instructed to establish communications across the designated connection channel. This connection channel may be, for example, a telephone number, an SMS number, an e-mail address, or a uniform resource locator (URL).



5531





(54) Title of the invention : "ADAPTED AUDIO RESPONSE" (71)Name of Applicant : (51) International classification :G10L 21/02 (31) Priority Document No :11/131,913 1)BOSE CORPORATION Address of Applicant :THE MOUNTAIN, FRAMINGHAM, (32) Priority Date :18/05/2005 MASSACHUSETTS 01701-9168,USA U.S.A. (33) Name of priority country :U.S.A. :PCT/US2006/019193 (72)Name of Inventor : (86) International Application No Filing Date :17/05/2006 1)DANIEL M.GAUGER, JR. (87) International Publication No : WO/2006/125061 2)CHRISTOPHER B.ICKLER (61) Patent of Addition to Application 3)NATHAN HANAGAMI :NA Number 4)EDWIN C.JOHNSON JR. :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Adapting an audio response addresses perceptual effects of an interfering signal, such as of a residual ambient noise or other interference in an earpiece of a headphone. In one aspect, an input audio signal is presented substantially unmodified when it is at levels substantially above the interfering signal and is compressed when at or below the level of the interfering signal. The approach can make use of a measured level of an acoustic signal, for example, within an earpiece of a headset, and use the measured level in conjunction with the level of an input audio signal to determine compression characteristics without requiring separation of an interfering signal present in the monitored acoustic signal from a component related to the inp...



5532





(54) Title of the invention : "KININ ANTAGONISTS FOR TREATING BLADDER DYSFUNCTION" (51) International classification :A61K 45/00 (71)Name of Applicant : (31) Priority Document No :05014581.2 1)JERINI AG (32) Priority Date :05/07/2005 Address of Applicant :INVALIDENSTR.130, D-10115 BERLIN,GERMANY. Germany (33) Name of priority country :EPO :PCT/EP2006/006504 (72)Name of Inventor : (86) International Application No Filing Date :04/07/2006 1)GIBSON CHRISTOPH (87) International Publication No :WO 2007/003411 2)HUMMEL GERD (61) Patent of Addition to Application 3)KNOLLE, JOCHEN :NA Number 4)REINEKE, ULRICH :NA Filing Date 5)TRADLER, THOMAS (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention is related to the use of a kinin receptor antagonist for the manufacture of a medicament for the treatment and/or prevention of bladder dysfunction, whereby the kinin receptor is selected from the group comprising Bl and B2 receptors.



5533





(54) Title of the invention : "METHOD FOR DISABLING A MOBILE DEVICE" (51) International classification :H04Q 7/32 (71)Name of Applicant : (31) Priority Document No :05104060.8 1)SONY ERICSSON MOBILE COMMUNICATION AB (32) Priority Date :16/05/2005 Address of Applicant :S-221 88 LUND, SWEDEN Sweden (72)Name of Inventor : (33) Name of priority country :EPO :PCT/EP2006/004428 1)TOM GAJDOS (86) International Application No Filing Date :11/05/2006 2)MARTIN KRETZ (87) International Publication No :WO 2006/122700 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Methods for disabling a mobile device (1) having communication capabilities. A message comprising disabling data for disabling at least one functionality of the mobile device (1) is transmitted from a control center (2) to the mobile device (1) . The disabling data comprises data for altering program instructions for at least one functionality of the mobile device (1) , thereby disabling said functionality. A mobile device (1) and a control center (20) are configured for implementing the methods.



5534





(54) Title of the invention : "SYSTEM AND METHOD FOR EFFICIENTLY TRACKING AND DATING CONTENT IN VERY LARGE DYNAMIC DOCUMENT SPACES" (51) International classification :G06F 17/30 (71)Name of Applicant : (31) Priority Document No :60/672,256 1)COLLAGE ANALYTICS LLC. (32) Priority Date :18/04/2005 Address of Applicant :1652 48TH STREET BROOKLYN, (33) Name of priority country :U.S.A. NEW YORK 11204 (US) U.S.A. (86) International Application No :PCT/US2006/014441 (72)Name of Inventor : Filing Date :18/04/2006 1)GORDON, RAZ (87) International Publication No : WO/2006/113644 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Systems and methods are provided for tracking the origins and dates of a document or piece of content by finding similar or exact matching documents or pieces of content stored in an index. The index may include current and non-current documents along with associated information for each document. By parsing each document using various schemes, it is possible to correlate similar or matching documents. Using such document correlations, it is possible to determine the origins and earlier dates of a particular document.



5535





(54) Title of the invention : "A SYSTEM FOR THE APPLICATION OF A SPRAY IN THE EYE" (71)Name of Applicant : (51) International classification :A61M 15/00 (31) Priority Document No :102 41 640.0 1)BOEHRINGER INGELHEIM PHARMA GMBH & (32) Priority Date :05/09/2002 CO.KG Address of Applicant :BINGER STRASSE 173, D-55216 (33) Name of priority country :Germany :PCT/EP2003/009442 INGELHEIM, GERMANY Germany (86) International Application No (72)Name of Inventor : Filing Date :26/08/2003 (87) International Publication No : WO/2004/022244 1)JORG SCHIEWE (61) Patent of Addition to Application 2)GILBERT WUTTKE :NA Number 3)BERND ZIERENBERG :NA Filing Date 4)STEPHEN DUNNE (62) Divisional to Application Number :442/DELNP/2005 5)HORST WERGEN Filed on :04/02/2005 (57) Abstract : The invention relates to a propellant gas-free device for discharging liquids, to a cartridge, which is adapted thereto and which is provided for storing the liquid, and to the ensemble comprised of both the device and cartridge. The invention consists of a device (1) for supplying pressure and for accommodating a cartridge (10), and of a cartridge (10) inside of which a discharging device (29) is integrated.



5536





(54) Title of the invention : "PROCESS FOR PREPARING TRIAZOLE SUBSTITUTED AZAINDOLEOXOACETIC PIPERAZINE DERIVATIVES AND NOVEL SALT FORM,S PRODUCED THEREIN'


(71)Name of Applicant : 1)BRISTOL-MYERS SQUIBB COMPANY. Address of Applicant :ROUTE 206 AND PROVINCE LINE ROAD, PRINCETON, NEW JERSEY 08543-4000, UNITED STATES OF AMERIICA. U.S.A. (72)Name of Inventor : 1)NACHIMUTHU SOUNDARARAJAN :C07D 471/04 2)YUPING QIU :60/693,004 3)WENHAO HU :22/06/2005 4)DAVID KRONENTHAL :U.S.A. 5)PIERRE SIRARD :PCT/US2006/024335 6)JEAN LAJEUNESSE :21/06/2006 7)ROBERTO DROGHINI :WO 2007/002308 8)RAMKRISHNAN CHIDAMBARAM :NA 9)XINHUA QIAN :NA 10)JR. KENNETH NATALIE 11)SHAWN K PACK :NA 12)NATHAN REISING :NA 13)ERQUING TANG 14)MICHAEL G. FAKES 15)QI GAO 16)FENG QUIN 17)BLISSE J. VAKKALAGADDA 18)CHIAJEN LAI 19)SHAN MING KUANG

(57) Abstract : A process is provided for preparing triazole substituted azaindoleoxoacetic piperazine derivative. Novel intermediates produced in the above process, and novel N-1 and amorphous forms of a 1,2,3-triazole substituted azaindoloxoacetic piperazine derivatives and processes for producing such novel forms are also provided.



5537





(54) Title of the invention : "METHODS OF ENHANCING ISOLATION OF RNA FROM BIOLOGICAL SAMPLES" (51) International classification :G01N 33/566 (71)Name of Applicant : (31) Priority Document No :11/109,366 1)NEXGEN DIAGNOSTICS LLC (32) Priority Date :19/04/2005 Address of Applicant :22900 W.EIGHT MILE ROAD, SOUTHFIELD, MI 48033-4302, USA U.S.A. (33) Name of priority country :U.S.A. :PCT/US2006/013251 (72)Name of Inventor : (86) International Application No Filing Date :07/04/2006 1)AKHAVAN-TAFTI, HASHEM (87) International Publication No :WO 2006/113198 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A method of enhancing the isolation of ribonucleic acids from samples of biological or cellular material is disclosed which uses a solution of an Agent during binding of nucleic acids onto a solid phase binding material which, after elution, enhances the recovery of RNA. Washing the solid phase and eluting the nucleic acid produces RNA in enhanced yield and/or purity. The use of the new method allows RNA to be captured and released in a form suitable for downstream processing in under five minutes. Preferred Agents according to the invention comprise monomeric, oligomeric, dendrimeric and polymeric organic compounds having multiple positive charges.



5538





(54) Title of the invention : "RECORDING MEDIUM HAVING DATA STRUCTURE FOR MANAGING RANDOM/SHUFFLE REPRODUCTION OF VIDEO DATA RECORDED THEREON AND RECORDING AND REPRODUCING METHODS AND APPARATUS" (51) International classification :H04N 5/85 (71)Name of Applicant : (31) Priority Document No :10-2003-0012861 1)LG ELECTRONICS INC. (32) Priority Date :28/02/2003 Address of Applicant :20, YOIDO-DONG, (33) Name of priority country :Republic of Korea YOUNGDUNGPO-GU, SEOUL 150-010, REPUBLIC OF :PCT/KR2004/000384 KOREA. Republic of Korea (86) International Application No Filing Date :25/02/2004 (72)Name of Inventor : (87) International Publication No :WO 2004/077417 1)SEO, KANG SOO (61) Patent of Addition to Application 2)KIM, BYUNG JIN :NA Number 3)KIM, MI HYUN :NA Filing Date (62) Divisional to Application Number :3788/DELNP/2005 Filed on :25/08/2005 (57) Abstract : A recording medium having data structures for managing random/shuffle reproduction of video data recorded thereon is disclosed. The recording medium in accordance with the present invention comprises at least one piece of title management information, a playlist directory area storing at least one playlist including at least one playitem, and a stream directory area storing at least one clip of video data associated with the playlist. The title management information includes at least one segment that is associated with at least one playlist in the playlist directory area, and each playitem in the playlist is a unit to be randomized or shuffled during random/shuffle reproduction mode.



5539





(54) Title of the invention : "IMPROVEMENTS RELATING TO SMOKE DETECTORS PARTICULARLY DUCTED SMOKE DETECTORS" (51) International classification :G08B 17/10 (71)Name of Applicant : (31) Priority Document No :PQ 5538 1)COLE, MARTIN, TERENCE (32) Priority Date :09/02/2001 Address of Applicant :36 ACACIA COURT, PATTERSON (33) Name of priority country :Australia LAKES, VIC 3197, AUSTRALIA. Australia (86) International Application No :PCT/AU2001/00121 (72)Name of Inventor : Filing Date :09/02/2001 1)COLE, MARTIN, TERENCE (87) International Publication No : WO/2001/059737 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :IN/PCT/2002/00744/DEL Filed on :31/07/2002 (57) Abstract : The present invention relates to the detection of particles suspended in fluid particularly smoke detectors (10) suitable for mounting on ducting for the early detection of smoke created by unwanted pyrolysis or combustion of materials in a protected area or fire zone to which the duct is connected. The present invention provides alternately illuminating a detection zone (12) with one of either a first or a second illumination (11). The improvement embodied in the current invention is the ability to retain sensitivity to a wide range of particle sizes and also to discriminate between different kinds of smoke or dust according to particle size, whilst also achieving relatively long service life, small size, light weight and low cost.



5540





(54) Title of the invention : "WIRELESS ROUTNG IMPLEMENTATION" (51) International classification :H04L 12/28 (71)Name of Applicant : (31) Priority Document No :11/160,779 1)HONEYWELL INTERNATIONAL INC. (32) Priority Date :08/07/2005 Address of Applicant :101 COLUMBIA ROAD, P.O.BOX 2245, MORRISTOWN, NEW JERSEY 07960, USA U.S.A. (33) Name of priority country :U.S.A. :PCT/US2006/026493 (72)Name of Inventor : (86) International Application No Filing Date :06/07/2006 1)DHARMASHANKAR SUBRAMANIAN (87) International Publication No :WO 2007/008648 2)ANOOP K.MATHUR (61) Patent of Addition to Application 3)SOUMITRI N.KOLAVENNU :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A wireless communications system comprising a number of node devices and a base station, and having a routing calculator, wherein the system is operating with a first routing map, the routing calculator gathers data relating to communications between node devices and determines whether route improvement is indicated and, if so, the routing calculator generates an improved routing solution, and instructions are distributed via the first routing map to the node devices for implementing a new routing map generated from the optimized routing solution (e.g. by replacing the current routing map/solution with the new one) . The improved routing solution may be optimized in light of one or more factors related to communications reliability and/or e...



5541





(54) Title of the invention : "SECURITY CAMERA FOR A NETWORK" (51) International classification :H04L 12/24 (71)Name of Applicant : (31) Priority Document No :60/203/652 1)NIKSUN, INC (32) Priority Date :12/05/2000 Address of Applicant :1100 CORNWALL ROAD, (33) Name of priority country :U.S.A. MONMOUTH JUNCTION, NEW JERSEY 08852, USA U.S.A. (86) International Application No :PCT/US01/15601 (72)Name of Inventor : Filing Date :12/05/2001 1)PARAG, PRUTHI (87) International Publication No :WO 01/88731 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :IN/PCT/2002,00149/DEL Filed on :21/11/2002 (57) Abstract : A method for processing data from a communication line. Data is received from the communication line (802) and segregated into packets (803). Packets are selected based on a respective characteristic (804) and the selected packets are provided to one of a plurality of data processing units.



5542





(54) Title of the invention : GUIDING TOUR SYSTEM AND APPARATUS (71)Name of Applicant : (51) International classification :H04B 7/00 (31) Priority Document No :200510072751.5 1)HSU, CHIA-YI Address of Applicant :B1, NO.8, LANE 92, SEC.1, (32) Priority Date :19/05/2005 JIANGUO N. RD., TAIPEI CITY, TAIWAN. Taiwan (33) Name of priority country :China :PCT/CN2006/001017 (72)Name of Inventor : (86) International Application No Filing Date :18/05/2006 1)HSU, CHIA-YI (87) International Publication No : WO/2006/133620 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A guiding-tour system and apparatus, including: at least one host, which adheres or near to an exhibition object, and sets an unique discriminate number corresponding to the exhibition object, has a memory slot and at least one wireless transceiver module, at least one memory card is inserted into the slot, a voice guiding-tour data digital file of the exhibition object is recorded in the memory card, and transmits the digital file in the memory card in a wireless manner via the wireless transceiver module; at least one slave handheld by a visitor, the slave being a portable guiding-tour handheld by the visitor, which at least has a wireless transceiver module, may start a download program in a wireless manner, and downloads the voice guidi...



5543





(54) Title of the invention : "PROCESS FOR SEPARATING T1 FROM A T1 SLURRY" (51) International classification :C22B 34/12 (71)Name of Applicant : (31) Priority Document No :60/408,932 1)INTENATIONAL TITANIUM POWDER, LLC. (32) Priority Date :07/09/2002 Address of Applicant :20634 W.GASKIN DRIVE, (33) Name of priority country :U.S.A. LOCKPORT, IL 60441, UNITED STATES OF AMERICA. :PCT/US2003/27785 U.S.A. (86) International Application No Filing Date :03/09/2003 (72)Name of Inventor : (87) International Publication No :WO 2004/022800 1)ANDERSON , RICHARD (61) Patent of Addition to Application 2)ARMSTRONG, DONN :NA Number 3)JACOBSEN, LANCE :NA Filing Date (62) Divisional to Application Number :843/DELNP/2005 Filed on :04/03/2005 (57) Abstract : A method of separating metal particulates from a slurry of original constituents of liquid metal and metal particulates and salt particulates is disclosed. The metal and salt particulates are concentrated by removing at least some of the liquid metal, and then, liquid metal or a liquid of the original salt constituent or a mixture thereof is passed through the particulates at a temperature greater than the melting point of the original salt constituent to further concentrate the metal particulates. The metal particulates are then separated from the remaining original constituents or a mixture of the salt constituent. Density differences between the liquid metal and salt are also used to facilitate separation.



5544





(54) Title of the invention : POWDER PAINT COMPOSITION (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country

(71)Name of Applicant : :C09D 5/03 :05076579.1 1)DSM IP ASSETS B.V. Address of Applicant :HET OVERLOON 1, NL - 6411 TE :11/07/2005 HEERLEN, THE NETHERLANDS Netherlands :EUROPEAN (72)Name of Inventor : UNION :PCT/EP2006/006315 1)MOLHOEK, LEENDERT JAN :29/06/2006 2)KIERKELS, PENIER HENRICUS MARIA :WO 2007/006425 3)GIJSMAN, PIETER 4)DUTMAN, JASPER HENDRIK JOHAN :NA :NA

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention is directed to a thermosetting powder paint composition comprising a thermosetting amorphous polyamide. The amorphous polyamide has a glass transition temperature between 20 °C and 200 °C. The polyamide may be a carboxyl-, a hydroxylor an amine functional polyamide. A carboxyl functional polyamide has an acid number between 10 and 150 mg of KOH/gram of resin. The invention also relates to a thermosetting powder paint composition comprising a thermosetting amorphous polyamide and an additive comprising a copper halogenide and another halogenide. The invention further relates to a process for coating a substrate at low temperature cure (LTC) conditions and a composition suitable for LTC.



5545


(21) Application No.210/MUMNP/2008 A



(54) Title of the invention : MODEM WITH ACOUSTIC COUPLING (51) International classification :H04M1/215 (71)Name of Applicant : (31) Priority Document No :95125037 1)ULTRA PROIZODNJA ELEKTRONSKIH NAPRAV (32) Priority Date :10/07/2006 D.O.O. (33) Name of priority country :Taiwan Address of Applicant :CESTA OTONA ZUPANCICA 23A, (86) International Application No :PCT/EP2005/009063 1410 ZAGORJE, Slovenia Filing Date :22/08/2005 (72)Name of Inventor : (87) International Publication No :WO2007/022788A1 1)URBANIJA, MILOS (61) Patent of Addition to Application 2)GOLOBIC, GREGOR :NA Number 3)CHOWDHURY, AMOR :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to a terminal interface and an arrangement including the terminal interface to enable interfacing between an electronic device and a service provider. The terminal interface comprises at least a data interface arranged for coupling the terminal interface to the electronic device, a processing means adapted to operate the terminal device, and modem means enabling data communication between the interface terminal and a terminal device enabled for voice conmutation in a public land mobile communications network. The data processing means coupled to the data interface and the modem means is further configured for processing data received from either of the data interface and the modem means and for generating data to be transmitted via the data interface and/or the modem means. Data is communicated between the interface terminal and the service provider via the terminal device on a voice communication through the public land mobile communications network.



5546





(54) Title of the invention : ORAL VEHICLE FOR SYSTEMIC PHARMACEUTICALS :A61K9/10,A61K47/36 (71)Name of Applicant : (51) International classification (31) Priority Document No :0519290.1 1)PBL MANUFACTURING LIMITED (32) Priority Date :22/09/2005 Address of Applicant :C/O 35 SALTBURN ROAD, (33) Name of priority country :U.K. MILFORD, AUCKLAND, 0620, New Zealand (86) International Application No :PCT/NZ2006/000246 (72)Name of Inventor : Filing Date :22/09/2006 1)ALEXANDER, CARL, ERNEST (87) International Publication No :WO2007/035117A1 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Systemic drug delivery means comprises boluses of a semi-solid agar gel, each containing active ingredients, packed singly or in cooperating sets in blister packs, or loose in a container. When placed in the mouth the bolus is disrupted, comes apart, and releases the active ingredients. Sialogogues, flavours, and other additives assist in swallowing. Grains of the active ingredients may be encapsulated inside harder gel capsules.Active ingredients include over-the-counter medications and prescription medications. Applications include self-medication particularly in water-free situations such as public transport, medication for children, stroke victims or the aged.



5547





(54) Title of the invention : INHIBITORS OF SERINE PROTEASES (51) International classification :C07D498/10 (71)Name of Applicant : (31) Priority Document No :60/711,530 1)VERTEX PHARMACEUTICALS INCORPORATED (32) Priority Date :26/08/2005 Address of Applicant :130 WAVERLY STREET, CAMBRIDGE, MA 02139-4242, U.S.A. (33) Name of priority country :U.S.A. (86) International Application No :PCT/US2006/033770 (72)Name of Inventor : Filing Date :28/08/2006 1)COTTRELL, KEVIN, M (87) International Publication No :WO/2007/025307 2)MAXWELL, JOHN (61) Patent of Addition to Application 3)TANG, QING :NA Number 4)GRILLOT, ANNE-LAURE :NA Filing Date 5)LE TIRAN, ARNAUD (62) Divisional to Application Number :NA 6)PEROLA, EMANUELE Filing Date :NA (57) Abstract : The present invention relates to compounds of formula (I): or a pharmaceutically acceptable salt or mixtures thereof that inhibit serine protease activity, particularly the activity of hepatitis C virus NS3-NS4A protease.



5548





(54) Title of the invention : METHOD OF CONTROLLING A BROWSER WINDOW (51) International classification :G06F9/44 (71)Name of Applicant : (31) Priority Document No :60/720,607 1)KONINKLIJKE KPN N. V. (32) Priority Date :26/09/2005 Address of Applicant :MAANPLEIN 55, NI-2516 CK THE HAGUE, Netherlands (33) Name of priority country :U.S.A. (86) International Application No :PCT/EP2006/008875 (72)Name of Inventor : Filing Date :12/09/2006 1)THIERBACH, HEIKO (87) International Publication No :WO2007/039048A1 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A method of controlling a browser window is disclosed. The method comprises the steps of associating the browser window to a token indicative of a personalized session; and repetitively, verifying said token; and, closing the browser window in dependence of said token. A valid token is generated at startup of the personalized session. The token is invalidated when the user logoffs from the personalized session. Upon detection of an invalid token all browser windows associated with said personalized session will be closed.



5549





(54) Title of the invention : O-NITRO COMPOUNDS, PHARMACEUTICAL COMPOSITONS THEREOF AND USES THEREOF :A01N37/00,A61K31/21 (71)Name of Applicant : (51) International classification (31) Priority Document No :60/707,896 1)ALLIANT TECHSYSTEMS INC. (32) Priority Date :12/08/2005 Address of Applicant :5050 LINCOLN DRIVE, EDINA, (33) Name of priority country :U.S.A. MINNESOTA 55436-1097, U.S.A. (86) International Application No :PCT/US2006/031722 2)RADIORX, INC. Filing Date :14/08/2006 (72)Name of Inventor : (87) International Publication No :WO2007/022121A2 1)KNOX, SUSAN (61) Patent of Addition to Application 2)CANNIZZO, LOUIS :NA Number 3)WARNER, KIRSTEN :NA Filing Date 4)WARDLE, ROBERT (62) Divisional to Application Number :NA 5)VELARDE, STEPHEN Filing Date :NA 6)NING, SHOUCHENG (57) Abstract : The present invention provides O-nitro compound, pharmaceutical compositions of O-nitro compounds and methods of using O-nitro compounds and/or pharmaceutical compositions thereof to treat or prevent diseases or disorders characterized by abnormal cell proliferation, such as cancer, inflammation, cardiovascular disease and autoimmune disease.



5550





(54) Title of the invention : CYCLIC NITRO COMPOUNDS, PHARMACEUTICAL COMPOSITIONS THEREOF AND USES THEREOF (51) International classification :A61K31/21 (71)Name of Applicant : (31) Priority Document No :60/707,851 1)ALLIANT TECHSYSTEMS INC. (32) Priority Date :12/08/2005 Address of Applicant :5050 LINCOLN DRIVE, EDINA, (33) Name of priority country :U.S.A. MINNESOTA 55436-1097, U.S.A. (86) International Application No :PCT/US2006/031917 2)RADIORX, INC. Filing Date :14/08/2006 (72)Name of Inventor : (87) International Publication No :WO2007/022225A2 1)KNOX, SUSAN (61) Patent of Addition to Application 2)CANNIZZO, LOUIS :NA Number 3)WARNER, KIRSTEN :NA Filing Date 4)WARDLE, ROBERT (62) Divisional to Application Number :NA 5)VELARDE, STEPHEN Filing Date :NA 6)NING, SHOUCHENG (57) Abstract : The present invention provides cyclic nitro compound, pharmaceutical compositions of cyclic nitro compounds and methods of using cyclic nitro compounds and/or pharmaceutical compositions thereof to treat or prevent diseases or disorders characterized by abnormal cell proliferation, such as cancer, inflammation, cardiovascular disease and autoimmune disease.



5551





(54) Title of the invention : PHASE CHANGE MATERIAL HEAT EXCHANGER :F28D20/02,F25B9/04 (71)Name of Applicant : (51) International classification (31) Priority Document No :20051018 1)MG INNOVATIONS CORP. (32) Priority Date :10/10/2005 Address of Applicant :KAUPPAKATU 7, 87100 KAJAANI, (33) Name of priority country :Finland Finland (86) International Application No :PCT/FI2006/050434 (72)Name of Inventor : Filing Date :10/10/2006 1)MOILALA, KARI (87) International Publication No :WO2007/042621A1 2)GASIK, MICHAEL (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to a phase change material (PCM) heat exchanger device comprising heat exchanger cells (1a, 1b) operating on the regenerative countercurrent principle, phase change material (PCM) accumulators (2, 3) provided in the heat exchanger cells and a vortex tube (6, 7, 8). When the directions of the air, gas and liquid flows are cyclically reversed in the apparatus, energy is recovered into the heat exchanger cell and the PCM accumulator, and during the subsequent cycle, the energy is released from the heat exchanger cell and PCM accumulator. While one heat exchanger cell and PCM accumulator is being charged, the other heat exchanger cell and PCM accumulator are simultaneously discharged. The cool/hot flow from the vortex tube is used to enhance/create needed temperature differences. The invention is applicable to buildings, vehicles, climate control rooms, single or multiple devices such as computers, and in various processes, such as, but not limited to, cryogenic methods, and in space technology and supercritical carbon dioxide applications.



5552





(54) Title of the invention : GEAR ASSEMBLY AND CONSTINUOUSLY VARIABLE TRANSMISSION COMPRISING SUCH GEAR ASSEMBLY (51) International classification :F16H55/56,F16H9/20 (71)Name of Applicant : (31) Priority Document No :60/721,572 1)INFINIGEAR AB (32) Priority Date :29/09/2005 Address of Applicant :LANGAKERSVAGEN 104, 122 41 (33) Name of priority country :U.S.A. ENSKEDE, Sweden (86) International Application No :PCT/SE2006/001099 (72)Name of Inventor : :28/09/2006 Filing Date 1)LINDKVIST, GUNNAR (87) International Publication No :WO2007/037747A1 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention concerns a gear assembly, suitable for a continuously variable transmission, comprising two gear tooth devices (10, 50) making up an imaginary gear wheel with variable pitch diameter, the two gear tooth devices being radially movable and also a continuously variable transmission comprising an input shaft (1), an output shaft (2), a gear-changing shaft (3) and first gearbox shaft (4) comprising a gear assembly according to the invention, a transmission chain (5) and a second gearbox shaft (6) comprising a gear assembly according to the invention or a gear wheel (7), whereby the first gearbox shaft (4) is driven by the input shaft (1), the second gearbox shaft (6) or the gear wheel (7) is driven by the first gearbox shaft (4), and the output shaft (2) is driven by the second gearbox shaft (6) or the gear wheel (7).



5553





(54) Title of the invention : PACKAGED OXIDATION-STABLE OIL-IN-WATER EMULSION (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country

:A23L2/38,A23L1/29 :05077589.9 :14/11/2005 :EUROPEAN UNION :PCT/EP2006/010134 :19/10/2006 :WO2007/054195A1

(71)Name of Applicant : 1)HINDUSTAN UNILEVER LIMITED Address of Applicant :HINDUSTAN LEVER HOUSE, 165/166 BACKBAY RECLAMATION, MUMBAI-400020, Maharashtra India (72)Name of Inventor : 1)BANKEN HERMANUS THEODORUS K M 2)CASTENMILLER WILHELMUS ADRIANUS M 3)ROSIER OTTO EDUARD

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : One aspect of the invention relates to a packaged, oxidation-stable oil-in-water emulsion comprising: - 0.1-10 wt .% of oil, said oil containing 0.3-80 g of polyunsaturated fatty acids per liter of emulsion; - at least 1 mg/1 of pro-oxidative metal cations; - 10-2000 mg/1 of vitamin C; and - up to 98 wt .% of water; wherein the container comprising the emulsion holds no headspace and wherein the molar ratio of vitamin C to pro- oxidative metal cations exceeds 1:2. Oxidation of the polyunsaturated fatty acids contained in the emulsion, is effectively prevented, despite the fact that the emulsion contain appreciable amounts of pro-oxidative metal cations and even if the emulsion is produced under conditions in which it is in direct contact with air. Another aspect of the invention relates to a method of preparing a packaged emulsion as defined above.



5554





(54) Title of the invention : APPARATUS FOR DISPENSING A METERED QUANTITY OF LIQUOR :G01F11/32,B67D3/04 (71)Name of Applicant : (51) International classification (31) Priority Document No :NA 1)DIGITOT INTERNATIONAL (PTY) LIMITED (32) Priority Date :NA Address of Applicant :213 STAMFORD HILL ROAD, (33) Name of priority country :NA STAMFORD HILL, DURBAN, 4001, KWA ZULU NATAL, (86) International Application No :PCT/ZA2005/000129 South Africa Filing Date :29/08/2005 (72)Name of Inventor : (87) International Publication No :WO2007/028174A1 1)GARVIE CRAIG WARREN (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Apparatus for dispensing liquor has a thimble of predetermined volume with a valve-controlled inlet (12) from a container for liquor and an outlet (10) for the liquor, the connection between the container including a shear (28) one side of which is for flow of liquor into the thimble and the other for flow of air from the thimble into the container as liquor flows into the thimble, a valve-controlled air vent (50) for entry of air into the thimble to replace the liquor flowing out of the thimble, and the valves (14, 16) for the inlet from the container and the outlet for liquor being mounted on a common shaft (20) and arranged for the outlet (10) to be closed when the inlet (12) is open and vice versa.



5555





(54) Title of the invention : A COMPOSITION COMPRISING A POLYPEPTIDE HAVING THE SEQUENCE OF SEQ ID NO: 431 OR A VARIANT THEREOF (51) International classification :C07K14/295 (71)Name of Applicant : (31) Priority Document No :09/620,412 1)CORIXA CORPORATION (32) Priority Date :20/07/2000 Address of Applicant :1124 COLUMBIA STREET, SUITE (33) Name of priority country :U.S.A. 200, SEATLE, WASHINGTON 98104, U.S.A. (86) International Application No :PCT/US2001/23121 (72)Name of Inventor : Filing Date :20/07/2001 1)STEVEN P. FLING (87) International Publication No :WO02/08267 2)YASIR A.W. SHEIKY (61) Patent of Addition to Application 3)PETER PROBST :NA Number 4)AJAY BHATIA :NA Filing Date (62) Divisional to Application Number :100/MUMNP/2003 Filed on :22/01/2003 (57) Abstract : A composition comprising: (a) a polypeptide comprising the sequence of Seq ID No: 431 or a variant thereof having at least 90% sequence identity thereto, as determined by comparing the two optimally aligned sequences over a window of comparison of the whole length of the sequence of Seq ID No: 431; or (b) a polynucleotide encoding the polypeptide of (a) and physiologically acceptable carrier; for use in stimulating an immune response in a patient.



5556





(54) Title of the invention : INTRAMEDULLARY, LONGITUDINAL IMPLANT :A61B17/17,A61B17/72 (71)Name of Applicant : (51) International classification (31) Priority Document No :PCT/CH2005/000657 1)SYNTHES GMBH (32) Priority Date :08/11/2005 Address of Applicant :EIMATTSTRASSE 3, CH-4436 (33) Name of priority country :Switzerland OBERDORF, Switzerland (86) International Application No :PCT/CH2005/000657 (72)Name of Inventor : Filing Date :08/11/2005 1)FRIGG ROBERT (87) International Publication No :WO2007/053960A1 2)SCHORI PASCAL (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An intramedullary longitudinal implant (1) comprising a curved first end portion (2) which is provided with coupling means (3) by means of which the implant (1) may be inserted into or removed from the intramedullary space of a bone (4); and a second end portion (3) being straight in a first position and which may be elastically bent into a second position such that it may have a curvature equal to the curvature of the first end portion (2) without being permanently deformed.



5557





(54) Title of the invention : PRESENTATION INSTRUMENT DISPLAY AND ACTIVATION SYSTEMS AND METHODS (51) International classification :G06K5/00 (71)Name of Applicant : (31) Priority Document No :60/711,017 1)FIRST DATA CORPORATION (32) Priority Date :23/08/2005 Address of Applicant :6200 S. QUEBEC ST., SUITE 270, GREENWOOD VILLAGE, COLORADO 80111, U.S.A. (33) Name of priority country :U.S.A. :PCT/US2006/032616 2)THE WESTERN UNION COMPANY (86) International Application No (72)Name of Inventor : Filing Date :21/08/2006 (87) International Publication No :WO2007/024786A1 1)ANDERSEN, TONYA (61) Patent of Addition to Application 2)KAUKOL, KAREN :NA Number 3)REX, DEBORAH :NA Filing Date 4)JEFFORDS, GARY (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A method of validating and activating a purchase card includes providing a purchase card that is removably attached to a card carrier, wherein the purchase card has an account identifier associated therewith and has a card indicium affixed thereto, wherein the purchase card includes a machine-readable information encoding region into which the account identifier is encoded, and wherein the card carrier has a carrier indicium affixed thereto; populating a database with a stored card indicium that relates to the card indicium, a stored carrier indicium that relates to the carrier indicium, and a stored account identifier that relates to the account identifier, thereby uniquely coupling the account identifier to the card indicium; at a point-of-sale device and in response to a customer request to purchase the purchase card, entering information from the card indicium into the point-of-sale device; at the point-of-sale device, entering information from the carrier indicium into the point-of-sale device; comparing the information from the card indicium and the information from the carrier indicium with the stored card indicium and the stored carrier indicium; and based at least in part on the comparing step, activating the card by associating value to it.



5558





(54) Title of the invention : COLLOID MILL (51) International classification :B02C2/10 (71)Name of Applicant : (31) Priority Document No :NA 1)XIANG, GUANSAN (32) Priority Date :NA Address of Applicant :VILLAGE 72, SHACHENG COUNTY, LONGWAN DISTRICT, WENZHOU, ZHEJIANG 325000, (33) Name of priority country :NA :PCT/CN2006/002540 China (86) International Application No (72)Name of Inventor : Filing Date :27/09/2006 (87) International Publication No :WO2007/038899 1)XIANG, GUANSAN (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention discloses a colloidal mill that is widely used in the fields of food, medication and chemical industry. An anti-leak pipe is further provided on the axle hole of inner chamber of a main body and integrated with it, wherein said anti-leak pipe is a little higher than a discharge port. The main axis is passed through the anti-leak pipe, and its head has a mill rotor matched with a mill stator on the main body. Round steel ball grooves in which steel balls are filled are added on the stable mill part and a regulation ring. The mill stator is matched with said regulation ring and a regulation cover. A hopper is mounted on the regulation cover, and the main axis of its feed port is provided with a mixing feeder having several blades. The chief advantage of said invention is that the invention can avoid idling when running in high speed for long time, prevent the damage and the leakage of the main body, and reduce the load of the motor. Therefore, it can realize easy and stable regulation, and its structure is simple.



5559





(54) Title of the invention : CASTING METHOD (51) International classification :B22D18/04 (71)Name of Applicant : (31) Priority Document No :2005-268163 1)GOKA, MASAHITO (32) Priority Date :15/09/2005 Address of Applicant :135-2, AZA-SAIGO, AZUMADACHO, TOYOHASHI-SHI, AICHI 4400062, Japan (33) Name of priority country :Japan :PCT/JP2006/316041 (72)Name of Inventor : (86) International Application No Filing Date :15/08/2006 1)GOKA, MASAHITO (87) International Publication No :WO2007/032174 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : To provide a method for casting with a gas permeable mold by gravity pouring, wherein melt is injected into only an intended cavity portion of a casting mold cavity and solidified. After pouring the melt having the volume substantially equal to that of the intended cavity portion to be filled with the melt, compressed gas is supplied from a sprue to inject the melt into the intended cavity portion and solidify the melt. The cavity may be decompressed before or after pouring according to need.



5560





(54) Title of the invention : METHOD AND SYSTEM FOR UPDATING HOME LOCATION REGISTER IN MOBILE NETWORK (51) International classification :H04Q7/38 (71)Name of Applicant : (31) Priority Document No :60/723,569 1)KONINKLIJKE KPN N. V. (32) Priority Date :04/10/2005 Address of Applicant :MAANPLEIN 55, NL-2516 CK THE HAGUE, Netherlands (33) Name of priority country :U.S.A. :PCT/EP2006/009564 (72)Name of Inventor : (86) International Application No Filing Date :03/10/2006 1)VAN LOON, JOHANNES MARIA (87) International Publication No :WO2007/039277A1 2)CORDENIER, THOMAS, HECTOR ANDRE, JOZEF (61) Patent of Addition to Application 3)EIKHOUT, LUDOVICUS, ANTONIUS, HERMANUS, :NA Number MARIA :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Method of registering a mobile subscriber in a mobile network and network unit for a mobile network having a home location register (12) in which data related to a plurality of active mobile subscribers are stored. A first attempt of a mobile subscriber to attach to the mobile network is detected, and subsequently the home location register (12) is updated by entering data related to the mobile subscriber in the home location register (12). Data related to a mobile subscriber which is not yet registered in the home location register (12) may be stored in a second register (1 1), and the data related to the mobile subscriber is transferred from the second register (11) to the home location register (12) upon detection of the first attempt.



5561





(54) Title of the invention : DIRECT TORQUE FLOW CONNECTION WITH OPTIMIZED RATIOS IN ATTACHMENT METHODS (51) International classification :F16D3/223 (71)Name of Applicant : (31) Priority Document No :NA 1)GKN DRIVELINE NORTH AMERICA, INC. (32) Priority Date :NA Address of Applicant :3300 UNIVERSITY DRIVE, (33) Name of priority country :NA AUBURN HILLS, MI-48326-2362, U.S.A. (86) International Application No :PCT/US2005/036299 (72)Name of Inventor : Filing Date :11/10/2005 1)BOOKER, DANNY, LEE (87) International Publication No :WO2007/044003A1 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present application is directed to a direct torque flow connector for torque transmission. The DTF connector includes a direct torque flow constant velocity universal joint having an outer race part and an inner race part, and a shaft coupled to the outer race part. The direct torque flow connector has at least one direct torque flow optimized ratio. Further, the inner race part of the direct torque flow connector may be selectively connected to a journal shaft of a drive unit. A direct torque flow connection with optimized ratios in attachment methods is also provided.



5562





(54) Title of the invention : COMBINED PREPARATION OF A THIAZIDE DIURETIC AND A LOOP DIURETIC :A61K31/64,A61P7/10 (71)Name of Applicant : (51) International classification (31) Priority Document No :102005040841.9 1)HEXAL AG (32) Priority Date :29/08/2005 Address of Applicant :INDUSTRIESTR. 25, 83607 (33) Name of priority country :Germany HOLZKIRCHEN, Germany (86) International Application No :PCT/EP2006/008455 (72)Name of Inventor : Filing Date :29/08/2006 1)KNAUF, HEINRICH (87) International Publication No :WO2007/025721A1 2)MUTSCHLER, ERNST (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to pharmaceutical preparations which contain a combination of a thiazide diuretic and a low dose of a loop diuretic and which is particularly suitable for treating hypertension and heart failure. It is not only the natriuretic/diuretic effects which are increased due to said combination of thiazide diuretic and loop diuretic, but also the undesired secondary effects in relation to potassium and magnesium losses are also significantly reduced. As a result, the desired hypocalciuric effect of the thiazide is maintained despite the presence of the loop diuretic.



5563


(21) Application No.1000/CHE/2005 A



(54) Title of the invention : AN ELECTRO-MECHANICAL SYSTEM FOR NON-DUPLICATION OF SOFTWARE (51) International classification

:H01L (71)Name of Applicant : 23/00 1)GEORGE JOHN THEKKETHIL :NA Address of Applicant :P/48(B-270), ANUGRAHA PIPE :NA LINE, JALAHALLI P.O. BANGALORE. Karnataka India :NA (72)Name of Inventor : :NA 1)GEORGE JOHN THEKKETHIL :NA : NA :NA :NA :NA :NA

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A system consisting of a memory storage unit in which the licensed softwares are stored. The function of this device is to recognize the requested data and thereby allow the software from the memory storage unit according to the instructions set to this device. It is an effective means for protecting the software in the device from duplication.



5564





(54) Title of the invention : TEXTILE MACHINE AND METHOD FOR OPERATING THE SAME (51) International classification (31) Priority Document No

:D01H-1/00 (71)Name of Applicant : :10 2004 1)MASCHINENFABRIK RIETER AG 036 900.3 Address of Applicant :KLOSTERSTRASSE 20, CH-8406 :29/07/2004 WINTERTHUR. Switzerland :Germany (72)Name of Inventor : :NA 1)HORST, WOLF :NA 2)GRIESSHAMMER, CHRISTIAN : NA :NA :NA :NA :NA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The invention relates to a textile machine (1), preferably a spinning or twisting machine, comprising individual positions having individually driven spindles (2) which receive bobbins (8) and balloon limiting tubes (3) which overlap said bobbins (8), and a method for operating the same. It is proposed that the drive motors (6, 7) of the spindles (2) and the balloon limiting tubes (3) should be made to automatically regulate themselves so that even when using the narrowest bobbins (8), a high-quality uniform yarn can be produced.



5565





(54) Title of the invention : VOLTAGE REGULATOR ARCHITECTURE PROVIDING SMOOTH STANDBY TO ACTIVE TRANSITION (51) International classification

:H02M (71)Name of Applicant : 3/00 1)Cypress Semiconductor Corporation :NA Address of Applicant :198, Champion Ct., San Jose, CA :NA 95134, U.S.A. (72)Name of Inventor : :NA :NA 1)RAhul Sankhe :NA 2)Kothandaraman Badrinarayanan : NA 3)Hemant Vispute :NA 4)Prashant Saxena :NA :NA :NA

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : Disclosed is voltage regulator architecture for providing smooth standby to active transition. The voltage regulator architecture comprises a band gap reference generator; and a high speed bias signal generator coupled to the band gap reference generator for generating start up bias signals and vonstant volgate reference. A standby regulator is coupled to the band gap reference generator and is coupled to the high speed bias signal generator for generating a regulated power supply voltage in a standby mode. The standby regulator comprises a source follower transistor for controlling viltage generated at an output of the standby regulator. An active regulator is coupled to the band gap reference generator and is coupled to the high speed bias signal generator for supporting the regulated power supply voltage. The active regulator comprises a current control switch.



5566


(21) Application No.1062/MAS/1999 A



(54) Title of the invention : A NETWORK COMPUTER AND A METHOD OF MANAGING POWER CONSUMPTION IN A COMPUTER NETWORK (51) International classification

:G06F 13/38 :09/211,371 :14/12/1998 :U.S.A. :NA :NA : NA :NA :NA :NA :NA

(71)Name of Applicant : 1)INTERNATIONAL BUSINESS MACHINES CORPORATION Address of Applicant :ARMONK, NEW YORK 10504, USA U.S.A. (72)Name of Inventor : 1)MAXIMINO AGUILAR 2)JOHN WILLIAM GORELL, JR 3)SANJAY GUPTA 4)JAMES MICHAEL STAFFORD

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A network computer including a motherboard powered by a power supply via a single ower supply plane, a clock generator, a processor, a system memory, and a network interface. lie network computer is configured to assume a low power state in response to a low power vent and further configured to transition from the low power state to a full power state in esponse to a wake up event. The wake up event may comprise a LAN wake up in the form of command issued by a server computer coupled to the network computer via a network. In one unbodiment, the network computer lacks a disk based storage device, but includes local permanent storage comprising a compact flash card. Preferably, the network computer's clock generator is configured to produce a clock signal for the processor when the network computer is in the full power mode, and further configured to produce no clock signal in the low power mode. In one embodiment, the network computer further includes at least one peripheral device coupled to the processor via a peripheral bus, such as a PCI bus. In this embodiment, the computer is preferably configured to transition each peripheral device on the peripheral bus to a power management mode when the network computer enters low power mode. The wake up event may be a LAN wake up event in which a wake up signal is received via the network



5567





(54) Title of the invention : APPLICATION WITH MULTIPLE EMBEDDED DRIVERS :G06F 9/46 (71)Name of Applicant : (51) International classification (31) Priority Document No :10/909872 1)HEWLETT-PACKARD DEVELOPMENT COMPANY, (32) Priority Date :02/08/2004 L.P. (33) Name of priority country :U.S.A. Address of Applicant :20555 S.H. 249 HOUSTON, TEXAS (86) International Application No :NA 77070 U.S.A. (72)Name of Inventor : Filing Date :NA (87) International Publication No : NA 1)DUPLICHAN, STEVEN, SCOTT (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Various systems, methods, and programs embodied in computer-readable mediums are provided for driver execution in association with an application. When an application is executed in a computer system , a processor compatibility of an operating system executed in the computer system is determined. In this respect, the operating system is compatible with one of a plurality of predefined types of processors. An association is drawn between the processor compatibility of the operating system and one of a plurality of drivers embedded in the application , where the one of the drivers is compatible with the operating system . The execution of the one of the drivers that is compatible with the operating system (123) is implemented in the computer system.



5568





(54) Title of the invention : HOME SECURITY SYSTEM USING AN AD-HOC WIRELESS MESH AND METHOD THEREOF (51) International classification

:G08B 13/00 :NA :NA :NA :NA :NA : NA :NA :NA :NA :NA

(71)Name of Applicant : 1)TANLA SOLUTIONS LIMITED, Address of Applicant :TANLA TECHNOLOGY CENTRE, HITECH CITY ROAD, MADHAPUR, HYDERABAD-500081. Andhra Pradesh India (72)Name of Inventor : 1)DASARI UDAY KUMAR REDDY, 2)SATISH KATHIRSETTI, 3)NAVNIT CHACHAN,

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : Disclosed is an automation and security system, comprising a plurality of communication nodes configuring one or more ad-hoc mesh networks. The communication nodes are operatively coupled with at least one of an automation device and/or a security device. The automation and/or the security device senses the occurrence of a situation and communicates a situation data of the situation in realtime to the communication nodes. The situation data is then dynamically routed over the ad-hoc mesh network to a central monitoring station which then automatically processes the situation data to provide real-time notification to the end user of the system.



5569





(54) Title of the invention : VECHICLE TRACKING AND SECURITY USING AN AD-HOC WIRELESS MESH AND METHOD THEREOF (51) International classification

:H04Q 7/20 :NA :NA :NA :NA :NA : NA :NA :NA :NA :NA

(71)Name of Applicant : 1)TANLA SOLUTIONS LIMITED, Address of Applicant :TANLA TECHNOLOGY CENTRE, HITECH CITY ROAD, MADHAPUR, HYDERABAD-500081. Andhra Pradesh India (72)Name of Inventor : 1)DASARI UDAY KUMAR REDDY, 2)SATISH KATHIRSETTI, 3)NAVNIT CHACHAN,

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : Disclosed is an automatic tracking and security system, comprising a plurality of mobile nodes, one or more fixed nodes, and a central monitoring station. The plurality of mobile nodes and at least one fixed node configure a wireless ad-hoc mesh network. The central monitoring station provides GPS-assistance data to the plurality of mobile nodes over the wireless ad-hoc mesh network. The plurality of mobile nodes compute the location data using the GPS-assistance data. The plurality of mobile nodes are also provided with one or more security modules which sense an occurrence of a situation and provide situation data. The location data and/or the situation data are dynamically routed over the wireless as-hoc mesh network from the plurality of mobile nodes to the central monitoring station. The central monitoring station automatically processes the location data and/or the situation data and provides a notification to an end user.



5570





(54) Title of the invention : PROCESS FOR THE PREPARATION OF APREPITANT POLYMORPHS I AND II


:C 07 D 265/02 :NA :NA :NA :NA :NA : NA :NA :NA :NA :NA

(71)Name of Applicant : 1)DR. REDDY'S LABORATORIES LIMITED Address of Applicant :DR. REDDY'S LABORATORIES LIMITED PLOT NO.116, S.V.CO-OPERATIVE INDUSTRIAL ESTATE, IDA, BOLLARAM, JINNARAM MANDAL MEDAK DISTRICT Andhra Pradesh India (72)Name of Inventor : 1)VIJAYAVITTHAL THIPPANNACHAR MATHAD 2)BANDA GOVERDHAN REDDY 3)GOVINDAN SHANMUGAM 4)MACHARLA PRABHAKAR 5)NALIVELA VENU

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The present invention relates to processes for the preparation of aprepitant crystalline Form I and Form II.



5571





(54) Title of the invention : METHOD AND APPARATUS FOR REDUCING RESIDUAL FAR-END ECHO IN VOICE COMMUNCATIONS NETWORKS (51) International classification :H04B 3/20 (71)Name of Applicant : (31) Priority Document No :08/398272 1)AT&T IPM CORP (32) Priority Date :03/03/1995 Address of Applicant :2333 PONCE DE LEON (33) Name of priority country :U.S.A. BOULEVARD, CORAL GABLES, FLORIDA-33134 USA (86) International Application No :NA U.S.A. (72)Name of Inventor : Filing Date :NA (87) International Publication No : NA 1)PATRICK MICHAEL VELARDO (61) Patent of Addition to Application Number :NA 2)WOODSON DALE WYNN Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A method and apparatus are described for reducing, in communication signals received by a local network from a remote network (FAR-IN signals), that energy content that is attributable to echoes of signals transmitted into the local network (NEAR-IN signals). This is achieved, in part, by generating a time-varying TEMPLATE signal which represents the smoothed energy content of NEAR-IN signals delayed according to the echo path and attenuated by an estimated echo transmission loss. A non-linear processor passes the FAR-IN signal substantially without attenuation if it exceeds the TEMPLATE, but attenuates the FAR-IN signal if it lies within a defined range below the TEMPLATE.



5572





(54) Title of the invention : A ROLLER TAKE OFF DEVICE FOR TEXTILE CARDING MACHINE (51) International classification

(71)Name of Applicant : : D01G15/00 1)LAKSHMI MACHINE WORKS LTD :NA Address of Applicant :PERIANAICKENPALAYAM :NA COIMBATORE-641020 Tamil Nadu India :NA (72)Name of Inventor : :NA 1)PERIASAMY LAKSHMI NARASIMHAN :NA 2)GOPALAN BALASUNDARAM : NA 3)DHARMAM DAVID :NA 4)JANAKIRAMAN SRINIVASAN :NA :NA :NA

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A roller take-off device for a textile carding machine, said device comprising a housing member disposed on either side of the carding machine to provide a primary rotatable support to top, bottom and redirecting doffing rollers, a cylindrical opening disposed in the housing member, a swiveling bracket with a bottom-doffing-roller passage to rotatably permit the bottom-doffing roller is connected to said housing member by a central and peripheral fitment members, a sliding bracket slidably disposed in a sliding-bracket opening of the swiveling bracket, said sliding bracket provided with a top-doffing-roller opening to rotatably permit the top-doffing roller, a crown-bracket mounted on said swiveling bracket, a vertical alignment element disposed to provide vertical radial alignment of upper and bottom doffing rollers, and a lateral alignment element disposed on the frame, said alignment member operably connected to the top- doffing roller and the redirecting roller, to provide a lateral radial alignment between the top-doffing roller and the redirecting roller.



5573





(54) Title of the invention : FLUIDS CHAIN-OF-CUSTODY


(71)Name of Applicant : 1)SCHLUMBERGER HOLDINGS LIMITED : G01N1/00 Address of Applicant :P O BOX 71, CRAIGMUIR :60/526,817 CHAMBERS, ROAD TOWN, TORTOLA British Virginia :04/12/2003 (72)Name of Inventor : :U.S.A. 1)BETANCOURT, SARAYA, S. :NA 2)MULLINS, OLIVER, C. :NA 3)HAMMAMI AHMED : NA 4)NIGHSWANDER JOHN A. :NA 5)HEGEMAN PETER S. :NA 6)RATULOWSKI JOHN :NA 7)MOIN MUHAMMAD :NA 8)RAYMOND G KENNADY 9)CHENGLI DONG 10)ERWAN OLLIERO

(57) Abstract : A method of assuring the collection of reliable and quality fluid sample includes the steps of acquiring a fluid sample at a point of acquisition, analyzing physical and chemical properties of the fluid sample at the point of acquisition; recording the point of acquisition sample properties in an electronic database archive, analyzing physical and chemical properties of the fluid sample at a location remote from the point of acquisition, recording the remote location sample properties in the archive, validating the fluid sample through comparison of the point of acquisition sample properties and the remote location sample properties and recording the validated sample properties in the archive.



5574





(54) Title of the invention : HYDRATES OF VARDENAFIL HYDROCHLORIDES (51) International classification

:C07D 401/12 :NA :NA :NA :NA :NA : NA :NA :NA :NA :NA

(71)Name of Applicant : 1)DR. REDDY 'S LABORATORIES LIMITED Address of Applicant :DR. REDDY'S LABORATORIES LIMITED PLOT NO.116, S.V.CO-OPERATIVE INDUSTRIAL ESTATE, IDA, BOLLARAM, JINNARAM MANDAL MEDAK DISTRICT Andhra Pradesh India (72)Name of Inventor : 1)SAJJA ESWARAIAH 2)KOPPERA RAVINDAR REDDY 3)REVU SATYANARAYANA 4)VAJRALLA VENKATA REDDY 5)KANUMATHI REDDY VIJAYAPAL REDDY

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : In one aspect the present invention provides the monohydrate of vardenafil dihydrochloride. The monohydrate of vardenafil dihydrochloride has an XRPD diffraction pattern with peaks at about 7.06, 11.7, 13.3, 16.0, 19.0, 21.3 :t 0.2 degrees two theta and moisture content of about 3.7%. The present invention also provides a process for preparing the monohydrate of vardenafil dihydrochloride involving the preparation of a solution of vardenafil in an aqueous organic solvent, adding hydrochloric acid, heating to reflux for dissolution, cooling the solution, seeding the solution with the hydrate of vardenafil hydrochloride, separating the reaction mass by filtration followed by drying the solid material for about 2 1/2 to 3 hours at a temperature of about 44 to 47°C hours to afford the formation of a monohyderate of vardenafil dihydrochloride.



5575





(54) Title of the invention : APPARATUS AND METHOD FOR FORMATION EVALUATION (51) International classification

:E21B 49/00 :10/960,403 :07/10/2004 :U.S.A. :NA :NA : NA :NA :NA :NA :NA

(71)Name of Applicant : 1)PRAD RESEARCH AND DEVELOPMENT N.V Address of Applicant :DE RUYTERKADE 62, WILLEMSTAD, CURACAO, NETHERLANDS ANTILLES Netherlands (72)Name of Inventor : 1)NOLD, RAYMOND, V., III 2)ZAZOVSKY, ALEXANDER, F., 3)DEL CAMPO, CHRISTOPHER,S., 4)ERVIN,SDTEVE 5)BRIQUET, STEPHANE,

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A probe assembly samples fluid from a wellbore penetrating a subsurface formation having a virgin fluid therein beyond a layer of contaminated fluid surrounding the wellbore. The probe assembly includes a probe body extendable from a downhole tool, and a packer carried by the probe body and having a distal surface adapted for sealingly engaging the wellbore. The packer has an outer and inner periphery, with the inner periphery being defmed by a bore through the packer. The packer is further equipped with channel(s) formed in the distal surface and arranged to defme an annular cleanup intake intermediate the inner and outer peripheries. The passageway(s) extend(s) through the packer for conducting virgin fluid and/or contaminated fluid between the channel(s). A sampling tube is sealingly disposed in the bore of the packer for conducting virgin fluid to a second inlet in the probe body and the downhole tool.



5576





(54) Title of the invention : A METHOD AND SYSTEM FOR PROGRAMMING DEVICES BY REMOTE CONTROL WITHOUT POWER SUPPLY (51) International classification

:H04L 12/28 :NA :NA :NA :NA :NA : NA :NA :NA :NA :NA

(71)Name of Applicant : 1)SAMSUNG ELECTRONICS CO LTD., INDIA SOFTWARE OPERATIONS Address of Applicant :J.P TECHNO PARK, 3/1, MILLERS ROAD, BANGALORE 560 052 Karnataka India (72)Name of Inventor : 1)SYAM MADANAPALLI

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : This invention in general relates to Remote Operated Devices (e.g. TVs, Music Systems etc.). Particularly this invention relates to operating the electronic devices using a remote in case of power failures. More particularly this invention relates to a method and system for programming devices by remote control without power supply. A system for programming devices by remote control without power supply comprising: a rechargeable battery which is charged with main power supply when available and which provides the power to a standby circuitry and an interface circuitry on the absence of main power supply; an interface Circuitry which disconnects standby circuitry and connects remote interface to main circuitry when main power supply is available and further connects standby circuitry and remote interface when the Main power supply is not available; a standby circuitry which disconnects the main power supply when there is no main power; and a non-volatile memory which retains the user commands even when the rechargeable battery is exhausted.



5577


(21) Application No.1522/CHENP/2005 A



(54) Title of the invention : 2-PYROLIDONE DERIVATIVES AS PROSTAGLANDIN AGONISTS (51) International classification :C07D 211/76 (71)Name of Applicant : (31) Priority Document No :60/439,152 1)HOFFMANN-LA ROCHE AG (32) Priority Date :10/01/2003 Address of Applicant :124 GRENZACHERSTRASSE CH4070 BASEL Switzerland (33) Name of priority country :U.S.A. :PCT/EP04/00008 (72)Name of Inventor : (86) International Application No Filing Date :02/01/2004 1)ELWORTHY, TODD, RICHARD :WO/2004/063158 (87) International Publication No (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention provides compounds of the Formula (I): wherein m, n, A, X, Y, Z, R1, R2, R4, R6, R7, R8, R9 and R10 are as defined in the desription and claims, and pharmaceutically acceptable salts, solvates'; prodrugs, single isomers or racemic or non-racemic mixture of isomers thereof. The invention also provides methods for preparing, compositions comprising, and methods for using compounds of formula I.



5578





(54) Title of the invention : MULTIPURPOSE ZEOLITE BASED CAPPING CEMENT AND INSULATORS FOR DEFENCE AND SPACE VOUCHERS & POCKETS FOR DEFENCE & SPACE (51) International classification :C04B (71)Name of Applicant : (31) Priority Document No :NA 1)THUMSWAMY JOSEPH DAVID (32) Priority Date :NA Address of Applicant :108, ASHOK ENCLAVE, KAPRA (33) Name of priority country :NA MUNICIPAL ROAD, ECIL HYDERABAD 500062 Andhra (86) International Application No :NA Pradesh India :NA Filing Date 2)APPAVARU LAKSHMINARAYANA (87) International Publication No : NA (72)Name of Inventor : (61) Patent of Addition to Application Number :NA 1)THUMSWAMY JOSEPHA DAVID Filing Date :NA 2)APPAVARU LAKSHMI NARAYANA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The object of this invention is to provide; Non spirit based Sealing Cement and it binds at temperature of 300 deg. C in an open flame. The conventional capping cement starts melting near 250. producing flames &fumes, creating health hazards. And above these temperatures the new inventional product becomes more stronger and it can with stand a temperatures of 1800 deg C open flame. In even in such high temperatures also the capping cement won't produce flame and bad odour even in the presence of Oxygen also. The further objective ef the Capping cement is to expand itself to provide bindihg in between metal and glass cavities. The expansion causing tight grip in between two components to provide and withstand required torsion force.



5579





(54) Title of the invention : A HEAT CONSERVING GAS STOVE (51) International classification

:F24C 3/06 :NA :NA :NA :NA :NA : NA :NA :NA :NA :NA

(71)Name of Applicant : 1)VALAGAM RAJAGOPAL RAGHUNATHAN Address of Applicant : OLD NO.6, NEW NO. 72, 12TH AVENUE ASHOK NAGAR, CHENNAI 600 083. Tamil Nadu India (72)Name of Inventor : 1)VALAGAM RAJAGOPAL RAGHUNATHAN

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A heat conserving stove comprising an outer chamber, an inner chamber and an innermost chamber; the top portion of the outer chamber consisting of burner holes and a dish shaped heat collector chamber; a fuel gas inlet pipe located in the innermost chamber, the base of the outer and innermost Chamber, the base of the outer and innermost chambers being provided with first and second air inlet ports the first , air inlet port being connected to a forced draft fan through a normally closed spring-loaded valve, the draft from the fan, when operative, actuating the valve to open the first port and close the second port thereby sending in air through the first port into the outer chamber and thence into the heat collector and thereafter into the inner chamber and innermost chamber, to finally emerge as hot air at the burner holes mixed with the fuel gas to undergo ignition, the valve being deactuated, whenever the fan is inoperative, to close the first port and open the second port to allow atmospheric air into the innermost chamber to emerge as hot air at the burner holes mixed with the fuel gas to undergo ignition.



5580





(54) Title of the invention : AN AUXILIARY STARTER AND CONTROLLER ASSEMBLY FOR A COMPRESSOR SYSTEM (51) International classification

:F04B 49/02 :NA :NA :NA :NA :NA : NA :NA :NA :NA :NA

(71)Name of Applicant : 1)KESAVAN PANNIR SELVAM Address of Applicant : LECTURER: MECHANICAL ENGINEERING DEPARTMENT NATIONAL INSTITUTE OF TECHNOLOGY, TIRUCHIRAPALLI 620015. Tamil Nadu India (72)Name of Inventor : 1)KESAVAN PANNIR SELVAM

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : An auxiliary starter assembly for a compressor system, comprising a prime mover for driving the driver motor and compressor to a predetermined speed before switching on power supply to the driver motor; a controller operating the said system selectively on on-off control mode or constant speed control mode on sensing the rate of pressure rise by measuring the time taken for the receiver pressure to change over from cut-in level to cut-off level.



5581





(54) Title of the invention : PROCESS FOR MODIFYING DRUG CRYSTAL FORMATION (51) International classification :A61K 9/14 (71)Name of Applicant : (31) Priority Document No :0301259.8 1)NOVARTIS PHARMA GMBH (32) Priority Date :20/01/2003 Address of Applicant :Brunner Strasse 59, A-1230 Vienna (AT) (AT only). Switzerland (33) Name of priority country :U.K. :PCT/EP2004/000354 (72)Name of Inventor : (86) International Application No Filing Date :19/01/2004 1)PFEFFER, Sabine (87) International Publication No :WO/2004/064806 2)WIECKHUSEN, Dierk (61) Patent of Addition to Application 3)WIECKHUSEN, Dierk :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A process for modifying the crystal habit of acicular drug substances, crystals obtained by such a process, and particular crystal forms or modifications of mycophenolic acid or mycophenolate sodium are provided, as well as pharmaceutical compositions comprising the crystals, methods of treatment and uses thereof.



5582





(54) Title of the invention : RETAIL POINT BRAND RECALL ENHANCER (51) International classification

:G06F (71)Name of Applicant : 17/60 1)M. MANOHARAN :NA Address of Applicant :NO. 11/4 V.V.GIRI ST RAM NAGAR, :NA AMBATTUR, CHENNAI-600053 INDIA Tamil Nadu India :NA (72)Name of Inventor : :NA 1)M. MANOHARAN :NA : NA :NA :NA :NA :NA

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A nylon wire knitted bag used for holding eatable items in the shops adapted to promote publicity for advertiser is disclosed Use container made of nylon wire knit material No 1 & 2 is fixed to a plastic basket with brim No3. The plastic basket is bounded by a plastic moulded sleeve No.4. The Sleeve forming the bottom half of the bag is reserved for carrying advertisements. This method will give the advertiser prime publicity position inside the retail outlet.



5583





(54) Title of the invention : HIGH SURFACE AREA MICRO-POROUS FIBERS FROM POLYMER SOLUTIONS (51) International classification :A24D 3/10 (71)Name of Applicant : (31) Priority Document No :60/285,632 1)PHILIP MORRIS PRODUCTS, INC. (32) Priority Date :20/04/2001 Address of Applicant :3601 Commerce Road, Richmond, VA 23234 U.S.A. (33) Name of priority country :U.S.A. :PCT/US2002/011817 (72)Name of Inventor : (86) International Application No Filing Date :16/04/2002 1)XUE, Lixin (87) International Publication No :WO/2002/085143 2)KOLLER, Kent, B. (61) Patent of Addition to Application 3)GAO, Qiong :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Fibers are produced from an acetone solution of cellulose acetate by pulling or extruding such material through a spinneret in a dry spinning process. A vacuum is applied to the thus formed fibers after a certain degree of drying. A dried outer skin is formed, and the vacuum causes the solvent inside the skin to explode or pop and exit the fiber along micro-porous paths thereby producing high surface area fibers with micro-porous cavities and internal void volume. Such micro-cavities are particularly useful for retaining solid and/or liquid reagents in a cigarette filter for selective filtration of various smoke components.



5584





(54) Title of the invention : FUNGICIDAL USE (71)Name of Applicant : :A01N 35/04 :60/394,932 1)BASF AKTIENGESELLSCHAFT :11/07/2002 Address of Applicant :D-67056, LUDWIGSHAFEN Germany (72)Name of Inventor : :U.S.A. :PCT/EP03/07255 1)GEWEHR, MARKUS :07/07/2003 2)ROSE INGO :WO 3)BERND MULLER (87) International Publication No 2004/006675 A1 4)AMMERMANN, EBERHARD (61) Patent of Addition to Application Number :NA 5)ORTH, ANN Filing Date :NA 6)VAN TUYL COTTER, HENRY (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A process for protecting and/or treating crop plants The present invention relates to a process for protecting and/or treating crop plants selected from wheat and barley from Pseudocercosporella herpotrichoides infection comprising finely distributing benzophenones of the formula I in which R is hydrogen or C1-C4-alkyl and Hal is fluorine, chlorine or bromine, in solutions, emulsions, suspensions, dusts, powders, paste or granules and applying to the crop plants. (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date



5585





(54) Title of the invention : AUTOMATED WATER SPRINKLER SYSTEM FOR GARDENING, HORTICULTURAL AND AGRICULTURAL PURPOSES (51) International classification :A62C35/60 (71)Name of Applicant : (31) Priority Document No :NA 1)VALAGAM RAJAGOPAL RAGHUNATHAN (32) Priority Date :NA Address of Applicant :OLD NO. 6, NEW NO.72, 12TH (33) Name of priority country :NA AVENUE, ASHOK NAGAR, CHENNAI 600 083, TAMIL NADU, INDIA Tamil Nadu India (86) International Application No :NA Filing Date :NA (72)Name of Inventor : (87) International Publication No : NA 1)VALAGAM RAJAGOPAL RAGHUNATHAN (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Automated water sprinkler system for gardening, horticultural and agricultural purposes comprising a master unit and a plurality of slave units, the master unit consisting of a master controller and a pump, with each slave unit consisting of a slave controller having an identity code, the pump supplying water, from a source to each of the slave units, on a command from the master controller; means for generating and storing electric energy within each slave unit for powering the slave controller, each slave controller being activated by predetermined varying values of water pressure applied by the pump, at predetermined times, on commands from the master controller, to open and close, an exit valve of a slave unit bearing a specific identity code, at the beginning and end, respectively, of a predetermined interval of time, set by the master controller, to allow water from the source to flow out through the said exit valve to a water sprinkler connected thereto.



5586





(54) Title of the invention : A PROCESS FOR FLUID CATALYTIC CRACKING HEAVY HYDROCARBON FEED (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filed on

(71)Name of Applicant : :C10G 55/06 1)W.R. GRACE & CO :09/221,539 Address of Applicant :7500 GRACE DRIVE,COLOMBIA, :28/12/1998 MARYLAND 20144. U.S.A. :U.S.A. (72)Name of Inventor : :NA 1)CHENG, WU-CHENG :NA 2)ROBERIE, TERRY, G : NA 3)TIMKEN, HYE KYUNG CHO :NA 4)PURNELL, SCOTT KEVIN :NA 5)ZHAO, XINJIN :1225/MAS/99 6)CHESTER, ARTHUR, W :24/12/1999 7)ZIEBARTH, MICHAEL, S

(57) Abstract : The present invention relates to a fluid catalytic cracking process in which a heavy hydrocarbon feed containing organosulfur compounds is catalytically cracked to lighter products by contact in a cyclic catalyst recirculation cracking process with a circulating fluidizable catalytic cracking catalyst inventory consisting of particles having a size ranging from 20 to 100 microns, by: (i) catalytically cracking the feed in a catalytic cracking zone operating at catalytic cracking conditions by contacting feed with a source of regenerated cracking catalyst to produce a cracking zone effluent comprising cracked products and spent catalyst containing coke and strippable hydrocarbons; (ii) discharging and separating the effluent mixture into a cracked product rich vapor phase and a solids rich phase comprising spent catalyst; (iii) removing the vapor phase as a product and fractionating the vapor to form liquid cracking products including gasoline, (iv) stripping the solids rich spent catalyst phase to remove occluded hydrocarbons from the catalyst, (v) transporting stripped catalyst from the stripper to a catalyst regenerator; (vi) regenerating stripped catalyst by contact with oxygen containing gas to produce regenerated catalyst; and (vii) recycling the regenerated catalyst to the cracking zone to contact further quantities of heavy hydrocarbon feed, in which the sulfur content of the liquid cracking products is reduced by carrying out the catalytic cracking in the presence of a product sulfur reduction catalyst which comprises a porous molecular sieve having (i) a first metal component which is within the interior pore structure of the molecular sieve and which comprises a metal in an oxidation state greater than zero and (ii) a second metal component which is within the interior pore structure of the molecular sieve and which comprises at least one rare earth.



5587





(54) Title of the invention : FLUID PUMP AND ELECTRIC MOTOR, AND MANUFACTURING METHOD FOR THE SAME (51) International classification (31) Priority Document No

:H02K 1/00 (71)Name of Applicant : :20051)DENSO CORPORATION 257416 Address of Applicant :1-1, SHOWA-CHO, KARIYA-CITY, :06/09/2005 AICHI-PREF. 448-8661. Japan :Japan (72)Name of Inventor : :NA 1)SAKAI, HIROMI :NA 2)NAGATA, KIYOSHI : NA 3)SUMIYA, SHINJI :NA :NA :NA :NA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A fluid pump (10) includes a motor portion (13) that has a stationary part (40) and a rotator (60). The inner circumferential periphery of the stationary part (40) and the outer circumferential periphery of the rotator (60) define a fuel passage (102) therebetween. The rotator (60) is rotatable around the inner circumferential periphery of the stationary part (40). The motor portion (13) drives a pump portion (12) for pumping fuel through the fuel passage (102). The rotator (60) includes a permanent magnet (64, 264) that is formed by injection molding a composite material containing a magnetic material and resin. The permanent magnet (64, 264) has one end with respect to the axial direction of the permanent magnet (64, 264). The one end defines an axial end surface (67, 267). The axial end surface (67, 267) has an injection port mark (66, 266).



5588





(54) Title of the invention : PROCESS FOR RECOVERY AND RECYCLING OF VALUABLE METALS FROM PRINTED CIRCUIT BOARDS OBTAINED FROM ELECTRONIC WASTE (51) International classification :H05K3/36 (71)Name of Applicant : (31) Priority Document No :NA 1)PEETHAMBARAM PARTHASARATHY (32) Priority Date :NA Address of Applicant :M/S. E. PARISARAA PVT. LTD B (33) Name of priority country :NA 41/1, III STAGE, PEENYA INDUSTRIAL ESTATE, BANGALORE - 560 058, KARNATAKA, INDIA Karnataka (86) International Application No :NA Filing Date :NA India (87) International Publication No : NA (72)Name of Inventor : (61) Patent of Addition to Application Number :NA 1)PEETHAMBARAM PARTHASARATHY Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Electronic Waste contains thousands of different substances, in which some of them are toxic and creates serious environmental and health problems when disposed or land filled in an unscientific manner. The present invention largely confines to recycling of metals from Printed Circuit Boards (PCB *s) using simple, non-incineration, cost effective technology with maximum resource recovery in an environmental friendly way, which is suitable for Indian conditions. The results of the invention shall form basis for future recyclers, for policy framework to get a better understanding of the suitable methodologies and also the concepts developed during the study can be extended, adopted for other waste management areas as well. The study also forms a basis for future research in the area of Electronic Waste management keeping in view of achieving better eco-efficiency to maximize the material recycling efficiency and at the same time conservations and better utilization of resources.



5589





(54) Title of the invention : A COMPOSITION FOR ORAL ADMINISTRATION AND DELIVERY TO THE INTESTINES (51) International classification

(71)Name of Applicant : :A61K 38/44 1)IXION BIOTECHNOLOGY, INC :60/150,259 Address of Applicant :13709 PROGRESS BOULEVARD, P :23/08/1999 O BOX 13, ALACHUA, FLORIDA 32615, USA U.S.A. :U.S.A. (72)Name of Inventor : :NA 1)MILTON J ALLISON :NA 2)HARMEET SIDHU : NA :NA :NA :NA :NA

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A composition for oral administration and delivery to the intestines The present invention relates to a composition for oral administration and delivery to the intestines, comprising lyophilized oxalate-degrading bacteria or oxalate-degrading enzymes in a gel capsule that has an enteric coating, for reduction of systemic oxalate levels by degrading oxalate in the intestines, wherein viable oxalate-degrading bacteria or active oxalate-degrading enzymes are delivered to the intestines.



5590





(54) Title of the invention : A NEW AND INNOVATIVE MEDIUM AND TECHNOLOGY FOR GETTING INFORMED, COUNSELED AND ADVISED (51) International classification :G06F7/00 (71)Name of Applicant : (31) Priority Document No :NA 1)EAFT TECHNOLABS (32) Priority Date :NA Address of Applicant :112, DD MILESTONE, (33) Name of priority country :NA KADAVANTHARA JUNCTION, KOCHI-682020 Kerala India (72)Name of Inventor : (86) International Application No :NA Filing Date :NA 1)EAFT TECHNOLABS (87) International Publication No : NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : the present invention is directed to a method for interacting with a caff center m which a user communication device initiates a realtime communication with a caff center and, before the real-time communication is routed to a resource associated with the caff center, the user communication device forwards to the caff center at least one message, via a very wide option of media, comprising personal information of the user.



5591





(54) Title of the invention : A SYSTEM FOR MODELING ARCHITECTURE FOR RESOURCE CONSTRAINT DEVICES AND METHODS THEREOF (51) International classification :H04L12/56 (71)Name of Applicant : (31) Priority Document No :NA 1)INFOSYS TECHNOLOGIES LIMITED (32) Priority Date :NA Address of Applicant :PLOT NO. 44, ELECTRONICS CITY, (33) Name of priority country :NA HOSUR ROAD, BANGALORE, KARNATAKA - 560 100, INDIA Karnataka India (86) International Application No :NA Filing Date :NA (72)Name of Inventor : (87) International Publication No : NA 1)VENKATARAMAN, MUKUNDAN (61) Patent of Addition to Application Number :NA 2)MURALIDHARAN, KARTIK Filing Date :NA 3)GUPTA, PUNEET (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A SYSTEM FOR MODELING ARCHITECTURE FOR RESOURCE CONSTRAINT DEVICES AND METHODS THEREOF A communication system in a wireless sensor network adapted to provide a communication link between a plurality of nodes is disclosed. The system includes a protocol stack encapsulating a plurality of fundamental network protocol layers that correspond to an open system interconnection (OSI) model, wherein each of the layers comprises a plurality of modules. The system further includes a preamble module adapted for defining a set of requirements for at least one application. Further, the system includes a communication module adapted for communicating data between the plurality of nodes by selecting one or more modules from at least one of the layer of the stack to form an optimal combination of modules indicative of the preamble module defined, wherein the optimal combination is based on quality of service (QoS) desired by the at least one application.



5592





(54) Title of the invention : "FLY SEWING MACHINE" (51) International classification (31) Priority Document No

:D05B (71)Name of Applicant : 35/06 1)YKK CORPORATION :2004Address of Applicant :1 kanda izumi-cho, chiyoda-ku, tokyo 355382 Japan :08/12/2004 (72)Name of Inventor : :Japan 1)SHO, YOSHIYUKI :NA 2)TAKAGISHI, HARUMI :NA : NA :NA :NA :NA :NA

(32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The invention provides a fly sewing machine comprising a fly carrying portion (20) disposed on an upstream side of a fly carrying passage (2a) between a fly supply portion (10) and a sewing machine (51) and a carrying speed adjusting portion (40) disposed on a downstream side, wherein the fly carrying portion (20) comprises a plurality of carrying roller pairs having driver rollers (21 to 23) and supporting rollers (24 to 26) disposed so as to oppose to each other vertically, and the carrying speed adjusting portion (40) comprises a pair of a drive roller (41) and a supporting roller (42) disposed vertically and roller gap adjusting means (44) for adjusting a gap (dl) between the drive roller (41) and the supporting roller (42) and wherein, by the time when a following fly (F2) carried from the fly carrying portion (20) is bitten into the gap (dl) between the drive roller (41) and the supporting roller (42) of the carrying speed adjusting portion (40), a predetermined interval (d2) is formed between a preceding fly (Fl) and the following fly (F2). Selected drawing FIG. 1



5593





(54) Title of the invention : AMORPHOUS ZALEPLON AND METHODS FOR PREPARING (51) International classification

:A61K 31/519 :NA :NA :NA :NA :NA : NA :NA :NA :NA :NA

(71)Name of Applicant : 1)DR. REDDY'S LABORATORIES LIMITED Address of Applicant :DR REDDY'S LABORATORIES LIMITED 7-1-27 AMEERPET HYDERABAD ANDHRA PRADESH Andhra Pradesh India (72)Name of Inventor : 1)RANGINENI SRINIVASULU 2)BOMMAREDDY SIVAKUMAR REDDY 3)SUDEEP KUMAR AGARWAL 4)GADE SRINIVAS REDDY

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The present invention relates to novel amorphous zaleplon and process for the preparation thereof. Particularly, present invention provides novel amorphous zaleplon in combination with a pharmaceutically acceptable carrier. Amorphous zaleplon of the present invention is characterized by its X-ray powder diffraction (XRPD) pattern substantially in accordance with Fig. 1. The present invention further provides a process for the preparation of novel amorphous zaleplon in combination with a pharmaceutically acceptable carrier. The process includes removing the solvent from a solution containing zaleplon in combination with a pharmaceutically acceptable carrier, in an organic solvent, such as using distillation under vacuum, spray drying, or an Ultrafilm agitated thin film drier (ATFD).



5594





(54) Title of the invention : LEVER FOR A RING MECHANISIM (51) International classification

:B42F 13/26 :11/027,550 :30/12/2004 :U.S.A. :NA :NA : NA :NA :NA :NA :NA

(71)Name of Applicant : 1)WORLD WIDE STATIONERY MANUFACTURING COMPANY,LTD Address of Applicant :19/F,KOON WAH MIRRORS FACTORY,3RD INDUSTRIAL BUILDING,5-9 KA HING ROAD,KWAI CHUNG, NEW TERRITORY,HONGKONG Hongkong(China) (72)Name of Inventor : 1)CHENG,HUNG ,YU

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A ring mechanism for retaining loose-leaf pages comprises a housing, hinge plates, and ring members. The housing supports the hinge plates for pivoting motion moving the ring members mounted thereon between an open position and a closed position. In the open position, the ring members are apart and pages can be added or removed from the ring members. In the closed position, the ring members are together and pages are retained by the ring members. The mechanism comprises an actuator for causing the pivoting motion of the hinge plates. In one aspect, the actuator includes an opening arm that causes the hinge plates to pivot to open the ring members. In another aspect, it includes closing arms that cause the hinge plates to pivot to close the ring members.



5595





(54) Title of the invention : ELECTRIC POWER SUPPLYING APPARATUS USING UNSTABLE ELECTRIC POWER SUPPLY AND A CONTROL METHOD THEREFOR (51) International classification :H02J 3/00 (71)Name of Applicant : (31) Priority Document No :8-240023 1)CANON KABUSHIKI KAISHA (32) Priority Date :23/08/1996 Address of Applicant :30-2, SHIMOMARUKO 3-CHOME, (33) Name of priority country :Japan OHTA-KU, TOKYO, JAPAN Japan (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)NOT APPLICABLE (87) International Publication No : NA (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An electric power supplying apparatus comprising an unstable power supply that generates electric power; an electric power storage unit that is connected to said unstable electric power supply in parallel; a switch that is connected between said unstable electric power supply and said electric power storage unit in series; a converter that converts electric power supplied from said unstable electric power supply, or from both said unstable electric power supply and said electric power storage unit, to electric power which is suitable for a load so as to supply the converted electric power to the load; and a controller that controls opening and closing of said switch and controls an operation of said converter based on an output from the unstable electric power supply so as to efficiently operate the unstable electric power supply.



5596





(54) Title of the invention : A BLENDED JUICE BEVERAGE (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date

:A23L 2/00 :10/201,395 :23/07/2002 :U.S.A. :

(71)Name of Applicant : 1)TROPICANA , PRODUCTS ,INC. Address of Applicant :1001 13TH AVENUE EAST , BRADENTON,FLORIDA 34208 U.S.A. (72)Name of Inventor : PCT/US2003/022814 1)HAYNES , KELLIE : 23.07.2003 2)BUNDANG, RACHEL : WO2004008885 3)EICHINGER , CHRISTIAN 4)LINEBACK ,D., SCOTT., :NA :NA

(87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number :51/CHENP/2005 Filed on :23/07/2003 (57) Abstract : A method for producing a coconut water beverage" The present invention relates to a method for producing a coconut water beverage comprising: combining coconut water with a food grade phosphoric acid in an amount sufficient to lower the pH of the coconut water to a level below 4.5.



5597





(54) Title of the invention : PROCESS FOR THE PREPARATION OF SUBSTITUTED HALOGENATED ANILINE (51) International classification :C07C 209/52 (71)Name of Applicant : (31) Priority Document No :60/433,847 1)BASF AKTIENGESELSHAFT (32) Priority Date :16/12/2002 Address of Applicant :D-67056, LUDWIGSHAFEN, (33) Name of priority country :U.S.A. GERMANY Germany (86) International Application No :PCT/EP03/14354 (72)Name of Inventor : Filing Date :16/12/2003 1)SMITH, JONATHAN, O (87) International Publication No :WO/2004/054961 2)PETRUSKA, MELISSA, A (61) Patent of Addition to Application 3)LONGLET, JON, J :NA Number :NA Filing Date (62) Divisional to Application Number :1554/CHENP/2005 Filed on :16/12/2003 (57) Abstract : The present invention relates to a process for the preparation of substituted halogenated anilines from substituted halogenated 1chlorobenzenes which comprises a) reacting a substituted halogenated 1-chlorobenzene selectively with an imine in the presence of a transition metal catalyst complex and a base to form an N-aryl imine; and b) hydrolyzing the N-aryl imine; and c) isolating the substituted halogenated aniline.



5598





(54) Title of the invention : ACCESS CONTROL FOR INTERACTIVE LEARNING SYSTEM (51) International classification :G09B 19/04 (71)Name of Applicant : (31) Priority Document No :60/256,558 1)BURLINGTONSPEECH LIMITED (32) Priority Date :18/12/2001 Address of Applicant :15 COSTA PAPARIGOPOULOU (33) Name of priority country :U.S.A. STREET, CHARME CHABERS LIMASSOL, CYPRUS Cyprus :PCT/US01/49318 (72)Name of Inventor : (86) International Application No Filing Date :18/12/2001 1)SHPIRO, ZEEV :WO/2002/050800 2)COHEN, ERIC (87) International Publication No (61) Patent of Addition to Application Number :NA Filing Date :NA (62) Divisional to Application Number :905/CHENP/2003 Filed on :18/12/2001 (57) Abstract : A technique to control access to computer network resources at a computer facility permits a user to interact with the computer facility through a computer node of a network, wherein the user interaction comprises language learning responses submitted to the computer facility through the computer node, and a user authentication process is performed to determine if the permitted user interaction is authorized. The user authentication process is performed with user authentication information that is obtained by the computer facility during the permitted user interaction and also with user authentication information that is extracted from the user's language learning responses. In this way, user authentication occurs without introducing into the utilization of the computer facility. [Figure 1]



5599





(54) Title of the invention : PHARMACEUTICAL COMPOSITION COMPRISING BENAZEPRIL AND AMLODIPINE (51) International classification :A61K 31/44 (71)Name of Applicant : (31) Priority Document No :PCT/US00/34246 1)NOVARTIS AG (32) Priority Date :18/12/2000 Address of Applicant :SCHWARZWALDALLEE 215, CH(33) Name of priority country :U.S.A. 4058 BASEL Switzerland (86) International Application No :PCT/US01/48808 (72)Name of Inventor : Filing Date :17/12/2001 1)WEBB, RANDY, LEE :WO/2002/049646 2)DALEY, WILLIAM, LIONEL (87) International Publication No (61) Patent of Addition to Application Number :NA 3)COMFORT, ANN, REESE Filing Date :NA 4)FLERES, SANTO, JOSEPH (62) Divisional to Application Number :952/CHENP/2003 5)ROYCE, ALLAN, EDWARD Filed on :17/12/2001 6)WEI, WILLIAM, SHIFENG (57) Abstract : Pharmaceutical composition comprising benazepril and amlodipine The present invention relates to a Pharmaceutical composition comprising: (3) an ACEI selected from the group consisting of benazepril, benazeprilat, and pharmaceutical acceptable salts thereof, and (4) amlodipine or pharmaceutical acceptable salt thereof, wherein (i) the amount of amlodipine or a pharmaceutical acceptable salt thereof is corresponds to 6 mg to 40 mg of the free base and (ii) the amount of the ACE inhibitor or a pharmaceutical acceptable salt thereof corresponds to 20 mg to 160 mg of benazepril hydrochloride.



5600





(54) Title of the invention : PROCESS FOR PREPARING SUBSTITUTED IMIDAZOLE DERIVATIVES AND INTERMEDIATES USED IN THE PROCESS (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date

:C07D 471/04 :20030026 :08/01/2003 :Finland :

(71)Name of Applicant : 1)OY JUVANTIA PHARMA LTD Address of Applicant :LEMMINKAISENKATU 5 FIN-20520 TURKU Finland (72)Name of Inventor : PCT/FI2004/000004 1)JUUJARVI, PAIVI : 08.01.2004 2)PARHI, SEPPO : WO2004/063168 3)KARJALAINEN, JAANA,

(87) International Publication No (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :1497/CHENP/2005 :08/01/2004 Filed on (57) Abstract : The invention relates to a process for preparing substituted imidazole derivatives of formula (I) and acid addition salts thereof (I) in which formula Y is -CH2- or -CO-, Rl is H, halo or hydroxy, R2 is H or halo and R3 is H or lower alkyl, starting from a compound of formula (II) wherein Y, R1,R2 and R3 are as defined above. The invention also relates to intermediates and their preparation.



5601





(54) Title of the invention : A PROCESS FOR IDENTIFYING A COMPOUND WHICH SELECTIVELY INDUCES THE MITOCHONRIAL PERMEABILITY TRANSIT (51) International classification :C12Q 1/68 (71)Name of Applicant : (31) Priority Document No :2002952526 1)NEWSOUTH INNOVATIONS PTY LIMITED (32) Priority Date :07/11/2002 Address of Applicant :RUPERT MYERS BUILDING, GATE (33) Name of priority country :Australia 14, BARKER STREET, SYDNEY, NEW SOUTH WALES 2052, (86) International Application No :PCT/AU03/01483 Australia Filing Date :07/11/2003 (72)Name of Inventor : (87) International Publication No :WO/2004/042079 1)HOGG, PHILIP, JOHN (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :1148/CHENP/2005 :07/11/2003 Filed on (57) Abstract : The present invention relates to process for identifying a compound which induces the mitochondrial permeability transition (MPT) in proliferating cells, wherein said process comprises contacting a cell or cell extract with a compound, determining whether the compound binds to adenine nucleotide translocator (ANT), and determining whether the compound selectively induces the MPT in proliferating cells.



5602





(54) Title of the invention : A BASE SEQUENCE PROCESSING APPARATUS (51) International classification :C12N 15/11 (71)Name of Applicant : (31) Priority Document No :2002-340053 1)BIO-THINK TANK CO., LTD (32) Priority Date :22/11/2002 Address of Applicant :3-32-6-703,HONGO, BUNKYO-KU, (33) Name of priority country :Japan TOKYO 113-0033 Japan (86) International Application No :PCT/JP03/14893 (72)Name of Inventor : Filing Date :21/11/2003 1)SAIGO, KAORU (87) International Publication No :WO/2004/048566 2)TEI, KUMIKO (61) Patent of Addition to Application 3)NAITO, YUKI :NA Number :NA Filing Date (62) Divisional to Application Number :1378/CHENP/2005 Filed on :21/11/2003 (57) Abstract : A base sequence processing apparatus characterized in that it comprises: partial base sequence creation means for acquiring base sequence information of a target gene for KNA interference and creating partial base sequence information corresponding to a sequence segment having a predetermined number of bases selected from 13 to 28 in the base sequence information; 3' end base determination means for determining whether the 3' end base in the partial base sequende information created by the partial base 'sequence creation means is adenine, thymine, or uracil; 5' end base determination means for determining whether the 5' end base in the partial base sequence information created by the partial base sequence creation means is guanine or cytosine; predetermined base inclusion determination means for determining whether base sequence information comprising 7 bases at the 3' end in the partial base sequence information created by the partial base sequence creation means is the base sequence information of the above wherein at least three bases among the seven bases are one or more types of bases selected from the group consisting of adenirxe, thymine, and uracil; and prescribed sequence selection means for selecting prescribed sequence information which specifically causes RNA interference in the target gene from the partial base sequence information created by the partial base sequence creation means, based on the results determined by the 3' base determination means, the 5' end base determination means, and the predetermined base inclusion determination means.



5603





(54) Title of the invention : A TRAVEL BAR FOR USE WITH A RING MECHANISM (51) International classification

:B42F 13/16 :60/678,394 :06/05/2005 :U.S.A. :NA :NA : NA :NA :NA :NA :NA

(71)Name of Applicant : 1)WORLD WIDE STATIONERY MANUFACTURING COMPANY LTD Address of Applicant :19/F KOON WAH MIRRORS FACTORY 3RD INDUSTRIAL BUILDING 5-9 KA HING ROAD KWAI CHUNG NEW TERRITORY Hongkong(China) (72)Name of Inventor : 1)CHENG, HUNG, YU

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : A ring mechanism for retaining loose-leaf pages has supporting hinge plates for pivoting motion relative to a housing to open and close ring members. The mechanism further includes a thin, flat travel bar between the housing and the hinge plates. The travel bar moves relative to the hinge plates between a position blocking the hinge plates against pivoting when the ring members are closed and a position allowing the hinge plates to pivot when it is desired to open the ring members. The travel bar is supported in a generally vertical orientation by the hinge plates within a guide in the housing. The guide controls movement of the travel bar lengthwise of the housing.



5604





(54) Title of the invention : JUNCTIONLESS OPHTHALMIC LENSES AND METHODS FOR MAKING SAME (51) International classification :G02C 7/04 (71)Name of Applicant : (31) Priority Document No :09/709,132 1)OCULAR SCIENCES INC (32) Priority Date :10/11/2000 Address of Applicant :1855 GATEWAY BLVD SUITE 700 CONCORD CALIFORNIA 94520 U.S.A. (33) Name of priority country :U.S.A. :PCT/US2001/051242 (72)Name of Inventor : (86) International Application No Filing Date :07/11/2001 1)BACK, ARTHUR (87) International Publication No :WO/2002/071130 2)HO, ARTHUR (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :820/CHENP/2003 Filed on :07/11/2001 (57) Abstract : Methods for producing a junctionless ophthalmic lens are provided. Additionally, ophthalmic lenses having junctionless, three dimensional surfaces, for example, asymmetrical anterior and/or posterior surfaces, as well as molding tools used in the production of such lenses, are also provided. The method generally include providing sample data points to define a surface contour, and interpolating between these data points using an algorithm to produce a simulated three dimensional surface. The simulated three dimensional surface is used in producing an ophthalmic lens, for example, in cast molding a contact lens,



5605





(54) Title of the invention : A METHOD FOR TRACKING AN OBJECT USING OBJECT DETECTION SYSTEM AND GPS INTEGRATED MOBILE DEVICE (51) International classification

:G01S 5/00 :NA :NA :NA :NA :NA : NA :NA :NA :NA :NA

(71)Name of Applicant : 1)SAMSUNG ELECTRONICS CO. LTD., INDIA SOFTWARE OPERATIONS (SISO) Address of Applicant :J.P. TECHNO PARK, 3/1, MILLERS ROAD, BANGALORE 560 052 Karnataka India (72)Name of Inventor : 1)SUDHIR KUMAR BAGHEL 2)SATISH KANUGOVI

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date (57) Abstract : The present invention in general relates to the Mobile Phone Application, GPS, Object detection system like RFID, Bluetooth etc. Particularly the present invention relates to a method for tracking an object using object detection system and GPS integrated mobile device. The invention explains a method for tracking an object using object detection system and GPS integrated mobile device comprising the steps of: providing the objects with RFID tags that uniquely identify the said objects ; periodically detecting the objects through their RFID tags by a RFID transmitter/interrogator in the mobile device; and registering the mobile's current location and assigning the said location as the current location of the object in the memory when an object is detected, wherein at a later time to locate the position of an object, the mobile's current GPS location and the object's last stored location are given to the GPS application and the GPS application generates a route map showing the location of the object.



5606





(54) Title of the invention : METHODS OF PRODUCING CYCLIC BENZAMIDINE DERIVATIVES, THEIR INTERMEDIATES AND PROCESS FOR PRODUCING THE INTERMEDIATES THEREOF (51) International classification :C07D 209/44 (71)Name of Applicant : (31) Priority Document No :2003-040949 1)EISAI R & D MANAGEMENT CO LTD (32) Priority Date :19/02/2003 Address of Applicant :6-10 KOISHIKAWA 4-CHOME (33) Name of priority country :Japan BUNKYO-KU TOKYO 112-8088 Japan (86) International Application No :PCT/JP2004/001396 (72)Name of Inventor : Filing Date :10/02/2004 1)TSUJII, MASAHIKO (87) International Publication No :WO/2004/078721 2)SHIMOMURA, NAOYUKI (61) Patent of Addition to Application 3)SASHO, MANABU :NA Number 4)KAYANO, AKIO :NA Filing Date 5)YOSHIZAWA, KAZUHIRO (62) Divisional to Application Number :2311/CHENP/2005 6)KURODA, HIROSHI Filed on :10/02/2004 7)FURUKAWA, KEN (57) Abstract : A method for producing a fluorinated cyclic benzamidine derivative(A) representated by formula (II) (wherein Et represents an ethyl group), or a salt thereof, (wherein, X represents a leaving group 0 with ammonia or an imide



5607





(54) Title of the invention : DIGITAL SET-TOP TERMINAL CONFIGURED TO RECEIVE ANALOG SIGNALS (51) International classification :H04N 5/44 (71)Name of Applicant : (31) Priority Document No :10/981,090 1)SCIENTIFIC-ATLANTA, INC (32) Priority Date :04/11/2004 Address of Applicant :5030 SUGARLOAF PARKWAY, LAWRENCEVILLE, GEORGIA 30044, U.S.A. (33) Name of priority country :U.S.A. :PCT/US2005/039915 (72)Name of Inventor : (86) International Application No Filing Date :03/11/2005 1)RUSS SAMUEL H :WO 2006/052711 A1 (87) International Publication No (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Systems and methods are disclosed in which analog television channels can be passed through digital set-top terminals. In some embodiments, among others, a switch and a splitter are included in a digital set-top terminal. The splitter is configured to receive a broadcast signal, and direct the broadcast signal to a first path and a second path. The first path has digital tuning circuitry, which processes the broadcast signal to produce an output signal for display on a television. The switch is located in the second path. The switch receives the broadcast signal from the splitter and the output signal from the digital tuning circuitry. The switch then selects between the broadcast signal and the output signal from the digital tuning circuitry. The selected signal is then output to a television.



5608





(54) Title of the invention : AN IMPLANTABLE MEDICAL DEVICE FOR DELIVERING A THERAPEUTIC AGENTLOCALLY TO MYOCARDIAL TISSUE (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date

:A61F 2/00 :60/425,096 :08/11/2002 :U.S.A. :

(71)Name of Applicant : 1)CONOR MEDSYSTEMS INC Address of Applicant :1003 HAMILTON COURT MENLO PARK CA 94025 U.S.A. (72)Name of Inventor : PCT/US2003/035953 1)LITVACK, FRANK : 10.11.2003 2)PARKER, THEODORE, L : WO2004/043511 3)SHANLEY, JOHN, F

(87) International Publication No (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :1144/CHENP/2005 :10/11/2003 Filed on (57) Abstract : The present invention relates to an implantable medical device for delivering a therapeutic agent locally to myocardial tissue, the device comprising: an implantable medical device configured to be implanted within a coronary artery; and a therapeutic dosage of a therapeutic agent for treatment of ischemic injury following acute myocardial infarction, the therapeutic agent affixed to the implantable medical device in a manner such that the therapeutic agent is released to the myocardial tissue at a therapeutic dosage and over an administration period effective to reduce ischemic injury of the myocardial tissue.



5609





(54) Title of the invention : ADDITIVES AND LUBRICANT FORMULATIONS FOR IMPROVED USED OIL COMBUSTION PROPERTIES (51) International classification :C10M (71)Name of Applicant : (31) Priority Document No :11/534,314 1)AFTON CHEMICAL CORPORATION (32) Priority Date :22/09/2006 Address of Applicant :500 SPRING STREET, (33) Name of priority country :U.S.A. RICHMOND,VIRGINA ,23219 U.S.A. (86) International Application No :NA (72)Name of Inventor : Filing Date :NA 1)MACPHERSON,IAN (87) International Publication No : NA 2)ARADI,ALLEN,A (61) Patent of Addition to Application Number :NA 3)CLEAVER, DAVID Filing Date :NA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The disclosure is directed to a method of enhancing a fuel value for a used or waste lubricating oil, lubricating oils having improved combustion and emission characteristics, and a business method for distributing and using waste oils as components of primary combustion fuels. In one embodiment, there is provided a lubricating oil composition having improved combustion and emission properties when burned as a used lubricating oil composition. The lubricating oil composition includes a major amount of oil of lubricating viscosity and a minor combustion improving amount of a combustion improving additive.



5610


(21) Application No.3812/KOLNP/2007 A



(54) Title of the invention : FUSED HETEROCYCLIC COMPOUNDS (51) International classification :C07D 235/24 (71)Name of Applicant : (31) Priority Document No :60/675,113 1)TAKEDA PHARMACEUTICAL COMPANY LIMITED (32) Priority Date :27/04/2005 Address of Applicant :1-1, DOSHOMACHI 4-CHOME, (33) Name of priority country :U.S.A. CHUO-KU, OSAKA-SHI, OSAKA Japan (86) International Application No :PCT/US2006/015646 (72)Name of Inventor : Filing Date :26/04/2006 1)KAZUYOSHI ASO (87) International Publication No :WO 2006/116412 2)MICHIYO MOCHIZUKI (61) Patent of Addition to Application 3)ALBERT CHARLES GYORKOS :NA Number 4)CHRISTOPHER PETER CORRETTE :NA Filing Date 5)SUK YOUNG CHO (62) Divisional to Application Number :NA 6)SCOTT ALAN PRATT Filing Date :NA 7)CHRISTOPHER STEPHEN SIEDEM (57) Abstract : There is provided a CRF receptor antagonist comprising a compound of the formula (I): wherein R is an optionally substituted hydrocarbyl, an optionally substituted C-linked heterocyclic group, an optionally substituted N-linked heteroaryl group, a cyano or an acyl; R2 is an optionally substituted cyclic hydrocarbyl or an optionally substituted heterocyclic group; X is oxygen, sulfur or -NR3(wherein R3 is a hydrogen, an optionally substituted hydrocarbyl or an acyl) ; Y1, Y2 and Y3 are each an optionally substituted carbon or a nitrogen, provided that one or less of Y, Y and Y3 is nitrogen; and Z is a bond, -CO-, oxygen, sulfur, -SO-, -SO2-, -NR4-, -NR4-alk-, -CONR4- or -NR4CO- (wherein alk is an optionally substituted C1-4 alkylene and R4 is a hydrogen, an optionally substituted hydrocarbyl or an acyl); or a salt thereof or a prodrug thereof.



5611





(54) Title of the invention : RECOMBINANT E-SELECTIN MADE IN INSECT CELLS (51) International classification :C07K 14/78 (71)Name of Applicant : (31) Priority Document No :60/660258 1)NOVAVAX, INC. (32) Priority Date :10/03/2005 Address of Applicant :508 LAPP ROAD, MALVERN, PA U.S.A. (33) Name of priority country :U.S.A. :PCT/US2006/008340 (72)Name of Inventor : (86) International Application No Filing Date :08/03/2006 1)SMITH GALE (87) International Publication No :WO 2006/099006 2)PUSHKO PETER (61) Patent of Addition to Application 3)COICE VITTORIA :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The inventive features include recombinant mammalian E-selectin peptides, nucleic acids encoding said peptides, vectors and cells having these nucleic acids, and methods of making the peptides. Further inventive features include methods of treating diseases and conditions associated with inflammation using recombinant mammalian E-selectin peptides to induce mucosal tolerance to E-selectin.



5612





(54) Title of the invention : ANTIBODIES AND RELATED MOLECULES THAT BIND TO 161P2F10B PROTEINS


(71)Name of Applicant : 1)AGENSYS, INC. :C07K 16/30 Address of Applicant :2225 COLORADO BOULEVARD :60/667588 SANTA MONICA, CALIFORNIA U.S.A. :31/03/2005 (72)Name of Inventor : :U.S.A. 1)JAKOBOVITS AYA :PCT/US2006/012314 2)KANNER STEVEN B :31/03/2006 3)CHALLITA-EID PIA M. :WO 2006/105488 4)PEREZ-VILLAR JUAN J. :NA 5)SATPAEV DAULET :NA 6)RAITANO ARTHUR B 7)MORRISON ROBERT KENDALL :NA 8)MORRISON KAREN JANE MEYRICK :NA 9)JIA XIAO-CHI 10)GUDAS JEAN

(57) Abstract : Antibodies and molecules derived therefrom that bind to 161P2F10B protein and variants thereof, are described wherein 161P2F10B exhibits tissue specific expression in normal adult tissue, and is aberrantly expressed in the cancers listed in Table I. Consequently, 161P2F10B provides a diagnostic, prognostic, prophylactic and/or therapeutic target for cancer. The 161P2F10B gene or fragment thereof, or its encoded protein, or variants thereof, or a fragment thereof, can be used to elicit a humoral or cellular immune response; antibodies or T cells reactive with 161P2F10B can be used in active or passive immunization.



5613





(54) Title of the invention : SITE-AWARE OBJECTS (51) International classification :G01R 31/26 (71)Name of Applicant : (31) Priority Document No :60/676005 1)TERADYNE, INC (32) Priority Date :29/04/2005 Address of Applicant :700 RIVERPARK DRIVE NORTH READING, MA U.S.A. (33) Name of priority country :U.S.A. :PCT/US2006/013546 (72)Name of Inventor : (86) International Application No Filing Date :12/04/2006 1)HLOTYAK STEPHEN J (87) International Publication No :WO 2006/118758 2)STIMSON RANDALL B (61) Patent of Addition to Application 3)THORNTON DANIEL P :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A method for use with automatic test equipment (ATE) having sites, each which accommodates a device under test (DUT), includes defining an object for use with the plural sites, where the object is to contain data associated with at least some of the plural sites, and where the object determines which sites are active. The method also includes using the object during testing of DUTs by the ATE,



5614





(54) Title of the invention : A MAGNETIC RESONANCE SYSTEM AND METHOD TO DETECT AND CONFIRM ANALYTES (51) International classification :G01N 33/53 (71)Name of Applicant : (31) Priority Document No :60/669019 1)MENON & ASSOCIATES (32) Priority Date :07/04/2005 Address of Applicant :12282 LIBELLE COURT, SAN DIEGO, CALIFORNIA U.S.A. (33) Name of priority country :U.S.A. :PCT/US2006/002368 (72)Name of Inventor : (86) International Application No Filing Date :24/01/2006 1)MENON SURESH M. (87) International Publication No :WO 2007/086840 2)NEWMAN DAVID E. (61) Patent of Addition to Application 3)HENDERSON TERRY J. :NA Number 4)PEREZ J. MANUEL :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A system and method are provided to detect target analytes based on magnetic resonance measurements. Magnetic structures produce distinct magnetic field regions having a size comparable to the analyte. When the analyte is bound in those regions, magnetic resonance signals from the sample are changed, leading to detection of the analyte.



5615





(54) Title of the invention : CRYSTAL FORMS OF {[(2R)-7-(2,6-DICHLOROPHENYL)-5-FLUORO-2,3-DIHYDRO-1BENZOFURAN-2-YL] METHYL} AMINE HYDROCHLORIDE (51) International classification :C07D 307/81 (71)Name of Applicant : (31) Priority Document No :60/674,318 1)WYETH (32) Priority Date :22/04/2005 Address of Applicant :FIVE GIRALDA FARMS, MADISON, (33) Name of priority country :U.S.A. NEW JERSEY U.S.A. (86) International Application No :PCT/US2006/015309 (72)Name of Inventor : Filing Date :21/04/2006 1)TADAYON ABDOLSAMAD (87) International Publication No :WO 2006/116218 2)YU QING (61) Patent of Addition to Application 3)BERNATCHEZ MICHEL :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention is directed to crystalline forms of the 5-HT2C agonist {[(2R)-7-(2,6-dichlorophenyl)-5-fluoro-2,3-dihydro-1benzofuran-2-yl]methyl}amine hydrochloride, as well as compositions, processes of preparation, and uses thereof.



5616





(54) Title of the invention : PHARMACEUTICAL COMPOSITION AND METHOD USING ANTIFUNGAL AGENT IN COMBINATION (51) International classification :A61K 31/445 (71)Name of Applicant : (31) Priority Document No :2005-110784 1)TOYAMA CHEMICAL CO., LTD. Address of Applicant :2-5, 3-CHOME, NISHISHINJUKU, (32) Priority Date :07/04/2005 SHINJUKU-KU, TOKYO Japan (33) Name of priority country :Japan (86) International Application No :PCT/JP2006/307204 (72)Name of Inventor : Filing Date :05/04/2006 1)NOBUHIKO NOMURA (87) International Publication No :WO 2006/109642 2)HIROSHI NISHIKAWA (61) Patent of Addition to Application 3)NORITOMO FUJINO :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A pharmaceutical composition containing one or more antifungal agents selected from an arylamidine derivative represented by the general formula: [Chemical Formula 1] (wherein R1 represents an amidino group that may be substituted with a hydroxyl group that may be protected with an acyl group, an amidino group that may be substituted with an alkoxy group that may be substituted, or an amidino group that may be substituted with an aralkyloxy group that may be substituted; R2 and R3 identically or differently represent a hydrogen atom or a halogen atom) or a salt thereof, an azole antifungal agent, a polyene antifungal agent, a candin antifungal agent and a fluoropyrimidine antifungal agent has a strong antifungal activity and is useful for the treatment of fungal infection. A method for using them in combination is useful as an excellent therapeutic method for fungal infection. A pharmaceutical composition containing the arylamidine derivative represented by the above general formula or a salt thereof and an immunosuppressant has a strong antifungal activity and is useful for the treatment of fungal infection and a skin disease such as atopic dermatitis. A method for using them in combination is useful as an excellent therapeutic method for fungal infection and a skin disease such as atopic dermatitis.



5617





(54) Title of the invention : PHARMACEUTICAL COMPOSITION (51) International classification :A61K 9/20 (71)Name of Applicant : (31) Priority Document No :60/672,805 1)SMITHKLINE BEECHAM (CORK) LIMITED (32) Priority Date :19/04/2005 Address of Applicant :CURRABINNY, CARRIGALINE, COUNTY CLERK Ireland (33) Name of priority country :U.S.A. :PCT/US2006/014447 (72)Name of Inventor : (86) International Application No Filing Date :18/04/2006 1)CARTER BARRY HOWARD (87) International Publication No :WO 2006/113649 2)CAMPBELL DWAYNE A (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Oral pharmaceutical formulations containing ditosylate salts of 4-quinazolineamines are described as well as methods of using the same in the treatment of disorders characterized by aberrant erbB family PTK activity.



5618





(54) Title of the invention : TASTE POTENTIATOR COMPOSITIONS AND EDIBLE CONFECTIONERY AND CHEWING GUM PRODUCTS CONTAINING SAME (51) International classification

:A23L 1/00, A23L (71)Name of Applicant : 1/22 1)CADBURY ADAMS USA LLC :60/683634 Address of Applicant :389 INTERPACE PARKWAY, :23/05/2005 PARSIPPANY NJ U.S.A. :U.S.A. (72)Name of Inventor : :PCT/US2006/020307 1)BOGHANI NAVROZ :23/05/2006 2)GEBRESELASSIE PETROS :WO 2006/127936 3)HARGREAVES CAROLE ANN

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to compositions and edible orally delivered products, such as confectioneries and chewing gum, which include taste potentiators to enhance the perception of active substances contained therein. More specifically, some embodiments provide potentiator compositions, which include at least one active substance and at least one taste potentiator. The taste potentiator is encapsulated to modify the release rate of the composition upon consumption.



5619





(54) Title of the invention : PROCESS FOR THE PRODUCTION OF ACETIC ACID (51) International classification :C07C 51/44 (71)Name of Applicant : (31) Priority Document No :11/116,771 1)CELANESE INTERNATIONAL CORPORATION (32) Priority Date :28/04/2005 Address of Applicant :1601 WEST LBJ FREEWAY DALLAS, TX U.S.A. (33) Name of priority country :U.S.A. :PCT/US2006/012822 (72)Name of Inventor : (86) International Application No Filing Date :06/04/2006 1)ZINOBILE, RAYMOND, J (87) International Publication No :WO 2006/115721 2)SCATES, MARK, O. (61) Patent of Addition to Application 3)MAKELKI, JONATHAN, A :NA Number 4)SALADO, MANUEL :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A process for the reduction and/or removal of permanganate reducing compounds formed by the carbonylation of methanol in the presence of a Group VIII metal carbonylation catalyst to produce acetic acid is disclosed. More specifically, a process for reducing and/or removing permanganate reducing compounds or their precursors from intermediate streams during the formation of acetic acid by said carbonylation processes is disclosed. In particular, a process in which a low boiling overhead vapor stream from a light ends column is subjected to a single distillation to obtain an overhead that is subjected to an extraction to selectively remove and/or reduce PRC s from the process is disclosed.



5620





(54) Title of the invention : MELAMINE-FORMALDEHYDE RESIN SOLUTION AND PROCESS FOR PRODUCING THE SAME (51) International classification :C08G 12/32 (71)Name of Applicant : (31) Priority Document No :10 2005 022 228.5 1)AMI AGROLINZ MELAMINE INTERNATIONAL (32) Priority Date :10/05/2005 GMBH (33) Name of priority country :Germany Address of Applicant :ST.-PETER-STRASSE 25 4021 LINZ (86) International Application No :PCT/EP2006/004379 Austria Filing Date :10/05/2006 (72)Name of Inventor : (87) International Publication No :WO 2006/119982 1)FRANK SCHRÖDER (61) Patent of Addition to Application 2)CHRISTIAN FÜRST :NA Number 3)DANIEL JOCHAM :NA Filing Date 4)OLIVER KATZENBERGER (62) Divisional to Application Number :NA 5)KATARINA ROT Filing Date :NA 6)JOHANNES FELLNER (57) Abstract : A melamine-formaldehyde resin solution has a formaldehyde/melamine ratio smaller than or equal of 1.5, at which it possesses a water compatibility ranging from 0.15 to 4.0 at 20oC, and a stability of at least 5 hours at a F/M ratio of 1.0, a stability of at least 6 hours at a F/M ratio of 1.1, a stability of at least 13 hours at a F/M ratio of 1.2, a stability of at least 24 hours at a F/M ratio of 1.3, a stability of at least 50 hours at a F/M ratio of 1.4, and a stability of at least 200 hours at a F/M ratio of 1.5, the stability of the resin solution being linearly dependent, within the range boundaries 1.0



5621





(54) Title of the invention : ELASTOMERIC SPRING-DAMPER WITH INTEGRAL STOPS (51) International classification :B60T 7/06 (71)Name of Applicant : (31) Priority Document No :60/675361 1)BELL HELICOPTER TEXTRON INC. (32) Priority Date :27/04/2005 Address of Applicant :P.O. BOX 482, FORTH WORTH, TEXAS U.S.A. (33) Name of priority country :U.S.A. (86) International Application No :PCT/US2006/015325 (72)Name of Inventor : Filing Date :20/04/2006 1)HALCOM LANCER D (87) International Publication No :WO 2006/116224 2)HAYNIE DAVID A (61) Patent of Addition to Application 3)BOUQUILLON BRIAN :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An elastomeric spring-damper has a one-piece tubular body having an integral cap. A tension stop flange is formed in the body near the cap portion, and a compression stop flange opposing the tension stop flange is formed on the cap portion. An inner member located within the body is coupled to the body with an annular elastomeric member, such that longitudinal motion of the inner member relative to the body is allowed through elastic deformation of the elastomeric member. An inner member stop flange is positioned between the compression stop flange and the tension stop flange to limit longitudinal motion of the inner member relative to the body.



5622





(54) Title of the invention : NEW LABELLING STRATEGIES FOR THE SENSITIVE DETECTION OF ANALYTES (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country

:C07H 21/00,C12Q (71)Name of Applicant : 1/68 1)BASF AKTIENGESELLSCHAFT :05009618.9 Address of Applicant :CARL-BOSCH-STRASSE 38 67056 LUDWIGSHAFEN Germany :02/05/2005 (72)Name of Inventor : :EUROPEAN UNION 1)CARELL THOMAS :PCT/EP2006/004017 2)SCHWOEGLER ANJA :28/04/2006 3)BURLEY GLENN ASHLEY :WO 2006/117161 4)GIERLICH JOHANNES 5)MOFID MOHAMMAD REZA :NA :NA

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to methods and reagents for detecting analytes, e.g. nucleic acids. The new methods and reagents allow a simple and sensitive detection even in complex biological samples.



5623





(54) Title of the invention : SUPPORT FRAME FOR ELECTRICAL APPARATUSES (51) International classification

(71)Name of Applicant : :H01H 9/18,H01R 13/46 1)BTICINO S.P.A. Address of Applicant :VIA MESSINA, 38, I-20154 MILANO :RM2005A000164 Italy :07/04/2005 (72)Name of Inventor : :Italy :PCT/IT2006/000217 1)FABRIZI FABRIZIO :03/04/2006 :WO 2006/106553

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention refers to a support frame (1) for wall -mounting one or more electrical apparatuses, the frame comprising a frame body (2) that can be fixed to a wall and extending around an opening (5) defining a mounting seat suitable for receiving and holding one or more electrical apparatuses. The support frame (1) is characterised in that it also includes: - at least one optical source (7.1, 7.2) suitable for generating an optical signal; - an electrical circuit (20, 10) connected to said optical source (7.1, 7.2) to supply it with an electrical power supply signal, - means (16.1, 16.2, 16.3) for housing said electrical circuit (20, 10) and said source (7.1, 7.2), foreseen in said frame body (2), the frame body (2) allowing the propagation of at least one part of said optical signal towards the outside of said body.



5624





(54) Title of the invention : PYRAZOLOCARBOXAMIDES AS FUNGICIDES


(71)Name of Applicant : 1)BASF AKTIENGESELLSCHAFT :C07D 231/14 Address of Applicant :67056 LUDWIGSHAFEN Germany :102005022651.5 (72)Name of Inventor : :11/05/2005 1)GEWEHR MARKUS :Germany 2)DIETZ JOCHEN :PCT/EP2006/062219 3)GROTE THOMAS :10/05/2006 4)GRAMMENOS WASSILIOS :WO 2006/120219 5)HUNGER UDO 6)MULLER BERND :NA 7)SCHIEWECK FRANK :NA 8)SCHWOGLER ANJA :NA 9)LOHMANN JAN KLAAS :NA 10)RHEINHEIMER JOACHIM 11)RENNER JENS 12)SCHAFER PETER

(57) Abstract : The present invention relates to pyrazolecarboxamides of the formula I in which the variables are as defined below: X is trifluoromethyl; R1 is F, CI, Br, C1-C4-alkyl or C1-C4-haloalkyl; R2 is hydrogen, halogen or C1-C4-alkyl; R3 is hydrogen, C1-C4alkyl, C1-C4-haloalkyl, C2-C4-alkenyl, C2-C4-alkynyl or C3-C6-cycloalkyl; W is O or S; with the proviso that, if R3 is hydrogen and W is oxygen, a) R1 and R2 are not simultaneously methyl and F, respectively; b) R1 and R2 are not simultaneously trifluoromethyl and hydrogen or fluorine, respectively. to processes for preparing these compounds, to seeds and compositions comprising them and to methods for controlling harmful fungi.



5625





(54) Title of the invention : METHOD FOR PRODUCTION OF 1-ALKYL-3-PHENYLURACILS (51) International classification :C07D 239/54 (71)Name of Applicant : (31) Priority Document No :102005024448.3 1)BASF AKTIENGESELLSCHAFT (32) Priority Date :24/05/2005 Address of Applicant :67056 LUDWIGSHAFEN Germany (72)Name of Inventor : (33) Name of priority country :Germany :PCT/EP2006/062414 1)GEBHARDT JOACHIM (86) International Application No Filing Date :18/05/2006 2)LOHR SANDRA (87) International Publication No :WO 2006/125746 3)KEIL MICHAEL (61) Patent of Addition to Application 4)SCHMIDT THOMAS :NA Number 5)WEVERS JAN HENDRIK :NA Filing Date 6)ZECH HELMUT (62) Divisional to Application Number :NA 7)HABERLE RUDOLF Filing Date :NA (57) Abstract : The present invention relates to a process for preparing 1 -alkyl-3-phenyluracils of the formula I where the variables R1 to R7 are as defined in the description by reacting 3-phenyluracils of the formula II and alkylating agents of the formula III R1-L1 III, with one another, wherein during the entire reaction the pH is kept in a range from 1 to 6 by adding base a little at a time.



5626





(54) Title of the invention : METHOD AND APPARATUS FOR PROVIDING A MOTION SIGNAL WITH A SOUND SIGNAL USING AN EXISTING SOUND SIGNAL ENCODING FORMAT (51) International classification

:H03M 99/00,H04N (71)Name of Applicant : 7/24 1)D-BOX TECHNOLOGIES INC. :60/674690 Address of Applicant :2172 DE LA PROVINCE LONGUEIL, :26/04/2005 QUEBEC J4G 1R7 Canada :U.S.A. (72)Name of Inventor : :PCT/CA2006/000682 1)ROY PHILIPPE :26/04/2006 2)PAILLARD BRUNO :WO 2006/113999

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A method for providing a motion signal with a sound signal using an existing sound signal encoding format. The method comprises providing the motion signal, providing the sound signal, inserting the motion signal in an available data field provided in the existing encoding algorithm, encoding the sound signal with the inserted motion signal according to the existing encoding algorithm lo generate an encoded bitstream sound signal and providing the encoded bitstream sound signal comprising the motion signal and the sound signal.



5627





(54) Title of the invention : METHOD FOR MAKING COVER OF BOOKLET, AND KIT FOR MAKING COVER OF BOOKLET (51) International classification

(71)Name of Applicant: :B42C 7/00, B42D 3/08 1) LAB. AT-SITE, LTD. Address of Applicant :124, ENMEI-CHO, NISHI-KU :2005-109904 NAGOYA-SHI, AICHI Japan :06/04/2005 (72)Name of Inventor : :Japan :PCT/JP2006/307075 1)YAMAMOTO TAKEMI :04/04/2006 :WO 2006/109611

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A peeling sheet on the back of a cover sheet is provided with a cover seal having a printed front surface is peeled off to partially expose an adhesive layer. A core material for cover is placed thereon. First side piece portion and second side piece portion are then peeled off and the entire surface of the first cover members, backbone member and second cover member of the core material for cover is bonded and fixed by the adhesive layer of the cover sheet for cover. Outer circumferential region of the cover seal for cover is then bent to the inside thus making a cover of a booklet. When a personal user edits electronic images and prints the electronic images on a printed sheet, the printed sheet can be fixed easily in a short time for making a booklet.



5628





(54) Title of the invention : OPTICAL DISK RECORDING METHOD, OPTICAL DISK DEVICE, PROGRAM AND RECORDING MEDIUM (51) International classification :G11B 7/004 (71)Name of Applicant : (31) Priority Document No :2005-135504 1)RICOH COMPANY, LTD Address of Applicant :3-6, NAKAMAGOME 1-CHOME, (32) Priority Date :09/05/2005 OHTA-KU TOKYO Japan (33) Name of priority country :Japan (86) International Application No :PCT/JP2006/309198 (72)Name of Inventor : Filing Date :26/04/2006 1)OHHASHI NAOYA (87) International Publication No :WO 2006/120986 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : In an optical disk recording method adapted to record information on an optical disk by a light beam incident to the disk in one direction, the disk has a plurality of rewritable recording layers including a first layer nearest to a plane of incidence and a second layer distant from the plane of incidence. A target layer where user data is to be recorded is specified from the first and second layers. Prior to recording the user data to a requested address in the second layer when the target layer is the second layer, a partial region of the first layer corresponding to a same radial position as the requested address in the second layer is set to either a non-recorded state or a recorded state depending on a characteristic of the disk. The user data is recorded to the requested address in the target layer.



5629





(54) Title of the invention : ROTATING MECHANISM (51) International classification :H02N 11/00 (71)Name of Applicant : (31) Priority Document No :2005-132993 1)HIROMICHI KINOSHITA (32) Priority Date :04/04/2005 Address of Applicant :1-34-43, KURIHARACHUO ZAMASHI, KANAGAWA Japan (33) Name of priority country :Japan (86) International Application No :PCT/JP2006/306233 2)YOKO KINOSHITA Filing Date :28/03/2006 (72)Name of Inventor : (87) International Publication No :WO 2006/106647 1)HIROMICHI KINOSHITA (61) Patent of Addition to Application 2)YOKO KINOSHITA :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention has an object to provide a rotating mechanism with a very high rotation efficiency in which rotation resistance is reduced and rotation is encouraged. It comprises a fixed member (1) having bearings (16, 18); a rotary member (2) including a rotary shaft (21) journalled by the bearings and a disk member (22) fixed on the rotary shaft; a plurality of coils (3) which are mounted on the fixed member (1) and arranged at regular intervals on a circle centered on the rotary shaft (21); and a first permanent magnet (4) mounted on the disk member (22), wherein first permanent magnets (4) are arranged at regular intervals on a circle centered on the rotary shaft (21) and arranged to face the coils (3).



5630





(54) Title of the invention : SKIN ENRICHMENT USING COQ 10 AS THE DELIVERY SYSTEM (51) International classification :A61K 31/7048 (71)Name of Applicant : (31) Priority Document No :60/667,380 1)ZYMES, LLC (32) Priority Date :01/04/2005 Address of Applicant :777 TERRACE AVENUE HASBROUCK HEIGHTS, NJ U.S.A. (33) Name of priority country :U.S.A. :PCT/US2006/012215 (72)Name of Inventor : (86) International Application No Filing Date :03/04/2006 1)LIPSHUTZ, BRUCE H (87) International Publication No :WO 2006/107825 2)DOLNICK, DEANNE (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention provides several skin enrichment formulations comprising ubiquinones. The present invention provides a composition for the treatment of acne, topical antimicrobial ointment, sun screening agents, facial cleansing, reduction of skin inflammation, firming skin tone, cosmetic foundation, skin protection, lip skin protection and skin cream. In a preferred embodiment, the composition contains Coenzyme Q10.



5631





(54) Title of the invention : METHOD AND SYSTEM FOR RISK MANAGEMENT IN A TRANSACTION (51) International classification :G07F 19/00 (71)Name of Applicant : (31) Priority Document No :11/102,941 1)BILL ME LATER INC. (32) Priority Date :11/04/2005 Address of Applicant :9690 DEERECO ROAD SUITE 705 TIMONIUM, MARYLAND U.S.A. (33) Name of priority country :U.S.A. :PCT/US2006/012474 (72)Name of Inventor : (86) International Application No Filing Date :04/04/2006 1)KEITHLEY, THOMAS, H (87) International Publication No :WO 2006/110392 2)TALBERT, VINCENT, W. (61) Patent of Addition to Application 3)LAVELLE, MARK, L. :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Disclosed is a Risk management system for providing risk data to an entity engaged in a transaction with a consumer. The system includes as authorization denial system having an authorization denial system interface for receiving a transaction data set having a plurality of data fields from the entity; and a denial rule set with multiple rules for outputting risk data directed to the transaction based upon the result of applying the rules to the data fields in the transaction data set. The authorization denial system interface transmits the resulting risk data to the entity. A method of authorizing a transaction between a consumer and an entity is also disclosed.



5632





(54) Title of the invention : BARRIER SYSTEM FOR THE LINE BUSHING OF AN ELECTRICAL INSTALLATION (51) International classification :H01B 17/28 (71)Name of Applicant : (31) Priority Document No :102005021255.7 1)SIEMENS AKTIENGESELLSCHAFT (32) Priority Date :02/05/2005 Address of Applicant :WITTELSBACHERPLATZ 2, 80333 MUNCHEN Germany (33) Name of priority country :Germany :PCT/EP2006/061907 (72)Name of Inventor : (86) International Application No Filing Date :28/04/2006 1)THOMAS HAMMER (87) International Publication No :WO 2006/117333 2)PETER HEINZIG (61) Patent of Addition to Application 3)JENS HOPPE :NA Number 4)DIETMAR JAHNEL :NA Filing Date 5)JOHANN SCHLAGER (62) Divisional to Application Number :NA 6)LAMBERT SCHUMMER Filing Date :NA (57) Abstract : A barrier system for a line leadthrough in an electric installation has adjoining wall elements as barriers which extend in an axial longitudinal direction and are spaced apart from each other, forming channels, the wall elements lying partially at least at their lower ends on a support. The wall elements are joined by a plug element to the leadthrough. Slots having a width which corresponds to the wall thickness of the wall elements are arranged in the plug clement. The wall elements can be inserted into the slots, thus permitting a barrier system to be quickly and easily assembled and disassembled.



5633





(54) Title of the invention : HIGH DENSITY COAXIAL SWITCHING JACK (51) International classification :H04Q 1/14 (71)Name of Applicant : (31) Priority Document No :60/671,849 1)ADC TELECOMMUNICATIONS, INC. (32) Priority Date :15/04/2005 Address of Applicant :13625 TECHNOLOGY DRIVE, EDEN PRAIRIE, MINNESOTA U.S.A. (33) Name of priority country :U.S.A. :PCT/US2006/012893 (72)Name of Inventor : (86) International Application No Filing Date :07/04/2006 1)KHEMAKHEM, M'HAMED ANIS (87) International Publication No :WO 2006/113155 2)PETERS, JEFFREY LOUIS (61) Patent of Addition to Application 3)SAND, DUANE R. :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A coaxial switching jack (12) with a pair of coaxial assemblies (124) mounted within a housing (100) having a pair of front openings (112). The coaxial assemblies include a center conductor (125) and a shell conductor (123). The center conductors are connected by a first spring (130) and the shell conductors are connected by a second spring (116). Insertion of a coaxial cable connector within one of the front openings deflects the spring from the corresponding coaxial assembly and disconnects the center and shell conductors of the two assemblies. The jack may also be configured to provide an electrical connection between the center and shell conductors of the second coaxial assembly if a coaxial cable connector is inserted with in the first coaxial assembly. The connection between the center and shell conductors of the second coaxial assembly may allow for selection of a desired electrical impedance.



5634





(54) Title of the invention : ORAL HYGIENE COMPOSITIONS (51) International classification

:A61K 8/25,A61Q 11/00 :0508174.0 :22/04/2005 :U.K. :PCT/GB2006/001459 :21/04/2006 :WO 2006/111761

(71)Name of Applicant : 1)PSIMEDICA LIMITED Address of Applicant :MALVERN HILLS SCIENCE PARK GERALDINE ROAD MALVERN, WORCESTERSHIRE WR 14 3SZ U.K. (72)Name of Inventor : 1)CANHAM, LEIGH, TREVOR

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Oral hygiene compositions suitable for use as dentifrice compositions comprising a silicon abrasive agent are provided.



5635





(54) Title of the invention : A COMMUNICATIONS NETWORK (51) International classification :G06F 15/16 (71)Name of Applicant : (31) Priority Document No :05252251.3 1)LASTMILE COMMUNICATIONS LIMITED (32) Priority Date :11/04/2005 Address of Applicant :39 MARSH GREEN ROAD MARSH BARTON INDUSTRIAL ESTATE, EXETER DEVON EX2 8 (33) Name of priority country :EPO :PCT/US2006/013347 PN U.K. (86) International Application No Filing Date :11/04/2006 (72)Name of Inventor : (87) International Publication No :WO 2006/110672 1)BALLOU, BERNARD L., JR. (61) Patent of Addition to Application 2)HUNTER, CHARLES ERIC :NA Number 3)CROCKER, TIMOTHY RICHARD :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A distributed communications network comprising a plurality of nodes and a plurality of user devices, wherein each node comprises; a communications device for establishing bi-directional wireless communications with at least one user device, a communications device for establishing bi-directional communications with at least one other node, and a data processor in association with a local memory for storing information for presentation to users, and wherein at least one of the nodes further includes a communications device connected to a further communications network, and wherewith nodes are grouped into clusters that cooperate with one another such that if a user requests information which is held in the local memory of a node within a cluster then the nodes cooperate to supply that information to the user and if a connection between a user and the further communications network is required, the nodes cooperate to establish it.



5636





(54) Title of the invention : METHOD AND DEVICE FOR AUTOMATIC MONITORING OF REPETITIVE SEQUENCES OF AN INJECTION MOULDING MACHINE (51) International classification :G05B 19/048 (71)Name of Applicant : (31) Priority Document No :751/05 1)NETSTAL-MASCHINEN AG Address of Applicant :INDUSTRIESTRASSE, CH-8752 (32) Priority Date :28/04/2005 NAFELS Switzerland (33) Name of priority country :Switzerland (86) International Application No :PCT/CH2006/000220 (72)Name of Inventor : Filing Date :21/04/2006 1)WERFELL, FRIEDRICH (87) International Publication No :WO 2006/114011 2)FAH, MARKUS (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to a device and method for automatically monitoring repetitive operational sequences on injection molding machines and/or on handling units to injection molding machines, and for identifying abnormalities or disruptions with regard to the operational sequence. During normal production operation, the repetitive operational sequence of at least one partial process is provided, and a measurable quantity (1), which is influenced by the partial process, regarding the operational sequence monitoring is automatically recorded in short sampling intervals (2). The sampled values are compared with limit values (6) that were formed, by using an algorithm, from a multitude of previous sampled values of the same operational sequence. The sensitivity is automatically adapted to the process variations with regard to a decision to alert or terminate. This novel solution permits the carrying out of monitoring with the highest possible sensitivity, however, without a negative response, e.g. repetitive traveling motion, but also for operational sequences without moving parts such as the d.c. link voltage in converters or during controlled processes for monitoring a quantity that is not controlled.



5637





(54) Title of the invention : METHOD AND PLANT FOR MANUFACTURING BLOCKS OF CONGLOMERATE STONE MATERIAL (51) International classification

:B29C 67/24,B28C (71)Name of Applicant : 5/46 1)TONCELLI, LUCA :TV2005A000067 Address of Applicant :VIALE ASIAGO 34, I-36061 :19/05/2005 BASSANO DEL GRAPPA (VICENZA) Italy :Italy (72)Name of Inventor : :PCT/EP2006/062123 1)TONCELLI, LUCA :08/05/2006 :WO 2006/122893

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : In order to manufacture articles in the form of blocks of conglomerate stone material, two mixes, i.e. a primary mix and a secondary mix, are prepared in two separate mixers operating under a vacuum. The primary mix is prepared with granulated stone material having at least one characteristic (such as colour and/or particle size) different from that that of the granulated material used in the secondary mix. The two mixes, which have a volume ratio such that the primary mix is preponderant, are mixed under a vacuum so that the secondary mix is mixed partly together with the primary mix, forming inclusions. The resultant final mix is fed to a formwork, which is then transferred to a vacuum vibrocompression section and then to a hardening section.



5638





(54) Title of the invention : ROTOMOULDED ARTICLES PREPARED FROM A BLEND OF POLYETHYLENE POWDERS (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country

:C08J 5/00,B32B (71)Name of Applicant : 27/32 1)TOTAL PETROCHEMICALS RESEARCH FELUY :05105533.3 Address of Applicant :ZONE INDUSTRIELLE C B-7181 SENEFFE (FELUY) Belgium :22/06/2005 (72)Name of Inventor : :EUROPEAN UNION 1)MAZIERS ERIC :PCT/EP2006/063386 :21/06/2006 :WO 2006/136572

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention discloses the use of a dry blend comprising a polyethylene resin and a functionalised polyolefin or ionomer in a composition with a thermoplastic resin in order to produce a layer that provides adhesion, fire resistance and low permeation rate in a multi layer rotomoulded article.



5639





(54) Title of the invention : SURGICAL INSTRUMENT SYSTEM (51) International classification :A61M 29/00 (71)Name of Applicant : (31) Priority Document No :60/669,514 1)ETHICON ENDO-SURGERY, INC (32) Priority Date :08/04/2005 Address of Applicant :4545 CREEK ROAD CINCINNATI, OH U.S.A. (33) Name of priority country :U.S.A. :PCT/US2006/013456 (72)Name of Inventor : (86) International Application No Filing Date :07/04/2006 1)VOEGELE, JAMES W. (87) International Publication No :WO 2006/110733 2)GILL, ROBERT P. (61) Patent of Addition to Application 3)HESS, CHRISTOPHER J. :NA Number 4)WEISENBURGH, WILLIAM B. :NA Filing Date 5)GEIS, WILLIAM P. (62) Divisional to Application Number :NA 6)MURRAY, MICHAEL A. Filing Date :NA 7)MORGAN, KAREN M. (57) Abstract : A surgical instrument system is provided for a hand-assisted, laparoscopic procedure. The system has a laparoscopic disc that is adaptable to hold multiple surgical instruments. Other elements in the surgical instrument system include a storage pouch for placement with the body cavity, a device for supporting tissue, a device for relocating tissue away from a surgical site, and tissue markers for marking tissue to plan a surgical event.



5640





(54) Title of the invention : PURLIN BEAM COMPRISING ATTACHABLE ENDS (51) International classification :E04G 11/52 (71)Name of Applicant: (31) Priority Document No :P200501680 1) SISTEMAS TECNICOS DE ENCOFRADOS, S.A. (32) Priority Date :11/07/2005 Address of Applicant :POL. IND. SECTOR MOLLET, C/LLOBREGAT, 8 08150 PARETS DEL VALLES (33) Name of priority country :Spain :PCT/ES2006/000371 (BARCELONA) Spain (86) International Application No Filing Date :23/06/2006 (72)Name of Inventor : (87) International Publication No :WO 2007/006825 1)UBINANA FELIX JOSE LUIS (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The beam has end terminals which can be connected to one another, such that one of the terminals is provided with front projections for guiding in vertical displacement of the other terminal, which has guides with a form which mates with the said projections, one of the terminals also having projecting lower arms to support the other terminal after it has been put into position, thus determining a single area of contact in order to permit disconnection of the supported terminal during dismantling, by turning on the said area of contact.



5641





(54) Title of the invention : SALTS WITH CYANOBORATE ANIONS (51) International classification :C07C 211/63 (71)Name of Applicant : (31) Priority Document No :103 06 617.9 1)MERCK PATENT GMBH (32) Priority Date :14/02/2003 Address of Applicant :FRANKFURTER STRASSE 250, 64293 DARMSTADT Germany (33) Name of priority country :Germany :PCT/EP2004/000231 (72)Name of Inventor : (86) International Application No Filing Date :15/01/2004 1)WELZ-BIERMANN, URS (87) International Publication No :WO/2004/072089 2)IGNATYEV, NIKOLAI (61) Patent of Addition to Application 3)BERNHARDT, EDUARD :NA Number 4)FINZE, MAIK :NA Filing Date 5)WILLNWE, HELGE (62) Divisional to Application Number :1543/KOLNP/05 Filed on :04/08/2005 (57) Abstract : Process for the preparation of alkali metal cyanoborates of the general formula (1) M+[B(CN)4]- (1), where M is selected from the group Li, Na, K, Rb and Cs, characterized in that an alkali metal tetrafluoroborate M[BF4], where M=Li, Na, K, Rb, Cs, is reacted with an alkali metal cyanide MCN, where M=Li, Na, K, Rb, Cs, in a solid-state reaction.



5642





(54) Title of the invention : A VEHICLE LOCATING UNIT WITH IMPROVED POWER MANAGEMENT METHOD


(71)Name of Applicant : 1)LOJACK OPERATING COMPANY, LP Address of Applicant :200 LOWDER BROOK DRIVE, :H04B 1/16 WESTWOOD, MA U.S.A. :11/131,847 (72)Name of Inventor : :18/05/2005 1)FRANK ROMANO :U.S.A. 2)SAMPATH KRISHNA :PCT/US2006/018963 3)SON NGUYEN :17/05/2006 4)JESSE RHODES :WO 2006/124925 5)PHILIP GRAHAME CREWE :NA 6)DANIEL JOHNATHAN FINCHLEY CLETHEROE :NA 7)MARK MARSDEN 8)STEVEN WALTER GREENDALE :NA 9)NIGEL JAMES WATSON :NA 10)IAN CHRISTOPHER STROUD 11)TIMOTHY DAVID HOWE 12)GERARD EDWARD SMITH

(57) Abstract : A vehicle locating unit with improved power management. A receiver receives a signal from a network of communication sources. A signal strength monitoring subsystem determines which of the communication sources are transmitting the strongest signals. A power management subsystem is responsive to the signal strength monitoring subsystem and is configured to alternatively enter sleep and wake-up modes, synchronize the wake-up mode to the communication source transmitting the strongest signal, and test the signal strength of at least one additional communication source according to a predefined sequence.



5643





(54) Title of the invention : METHOD OF PRODUCING SUSPENDED AGRICULTURAL CHEMICAL COMPOSITION (51) International classification :A01N 25/00 (71)Name of Applicant : (31) Priority Document No :11/139264 1)NIPPON SODA CO., LTD. (32) Priority Date :26/05/2005 Address of Applicant :2-1, OHTEMACHI 2-CHOME CHIYODA-KU, TOKYO Japan (33) Name of priority country :U.S.A. :PCT/US2006/018364 (72)Name of Inventor : (86) International Application No Filing Date :11/05/2006 1)MAEKAWA YUICHI (87) International Publication No :WO 2006/127298 2)HASHIMOTO SEIZO (61) Patent of Addition to Application 3)CHEN ROY, C., Y :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A method of producing a suspended agricultural chemical composition, includes the steps of: grinding an agricultural chemical active ingredient; mixing at least water, a polyalcohol, a mineral salt, and a surfactant to produce a solution; adding to the solution the ground agricultural chemical active ingredient and a suspension stabilizer, to produce a mixture; heating the mixture to 40 to 70°C while stirring; cooling the heated mixture to 10 to 25°C; and wet-milling the cooled mixture at 30°C or below. Alternatively the method includes the steps of: grinding an agricultural chemical active ingredient; mixing at least water, a polyalcohol, a mineral salt, and a surfactant to produce a solution; adding to the solution the ground agricultural chemical active ingredient and a suspension stabilizer to produce a mixture; wet-milling the mixture; heating the wet-milled mixture to 40 to 70°C while stirring; and cooling the heated mixture.



5644





(54) Title of the invention : PROVIDING ROAD INFORMATION INCLUDING VERTEX DATA FOR A LINK AND USING THE SAME (51) International classification :G08G 1/0969 (71)Name of Applicant : (31) Priority Document No :60/681971 1)LG ELECTRONICS INC Address of Applicant :20, YOIDO-DONG, (32) Priority Date :18/05/2005 YOUNGDUNGPO-GU, SEOUL Republic of Korea (33) Name of priority country :U.S.A. (86) International Application No :PCT/KR2006/001859 (72)Name of Inventor : Filing Date :18/05/2006 1)LEE, JOON, HWI (87) International Publication No :WO 2006/123902 2)SEO, CHU, HYUN (61) Patent of Addition to Application 3)KIM, YOUNG, IN :NA Number 4)JUNG, MUN, HO :NA Filing Date 5)JOE, MOON, JEUNG (62) Divisional to Application Number :NA 6)YI, DONG, HOON Filing Date :NA (57) Abstract : A method of processing traffic information includes receiving link vertex information including a first identifier and vertex components that each reveal a position along a link. The first identifier enables a determination of a type of information that is included within the received link vertex information. The method also includes determining the type of information included within the received link vertex information based on the first identifier and identifying vertex components within the link vertex information only if the first identifier enables a determination that the received link vertex information includes at least one vertex component.



5645





(54) Title of the invention : SOLAR COLLECTOR HAVING AN INTEGRATED HEAT STORAGE (51) International classification :F24J 2/34 (71)Name of Applicant : (31) Priority Document No :1029168 1)ECONCERN B.V. (32) Priority Date :02/06/2005 Address of Applicant :KANAAL WEG 16G, NL-3526 KL UTRECHT Netherlands (33) Name of priority country :Netherlands :PCT/NL2006/000276 (72)Name of Inventor : (86) International Application No Filing Date :02/06/2006 1)SCHAAP ANTONIUS BERNARDUS (87) International Publication No :WO 2006/130006 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to a solar collector having an integrated heat storage (ICS), in which between an involute mirror (6) and a transparent cover plate (3) a storage tank (5) for the storage of water is provided and in which the storage tank (5) is provided with a light absorbing fin (17). At the lower end (8) near the circumference of the storage tank (5) the ICS according to the invention is provided with a fin system (9) which comprises a light absorbing fin (17) having a length in the longitudinal direction of the storage tank (5) of at least 10 cm, and the fin system(9) is designed such that the ICS lower end (8) is shielded to a great extent, as a result of which losses by radiation and convection of air are restricted. Thus, the fin systems (85) has a double function.



5646





(54) Title of the invention : OPTICAL RECORDING MEDIUM, OPTICAL RECORDING MEDIUM RECORDING / REPRODUCTION METHOD, AND RECORDING / REPRODUCTION DEVICE (51) International classification :G11B 7/0045 (71)Name of Applicant : (31) Priority Document No :2002-365541 1)MITSUBISHI KAGAKU MEDIA CO. LTD. (32) Priority Date :17/12/2002 Address of Applicant :31-19 SHIBA 5-CHOME, MINATO(33) Name of priority country :Japan KU, TOKYO Japan (86) International Application No :PCT/JP2003/015983 (72)Name of Inventor : Filing Date :12/12/2003 1)NODA YOSHIHIRO (87) International Publication No :WO 2004/055790 2)KUBO HIDEYUKI (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :937/KOLNP/2005 Filed on :19/05/2005 (57) Abstract : In an optical recording medium of a single - sided incident type having a plurality of recording layers, recording / reading conditions (for example, tracking polarity, recording pulse strategy, recording recommended power, etc.) can be instantaneously switched according to each of the recording layer, and recording or reading of information can be accurately and surely performed under recording / reading conditions adapted to each recording layer. A control unit reads out layer information from one recording layer of the optical recording medium (S30) in which the layer information is recorded in each of the plural layers, on which recording or reading of information can be performed by irradiating a laser beam from one side thereof (layer information reading step), and controls so that recording or reading is performed under recording / reading conditions adapted to a recording layer specified on the basis of the layer information (recording controlling step).



5647





(54) Title of the invention : DEVICE AND METHOD FOR REMOVING FLASK FROM SAND MOLD WITH POURED FLASK (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date

:B22D 33/00 :2005-136834 :10/05/2005 :Japan :PCT/JP2006/309402 :10/05/2006 :WO 2006/121078 :NA :NA :NA :NA

(71)Name of Applicant : 1)SINTOKOGIO, LTD. Address of Applicant :28-12, MEIEKI 3-CHOME, NAKAMURA-KU NAGOYA-SHI, AICHI-KEN 450-0002, Japan (72)Name of Inventor : 1)ONO YASUSHI 2)INOUE KAZUMI 3)SUZUKI YOSHINOBU

(57)Abstract : A device for removing a flask from a molten-metal-poured, flask-tight sand mold, comprising a carrying station (H1) into which a molten-metal-poured, flask-tight sand mold (W), including cope and drag flasks (F), is carried; a carrying-out station (H2) for carrying out a molten-metal-poured sand mold (M) pulled out of the molten-metal-poured, flask-tight sand mold (W); a traveling truck (2) for reciprocatingly moving between the carrying station and the carrying-out station; a punching head (9); a punching head elevating means (10) mounted on the traveling truck for supporting and elevating the punching head (9); a transfer means (1) for transferring the molten-metal-poured, flask-tight sand mold (W) under the punching head (9) located at the carrying station (H1); a flask elevating means (3; 103) mounted on the traveling truck (2) for elevating the carried, molten-metal-poured, flask-tight sand mold (W); an engaging means (8) attached to a lower part of the flask elevating means (3; 103) for engaging with the cope and drag flasks (F); a drive means (2a, 15,16,102a) for reciprocating the traveling truck (2) with the flask elevating means between the carrying station and the carrying-out station so as to transfer the molten-metal-poured, flask-tight sand mold (W) carried into the carrying station to the carrying-out station; and a mold receiving means (14a) attached to the carrying-out station (H2) for receiving the molten-metal-poured sand mold (M) pulled out from the molten-metal-poured, flask-tight sand mold (W) by the interaction of the punching head (9) and the molten-metal-poured, flask-tight sand mold (W) that is raised; wherein the drive means (2a, 15, 16, 102a) for reciprocating the traveling truck (2) between the carrying station and the carrying-out station, the flask elevating means (3; 103), and the punching head elevating means(10), are arranged to be disposed above the molten-metal-poured, flask-tight sand mold (W) during the operation of the flask-removing device, which sand mold (W) is moved between the carrying station and the carrying-out station during the operation of the flask-removing device. The present invention also discloses a method of removing a flask from a molten-metal-poured, flask-tight sand mold.



5648





(54) Title of the invention : EFFICIENT AND ECONOMIC ASYMMETRIC SYNTHESIS OF NOOTKATONE, TETRAHYDRONOOTKATONE, THEIR PRECURSORS AND DERIVATIVE


:C07C 45/00 :11/106338 :14/04/2005 :U.S.A. :PCT/US2006/013710 :11/04/2006 :WO 2006/113285 :NA :NA :NA :NA

(71)Name of Applicant : 1)BOARD OF SUPERVISORS OF LOUISIANA STATE UNIVERSITY AND AGRICULTURAL AND MECHANICAL COLLEGE Address of Applicant :LOUISIANA AGRICULTURAL EXPERIMENT STATION, LSU AGRICULTURAL CENTER, P.O. BOX 25055 BATON ROUGE, LOUISIANA 70894-

5055 -- U.S.A. (72)Name of Inventor : 1)SAUER ANNE M 2)CROWE WILLIAM E 3)LAINE ROGER A 4)HENDERSON GREGG

(57) Abstract : An inexpensive, stereoselective synthesis for nootkatone, tetrahydronootkatone, and their derivatives is disclosed. The starting materials used in the synthesis are inexpensive. The principal starting material, (-)- β-Pinene, is on the GRAS list (generally recognized as safe).



5649





(54) Title of the invention : STEREOGRAPHIC VIEW IMAGE GENERATION DEVICE AND PROGRAM (51) International classification :H04N 13/00 (71)Name of Applicant : (31) Priority Document No :2005-137709 1)ERA, KAZUNARI (32) Priority Date :10/05/2005 Address of Applicant :4-1-11-201, MATSUBA-CHO, (33) Name of priority country :Japan KASHIWA-SHI, CHIBA 277-0827 , Japan (86) International Application No :PCT/JP2006/309331 (72)Name of Inventor : Filing Date :09/05/2006 1)ERA, KAZUNARI (87) International Publication No :WO 2006/121050 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : In a stereoscopic image generation device according to the invention, an obtaining means 11 obtains sequentially a plurality of original images Ga arranged in a time line and forming a content item. A calculation means 12 calculates an image characteristic value Ng from pixel values of a plurality of pixels included in an original image Ga obtained by the obtaining means 11. A storage device 21 stores a project file Fp by which image characteristic values Nf for the original images Ga forming the content item are respectively associated with stereoscopic parameters for generating stereoscopic images Gb from the original images Ga. A retrieval means 13 compares an image characteristic value calculated by the calculation means 12 from a particular original image Ga, with each of the image characteristic values Nf stored in the storage device 21, to retrieve a stereoscopic parameter for the particular original image Ga on the basis of a comparison result. A stereoscopic imaging means 14 generates a stereoscopic image Gb from each original image Ga, based on the stereoscopic parameter retrieved by the retrieval means 13.



5650





(54) Title of the invention : GENE DELIVERY (51) International classification :A61N 2/00 (71)Name of Applicant : (31) Priority Document No :0508110.4 1)KEELE UNIVERSITY (32) Priority Date :22/04/2005 Address of Applicant :KEELE STAFFORDSHIRE ST5 5BG (33) Name of priority country :U.K. GREAT BRITAIN (86) International Application No :PCT/GB2006/001477 2)UNIVERSITY OF FLORIDA RESEARCH Filing Date :21/04/2006 223 GRINTER HALL GAINESVILLE FLORIDA (87) International Publication No :WO 2006/111770 32611 (61) Patent of Addition to Application :NA UNITED STATES OF AMERICA Number :NA (72)Name of Inventor : Filing Date 1)DOBSON JON (62) Divisional to Application Number :NA 2)BATICH CHRISTOPHER D Filing Date :NA (57) Abstract : The present invention relates to a method of delivery of a therapeutic agent to a target cell the method comprising targeting particles comprising the therapeutic agent to the cell using magnetic means to apply a magnetic force to said particles so as to tend to move said particles towards said magnetic means and at the same time moving said magnetic means.



5651





(54) Title of the invention : CARTON WITH DETACHABLE PORTION (51) International classification :B65D 5/54 (71)Name of Applicant : (31) Priority Document No :60/683,010 1)MEADWESTVACO PACKAGING SYSTEMS LLC (32) Priority Date :19/05/2005 Address of Applicant :11013 WEST BROAD STREET, GLEN ALLEN, VA 23060, U.S.A. (33) Name of priority country :U.S.A. :PCT/US2006/019306 (72)Name of Inventor : (86) International Application No Filing Date :19/05/2006 1)HOLLEY, JOHN, M., JR. (87) International Publication No :WO 2006/125110 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A carton (200) including a top wall (214), a bottom wall (218), opposing side walls (212, 216), and first and second end walls (220, 222). A detachable portion (210) of the carton (200) is defined by a severance line (180) to include at least a portion of the top wall (214) and a portion of the side walls (212, 216). The top wall portion (182) of the severance line (180) is spaced apart from the second end wall (222) by a certain distance D1 such that a portion of the top wall (214) remains to provide structural integrity to the carton (200) after the detachable portion (210) is detached. The distance (D1) is also determined such that articles (B) in the carton (200) are viewable and easily accessed. The minimum distance (D1) between a top wall portion (182) of the severance line (180) and the second end wall (222) is no greater than half of the distance between the first and second end walls (220, 222).



5652





(54) Title of the invention : COMPOSITION AND METHOD FOR TREATING NOSEBLEEDS (51) International classification

(71)Name of Applicant : :A61K 31/4164 ,A61K31/29 1)BINYARCO, LLC Address of Applicant :35974 SOLON ROAD, :11/122,894 :05/05/2005 BENTLEYVILLE, OHIO 44022. U.S.A. :U.S.A. (72)Name of Inventor : :PCT/US2006/016922 1)BINDER, JEFFREY, E. :03/05/2006 :WO 2007/027236

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A composition and method for treating nosebleed, that is, epistaxis. The composition comprises bismuth subgallate and a vasoconstriction agent, preferably oxymetazoline. The composition is preferably a paste administered intranasally.



5653





(54) Title of the invention : PROCESS FOR THE PREPARATION OF IRIDIUM ACETATE (51) International classification :C07C 53/10 (71)Name of Applicant : (31) Priority Document No :10 2005 024 116.6 1)UMICORE AG & CO. KG (32) Priority Date :25/05/2005 Address of Applicant :RODENBACHER CHAUSSEE 4, 63457 HANA-WOLFGANG Germany (33) Name of priority country :Germany :PCT/EP2006/004964 (72)Name of Inventor : (86) International Application No Filing Date :24/05/2006 1)KARCH, RALF (87) International Publication No :WO 2006/125628 2)KAYSER, BERND (61) Patent of Addition to Application 3)RIVAS-NASS, ANDREAS :NA Number 4)WIDMER, JURGEN BODO :NA Filing Date 5)WINDE, ROLAND (62) Divisional to Application Number :NA 6)WORNER, EILEEN Filing Date :NA (57) Abstract : The present invention relates to a process or the preparation of indium acetate comprising the steps (a) reacting an indium compound with an alkaline compound in a protic solvent to obtain an iridium containing precipitate, where the reaction is conducted in the presence of at least one component (i) selected from oxalic acid, , a salt of oxalic acid, formic acid and a salt of formic acid, (b) reacting the precipitate in the presence of at least (i) one compound selected from oxalic acid, a salt of oxalic acid, formic acid and a salt of formic acid, and (ii) CH3CH2H and/or CH3(CO)O(CO)CH3 to give an iridium acetate containing solution. The invention also relates to indium acetate having a low halide content, to an indium containing precipitate and to uses of the iridium containing precipitate of the present invention and the iridium acetate of the present invention.



5654





(54) Title of the invention : CYTOMEGALOVIRUS INTRON A FRAGMENTS (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filed on (57) Abstract :

(71)Name of Applicant : :C12N 15/67,C12N 7/00 1)CHIRON CORPORATION Address of Applicant :4560 HORTON STREET, :60/240,502 :13/10/2000 EMERYVILLE, CALIFORNIA 94608-2916, U.S.A. :U.S.A. (72)Name of Inventor : :PCT/US2001/032050 1)THUDIUM DENT :12/10/2001 2)SELBY MARK :WO/2002/031137 :NA :NA :611/KOLNP/2003 :13/05/2003

Cytomegalovirus (CMV) Intron A fragments for expressing gene products are disclosed. Also described are expression vectors including the fragments, as well as methods of using the same.



5655





(54) Title of the invention : NON-PNEUMATIC TYRE ASSEMBLY (51) International classification

(71)Name of Applicant : :B60C 7/00, B60C 7/14 1)BIG TYRE PTY LTD. Address of Applicant :226, NORTH STREET, :2005902165 :29/04/2005 TOOWOOMBA, QUEENSLAND 4350. Australia :Australia (72)Name of Inventor : :PCT/AU2006/000568 1)LOUDEN, BRUCE :28/04/2006 :WO 2006/116807

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A non - pneumatic wheel assembly (10) which has an outer rim assembly (26), an inner vehicle hub connection member (11), a compartment located between the outer rim assembly (26) and the inner hub connection member (11) which has a plurality of spring elements (21, 22) wherein at least some of the spring elements (21, 22) are attached to the outer rim assembly (26) and/or the inner hub connection member (11) characterized in that the spring elements (21, 22) are oriented in opposed or counteracting orientations.



5656





(54) Title of the invention : METHOD AND APPARATUS FOR PRODUCING PAPER TUBE HAVING POLYGONAL CROSS SECTION, AND PAPER TUBE MANUFACTURED BY THE METHOD


(71)Name of Applicant : :B31C 1/00 1)LEE JAE-MUN :102005-0039872 Address of Applicant :RAINBOW VILLAGE LG APT 208:12/05/2005 1302, GUMI-DONG, BUNDANG-GU SEONGNAM-SI, :Republic of Korea GYEONGGI-DO 463-705, Republic of Korea :PCT/KR2006/001664 2)CHO HAN-YONG :03/05/2006 SEJONG GRANCIA 107-304, :WO 2006/121253 :NA :NA

930, YEONGDEOK-RI,GIHEUNG-EUP YONGIN-SI, GYEONGGI-DO 446-908 REPUBLIC OF KOREA

:NA :NA

(72)Name of Inventor : 1)LEE JAE-MUN 2)CHO HAN-YONG

(57) Abstract : The present invention relates to a method and apparatus for manufacturing a polygonal paper tube, and more particularly, to a method and apparatus for manufacturing a thick paper tube by discharging a plurality of paper strips, which are helically overlapped and wound on a rotating core, from the core using a delivery member moving in the interior of the core. An apparatus for manufacturing a paper tube having a polygonal cross section according to the present invention comprises a frame, an elongate core assembly having an end rotatably supported to the frame and the other free end and having an outer peripheral surface of a predetermined polygonal shape, and a delivery member installed to the core assembly for at least a portion of the delivery member to be exposed from to the outer peripheral surface of the core assembly on which the strips are wound, the delivery member being installed for the exposed portion to move toward the free end of the core assembly after receiving the power, whereby the continuously exposed portion is brought into contact with an inner surface of the lowermost one of a plurality of the strips wound on the outer peripheral surface of the core assembly and thus a plurality of the strips wound on the core assembly continuously move toward the free end of the core assembly.



5657





(54) Title of the invention : AUXILIARY SUPPORT CASE FOR AT LEAST ONE PIECE OF ELECTRICAL EQUIPMENT (51) International classification :H02G 3/12 (71)Name of Applicant : (31) Priority Document No :MI2005A000895 1)BTICINO S.P.A. (32) Priority Date :17/05/2005 Address of Applicant :VIA MESSINA, 38, I-20154 MILANO Italy (33) Name of priority country :Italy :PCT/IT2006/000354 (72)Name of Inventor : (86) International Application No Filing Date :12/05/2006 1)DE AMBROGGI RENATO (87) International Publication No :WO 2007/000783 2)PIANEZZOLA ENRICO (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An auxiliary support case (1) for at least one piece of electrical equipment to be wall -mounted is described, such that a mounting seat (3) is defined, which is suitable to receive and hold said at least one piece of electrical equipment. The support case (1) can be removably fixed to a wall-mounted case according to at least two different positions, thereby allowing respective orientations to said at least one piece of electrical equipment (400).



5658





(54) Title of the invention : N-(2-ARYLETHYL) BENZYLAMINES AS ANTAGONISTS OF THE 5-HT6 RECEPTOR (51) International classification

(71)Name of Applicant : :A61K 31/4045 ,C07C211/52 1)ELI LILLY AND COMPANY : 60/279,928 Address of Applicant :LILLY CORPORATE CENTRE, :29/03/2001 INDIANAPOLIS, IN 46285, U.S.A. :USA (72)Name of Inventor : :PCT/US2002/05115 1)CHEN, ZHAOGEN :15/03/2002 2)COHEN, MICHAEL, PHILIP :WO 2002/078693 3)FISHER, MATTHEW, JOSEPH 4)GIETHLEN, BRUNO :NA 5)GILLIG, JAMES, RONALD :NA 6)MCCOWAN, JAFFERSON, RAY :1111/KOLNP/2003 7)MILLER, SHAWN, CHRISTOPHER :02/09/2003 8)SCHAUS, JOHN, MEHNERT

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filed on (57) Abstract : The present invention provides compounds of formula (I), which are antagonists of the 5-HT6 receptor.



5659





(54) Title of the invention : NON-SLIPPING WHEEL (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country

:B60C 7/10,B29D (71)Name of Applicant : 30/02 1)JOHNSONDIVERSEY, INC. :05010501.4 Address of Applicant :8310 16TH STREET, M/S 509, :13/05/2005 STURTEVANT, WISCONSIN 53177, U.S.A. :EUROPEAN (72)Name of Inventor : UNION 1)MAYER, HEINRICH-TITO :PCT/US2006/018492 :12/05/2006 :WO 2006/124632

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Non-slipping wheel (1) comprising an elastomer layer (3) which covers at least the radially outer part of the wheel, characterized in that the elastomer layer has been provided with bubbles which are continuously torn open during use of the wheel thereby generating a suction effect. The buttles can be provided by foaming the elastomer. The elastomer can be polyurethane, and the wheel can further comprise an inner core layer (2) of a different material which is elastic, e.g., rubber. The wheel is particularly useful for floor cleaning machines: due to their use on ground which is covered by a cleaning solution, the wheels face traction problems - on the other hand, the wheels should not leave additional residues or markings on the floor.



5660





(54) Title of the invention : HOT FORMING SYSTEM FOR METAL WORKPIECES (51) International classification

:B21J 9/08,B21J (71)Name of Applicant : 13/10 1)MEHMET, TERZIAKIN :NA Address of Applicant :INCIRLI CAD. GULBAHCE SOK. :NA 13/1, BAKIRKOY ISTANBUL Turkey :NA (72)Name of Inventor : :PCT/TR2005/000025 1)MEHMET, TERZIAKIN :16/05/2005 :WO 2006/124005

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A device including at least one transformer (1) with primary (N1) / secondary (N2) coil ratio more than one and including a control unit (9) used to control timing and magnitude of the primeary current is employed to heat a metal workpiece (4) to be subjected a subsequent forming operation. A homopolar DC generator can also be used as current source for current heating preparing workpiece for forming operation. Subsequent heating, forming and cooling processes of the metal workpiece are carried out in a controlled manner by a central synchronization unit. This process can be applied in hot metal bulk forging, sheet forming and hot tube blowforming.



5661





(54) Title of the invention : DEVICE FOR DELIVERING MEDICAMENT (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country

:A61M 5/315 :05104734.8 :01/06/2005 :EUROPEAN UNION :PCT/SE2006/050148 :22/05/2006 :WO 2006/130098

(71)Name of Applicant : 1)SHL MEDICAL AB Address of Applicant :P.O. BOX 1240, AUGUSTENDALSVAGEN 19 S-131 28 NACKA STRAND Sweden (72)Name of Inventor : 1)KRONESTEDT VICTOR 2)BRUNNBERG LENNART 3)OLSON STEPHAN

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to a device for the delivery of predetermined doses of liquid medicament to a patient, which medicament is intended to be inhaled by the patient or intended to be injected into the body of the patient. The device is adapted to be in a medicament delivery state and in a medicament non-delivery state. When the device is in a medicament delivery state, said device is adapted to drive a piston into a cartridge containing the liquid medicament to be delivered, with a predetermined force value. The device is designed and arranged to ensure that the predetermined dose of medicament expelled from the cartridge has a high degree of accuracy and to show the user in a simple manner how much medicament is remaining in the cartridge after a dose or several doses has/have been expelled and at the same time offering a shorter device, which is more convenient for the user when he/she has to carry it with him/her.



5662





(54) Title of the invention : DEVICE FOR DELIVERING MEDICAMENT (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country

:A61M 5/315 :05104734.8 :01/06/2005 :EUROPEAN UNION :PCT/SE2006/050150 :22/05/2006 :WO 2006/130100

(71)Name of Applicant : 1)SHL MEDICAL AB Address of Applicant :P.O. BOX 1240, AUGUSTENDALSVAGEN 19 S-131 28 NACKA STRAND Sweden (72)Name of Inventor : 1)KRONESTEDT VICTOR 2)BRUNNBERG LENNART 3)OLSON STEPHAN 4)DEURELL TOMAS 5)KARLSSON ANDERS

(86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to a device for the delivery of predetermined doses of 1iquid medicament to a patient, which medicament is intended to be inhaled by the patient or intended to be injected into the body of the patient. The device is adapted to be in a medicament delivery state and in a medicament non-delivery state. When the device is in a medicament delivery state, said device is adapted to drive a piston into a cartridge containing the liquid medicament to be delivered, with a force that is above or equal to a predetermined minimum force value and below a predetermined maximum force value. The minimum force value is the lowest force value needed to deliver the predetermined dose and the maximum force value is the first force value at which it exists a risk of damaging the cartridge or the components of the device. Further, more of the spring force is brought to an efficient output torque ensuring that a predetermined volume of medicament is expelled from a cartridge.



5663





(54) Title of the invention : FUNGICIDAL 5-HYDROXYPYRAZOLINES, METHOD FOR PRODUCING THE SAME AND AGENTS COMPRISING THE SAME (51) International classification

:A01N 43/56,A01P (71)Name of Applicant : 3/00 1)BASF AKTIENGESELLSCHAFT :102005025397.0 Address of Applicant :67056 LUDWIGSHAFEN Germany :31/05/2005 (72)Name of Inventor : :Germany 1)GEWEHR MARKUS :PCT/EP2006/062565 2)DIETZ JOCHEN :24/05/2006 3)GROTE THOMAS :WO 2006/128817 4)GYPSER ANDREAS 5)NIEDENBRUCK MATTHIAS :NA :NA

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to novel 5-hydroxypyrazolines of the formula I in which the substituents are as defined below: B is phenyl, naphthyl or 5- or 6-membered hetaryl which contains one to four heteroatoms from the group consisting of O, N and S; A is C=O, OS or S02; R1 is alkyl, haloalkyl, alkenyl, haloalkenyl, alkynyl or haloalkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, phenyl, 5- or 6-membered heterocyclyl or hetaryl which contains one to four heteroatoms from the group consisting of O, N and S; R2 is alkyl, haloalkyl, alkenyl, haloalkyl, alkynyl, haloalkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, phenyl, 5- or 6-membered hetaryl or heterocyclyl which contains one to four heteroatoms from the group consisting of O, N and S; R3 is hydrogen, nitro, cyano, alkyl, haloalkyl, alkoxy, haloalkoxy, alkenyl, haloalkenyl, alkynyl, haloalkynyl or NR'2, where R' independently of one another are hydrogen or alkyl; R4 is hydrogen, halogen, nitro, cyano, NR'2, alkyl, haloalkyl, COOR' or 5- or 6- membered hetaryl or heterocyclyl; where the variables mentioned above may be substituted according to the description; processes for their preparation, their use for controlling harmful fungi and compositions comprising them.



5664





(54) Title of the invention : ENEMA DISPENSER (51) International classification

:A61M 39/24,A61M (71)Name of Applicant : 3/02 1)C.B. FLEET COMPANY, INCORPOATED Address of Applicant :4615 MURRAY PLACE, :11/152,818 LYNCHBURG, VA U.S.A. :14/06/2005 (72)Name of Inventor : :U.S.A. :PCT/US2006/021368 1)COX, CHARLES, H. :02/06/2006 :WO 2006/138076

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : An enema includes a liquid in a dispenser having a bottle, a nozzle attached to the bottle, and a valve. The valve may be a membrane having a slit and a thickness of at most 0.90 mm. The valve may be attached to the bottle or it may be attached to the nozzle, the enema can be administered more easily, with a lower amount of force. A method of bowel cleansing includes inserting the enema into a rectum and applying a compression force to the enema bottle.



5665





(54) Title of the invention : FUNGICIDAL MIXTURES BASED ON 2,5-DISUBSTITUTED PYRAZOL CARBOXYLIC ACID BIPHENYLAMIDES (51) International classification :A01N 43/56 (71)Name of Applicant : (31) Priority Document No :102005030951.8 1)BASF AKTIENGESELLSCHAFT Address of Applicant :67056 LUDWIGSHAFEN Germany (32) Priority Date :30/06/2005 (72)Name of Inventor : (33) Name of priority country :Germany (86) International Application No :PCT/EP2006/063624 1)DIETZ JOCHEN Filing Date :28/06/2006 2)GEWEHR MARKUS (87) International Publication No :WO 2007/003540 3)STRATHMANN SIEGFRIED (61) Patent of Addition to Application 4)STIERL REINHARD :NA Number 5)WERNER FRANK :NA Filing Date 6)SCHERER MARIA (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to fungicidal mixtures comprising, as active components, 1) at least one 2,5-disubstituted Nbiphenylpyrazolecarboxamide of the formula I in which X = oxygen or sulfur; R1 and R2 = cyano, nitro, halogen, C1-C6-alkyI, C1C6-haloalkyl, methoxy, difluoromethoxy or trifluoromethoxy; R3 = halogen, C1-C4-alkyl or C1-C4-haloalkyl; R4 = hydrogen or halogen; and 2) at least one active compound II selected from groups A) to F): A) azoles; B) strobilurins; C) carboxamides; D) heterocyclic compounds; E) carbamates; F) other fungicides; in a synergistically effective amount, methods for controlling harmful fungi using mixtures of at least one compound I and at least one active compound II, the use of the compound(s) I with active compounds II for preparing such mixtures and also compositions and seed comprising these mixtures.



5666





(54) Title of the invention : EXPRESSION PROFILES OF PERIPHERAL BLOOD MONONUCLEAR CELLS FOR INFLAMMATORY BOWEL DISEASES (51) International classification (31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number Filing Date

(71)Name of Applicant : :C12Q 1/68 1)WYETH :60/687331 Address of Applicant :FIVE GIRALDA FARMS MADISON, :06/06/2005 NJ U.S.A. :U.S.A. (72)Name of Inventor : :PCT/US2006/022102 1)BURCZYNSKI MICHAEL E :06/06/2006 2)PETERSON RON L :WO 2006/133287 3)TWINE NATALIE C :NA 4)STRAHS ANDREW :NA 5)IMMERMANN FREDERICK W 6)SCHWERTSCHLAG ULLRICH :NA 7)COTREAU MONETTE M :NA 8)DORNER ANDREW J

(57) Abstract : The present invention is directed to the identification of PBMC- and IBD- associated biomarkers that may be used to diagnose inflammatory bowel disease, and optionally, distinguish between PBMCs isolated from a patient with Crohn's disease and PBMCs isolated from a patient with ulcerative colitis. The present invention is further directed to methods of screening, including high throughput methods of screening, for regulatory agents capable of regulating the activity of PBMC- and IBD-associated biomarkers. Provided are compositions of PBMC- and IBD-associated biomarkers, including regulatory agents of at least one PBMC- and IBDassociated biomarker for methods of diagnosis, prognosis, therapeutic intervention and prevention of an inflammatory bowel disease, e.g., Crohn's disease and ulcerative colitis. Moreover, the present invention is also directed to methods that can be used to assess the efficacy of test compounds and therapies in the treatment inflammatory bowel disease, i.e., Crohn's disease or ulcerative colitis.



5667





(54) Title of the invention : SYNTHESIS AND EVALUATION OF NOVEL PHTHALIMIDE MIMICS AS ANTI-ANGIOGENIC AGENTS (51) International classification :C07D 209/48 (71)Name of Applicant : (31) Priority Document No :60/285745 1)UNIVERSITY OF VIRGINIA PATENT FOUNDATION (32) Priority Date :23/04/2001 Address of Applicant :1224 WEST MAIN STREET, SUITE (33) Name of priority country :U.S.A. 1-110, CHARLOTTESVILLE, VA U.S.A. (86) International Application No :PCT/US2002/012655 (72)Name of Inventor : Filing Date :22/04/2002 1)BROWN MILTON L (87) International Publication No :WO/2002/086078 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :1310/KOLNP/2003 Filed on :14/10/2003 (57) Abstract : The present invention is directed to novel thalidomide derivative compounds that have activity as anti-angiogenic compounds. More particularly the compounds have the general structure: where R1 is selected from the group consisting of H, halo, alkyl, haloalkyl, NH2, hydroxy and alkoxy; R2 is selected from the group consisting of optionally substituted bicyclic, optionally substituted aryl, and R6 is H, or C1-C8 alkyl; R19 is optionally substituted aryl; and m is 0-6.



5668





(54) Title of the invention : DOCUMENT SECURITY SYSTEM (51) International classification

:G06F 21/24,H04N (71)Name of Applicant : 1/00 1)RICOH COMPANY, LTD Address of Applicant :3-6, NAKAMAGOME 1-CHOME, :2006-128557 OHTA-KU TOKYO Japan :02/05/2006 (72)Name of Inventor : :Japan :PCT/JP2007/059802 1)KANAI YOICHI :02/05/2007 2)OHTA YUSUKE :WO 2007/129763 3)SAITOH ATSUHISA

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A document security system is disclosed. In the document security system, when a user is permitted to use a device and to use a document, a process for the document requested by a user is executed by the device. Further, after executing the process, a follow-up obligation is executed corresponding to the type of the document obtained from image data of the document.



5669





(54) Title of the invention : A SYSTEM FOR A FAST FREQUENCY HOPPING RADIO (51) International classification :H04B 1/713 (71)Name of Applicant : (31) Priority Document No :NA 1)TELEFONAKTIEBOLAGET LM ERICSSON (PUBL) (32) Priority Date :NA Address of Applicant :SE-164 83 STOCKHOLM Sweden (72)Name of Inventor : (33) Name of priority country :NA :PCT/SE2005/000693 1)NUMMINEN, MICHAEL (86) International Application No Filing Date :13/05/2005 2)ANDERSSON, MORGAN (87) International Publication No :WO 2006/121379 (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention discloses a system (100) for a fast frequency hopping radio, and comprises a transmit part (110) and a receive part (120). Each of the receive (110) and transmit (120) parts comprise a unit (115,125) for random frequency generation, the random frequency generating unit of both parts being similar. The random frequency generator (115, 125) of each of said parts comprises a pseudo random number generator, a PRN-generator, the PRN-generator being based on a FIR- algorithm, and said PRN-generator uses a clock signal which has been generated externally to the system as input. The external clock signal which is used is suitably a clock signal from the GPS-system.



5670





(54) Title of the invention : THARMOPLASTIC COMPOUND/MATRIX (51) International classification

:C08K 3/36, C08K (71)Name of Applicant : 9/06 1)EVONIK DEGUSSA GMBH :05013757.9 Address of Applicant :BENNIGSENPLATZ 1 40474 DUSSELDORF Germany :25/06/2005 :EPO (72)Name of Inventor : :PCT/EP2006/062675 1)UWE SCHACHTELY :29/05/2006 2)DR. JÜRGEN MEYER :WO 2007/000382 3)THOMAS SCHIENER 4)DR. FRANK MENZEL :NA :NA

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application Number Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Thermoplastic matrix/compound, comprising thermoplastic polymer and silanised, structurally modified, pyrogenically produced silica.



5671





(54) Title of the invention : SEMI-PERMEABLE COMPOSITIONS PROVIDING REDUCED DRYING TIME FOR OSMOTIC DOSAGE FORMS


:A61K 9/00,A61K (71)Name of Applicant : 9/22, A61K 9/32A61K 1)ALZA CORPORATION 9/36 Address of Applicant :1900 CHARLESTON ROAD :60/695,565 MOUNTAIN VIEW, CA U.S.A. :29/06/2005 (72)Name of Inventor : :U.S.A. 1)SHANBHAG, ANANT R. :PCT/US2006/025473 2)BARCLAY, BRIAN L. :29/06/2006 :WO 2007/002872

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : Disclosed are methods including providing an osmotic core; coating the osmotic core with a coating composition that comprises cellulose acetate butyrate; drying the coated osmotic core for a maximum period of about 36 hours; wherein the coated core is dried to an average residual solvent content of less than about 1000 parts per million. Also disclosed are coated osmotic cores and methods of administering the coated osmotic cores to a patient.



5672





(54) Title of the invention : METHOD FOR TRANSMITTING LCAS PROTOCOL VIA AN OPTICAL COMMUNICATION LINE (51) International classification

:H04J 3/16 ,H04J3/14,H04Q (71)Name of Applicant : 11/04 1)ECI TELECOM LTD. :169416 Address of Applicant :30 HASIVIM STREET, 49517 :27/06/2005 PATACH TIKVA Israel :Israel (72)Name of Inventor : :PCT/IL2006/000691 1)SOMMER, RONEN :15/06/2006 2)YEHUDA, EITAN :WO 2007/000753

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A technique for exchanging LCAS control information between a first network element and a second network element interconnected by a bi-directional optical communication line, while conveying substantially unidirectional data traffic in the form of a virtual concatenated group (VCG) binary stream transmitted in a first direction via the bi- directional optical communication line, the technique comprising :-in the first direction transmitting the LCAS control information via the bi-directional optical communication line in the VCG binary stream, by placing the information in one or more overhead bytes conventionally specified for the VCG binary stream,-in a second (opposite) direction, transmitting the LCAS control information in an existing binary stream non-related to the above-mentioned unidirectional data traffic; the existing binary stream should pass via a communication trail connecting the first network element and the second network element but not obligatory coinciding with the above-mentioned line; the discussed information should be placed in one or more overhead bytes of the existing binary stream.



5673





(54) Title of the invention : A METHOD AND DEVICE FOR MANUFACTURING A THREE-DIMENSIONAL OBJECT IN A GENERATIVE 3D PROCESS (51) International classification :B29C 67/00 (71)Name of Applicant : (31) Priority Document No :102005030067.7 1)FHS ST. GALLEN (HOCHSCHULE FUR (32) Priority Date :27/06/2005 ANGEWANDTE WISSENSCHAFTEN, INSTITUT RPD) (33) Name of priority country :Germany Address of Applicant :LERCHENFELDSTRASSE 5, CH(86) International Application No :PCT/CH2006/000344 9014 ST. GALLEN Switzerland Filing Date :27/06/2006 (72)Name of Inventor : (87) International Publication No :WO 2007/000069 1)SCHLEISS, PETER (61) Patent of Addition to Application 2)LEVY, GIDEON :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The invention relates to a method and to a device for producing a 3D object by means of a generative 3D-method, for example, selective laser sintering (SLS)and selective laser melting (SLM). An infrared sensor can be cross flown by a tempered fluid in order to prevent said infrared sensor (6), which is provided in the process chamber (1) of the device, from being impaired by monomer deposits, oligomers or solid material particles during the construction thereof.



5674





(54) Title of the invention : IMPROVED STRATEGIES FOR SEQUENCING COMPLEX GENOMES USING HIGH THROUGHPUT SEQUENCING TECHNOLOGIES (51) International classification :C12Q 1/68 (71)Name of Applicant : (31) Priority Document No :60/693053 1)KEYGENE N.V. Address of Applicant :90, AGRO BUSINESS PARK NL-6708 (32) Priority Date :23/06/2005 (33) Name of priority country :U.S.A. PW WAGENINGEN Netherlands (86) International Application No :PCT/NL2006/000312 (72)Name of Inventor : Filing Date :23/06/2006 1)VAN EIJK, MICHAEL, JOSEPHUS, THERESIA (87) International Publication No :WO 2006/137734 2)SORENSEN ANKER PREBEN (61) Patent of Addition to Application 3)HOGERS RENE CORNELIS JOSEPHUS :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A method for determining a genome sequence comprising the steps of digesting the genome with at least one first restriction endonuclease, ligating at least one adaptor to the restriction fragments of the first subset, selectively amplifying the first set of adaptorligated restriction fragments using a first primer combination wherein at least a first primer contains a first selected sequence at the 3' end of the primer sequence, comprising 1-10 selective nucleotides, repeating these steps with at least a second primer combinations wherein the primer contains a different second selected sequence, fragmenting each of the subsets of amplified adaptor-ligated restriction fragments to generate sequencing libraries, determine the nucleotide sequence of the fragments, aligning the sequence of the fragments in each of the libraries to generate contigs, repeating these steps for one second and /or further restriction endonucleases, aligning the contigs obtained for each of the second and /or further restriction endonucleases to provide for a sequence of the genome



5675





(54) Title of the invention : MOBILE STATION, WIRELESS ACCESS NETWORK, APPARATUS, MOBILE COMMUNICATION SYSTEM AND COMMUNICATION METHOD (51) International classification :H04Q 7/38 (71)Name of Applicant : (31) Priority Document No :2005-217578 1)NTT DOCOMO, INC. Address of Applicant :11-1, NAGATACHO 2-CHOME (32) Priority Date :27/07/2005 CHIYODA-KU, TOKYO Japan (33) Name of priority country :Japan (86) International Application No :PCT/JP2006/314625 (72)Name of Inventor : Filing Date :25/07/2006 1)ISHII MINAMI (87) International Publication No :WO 2007/013427 2)UMESH ANIL (61) Patent of Addition to Application 3)ABETA SADAYUKI :NA Number 4)NAKAMURA TAKEHIRO :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : A mobile communication system is provided that performs bi-directional communications between a mobile station and a wireless access network device. The mobile station includes a connection set-up signal reception timing calculation unit for calculating a reception timing of a connection set-up signal when a connection request signal is transmitted, and a connection set-up signal reception determination unit that determines, according to the reception timing, whether the connection set-up signal is received, and performs a signal reception operation based on the determination. The wireless access network device includes a connection set-up signal scheduling unit that, after receiving a connection request signal from the mobile station, performs a connection set-up signal transmission assignment based on a reception timing of the connection request signal, a connection set-up signal generation unit that generates a connection set-up signal to be sent to the mobile station; and a connection set-up signal transmission unit that transmits the connection set-up signal based on the connection set-up signal transmission assignment.



5676





(54) Title of the invention : METHOD FOR PRODUCING ANTIFALSIFICATION PAPERS, PAPER MOULD, AND FORMING ELEMENT FOR PAPER MOULD


:D21F 11/00,D21F (71)Name of Applicant : 1/44 ,D21F 1)GIESECKE & DEVRIENT GMBH 11/06,D21H 21/40 Address of Applicant :PRINZREGENTENSTRASSE 159 :102005032815.6 81677 MUNCHEN Germany :12/07/2005 (72)Name of Inventor : :Germany 1)GRUSZCZYNSKI UWE :PCT/EP2006/006437 2)BODENDIECK THOMAS :03/07/2006 :WO 2007/006445

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to a method for manufacturing a security paper, for security or value documents, that exhibits at least one through opening (12) having characteristic irregularities (14) in the edge region. According to the present invention, a paper web having thin sites in the form of the outline of the desired shape of the at least one through opening (12) is formed on a paper mold, and the paper web dewatered after sheet formation, the region delimited by the thin sites being removed from the paper web by the occurring forces.



5677





(54) Title of the invention : THERMOPLASTIC POLYMER COMPOSITIONS INCLUDING SILICA-CONTAINING NUCLEATING AGENTS (51) International classification

:C08K 3/40, C08K 3/34 :60/688759 :09/06/2005 :U.S.A. :PCT/US2006/022625 :09/06/2006 :WO 2006/135809

(71)Name of Applicant : 1)BEAULIEU GROUP, LLC D/B/A BEAULIEU OF AMERICA Address of Applicant :1502 CORONET DRIVE DALTON, GEORGIA 30722U.S.A. (72)Name of Inventor : 1)SALSMAN ROBERT KEITH

(31) Priority Document No (32) Priority Date (33) Name of priority country (86) International Application No Filing Date (87) International Publication No (61) Patent of Addition to Application :NA Number :NA Filing Date (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The embodiments disclosed herein relate to thermoplastic polymer compositions that comprise a thermoplastic and nucleating agents, such as silica-containing nucleating agents. The polymer compositions provide improved properties relating to processing, dimensional and thermal stability, improved crystalline structure, and flame retardant properties. The thermoplastic polymer compositions are useful, for example, for carpet backing applications. It is a further feature of the embodiments to provide carpet backing compositions and carpet tiles prepared using the thermoplastic polymer composition, as well as methods of making the carpet tiles.



5678





(54) Title of the invention : LIGHT EMITTING DEVICE AND METHOD OF MANUFACTURING THE SAME (51) International classification :H01L 33/00 (71)Name of Applicant : (31) Priority Document No :102005-0053797 1)SEOUL OPTO-DEVICE CO., LTD. (32) Priority Date :22/06/2005 Address of Applicant :1 BLOCK 36, 725-5, WONSI-DONG DANWON-GU, ANSAN Republic of Korea (33) Name of priority country :Republic of Korea :PCT/KR2006/002427 (72)Name of Inventor : (86) International Application No Filing Date :22/06/2006 1)LEE JONG LAM (87) International Publication No :WO 2006/137711 2)LEE JAE HO (61) Patent of Addition to Application 3)YOON YEO JIN :NA Number 4)HWANG EU JIN :NA Filing Date 5)KIM DAE WON (62) Divisional to Application Number :NA Filing Date :NA (57) Abstract : The present invention relates to a light emitting device and a method of manufacturing the light emitting device. According to the present invention, the light emitting device comprises a substrate, an N-type semiconductor layer formed on the substrate, and a P-type semiconductor layer formed on the N-type semiconductor layer, wherein a side surface including the N-type or P-type semiconductor layer has a slope of 20 to 80°from a horizontal plane. Further, the present invention provides a light emitting device comprising a substrate formed with a plurality of light emitting cells each including an N-type semiconductor layer and a P-type semiconductor layer formed on the N-type semiconductor layer, and a submount substrate flip-chip bonded onto the substrate, wherein the N-type semiconductor layer of one light emitting cell and the P-type semiconductor layer of another adjacent light emitting cell are connected to each other, and a side surface including at least the P-type semiconductor layer of the light emitting cell has a slope of 20 to 80°from a horizontal plane. Further, the present invention provides a method of manufacturing the light emitting device. Accordingly, there is an advantage in that the characteristics of a light emitting device such as luminous efficiency, external quantum efficiency and extraction efficiency are enhanced and the reliability is secured such that light with high luminous intensity and brightness can be emitted.



5679

Publication U/R 84(3) in respect of Application for Restoration of Patents Notice is hereby given that any person interested in opposing the following applications for Restoration of Patents under Section 60 of the Patent Act, 1970, may at any time within 2 months from the date of Publication of this notice, give notice to the Controller of Patents at the appropriate office on the prescribed Form 14 under Rule 85 of the Patents (Amendment ) Rules, 2006. PATENT NO.

193054

198119

202230

APPLICANTS

TITLE

SOCIETE DES PRODUITS NESTLE SA

A METHOD OF PRODUCING A COATED HIGH – BOILED CONFECTION

N.T. SRINIVASAN & A. SRINIVASAN

MATSUSHITA ELECTRIC INDUSTRIAL CO., LTD.

QUICK FIT CLUTCH RELEASE CARBON THRUST RING ASSEMBLY CUT – OPEN TWO PIECE TYPE

A WIRELESS COMMUNICATION APPARATUS AND A TRANSMISSION POWER CONTROL METHOD


APPROPRIATE DATE OF OFFICE CESSATION

28/11/2006

CHENNAI

29/11/2006

CHENNAI

23/01/2007

CHENNAI

5680

Publication Under Section 43(2) in Respect of the Grant Following Patents have been granted and any “person interested” in opposing these patents under Section 25(2) may at any time within one year from the date of this issue, give notice to the Controller of Patents at the appropriate office, on the prescribed form-7 along with written statement and evidence, if any.

Serial Patent Date of Date of Application Number Number Number Application Priority

1

Title of Invention

Name of Patentee

Date of Publication Appropriate of Abstract Office u/s 11(A)

DELTA OBJECT REPLICATION

ORACLE INTERNATIONAL CORPORATION

21/07/2006 KOLKATA

28/04/2006 KOLKATA

THEREOF"

FOOT STEPS ORTHOTICS PTY LIMITED

BIOPSY DEVICE WITH SAMPLE TUBE

ETHICON ENDO SURGERY, INC.

14/07/2006 KOLKATA

ASTELLAS PHARMA INC.,

17/02/2006 KOLKATA

216842 00981/KOLNP/2005 19/11/2003 17/12/2002 SYSTEM AND METHOD FOR

CLUSTERED SYSTEM. "ORTHOTIC INSERT AND 2

218530 01000/KOLNP/2004 15/01/2003 16/01/2002 METHOD OF MANUFACTURE

3

218531 01310/KOLNP/2005 11/12/2003 11/12/2002

4

A PHARMACEUTICAL COMPOSITION FOR 218532 00942/KOLNP/2004 15/01/2003 18/01/2002 INCREASING THE NUMBER OF PLATELETS

5

218533 01304/KOLNP/2005 19/11/2003 09/12/2002

6

PARTICULATE POROUS AMMOXIDATION CATATYST 218534 01365/KOLNP/2005 27/02/2004 05/03/2003 FOR USE IN PRODUCING ACRYLONITRILE OR METHACRYLONITRILE.

ASAHI KASEI CHAMICALS CORPORATION

10/11/2006 KOLKATA

7

218535 01470/KOLNP/2005 05/02/2004 06/02/2003 PIPE-CONNECTING DEVICE

PISCINES DESJOYAUX S.A.

20/10/2006 KOLKATA

8

218536 01474/KOLNP/2005 06/02/2004 07/02/2003

9

METHOD AND APPARATUS FOR DETERMIMG FREQUENCY 218537 01374/KOLNP/2005 22/01/2004 22/01/2003 PLANNING MEASUREMENT MOTOROLA, INC. DATA IN A CELLULAR COMMUNICATIONS SYSTEM.

10

218538 01519/KOLNP/2004 27/11/2002 27/03/2003 NEMATODE RESISTANCE GENE

METHOD FOR PROCESSING DIGITAL DATA VALUES

A YARN WINDING METHOD TSTM CO. , LTD. AND A YARN WINDING DEVICE

NOVEL ROOT KNOT AND APPLICATION THEREOF "A PROCESS FOR PREPARING 11

SIEMENS 11/08/2006 KOLKATA AKTIENGESELLSCHAFT

218539 01794/KOLNP/2004 17/06/2003 17/06/2002 DIAMINO SUBSTITUTED

PYRIMIDINDE COMPUNDS"

UNIVERSITY OF TSUKUBA

218540 01804/KOLNP/2005 04/03/2004 14/03/2003

DEVICE FOR MAXINGF PASTY AND LIQUID MASSES.

13

218541 01960/KOLNP/2004 30/06/2003 28/06/2002

A THERAPEUTIC COMPOSITION COMPRISING PATHOGEN GLYKOS FINLAND OY INHIBITING OLIGOSACCHARIDES

14

218542 02111/KOLNP/2005 25/10/2005 16/05/2003

METHOD AND DEVICE FOR TREATING WATER

218543 100/KOLNP/2005

01/09/2006 KOLKATA

26/05/2006 KOLKATA

SMITHKLINE BEECHAM 16/06/2006 KOLKATA CORPORATION

12

15

29/09/2006 KOLKATA

STORK PRINTS B.V.

01/09/2006 KOLKATA

21/07/2006 KOLKATA

STERIS EUROPE 15/09/2006 KOLKATA INC.SUOMEN SIVULIIKE

" PROCESS FOR THE MELT SPINNING OF POLYESTER MICROFILAMENTS WITH A DTY UHDE INVENTA23/07/2003 24/07/2002 TIIRE OF NOT MORE THAN 0 .7 FISCHER AG DTEX AND POLYESTER MICROFILAMENTS


04/11/2005 KOLKATA

5681

MANUFACTURED BY THE SAID METHOD" DEVICE AT THE SPINNING MILL PREPARATION FOR SEPARATION OF CARRIER AIR TRUTZSCHLER GMBH 04/03/2003 30/03/2002 DURING CHARGING OF FIBRE & CO. KG., MATERIALS AS FOR EXAMPLE COTTON OR THE EQUIVALENT TO A PROCESSING MACHINE.

16

218544 133/KOL/2003

17

"HETEROARYL COMPOUNDS WHICH INHIBIT LEUKOCYTE 218545 01533/KOLNP/2004 27/05/2003 24/05/2002 ADHESION MEDIATED BY ALPHA-4 INTEGRINS"

18

218546 01932/KOLNP/2004 12/06/2003 14/06/2002 USE IN BIOCIDAL COATINGS

19

218547 110/CAL/2002

11/03/2005 KOLKATA

ELAN PHARMACEUTICALS, INC.

02/06/2006 KOLKATA

"N- HALAMINE SILOXANES FOR AUBURN UNIVERSITY AND VANSON AND MATERIALS" HALOSOURCE, INC.

30/06/2006 KOLKATA

IMPROVED SAFETY EDGE FOR 27/02/2002 12/03/2001 HORIZONTALLY PIVOTED

STAGNOLIT. G. S.R.L.

17/11/2006 KOLKATA

MERCK PATENT GESELLSCHAFT MIT BESCHRANKTER HAFTUNG

04/03/2005 KOLKATA

ROLLING GATES. 20

218548 1414/CAL/1996

4-SULFONYL- OR 4SULFINYLBENZOYLGUANIDINE 07/08/1996 11/08/1995 DERIVATIVES OF THE FORMULA I

21

218549 167/CAL/2001

21/03/2001 05/04/2000

INK-JET INKS WHICH PREVENT KOGATION AND PROLONG HEWLETT-PACKARD RESISTOR LIFE IN INK-JET COMPANY PENS.

21/01/2006 KOLKATA

22

218550 190/CAL/2001

02/04/2001 14/04/2000

AWNING FABRIC AND PROCESS SCHMITZ- WERKE FOR PRODUCING SAME. GMBH & CO.

29/09/2006 KOLKATA

23

218551 265/KOLNP/2005

ALUMINUM AEROSOL CAN AND ALUMINUM BOTTLE AND 27/06/2003 20/08/2002 METHOD OF MANUFACTURE FROM COIL FEEDSTOCK

24

218552 268/KOL/2004

24/05/2004 04/12/2003 GOODS WITH A SELF-

EXAL CORPORATION

06/01/2006 KOLKATA

SYSTEM FOR CONVEYING INNOVA PATENT GMBH 02/06/2006 KOLKATA

CONTAINED CONVEYOR BELT. 25

218553 280/CAL/2001

14/05/2001 18/05/2000

METHOD AND RECEIVER FOR PROVIDING AUDIO TRANSLATION DATA ON DEMAND.

DEUTSCHE THOMSONBRANDT GMBH.

09/12/2005 KOLKATA

26

218554 314/KOLNP/2005

26/08/2003 27/08/2002

NOVEL ACYL GROUPCONTAINING COMPOSITION

ASAHI KASEI CHEMICALS CORPORATION

11/08/2006 KOLKATA

27

218555 133/KOLNP/2003

18/08/2000 18/08/2000 AND DATA WIRE

TECHNIGROUP FAR EAST PTE LTD.,

17/02/2006 KOLKATA

GLAXO GROUP LIMITED

25/03/2005 KOLKATA

A HOUSING FOR ELECRICAL MANAGEMENT. PHENYL XANTHINE ESTERS AND AMIDES.

28

218556 226/CAL/1998

12/02/1998 14/02/1997

29

218557 382/KOL/2003

09/07/2003 20/07/2002 Eye-type buttonhole sewing machine

Durkopp Adler Aktiengesellschaft

04/02/2005 KOLKATA

30

218558 345/KOLNP/2003

ELECTRICALLY CONDUCTIVE POLYMER COMPOSITE COMPOSITIONS METHOD FOR 17/07/2001 03/11/2000 MAKING , AND METHOD FOR ELECTRICAL CONDUCTIVITY ENHANCEMENT.

GENERAL ELECTRIC COMPANY

11/03/2005 KOLKATA

31

218559 481/KOLNP/2005

08/10/2002 08/10/2002

AN ARRESTOR AGAINST VOLTAGE SURGES

DISENO DE SISTEMAS EN SILICIO,S.A

07/07/2006 KOLKATA

32

218560 546/KOLNP/2005

18/09/2003 18/09/2002

"A HUMIDIFIER APPARATUS FOR USE IN A RECIPIRATORY

MEDEX CARDIOPULMONARY, INC.

27/01/2006 KOLKATA


5682

THERAPY CIRCUIT HAVING A BREATHABLE GAS SUPPLY AND OPERATING AT AN AIR PRESSURE" 05/05/1999

AUTOLIFTING OF TOILET SEAT. SATISH GOKHALE

18/05/2007 KOLKATA

218562 479/KOL/2003

10/09/2003

A COMPOSITION FOR CONSOLIDATION OF DENSE CERAMICS AND METAL COMPACTS

22/07/2005 KOLKATA

35

218563 646/KOLNP/2003

A METHOD FOR FACILITATING A TRANSFER OF A COMMUNICATION BETWEEN A 17/10/2001 17/10/2000 INVENTIONS INC., FIRST DEVICE OF AN AGENT AND A SECOND DEVICE OF A CUSTOMER.

36

218564 621/KOL/2005

15/07/2005

218565 668/CAL/2001

A METHOD FOR MANUFACTURING A SLIDING 04/12/2001 06/12/2000 PART FOR A HERMETIC COMPRESSOR.

LG ELECTRONICS INC.

24/03/2006 KOLKATA

38

218566 738/CAL/1998

DISC-SHAPED INFORMATION CARRIER PROVIDED WITH TWO KONINKLIJKE PHILIPS 27/04/1998 23/06/1997 PORTIONS HAVING DIFFERENT ELECTRONICS N.V. READ-OUT SPEEDS.

25/05/2007 KOLKATA

39

218567 664/CAL/2000

01/12/2000 22/12/1999 DETECT A SIGNAL RECEIVED

33

34

37

218561 418/CAL/1999

BOILER FURNACE MAINTENANCE STRUCTURE (BFMS).

METHOD AND DEVICE TO FROM A CHANNEL SIGNAL.

INDIAN INSTITUTE OF TECHNOLOGY

21/01/2005 KOLKATA

BHARAT HEAVY 16/02/2007 KOLKATA ELECTRICALS LIMITED

DEUTSCHE THOMSONBRANDT GMBH.

02/09/2005 KOLKATA

40

218568 672/CAL/1999

METHOD OF PRIORITIZING HANDOFF REQUESTS IN 30/07/1999 31/07/1998 MOBILE COMMUNICATION SYSTEM.

41

218569 74/CAL/1998

18/02/1994

42

218570 00214/KOLNP/2004 05/09/2002 11/09/2001

43

INJECTABLE COMPOSITIONS FOR THE CONTROLLED 218571 00224/KOLNP/2004 18/10/2002 19/10/2002 DELIVERY OF PHARMACOLOGICALLY ACTIVE COMPOUND

44

" A METHOD FOR READING INITIALIZATION DATA INTO A GIESECKE & DEVRIENT 218572 00240/KOLNP/2004 27/08/2002 30/08/2001 CHIP CARD AND A METHOD OF 31/03/2006 KOLKATA GMBH GENERATING A RECORD FOR INITIALIZING A CHIP CARD"

45

"AUTOMATIC HAIR IMPLANTER FOR MANUFACTURING WIG 218573 00398/KOLNP/2004 22/08/2002 28/09/2001 PROPIA CO.LTD. AND METHOD OF MANUFACURING WIG

07/04/2006 KOLKATA

46

"A METHOD FOR DIRECTING THE4 DIFFERENTIATION OF 218574 00457/KOLNP/2004 01/11/2002 02/11/2001 PRIMATE EMBRYONOC STEM CELLS INTOP ENDOTHELIAL CELLS"

14/04/2006 KOLKATA

47

218575 00554/KOLNP/2005 08/08/2003 04/09/2002

48

218576 00245/KOLNP/2004 14/08/2002 23/08/2001 "GLUCAGON-LIKE PEPTIDE-1

SAMSUNG 06/01/2006 KOLKATA ELECTRONICS CO. LTD.

SECURITY ELEMENT FOR A SECURITY DOCUMENT AND METHOD OF PRODUCING IT.

GIESECKE & DEVRIENT 26/05/2006 KOLKATA GMBH.

"DROPLET DEPOSITION APPARATUS"

XAAR TECHNOLOGY LIMITED

07/04/2006 KOLKATA

IDEXX LABORATORIES, 23/09/2005 KOLKATA INC.

WISCONSIN ALUMNI RESEARCH FOUNDATION

ETCHING PASTES FOR SILICON MERCK PATENT GMBH 24/02/2006 KOLKATA SURFACE AND LAYERS ELI LILLY AND


31/03/2006 KOLKATA

5683

ANALOGS"

49

" PROCESS FOR THE PRODUCTION OF ZNCL2 FROM 218577 00354/KOLNP/2004 27/09/2002 03/10/2001 A ZINC BEARINGT PRIMARY AND/OR SECONDARY MATERIAL"

50

218578 00750/KOLNP/2005 27/10/2003 30/10/2002 PRODUCING OLEFIN

PROCESS AND APPARATUS FOR POLYMERS. "TEMPERATURE SENSITIVE SAFETY VALVE ASSEMBLY"

51

218579 00818/KOLNP/2004 11/01/2002 22/11/2001

52

218580 00901/KOLNP/2005 14/10/2003 14/10/2002 COMPRESSOR SYSTEM AND

AN ELECTROCHEMICAL FUEL CELL SYSTEM. 53

218581 00909/KOLNP/2004 25/11/2002 30/11/2001 A LOUVRE WINDOW SYSTEM

54

218582 00615/KOLNP/2005 06/10/2003 11/10/2002 FOR MEASURING THE SPEED

"A SPEED SENSING SYSTEM OF A TARGET OBJECT"

COMPANY

UMICORE

07/04/2006 KOLKATA

BOREALIS TECHNOLOGY OY

30/06/2006 KOLKATA

THE LINDEN SHIELD LIMITED

25/08/2006 KOLKATA

REINZ-DICHTUNGSGMBH

09/06/2006 KOLKATA

BREEZWAY AUSTRALIA 05/05/2006 KOLKATA PTY LTD. THE TIMKEN COMPANY,

03/03/2006 KOLKATA

BELL KIM N. I.,

20/05/2005 KOLKATA

CNR CONSIGLIO NAZIONALE DELLE RICERCHE

08/07/2005 KOLKATA

A COOLAPSED BAG AND 55

218583 00922/KOLNP/2003 17/12/2001 18/12/2000 METHOD FOR OPENING THE

SAME.

56

INTERSTITIAL MICROWAVE ANTENNA WITH 218584 00942/KOLNP/2003 31/01/2002 31/01/2001 MINIATURIZED CHOKE FOR HYPERTHERMIA AND SURGERY.


5684

8482;æ¦â¢ å¶å¼ç§æ°å¼ å¶ æç½®è¬² æµ â¢ #8722;è¡·æ¢ - Intellectual ...

8482;æ¦â¢ å¶å¼ç§æ°å¼ å¶ æç½®è¬² æµ â¢ #8722;è¡·æ¢ - Intellectual ...

8482;æ¦â¢ å¶å¼ç§æ°å¼ å¶ æç½®è¬² æµ â¢ #8722;è¡·æ¢ - Intellectual ...

8482;æ¦â¢ å¶å¼ç§æ°å¼ å¶ æç½®è¬² æµ â¢ #8722;è¡·æ¢ - Intellectual ...