A molecular phylogeny recovers Strabomantis

Zootaxa 3741 (4): 569–582 www.mapress.com /zootaxa / Copyright © 2013 Magnolia Press

Article

ISSN 1175-5326 (print edition)

ZOOTAXA

ISSN 1175-5334 (online edition)

http://dx.doi.org/10.11646/zootaxa.3741.4.7 http://zoobank.org/urn:lsid:zoobank.org:pub:74D5A225-9727-48BE-B273-64E8D84FF19C

A molecular phylogeny recovers Strabomantis aramunha Cassimiro, Verdade and Rodrigues, 2008 and Haddadus binotatus (Spix, 1824) (Anura: Terrarana) as sister taxa RENATA C. AMARO1,7, IVAN NUNES2, CLARISSA CANEDO2,, MARCELO F. NAPOLI3, FLORA A. JUNCÁ4, VANESSA K. VERDADE5, CÉLIO F.B. HADDAD6 & MIGUEL T. RODRIGUES1 1 Universidade de São Paulo, Instituto de Biociências, Departamento de Zoologia, Caixa Postal 11.461, 05422-970 São Paulo, São Paulo, Brazil 2 Universidade Federal do Rio de Janeiro, Museu Nacional, Departamento de Vertebrados, 20940-040 Rio de Janeiro, Rio de Janeiro, Brazil 3 Universidade Federal da Bahia, Museu de Zoologia, Instituto de Biologia, Departamento de Zoologia, 40170-115, Salvador, Bahia, Brazil 4 Universidade Estadual de Feira de Santana, Departamento de Ciências Biológicas, 44036-900 Feira de Santana, Bahia, Brazil 5 Universidade Federal do ABC, Centro de Ciências Naturais e Humanas, Avenida dos Estados, n5001, 09210-971 Santo André, São Paulo, Brazil 6 Universidade Estadual Paulista ‘‘Júlio de Mesquita Filho’’, Instituto de Biociências, Departamento de Zoologia, 13506-900 Rio Claro, São Paulo, Brazil 7 Corresponding author. E-mail: [email protected]

Abstract The taxonomic and biogeographic affinities of Strabomantis aramunha from the Campos Rupestres of Brazil are intriguing. A unique skull morphology of females suggest affinities with the broad-headed eleutherodactylines of Northwestern South America in the genus Strabomantis. Male and juvenile morphology nonetheless suggest S. aramunha could be related to members of the recently described genus Haddadus from eastern Brazil. We assess the affinities of S. aramunha using molecular phylogenetic analyses of mitochondrial (12S, tRNAval, 16S, cyt b) and nuclear sequences (RAG-1and rhodopsin). Bayesian inference, likelihood, and parsimony analysis recover a highly supported clade with S. aramunha and H. binotatus as sister taxa. Accordingly, we transfer S. aramunha to Haddadus, and provide a new generic definition of the later. The distribution of species in Haddadus (highlands of the Espinhaço mountain Range and coastal eastern Brazil) is now concordant with the general pattern observed for other species in the area. Key words: Haddadus aramunha, molecular data, new combination, nomenclature, phylogeny

Introduction Molecular phylogenetic studies have resulted in several taxonomic changes at the family and generic levels within Terrarana (an unranked name for direct developing frogs created by Hedges et al. 2008) during the last ten years (see Darst & Cannatella 2004; Crawford & Smith 2005; Frost et al. 2006; Heinicke et al. 2007, 2009; Hedges et al. 2008; Padial et al. 2009; Canedo & Haddad 2012). In this context, frogs formerly placed in the highly speciose paraphyletic genus Eleutherodactylus were partitioned in several other genera (e.g., Frost et al. 2006; Hedges et al. 2008; Padial et al. 2009). The recent results presented by Canedo & Haddad (2012) indicated the non-monophyly of yet some other genera in the current taxonomy (e.g. Ischnocnema sensu Hedges et al. 2008). Despite progress in our understanding of the phylogenetic relationships of Terraranas and the consequent improvement in their taxonomy, several relationships inferred by Frost et al. (2006), Hedges et al. (2008), Padial et al. (2009), Pyron & Wiens (2011), and Canedo & Haddad (2012) are poorly supported, many species have not yet been sampled, and other lack substantial amounts of evidence. These limitations suggest that additional work is still much needed.

Accepted by J. Padial: 29 Oct. 2013; published: 29 Nov. 2013

569

The naming and description of the terraranan frog Strabomantis aramunha by Cassimiro et al. (2008) is contemporary with Hedges et al. (2008). The species was described on the basis of four adults and three juvenile specimens from Serra do Sincorá (13°04'07"S, 41°20'09"W, 998 m a.s.l.), northern Espinhaço mountain range, Mucugê Municipality, Bahia State, Brazil. This species occurs in the highly endemic rock meadows environment referred to as “Campos Rupestres” (for the description of Brazilian Campos Rupestres, see Heyer 1999). The disjunctive distribution of S. aramunha with respect to the remaining western and northwestern South American species of Strabomantis was considered enigmatic (Cassimiro et al. 2008). Nonetheless, its generic allocation was justified by the observation of a combination of characters of females of S. aramunha that, following Lynch (1997), would ally this species with members of the former Eleutherodactylus sulcatus species group (now Strabomantis biporcatus species series; Hedges et al. 2008): large size, broad head, posterior pars fascialis of maxillae deepened, V3 ramus of trigeminus nerve superficial to the m. levator posterior mandibulae subexternus (“S” condition of Lynch 1986). Alternatively, according to Cassimiro et al. (2008), males of S. aramunha are also similar to Haddadus binotatus Spix. Placing S. aramunha within the genus Haddadus, however, would require a new generic definition of the later to correct that of Hedges et al. (2008). Since the morphological evidence can be considered ambiguous, herein we provide novel evidence based on molecular analysis of mitochondrial and nuclear sequences for Strabomantis, Haddadus, and other Neobatrachia (mainly Terrarana), in order to clarify the position of S. aramunha.

Material and methods Molecular study design. The phylogenetic analyses relied on two different datasets, one gene-rich dataset including mitochondrial and nuclear DNA for 51 taxa, and species-rich dataset including only mitochondrial DNA for 322 taxa. The gene-rich dataset includes 2,082 bp (508 bp of 12S, 591 bp of 16S, 223 bp of cyt b, 442 bp of RAG-1 and 318 bp of Rhodopsin) and 51 terminals. This dataset includes sequences of four paratypes of Strabomantis aramunha and representatives of diverse Neobatrachia families and major groups of Terrarana sampled by Heinicke et al. (2009). The species-rich dataset includes 1,602 bp of aligned DNA sequences from mitochondrial genes (890 bp of 12S, 85 bp of tRNAVal, 627 bp of 16S) for 322 terminals (Appendix 1 and 2). The ingroup comprised 312 terminals, including sequences for two specimens of Strabomantis aramunha, for seven other species of Strabomantis, eight specimens of Haddadus binotatus, and 295 other terminals within Terrarana. Outgroup selection followed Frost et al. (2006), and includes ten terminals from seven anuran genera: six hyloids, Agalychnis callidryas (Cope), Epipedobates boulengeri (Barbour), E. tricolor (Boulenger), Flectonotus fitzgeraldi (Parker), Flectonotus sp., Litoria caerulea (White), Rhinella arenarum (Hensel), R. margaritifera (Laurenti), Uperoleia laevigata Keferstein), and the ranoid Lithobates catesbeianus (Shaw); the last one was used to root the tree. The second species of the genus Haddadus, H. plicifer (Boulenger), is a poorly characterized species for which we could not access tissue samples for molecular analyses. Molecular data gathering. We extracted genomic DNA from ethanol-preserved tissues following protocol from Feztner (1990). The Polymerase Chain Reaction (PCR) were directly purified with Exonuclease I and Shrimp Alkaline Phosphatase (USB or Fermentas). Automated sequencing was carried out using BigDye Terminator v3.1 Cycle Sequencing kit (Applied Biosystems), followed by analysis on ABI Prism 310, 3700 or 3170 Genetic Analyzer Sequencers (Applied Biosystems) according to the manufacturer’s instructions. In the second aproach, we extracted genomic DNA from ethanol-preserved tissues using the DNeasy tissue extraction kit (Qiagen Inc.). We performed Polymerase Chain Reaction (PCR) for the amplification of the selected fragments using PCR Master Mix (2X) Fermentas (0.05 u/µl Taq DNA Polymerase, reaction buffer, 4 mM MgCl2, 0.4 mM of each dNTP) and specific primers (Table 1). Standard reaction conditions were an initial hold for 2 min at 94ºC; 35 cycles of 94ºC for 30s, 50ºC for 30s, and 72ºC for 2 min, followed by a final hold of 72ºC for 7 min, and terminating the reaction at 4ºC. PCR products were visualized in 1% agarose gels. Part of purification and sequencing were done by Macrogen Inc. (sequencing conducted under BigDyeTM terminator cycling conditions; reacted products purified using ethanol precipitation and runs performed in Automatic Sequencer 3730XL). Chromatograms were fully inspected, embedded primer sequences were deleted, and forward and reverse strands were compared before assembling consensus sequences with CodonCode Aligner 3.5 (Codon Code Corporation). GenBank accession numbers for sequences generated in this study are available on Appendix 1 and 2, as well those data downloaded

570 · Zootaxa 3741 (4) © 2013 Magnolia Press

AMARO ET AL.

from GenBank. In some cases we joined sequences from different individuals of the same species to construct a single composite terminal (applied only to GenBank sequences from non-Strabomantis or non-Haddadus terminals). Sequences were aligned in MEGA 5.0 (Molecular Evolutionary Genetics Analysis; Tamura et al., 2011) using Muscle (Multiple Sequence Comparison by Log-Expectation; Edgar 2004a; Edgar 2004b), and were subsequently adjusted by hand for some of the highly variable regions of the 12S and 16S genes. Alignments were deposited in Treebase (http://purl.org/phylo/treebase/phylows/study/TB2:S14863). TABLE 1. Primers used in this study. Primer

Gene

Sequence

Reference

MVZ59

F

12S

ATAGCACGTAAAAYGCTDAGATG

Graybeal (1997)

12S F-H

R

12S

CTTGGCTCGTAGTTCCCTGGCG

Goebel et al. (1999)

12SA

F

12S

CTGGGATTAGATACCCCACTA

Kocher et al. (1989)

12SB

R

12S

TGAGGAGGGTGACGGGCGGT

Kocher et al. (1989)

12S A-L

F

12S–tRNA-V

AAACTGGGATTAGATACCCCACTAT


tRNAval-H

R

12S–tRNA-V

GGTGTAAGCGARAGGCTTTKGTTAAG


12SL13

F

tRNA-V–16S

TTAGAAGAGGCAAGTCGTAACATGGTA

Feller & Hedges (1998)

16sTitus_1

R

tRNA-V–16S

GGTGGCTGCTTTTAGGCC

Titus & Larson (1996)

16sAR

F

16S

CGCCTGTTTATCAAAAACAT

Palumbi (1996)

16sBR

R

16S

CCGGTCTGAACTCAGATCACGT

Palumbi (1996)

16sWilk2

R

16S

GACCTGGATTACTCCGGTCTGA

Wilkinson et al. (1996)

CB1-L

F

Cyt b

CCATCCAACATCTCAGCATGATGAAA

Palumbi (1996)

CB3-H

R

Cyt b

GGCGAATAGGAAGTATCATTC

Palumbi (1996)

R1-GFF

F

Rag-1

GAGAAGTCTACAAAAAVGGCAAAG

Faivovich et al. (2005)

R1-GFR

R

Rag-1

GAAGCGCCTGAACAGTTTATTAC

Faivovich et al. (2005)

Rhod1A

F

rhodopsin

ACCATGAACGGAACAGAAGGYCC

Bossuyt & Milinkovitch (2000)

Rhod1C

R

rhodopsin

CCAAGGGTAGCGAAGAARCCTTC


Rhod1D

R

rhodopsin

GTAGCGAAGAARCCTTCAAMGTA


Molecular data analysis. For both datasets we used maximum parsimony (MP), maximum likelihood (ML), and Bayesian inference (BI). Maximum Parsimony (MP) analyses for the gene-rich dataset were implemented in PAUP* 4.0b10 (Swofford 2002), and for the species-rich dataset in TNT 1.1 (Tree analysis using New Technology, Goloboff et al. 2008, the Willi Hennig Society Edition). Maximum likelihood analyses (ML) were implemented in RAxML 7.4.4. (Stamatakis 2006) available on Cipres Science Gateway (Miller et al. 2010) and Bayesian analyses (BA) were implemented in MrBayes 3.1.2 (Ronquist & Huelsenbeck 2003) also available on Cipres Science Gateway. Gene-rich dataset. MP searches were conducted with equal character weighting and gaps treated as fifth base under the heuristic search with tree bisection reconnection (TBR) branch swapping and 1,000 random-addition sequence replicates, retaining five trees after each replicate. Nodal support was estimated using non-parametric bootstrapping (Felsenstein 1985) with 1,000 replicates with five random additional sequence replicates each and TBR branch swapping. For Bayesian analysis the best–fit model of nucleotide substitution for each data partition was selected using the Akaike Information Criterion implemented in MrModeltest v.2.2 (Nylander 2004): GTR+I+G for 12S, 16S, cyt b and RAG-1, and HKY+I+G for Rhodopsin. Two independent BI were performed for each partition, with a random starting tree, four incrementally heated Markov chains, and 10,000,000 generations, with trees sampled every 1,000 generations to estimate likelihood and sequence evolution parameters. Stationary for each run was detected by plotting the likelihood scores of the trees against generation time, and the topology, posterior probability values, and branch lengths inferences were estimated after discarding 25% of the initial trees AFFINITIES OF STRABOMANTIS ARAMUNHA

Zootaxa 3741 (4) © 2013 Magnolia Press ·

571

of each run as burn-in samples. Best maximum likelihood (ML) tree were assessed after 100 runs in RAxML and 1,000 replicates of bootstrap was performed. Uncorrected genetic distances for cyt b and 16S were also calculated using PAUP* 4.0b10 (Swofford 2002). Species-rich dataset. Gaps were treated as missing data. We performed MP analyses in TNT 1.1 (Tree analysis using New Technology, Goloboff et al. 2008, the Willi Hennig Society Edition) using driven searches level 15 under “new technology search” (sect. search, drift, and tree fusing; random addition sequence 100; random seed 1; replace existing trees, auto-constrain); we also performed a total of 100 bootstrap replicates with the same specifications with 100 random-addition sequence replicates. We performed ML analyses in RAxMLGUI 0.9.3, a graphical front-end for RAxML (Randomized Axelerated Maximum Likelihood for High Performance Computing; Stamatakis, 2006), using the GTRCAT model of nucleotide substitution (a GTRGAMMA approximation with optimization of individual per-site substitution rates). We partitioned the dataset by gene (12S, tRNAVal, and 16S). We performed a total of 100 runs and assessed node support via 1,000 bootstrap replicates (ML + thorough bootstrap; n. threads 20). For BI analyses, we implemented the model of nucleotide substitution selected as the best fit for every particular partition according to the Akaike Information Criterion (AIC) in JModelTest (Posada 2008) and performed analyses in Mr.Bayes 3.1 (Ronquist & Huelsenbeck 2003). The combined datasets were analyzed by partitioning the data as for the ML analyses (three partitions). We performed analyses with 30 million generations; the analyses consisted of two independent runs, four Markov chains with default heating values and default priors. Trees were sampled every 1,000 generations, and the first 25% of generated trees were discarded as burn-in. We used standard deviation of split frequencies to assess the convergence (< 0.01). Phenotypic data. Morphological characteristics of Strabomantis aramunha were analyzed from specimens housed in the Museu de Zoologia da Universidade Estadual de Feira de Santana (MZFS 1555, 1789, 1895, 2124– 2126, 2129, 2194, 2360–2361, 2368–2369, 2376–2377, 2380, 2382, 2739), and Museu de Zoologia, Universidade Federal da Bahia (UFBA 5971, 6222, 6383–6384, 6729–6731, 7384) (see additional information on specimens examined in Napoli et al. 2010), representing almost all known species geographic distribution. Calling males (MZFS 2125–2126) were recognized as adult specimens, and their SVL range as a size estimator in the recognition of adult males. Doubtful specimens were dissected to determine sexual and maturity condition. We also examined adult specimens of Haddadus binotatus from the State of Rio de Janeiro: Municipality of Rio de Janeiro, Jacarepaguá, Parque Estadual da Pedra Branca, Pau da Fome (UFBA 105–106); Municipality of Engenheiro Paulo de Frontin, Morro Azul do Tinguá (UFBA 373–387); Municipality of Miguel Pereira (UFBA 300–301). According to Bokermann (1966), the city of Rio de Janeiro, and its surroundings, is the type-locality of H. binotatus.

Results All phylogenetic trees based on different criteria for phylogenetic reconstruction (MP, ML, and BI) did not recover the genus Strabomantis as monophyletic in the current sense as S. aramunha is highly supported as sister taxon of Haddadus binotatus (Figs. 1 and 2). In the species-rich analysis (Fig. 2) Brachycephalus is sister to the clade formed by Haddadus and S. aramunha, while for the gene-rich dataset Craugastor is the sister group of S. aramunha and H. binotatus (Fig. 1). Genetic distances (Table 2) for the cyt b varied from 15.2% to 35.4% among species of Terrarana and 16Sdistances ranged from 9.2% to 24.6%. Strabomantis aramunha and H. binotatus showed distances of 15.2% for cyt b and 9.2% for 16S while those of S. aramunha and S. biporcatus were 29.1% for cyt b and 22.3% from S. bufoniformis and 22.5% from S. biporcatus for 16S. Following these results we transfer Strabomantis aramunha Cassimiro, Verdade & Rodrigues, 2008 to the genus Haddadus Hedges, Duellman & Heinicke, 2008 and restore thus the monophyly of Strabomantis.


AMARO ET AL.

FIGURE 1. Bayesian inference (BI) topology of combined molecular dataset (cyt b, 16 S, 12S, RAG–1, and rhodopsin genes) showing the relationships of Haddadus aramunha within Terrarana. Numbers above nodes are posterior probability values (ns < 95%), maximum likelihood (ML) bootstrap support (ns < 70%), and maximum parsimony (MP) bootstrap support (ns < 70%), displayed as (BI/ML/MP); ns = no high support; * = 100%; nc = no such clade by this criterion.

AFFINITIES OF STRABOMANTIS ARAMUNHA


573

FIGURE 2. Bayesian inference (BI) topology of mitochondrial molecular dataset (12S, t-RNAval, 16S), showing the relationships of Haddadus aramunha within a broad sample of Terraranan species. Numbers above nodes are posterior probability values (ns < 95%), maximum likelihood (ML) bootstrap support (ns < 70%), and maximum parsimony (MP) bootstrap support (ns < 70%), displayed as (BI/ML/MP); ns = no high support; * = 100%; nc = no such clade by this criterion. The figures of specimens are not to scale.


AMARO ET AL.

TABLE 2. Uncorrect p-distances for mitochondrial genes cyt b (above) and 16S (below) for several members of Terrarana. Intraspecific distances of Haddadus species are in bold, and distances among Haddadus and Strabomantis are in italics. 1 1) Adelophryne 2) Brachycephalus

0.303

3) Ceuthomantis A

0.296

2

3

4

5

6

7

8

0.246

0.215

0.218

0.221

0.205

0.215

0.213

0.235

0.240

0.244

0.236

0.217

0.215

0.013

0.231

0.223

0.230

0.227

0.300

4) Ceuthomantis W1

0.305

0.310

0.022

5) Craugastor

0.251

0.290

0.332

0.341

0.224

0.215

0.225

0.225

0.215

0.224

0.203

6) Diasporus

0.278

0.291

0.291

0.291

0.242

0.131

0.217

7) Eleutherodactylus

0.287

0.240

0.300

0.305

0.287

0.220

8) Haddadus

0.256

0.267

0.314

0.309

0.238

0.269

0.251

9) Ischnocnema

0.278

0.282

0.327

0.318

0.287

0.247

0.251

0.287

10) Oreobates

0.274

0.309

0.300

0.305

0.314

0.283

0.274

0.251

11) Phrynopus

0.287

0.304

0.345

0.341

0.283

0.274

0.269

0.291

12) Pristimantis

0.260

0.281

0.300

0.305

0.278

0.238

0.233

0.278

13) Psychrophrynella

0.269

0.291

0.291

0.296

0.305

0.247

0.256

0.323

14) Strabomantis biporcatus

0.305

0.277

0.354

0.354

0.318

0.305

0.287

0.269

15) Strabomantis bufoniformis

-

-

-

-

-

-

-

-

16) Haddadus aramunha (MZUSP138691)

0.260

0.263

0.291

0.291

0.224

0.238

0.242

0.152

9

10

11

12

13

14

15

16

0.243

0.184

0.224

0.214

0.211

0.215

0.224

0.216

0.213

continued.

1) Adelophryne 2) Brachycephalus

0.223

0.229

0.225

0.208

0.254

0.220

0.224

0.241

3) Ceuthomantis A

0.233

0.193

0.207

0.222

0.230

0.230

0.233

0.229

4) Ceuthomantis W1

0.227

0.188

0.202

0.219

0.216

0.226

0.234

0.222

5) Craugastor

0.213

0.210

0.214

0.213

0.217

0.219

0.223

0.213

6) Diasporus

0.230

0.184

0.197

0.176

0.188

0.184

0.193

0.215

7) Eleutherodactylus

0.223

0.195

0.195

0.204

0.202

0.202

0.204

0.223

8) Haddadus

0.243

0.192

0.214

0.214

0.234

0.210

0.216

0.092

0.233

0.229

0.249

0.232

0.230

0.243

0.262

9) Ischnocnema 10) Oreobates

0.283

11) Phrynopus

0.296

0.291

0.170

0.184

0.182

0.162

0.179

0.218

0.181

0.189

0.156

0.174

0.219

12) Pristimantis

0.274

0.238

0.251

0.209

0.215

0.215

0.197

13) Psychrophrynella

0.274

0.309

0.233

0.300

0.184

0.210

0.235

14) Strabomantis biporcatus

0.305

0.278

0.274

0.269

0.291

0.127

0.225

15) Strabomantis bufoniformis

-

-

-

-

-

-

16) Haddadus aramunha (MZUSP138691)

0.269

0.220

0.260

0.274

0.283

0.291

0.223 -

Taxonomic account Haddadus aramunha (Cassimiro, Verdade & Rodrigues, 2008), new comb. Diagnosis. To date, there is no identifiable morphological synapomorphy supporting the monophyly of the genus Haddadus (see discussion). We assign H. aramunha to this genus based on inferred relationships using molecular



575

data, as well as on the overall similarity among males of S. aramunha and H. binotatus. Also, head width (HW)/ snout-vent length (SVL) lower than 49% is a characteristic distinguishing members of Haddadus from Strabomantis (Cassimiro et al. 2008) (up to 54% in Strabomantis, Hedges et al. 2008). Haddadus aramunha is characterized by the following combination of traits: (1) largest size for the genus (adult males SVL 37.3–44.9 mm, adult females SVL 51.0–81.9 mm; Napoli et al. 2010); (2) wide head (HW/SVL 0.40–0.49; HL/SVL 0.37–0.45), its width greater to slightly smaller than its length; (3) adult females bearing welldeveloped frontoparietal crests, delimiting a mid-dorsal longitudinal groove; (4) posterior part of pars fascialis of maxilla deepened; (5) mandibular ramus of the trigeminal nerve passing lateral to the m. levator mandibulae posterior subexternus, (6) finger I much longer (FLI/SVL 0.15–0.23) than finger II (FLII/SVL 0.08–012); (7) fifth toe smaller than third; (8) dorsum generally smooth, covered with keratin white dots, bearing only one or two granular dorsolateral ridges; (9) vocal sac and vocal slits absent in males; (10) no asperities on thumbs of males; (11) in adult live specimens, dorsal background dark reddish brown. The new combination herein proposed changes Hedges’ et al. (2008) generic diagnosis of Haddadus: (1) head narrower (or broader than body); (3) cranial crests absent (or present and well developed in females); (8) Toe III equal in length, slightly shorter (or clearly longer than Toe V); and (11) range in SVL 17 mm in only known specimen of H. plicifer (82 mm in females of H. aramunha). Comparisons with other species. Haddadus aramunha differs from H. binotatus by always presenting the head wider than long in females, and usually wider than long in males (always longer than wide in H. binotatus); shorter legs (slightly longer than SVL in H. aramunha (thigh + tibia + foot length about 1.05 SVL), and clearly longer than SVL in H. binotatus (thigh + tibia + foot length about 1.15 SVL); conspicuous frontoparietal crests in females, and poorly developed ones in males, delimiting a mid-dorsal longitudinal groove (absent in H. binotatus); Haddadus aramunha also differs from H. binotatus and H. plicifer (species data from Boulenger 1888) by the presence of only one or two granular dorsolateral ridges on dorsum (five symmetrical undulous linear folds on each side of the back in H. binotatus and H. plicifer). The dark reddish brown dorsal background in live adult females of H. aramunha differs this species from H. binotatus, which never presents such a pattern (See Fig. 1 of Napoli et al. 2010). Haddadus aramunha inhabits open areas, living near streams within “campo rupestre” environments, while H. binotatus and H. plicifer are restricted to forested areas of the tropical Atlantic forest.

Discussion Our analyses including just mitochondrial data, or comprising both mitochondrial and nuclear data resulted in different topologies (Figs. 1 and 2), a result that mirrors the results of different studies on which the recent taxonomy of Terrarana was build (Frost et al. 2006; Hedges et al. 2008; Heinicke et al. 2009; Padial et al. 2009; Pyron & Wiens 2011; Canedo & Haddad 2012). However, the phylogenetic placement of Haddadus aramunha was congruent for both datasets. Concordant with Canedo & Haddad (2012) our results reject a monophyletic Terrarana because the genus Ceuthomantis was nested among outgroup terminals (Figs. 1 and 2). According to Canedo & Haddad (2012), this result is probably an artifact of the different sampling of terminals or characters used in the different studies. Since our study was not designed to address the overall relationships among parts of Terrarana and therefore lacked part of the evidence provided in other studies (e.g. Frost et al. 2006; Hedges et al. 2008; Heinicke et al. 2009; Pyron & Wiens 2011; Canedo & Haddad 2012) but, rather, focus on an smaller part for which the evidence provided is unambiguous, we refrain from dragging conclusions and build taxonomic decisions for groups other than Strabomantis and Haddadus. In short, the relationships among the two species of the genus Haddadus was recovered with high support and this result is congruent with the alternative generic placement pointed by the authors of the original description of H. aramunha (see Cassimiro et al. 2008). The genetic distances between S. aramunha and H. binotatus are congruent with divergences estimated for species within other genera of frogs (e.g., Amaro et al. 2009; Grant et al. 2006; Padial et al. 2012). Nonetheless, divergences among species within a single genus can be broad, as the result of, for example, taxonomic coverage biases or different mutation rates. For example, Padial et al. (2012) found 16S distances ranging from 4% to 17% within Oreobates, another terraranan genus. Also, intraspecific distances of Proceratophrys ranged from 12% to 19% for cyt b and 2% to 8% for 16S, while distances between Proceratophrys and Odontophrynus ranged from 18% to 22% for cyt b and 7% to 11% for 16S (Amaro et al. 2009).


AMARO ET AL.

Molecular phylogenetic studies are becoming very popular and their number is increasing rapidly, clearly at a faster pace than morphological studies. Therefore there is a growing gap to be filled through the study of the morphology with the goal of identifying putative synapomorphies for known clades (e.g. Taboada et al. 2013). But, it is worth noting that the morphological characters that lead Lynch’s (1975) grouping of the broad-headed eleutherodactyline frogs, and which later pointed to the existence of two different clades within that group (Lynch, 1986), is currently mirrored by the recognition of Strabomantis and Craugastor as different genera (Hedges et al. 2008) Haddadus aramunha is known from several localities at the northern portion of Espinhaço mountain range, called Chapada Diamantina Ecorregion (Napoli et al. 2010; Xavier & Napoli 2011), where it inhabits open areas of savanna woodlands (‘cerrados’), in rocky mountain fields known as ‘campos rupestres’, and in semi-deciduous forest environments surrounded by ‘campos rupestres’, within elevations ranging from 800 to 1200 m above sea level. Haddadus binotatus occurs in eastern and southeastern Brazil from southern Bahia to Rio Grande do Sul states (Hedges et al. 2008), from sea level to 1240 m elevation at Serra do Mar mountain range (Moura et al. 2012; IN personal communication), where it inhabits the leaf litter of the forest floor (Heyer et al. 1990). As far as we known, H. plicifer is only known from the holotype described from the Municipality of Igarassu (sea level), State of Pernambuco, Brazil (Heyer 1984), at a northern distribution to H. binotatus. The new combination solves a biogeographic puzzle posed by the original placement of H. aramunha in Strabomantis. Strabomantis is restricted to Central and Northwestern South America, and Haddadus is restricted to eastern Brazil. The biogeographical relationships of H. aramunha now fit the expected pattern for endemic species from the Espinhaço mountain range [e.g., Bokermannohyla diamantina Napoli & Juncá, Hylodes otavioi Sazima & Bokermann, Phasmahyla jandaia (Bokermann & Sazima), Proceratophrys minuta Napoli, Cruz, Abreu & DelGrande, and Thoropa megatympanum Caramaschi & Sazima; see Leite et al. 2008 for a checklist and discussion of the endemic species of amphibians from the Espinhaço mountain range]. Species in this range are usually related to species from the coastal Atlantic Forest [e.g., Bokermannohyla circumdata (Cope), Hylodes lateristrigatus (Baumann), Phasmahyla guttata (Lutz), and Thoropa miliaris (Spix)]. Remarks. The current taxonomic status of Haddadus plicifer remains unresolved. The species was named as Hylodes plicifera by Boulenger (1888) from a single specimen collected at Igarassu, State of Pernambuco, Brazil, but the species has not been registered since the original collection. Boulenger’s original description matches perfectly with H. binotatus, except by the small size of the specimen (17 mm SVL), which suggests that H. plicifer could be a juvenile specimen of H. binotatus. This morphological similarity probably led Cochran (1955) to identify this specimen (holotype of H. plicifer; Natural History Museum, London 88.4.18.16) as H. binotatus (cited in Cochran’s specimens examined of H. binotatus), although the author did not propose the synonimization of the former. The type-locality of H. plicifer, lies on the Brazilian Atlantic coast, covered by the Tropical Atlantic Forest, which is contiguous with the southernmost Atlantic forests of the states of Sergipe and Bahia, and where we captured H. binotatus (UFBA 4370, Municipality of Mata de São João, northern State of Bahia; Juncá 2006). Therefore, H. plicifer could represent the northernmost population of H. binotatus. On the other hand, differences in size and shape of H. binotatus along the Tropical Atlantic Forest (M. F. Napoli, personal observation) may indicate that this taxon is a complex of species, which makes a more detailed taxonomic revision of H. binotatus necessary.

Acknowledgements This research was supported by resources supplied by the Núcleo de Computação Científica (NCC/GridUNESP) from the Universidade Estadual Paulista “Júlio de Mesquita Filho”(UNESP). We would like to thank F. S. F. Leite and L. E. Lopes for their help in field; S. Baroni for technical assistance; M. Teixeira Jr. by figure improvements; and J. Cassimiro and J. M. Padial for critical reading of early version of manuscript. RCA, MTR, and VKV acknowledges Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) grant # 11/50146-6 and CNPq for support, and Instituto Brasileiro do Meio Ambiente e dos Recursos Naturais Renováveis (IBAMA) for collection permits (02001.003933/01). IN acknowledges Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) and Fundação Carlos Chagas Filho de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ) for fellowship and support; CC acknowledges Coordenação de Aperfeiçoamento de Pessoal de Nível



577

Superior (Capes) and FAPERJ for fellowship and support; FAJ acknowledges Universidade Estadual de Feira de Santana (UEFS) for support; CFBH acknowledges São Paulo Research Foundation (FAPESP) grant # 2008/509281 and CNPq for financial support; MFN acknowledges CNPq for fellowship (process number 309672/2012-0).

References Amaro, R.C., Pavan, D. & Rodrigues, M.T. (2009) On the generic identity of Odontophrynus moratoi Jim & Caramaschi, 1980 (Anura, Cycloramphidae). Zootaxa, 2071, 61–68. Bokermann, W.C.A. (1966) Lista anotada das localidades tipo de anfíbios brasileiros. Serviço de Documentação, RUSP, São Paulo, 181 pp. Bossuyt, F. & Milinkovitch, M.C. (2000). Convergent adaptive radiations in Madagascan and Asian ranid frogs reveal covariation between larval and adult traits. Proceedings of the National Academy of Sciences of the United States of America, 97, 6585–6590. http://dx.doi.org/10.1073/pnas.97.12.6585 Boulenger, G.A. (1888) On some reptiles and batrachians from Iguarasse, Pernambuco. Annals and Magazine of Natural History, Series 6, 2, 40–43. http://dx.doi.org/10.1080/00222938809460873 Canedo, C. & Haddad, C.F.B (2012) Phylogenetic relationships within anuran clade Terrarana, with emphasis on the placement of Brazilian Atlantic rainforest frogs genus Ischnocnema (Anura: Brachycephalidae). Molecular Phylogenetics and Evolution, 65, 610–620. http://dx.doi.org/10.1016/j.ympev.2012.07.016 Cassimiro, J., Verdade, V.K. & Rodrigues, M.T. (2008) A large and enigmatic new Eleutherodactylinae frog (Anura, Strabomantidae) from Serra do Sincorá, Espinhaço range, Northeastern Brazil. Zootaxa, 1761, 59–68. Cochran, D.M. (1955) Frogs of Southeastern Brazil. Bulletin of the United States National Museum, 206, 1–423. http://dx.doi.org/10.5479/si.03629236.206.1 Crawford, A.J. & Smith, E.N. (2005) Cenozoic biogeography and evolution in direct-developing frogs of Central America (Leptodactylidae: Eleutherodactylus) as inferred from a phylogenetic analysis of nuclear and mitochondrial genes. Molecular Phylogenetics and Evolution, 35, 536–555. http://dx.doi.org/10.1016/j.ympev.2005.03.006 Darst, C.R. & Cannatella, D.C. (2004) Novel relationships among hyloid frogs inferred from 12S and 16S mitochondrial DNA sequences. Molecular Phylogenetics and Evolution, 31, 462–475. http://dx.doi.org/10.1016/j.ympev.2003.09.003 Edgar, R.C. (2004a) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research, 32, 1792–1797. http://dx.doi.org/10.1093/nar/gkh340 Edgar, R.C. (2004b) MUSCLE: a multiple sequence alignment method with reduced time and space complexity. BMC Bioinformatics, 5, 113. Faivovich, J., Haddad, C.F.B., Garcia, P.C.A., Frost, D.R., Campbell, J.A. & Wheeler, W.C. (2005) Systematic review of the frog family Hylidae, with special reference to Hylinae: phylogenetic analysis and taxonomic revision. Bulletin of the American Museum of Natural History, 294, 1–240. Feller, A.E. & Hedges, S.B. (1998) Molecular evidence for the early history of living amphibians. Molecular and Phylogenetics Evolution, 9, 509–516. http://dx.doi.org/10.1006/mpev.1998.0500 Felsenstein, J. (1985) Confidence limits on phylogenies: an approach using the bootstrap. Evolution, 39, 783–791. http://dx.doi.org/10.2307/2408678 Fetzner, J. (1999) Extracting high–quality DNA from shed reptiles skins: a simplified method. BioTechiniques, 26, 1052–1054. Frost, D.R., Grant, T., Faivovich, J., Bain, R.H., Haas, A., Haddad, C.F.B., de Sá, R.O., Channing, A., Wilkinson, M., Donnelan, S.C., Raxworthy, C.J., Campbell, J.A., Blotto, B.L., Moler, P., Drewes, R.C., Nussbaum, R.A., Lynch, J.D., Green, D.M. & Wheeler, W.C. (2006) The amphibian tree of life. Bulletin of the American Museum of Natural History, 297, 1–370. Goebel, A.M., Donnelly, J.M. & Atz, M.E. (1999) PCR primers and amplification methods for 12S ribosomal DNA, the control region, cytochrome oxidase I, and cytochrome b in bufonids and other frogs, and an overview of PCR primers which have amplified DNA in amphibians successfully. Molecular and Phylogenetics Evolution, 11, 163–199. http://dx.doi.org/10.1006/mpev.1998.0538 Goloboff, P., Farris, J. & Nixon, K. (2008) TNT, a free program for phylogenetic analysis. Cladistics, 24, 774–786. http://dx.doi.org/10.1111/j.1096-0031.2008.00217.x Grant, T., Frost, D.R., Caldwell, J.P., Gagliardo, R., Haddad, C.F.B., Kok, P.J.R., Means, D.B., Noonan, B.P., Schargel, W. & Wheeler, W.C. (2006) Phylogenetics systematics of dart-poison frogs and their relatives (Anura: Athesphatanura: Dendrobatidae). Bulletin of the American Museum of Natural History, 299, 1–262.


AMARO ET AL.

Graybeal, A. (1997) Phylogenetic relationships of bufonid frogs and tests of alternate macroevolutionary hypotheses characterizing their radiation. Zoological Journal of Linnean Society, 119, 297–338. http://dx.doi.org/10.1111/j.1096-3642.1997.tb00139.x Hedges, S.B., Duellman, W.E. & Heinicke, M.P. (2008) New World direct-developing frogs (Anura: Terrarana): molecular phylogeny, classification, biogeography, and conservation. Zootaxa, 1737, 1–182. Heinicke, M.P., Duellman, W.E. & Hedges, S.B. (2007) Major Caribbean and Central American frog faunas originated by ancient oceanic dispersal. Proceedings of the National Academy of Sciences, USA, 104, 10092–10097. http://dx.doi.org/10.1073/pnas.0611051104 Heinicke, M.P., Duellman, W.E., Trueb, L., Means, D.B., MacCulloch, R.D. & Hedges, S.B. (2009) A new frog family (Anura: Terrarana) from South America and an expanded direct-developing clade revealed by molecular phylogeny. Zootaxa, 2211, 1–35. Heyer, W.R. (1984) Variation, systematics, and zoogeography of Eleutherodactylus guentheri and closely related species (Amphibia: Anura: Leptodactylidae). Smithsonian Contributions to Zoology, 402, 1–42. http://dx.doi.org/10.5479/si.00810282.402 Heyer, W.R. (1999) A new genus and species of frog from Bahia, Brazil (Amphibia: Anura: Leptodactylidae) with comments on the zoogeography of the Brazilian campos rupestres. Proceedings of the Biological Society of Washington, 112, 19–39. Heyer, W.R., Rand, A.S., Cruz, C.A.G., Peixoto, O.L. & Nelson, C.E. (1990) Frogs of Boracéia. Arquivos de Zoologia, 31, 231– 410. Juncá, F.A. (2006) Diversidade e uso de hábitat por anfíbios anuros em duas localidades de Mata Atlântica, no norte do estado da Bahia. Biota Neotropica, 6, 1–17. http://dx.doi.org/10.1590/s1676-06032006000200018 Kocher, T.D., Thomas, W.K., Meyer, A., Edwards, S.V., Paabo, S., Villablanca, F.X. & Wilson, A.C. (1989) Dynamics of mitochondrial DNA evolution in animals: Amplification and sequencing with conserved primers. Proceedings of the National Academy of Sciences of the United States, 86, 6196–6200. http://dx.doi.org/10.1073/pnas.86.16.6196 Leite, F.S.F., Juncá, F.A. & Eterovick, P.C. (2008) Status do conhecimento, endemismo e conservação de anfíbios anuros da Cadeia do Espinhaço, Brasil. Megadiversidade, 4, 158–176. Lynch, J.D. (1975) A review of the broad-headed Eleutherodactyline frogs of South America (Leptodactylidae). Occasional Papers of the Museum of Natural History, The University of Kansas, 38, 1–46. Lynch, J.D. (1986) The definition of the Middle American clade of Eleutherodactylus based on jaw musculature (Amphibian: Leptodactylidae). Herpetologica, 42, 248–258. Lynch, J.D. (1997) Intrageneric relationships of mainland Eleutherodactylus II. A review of the Eleutherodactylus sulcatus group. Revista de la Academia Colombiana de Ciencias Exactas, Físicas y Naturales, 21, 353–372. Miller, M.A., Pfeiffer, W. & Schwartz, T. (2010) Creating the CIPRES Science Gateway for inference of large phylogenetic trees. In: Proceedings of the Gateway Computing Environments Workshop (GCE), 14 Nov. 2010, New Orleans, LA, pp. 1– 8. Moura, M.R., Lacerda, J.V.A. & Feio, R.N. (2012) The advertisement call of Haddadus binotatus (Spix, 1824) (Anura; Craugastoridae). Zootaxa, 3224, 67–68. Napoli, M.F., Juncá, F.A., Cruz, D. & Abreu, R.O. (2010) Amphibia, Anura, Strabomantidae, Strabomantis aramunha Cassimiro, Verdade and Rodrigues, 2008: Distribution extension with notes on natural history, color patterns, and morphometric data. Check List, 6, 275–279. Nylander, J.A.A. (2004) MrModeltest v. 2.2. Program distributed by the author. Evolutionary Biology Centre, Uppsala University, Uppsala, Sweden. Padial, J.M., Castroviejo-Fisher, S. & De La Riva, I. (2009) The phylogenetic relationships of Yunganastes revisited (Anura: Terrarana). Molecular Phylogenetics and Evolution, 52, 911–915. http://dx.doi.org/10.1016/j.ympev.2009.05.006 Padial, J.M., Chaparro, J.C., Castroviejo-Fisher, S., Guayasamin, J.M., Lehr, E., Delgado, A.J., Vaira, M., Teixeira, Jr., M., Aguayo, R. & De La Riva, I. (2012) A revision of species diversity in the neotropical genus Oreobates (Anura: Strabomantidae), with the description of three new species from the Amazonian slopes of the Andes. American Museum Novitates, 3752, 1–55. http://dx.doi.org/10.1206/3752.2 Palumbi, S.R. (1996) Nucleic acids II: The Polymerase Chain Reaction. In: Hillis, D.M., Moritz, C. & Mable, B.K. (Eds.), Molecular Systematics. Sinauer Associates, Sunderland, Massachusetts, USA, pp. 205–247. Posada, D. (2008) JModelTest: phylogenetic model averaging. Molecular Biology and Evolution, 25, 1253–1256. http://dx.doi.org/10.1093/molbev/msn083 Pyron, R.A. & Wiens, J.J. (2011) A large-scale phylogeny of Amphibia including over 2800 species, and a revised classification of extant frogs, salamanders, and caecilians. Molecular Phylogenetics and Evolution, 61, 543–583. http://dx.doi.org/10.1016/j.ympev.2011.06.012 Ronquist, F. & Huelsenbeck, J.P. (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics, 19, 1572–1574. http://dx.doi.org/10.1093/bioinformatics/btg180



579

Stamatakis, A. (2006) RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics, 22, 2688–2690. Swofford, D.L. (2002) PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4. Sinauer Associates, Sunderland, Massachusetts, USA. Taboada, C., Grant, T., Lynch, J.D. & Faivovich, J. (2013) New morphological synapomorphies for the new world direct– developing frogs (Amphibia, Anura, Terrarana). Herpetologica, 69, 342–357. http://dx.doi.org/10.1655/herpetologica-d-13-00019 Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. & Kumar, S. (2011) MEGA5: Molecular Evolutionary Genetics Analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution, 28, 2731–2739. http://dx.doi.org/10.1093/molbev/msr121 Titus, T.A. & Larson, A. (1995) A molecular phylogenetic perspective on the evolutionary radiation of the salamander family Salamandridae. Systematics Biology, 44, 125–141. Vences, M., Thomas, M., Van Der Meijden, A., Chiari, Y. & Vieites, D.R. (2005) Comparative performance of the 16S rRNA gene in DNA barcoding of amphibians. Frontiers in Zoology, 2, 1–12. http://dx.doi.org/10.1186/1742-9994-2-5 Wilkinson, J.A., Matsui, M. & Terachi, T. (1996) Geographic variation in a Japanese tree frog (Rhacophorus arboreus) revealed by PCR-aided restriction site analysis of mtDNA. Journal of Herpetology, 30, 418–423. http://dx.doi.org/10.2307/1565184 Xavier, A. & Napoli, M.F. (2011) Contribution of environmental variables to anuran community structure in the Caatinga Domain of Brazil. Phyllomedusa, 10, 45–64.

APPENDIX 1. Genbank accession numbers of 12S/16S; cyt b; Rag-1; Rhodopsin of Terrarana and outgroup taxons included in gene-rich analises of this study. MZUSP=Museu de Zoologia da Universidade de São Paulo. *Different species to represent the genus as a terminal taxon. Acris crepitans: EF566970, AY843782, EF107304, AY844533; Adelophryne gutturosa: EU186679, GQ345201, GQ345280, GQ345302; Allophryne ruthveni, AY843564, AY843786, -, AY844538; Batrachyla*, AY843572 (B. leptopus), AY843794 (B. leptopus), AY948936 (B. taeniata), AY844546 (B. leptopus); Brachycephalus ephippium: AY326008, GQ345195, GQ345275, DQ283808; Calyptocephalella gay: DQ283439, -, EF107334, DQ284036; Ceratophrys*: AY326013 (C. ornata), AY843797 (C. cranwelli), AY364218 (C. ornata), AY364399 (C. ornata); Ceuthomantis smaragdinus A, EU186677, GQ345208, -, GQ345306; Ceuthomantis smaragdinus W1, GQ345132, GQ345206, -, GQ345305; Craugastor*: EF493360 (C. podiciferus), GQ345197 (C. podiciferus), GQ345277 (C. podiciferus), DQ283960 (C. rhodopis); Dendrobates auratus: AY364565, DQ502491, AY364214, AY364395; Diasporus diastema: EU186682, GQ345200, GQ345279, - ; Duttaphrynus melanostictus: AY458592, AY458592, AY364197, AF249097; Eleutherodactylus*: EF493539 (E. cooki), GQ345199 (E. cooki), EF107341 (E. coqui), DQ283937 (E. planirostris); Epipedobates*: AY364577 (E. tricolor), DQ502584 (E. anthonyi), EF107295 (E. tricolor), DQ283768 (E. boulengeri); Espadarana prosoblepon: AY843574, AY843796, AY364223, AY844548; Flectonotus*: AY843589 (F. sp, CFBH 5720), AY843809 (F. sp, CFBH 5720), DQ679274 (F. fitzgeraldi), AY844562 (F. sp, CFBH 5720); Haddadus binotatus: EF493361, GQ345198, GQ345278, DQ283807; Haddadus aramunha: MZUSP138687: JQ182718/ JQ182714, JQ182710, JQ182706, JQ182722; MZUSP138689: JQ182719/JQ182715, JQ182711, JQ182707, JQ182723; MZUSP138691: JQ182720/JQ182716, JQ182712, JQ182708, JQ182724; MZUSP138692: JQ182721/JQ182717, JQ182713, JQ182709, JQ182725; Hemiphractus*: DQ679263 (H. bubalus)/AY843594 (H. helioi), AY843813 (H. helioi), DQ679303 (H. bubalus), AY844566 (H. helioi); Hyla arenicolor: EF566960, AY843824, AY364220, AY844577; Hylodes*: DQ502171(H. phyllodes), DQ502606 (H. phyllodes), GQ345289 (H. nasus), DQ503253 (H. phyllodes); Hypodactylus: EF493357 (H. brunneus), GQ345203 (H. brunneus), GQ345282 (H. brunneus), GQ345304 (H. dolops); Ischnocnema*: EF493533 (I. guentheri), GQ345196 (I. guentheri), GQ345276 (I. guentheri), DQ283809 (I. juipoca); Lepidobatrachus laevis: DQ283152, , EF107298, DQ283851; Leptodactylus*: AY843688 (L. ocellatus), AY843934 (L. ocellatus), AY364224(L. melanonotus), AY844681 (L. ocellatus); Litoria caerulea: AY326038 , AY843938 , AY948926 , AY844685; Lymnodynastes*: AY326071 (L. salmini), GQ345209 (L. tasmaniensis), AY364219 (L. salmini), DQ283954 (L. depressus); Mannophryne/Allobates*: DQ502131 (M. trinitatis), DQ502654 (A. femoralis), GQ345274 (M. trinitatis), DQ503236 (M. trinitatis); Melanophryniscus*: AY325999 (M. stelzneri), DQ502444 (M. klappenbachi), AY948927 (M. stelzneri), DQ283765 (M. klappenbachi); Myobatrachidae*: DQ283221 (Uperoleia laevigata) AY84, 3988 (Pseudophryne bibronii), -, DQ283955 (Myobatrachus gouldii); Odontophrynus*: AY843704 (O. americanus), AY843949 (O. americanus), AY948934 (O. occidentalis), AY844695 (O. americanus); Oreobates quixensis: AY819344/DQ679380, EU368889, -, -; Phrynopus bracki: EF493709, GQ345202, GQ345281, GQ345303; Phyllomedusa hypochondrialis: AY843724, AY843969, AY948929, AY844711; Physalaemus*: AY843729 (P. cuvieri), AY843975 (P. cuvieri), EF107299 (Engystomops pustulosus), AY844717 (P. cuvieri); Pleurodema*: AY843733 (P. brachyops), AY843979 (P. brachyops), AY948932 (P. sp, VUB1030), AY844721 (P. brachyops); Pristimantis*: EF493697 (P. cruentus), EU368884 (P. fenestratus), AY948935 (P. cruentus), -; Psychrophynella*: EU186696 (P. wettsteini), GQ345205 (P. usurpator), GQ345284 (P. wettsteini), -; Rana temporaria: AY326063, AY522428, DQ347231, AF249119; Rhinella arenarum: AY843573, AY843795, DQ158354, AY844547; Rhinoderma darwinii: DQ283324, DQ502589,


AMARO ET AL.

AY364222, DQ283963; Stefania*: DQ679266/DQ679417 (S. ginesi), AY844013 (S. schuberti), DQ679308 (S. ginesi), AY844756 (S. schuberti); Strabomantis biporcatus: EU186691, GQ345204, GQ345283, -; Strabomantis bufoniformis: DQ283165, -, -, -; Telmatobius*: DQ283040 (T. jahuira), DQ502448 (T. jahuira), DQ347275 (T. sp, FB2006), AY844757 (T. sibiricus); Thoropa*, DQ283331 (T. miliaris), DQ502607 (T. miliaris), GQ345288 (T. taophora), GQ345307 (T. taophora); Trachycephalus venulosus: AY326048, EU034077, AY364215, AY844707.

APPENDIX 2. List of terminals and accession numbers of sequences from Genbank (12S–Tval–16S) included in species-rich analyses. *Different individuals to represent the species as a terminal taxon. Outgroup. Agalychnis callidryas AY819412; Epipedobates boulengeri AY364572; Epipedobates tricolor AY364576; Flectonotus fitzgeraldi AY819355; Flectonotus sp. AY843589; Lithobates catesbeianus X12841; Litoria caerulea AY326038; Rana catesbeiana X12841; Rhinella arenarum AY843573; Rhinella margaritifera AY819331, AF375514; Uperoleia laevigata DQ283221. Ingroup. Adelophryne baturitensis JX267388, JX267290, JX267465; Adelophryne gutturosa EU186679; Barycholos pulcher EU186727, EU186709; Barycholos ternetzi JX267466, DQ283094; Brachycephalus cf. didactylus JX267389, JX267467; Brachycephalus ephippium AF375484; Bryophryne cophites EF493537; Ceuthomantis smaragdinus GQ345133, GQ345252; Craugastor alfredi DQ283318; Craugastor andi EU186687; Craugastor angelicus EU186681; Craugastor augusti AY326011, DQ283271; Craugastor bocourti EF493713; Craugastor crassidigitus EU186733, EU186715; Craugastor daryi EF493531; Craugastor emcelae EU186738, EU186720; Craugastor fitzingeri AY326001; Craugastor laticeps EU186731, EU186713; Craugastor lineatus EU186732, EU186714; Craugastor loki EU186685; Craugastor longirostris EF493395; Craugastor megacephalus EU186688, FJ766662; Craugastor melanostictus EU186683; Craugastor mexicanus AY326006; Crugastor noblei FJ784513, FJ784367; Craugastor obesus EU186719, EU186737; Craugastor podiciferus EF493360; Craugastor punctariolus DQ283168; Craugastor pygmaeus EF493711; Craugastor rhodopis DQ283317; Craugastor rugulosus EU186680; Craugastor rupinius EU186669; Craugastor sandersoni EF493712; Craugastor sartori EF493530; Craugastor spatulatus EU186674; Craugastor stejnegerianus EF562325, EF562360; Craugastor stuarti EU186684; Craugastor tabasarae FJ784512, FJ784342; Craugastor talamancae FJ784506, FJ784462; Craugastor tarahumaraensis EU186702; Craugastor uno EU186673; Diasporus diastema EU186682; Diasporus quidditus FJ784405, FJ784326; “Eleutherodactylus” bilineatus JX267323, JX267393, JX267324; Eleutherodactylus abbotti EF493540; Eleutherodactylus albipes EF493386; Eleutherodactylus alcoae EF493382; Eleutherodactylus bothroboans EU186655; Eleutherodactylus caribe EF493385; Eleutherodactylus cf. varleyi EF493345; Eleutherodactylus chlorophenax EF493543, EF493589; Eleutherodactylus cooki EF493539; Eleutherodactylus coqui EF493550, EF493722, GQ345176; Eleutherodactylus counouspeus EF493719; Eleutherodactylus eileenae FJ527416, GQ426533, EF493577; Eleutherodactylus glamyrus EF493737, EF493575; Eleutherodactylus glanduliferoides EF493546, EF493364; Eleutherodactylus glaphycompus EF493383; Eleutherodactylus gossei EF493716; Eleutherodactylus griphus EF493381; Eleutherodactylus inoptatus EF493380; Eleutherodactylus jaumei EU186672; Eleutherodactylus klinikowskii EF493547, EF493363; Eleutherodactylus lamprotes EF493379; Eleutherodactylus leberi EF493342; Eleutherodactylus lentus EF493717; Eleutherodactylus luteolus EF493545; Eleutherodactylus mariposa FJ527414, GQ426531; Eleutherodactylus martinicensis EF493343; Eleutherodactylus planirostris DQ283107, DQ283108, EF493346,; Eleutherodactylus principalis FJ527380; Eleutherodactylus richmondi EF493541; Eleutherodactylus riparius Y10944; Eleutherodactylus schmidti EU186653; Eleutherodactylus sommeri EU186654; Eleutherodactylus thorectes EF493384; Eleutherodactylus unicolor EF493542; Eleutherodactylus wetmorei EU186652; Eleutherodactylus wightmanae EU186651; Eleutherodactylus zeus EF493718; Eleutherodactylus zugi EF493347; Euparkerella brasiliensis JX267390, JX267468; Hadadus aramunha KF740844, KF740845; Haddadus binotatus DQ283092, EF493361, JX267346, JX267357, JX267469, KF740846, KF740847, KF740848; Holoaden bradei EF493378, EF493366; Holoaden luederwaldti* EU186728, EU186710, JX267470; Hypodactylus brunneus EF493357; Hypodactylus dolops EF493394; Hypodactylus elassodiscus EF493358, EU368906; Hypodactylus peraccai EF493710; Ischnocnema abdita JX267325, JX267471, JX267326, JX267472; Ischnocnema aff. holti JX267473, JX267337, JX267474, JX267336, JX267475; Ischnocnema bolbodactyla JX267327, JX267476; Ischnocnema cf. henselii JX267293, JX267295, JX267328, JX267478, JX267294; Ischnocnema cf. holti JX267329, JX267479, JX267330, JX267480; Ischnocnema cf. manezinho JX267335, JX267481; Ischnocnema cf. nigriventris JX267396, JX267359; Ischnocnema erythromera JX267340, JX267341; Ischnocnema guentheri JX267339, JX267494, JX267354, JX267495, JX267302, JX267303, JX267304, JX267416, JX267367, JX267417, JX267368, JX267418; Ischnocnema hoehnei JX267347; Ischnocnema holti JX267333, JX267508, JX267509, JX267306; Ischnocnema izecksohni JX267307, JX267426, JX267510; Ischnocnema juipoca JX267349, JX267348, JX267373, JX267511, JX267512, JX267513; Ischnocnema manezinho JX267481, JX267335; Ischnocnema nasuta JX267311; Ischnocnema oea JX267338, JX267313; Ischnocnema parva EF493532, JX267314, JX267315, JX267522, JX267316, JX267317, JX267435, JX267376, JX267436, JX267377, JX267437, JX267378, JX267438, JX267379; Ischnocnema venancioi JX267321, JX267454, JX267382; Ischnocnema verrucosa JX267383; Ischnocnema vizottoi JX267458, JX267352, JX267350; Lynchius flavomaculatus EU186667; Lynchius nebulanastes EU186704; Lynchius parkeri EU186705; Noblella lochites EU186699; Noblella sp. AM039714, AM039646; Oreobates choristolemma EU368895, JF809921, FJ539072, FJ539067; Oreobates cruralis EU186666, FJ438815, FJ438795, EU192295; Oreobates discoidalis FJ539073, EU368896; Oreobates granulosus FJ539074,



581

EU368897; Oreobates heterodactylus EU192296, EU368898, FJ438805, FJ438816; Oreobates ibischi FJ438817, FJ438806; Oreobates lehri FJ539069; Oreobates madidi FJ539070, FJ539075; Oreobates quixensis EF493662, EF493828; Oreobates sanctaecrucis EU368903; Oreobates sanderi EU368904; Oreobates saxatilis EU186726, EU186708; Phrynopus barthlenae AM039722, AM039721, AM039717, AM039653, AM039649, AM039654; Phrynopus bracki AY964084; Phrynopus bufoides AM039713, AM039645; Phrynopus carpish AM039702, AM039634; Phrynopus heimorum AM039704, AM039703, AM039635, AM039636; Phrynopus horstpauli AM039719, AM039715, AM039651, AM039647; Phrynopus juninensis AM039728, AM039725, AM039657, AM039660; Phrynopus kauneorum AM039718, AM039723, AM039655, AM039650; Phrynopus pesantesi AM039724, AM039656; Phrynopus simonsii AM039709; Phrynopus tautzorum AM039652; Phyzelaphryne miriamae EU186689; Pristimantis acerus EF493678; Pristimantis actites EF493696; Pristimantis altamazonicus EF493670; Pristimantis aniptopalmatus EF493390; Pristimantis appendiculatus EF493524; Pristimantis ardalonychus EU186664; Pristimantis bipunctatus EF493702; Pristimantis bromeliaceus EF493351; Pristimantis buckleyi EF493350; Pristimantis calcaratus JN104658; Pristimantis caprifer EF493391; Pristimantis caryophyllaceus EU186686; Pristimantis celator EF493685; Pristimantis ceuthospilus EF493520; Pristimantis cf. fenestratus JX267392, JX267540; Pristimantis cf. paulodutrai JX267296, JX267297, JX267399, JX267360; Pristimantis cf. ramagii JX267400, JX267484, JX267299, JX267300; Pristimantis cf. vinhai JX267301, JX267343, JX267362, JX267363, JX267408, JX267364, JX267409, JX267353, JX267410, JX267365, JX267411, JX267491, JX267412, JX267492; Pristimantis chalceus EF493675; Pristimantis chloronotus AY326007; Pristimantis citriogaster EF493700; Pristimantis colomai EF493354; Pristimantis condor EF493701; Pristimantis conspicillatus EF493529; Pristimantis cremnobates EF493528 Pristimantis cruentus EF493697; Pristimantis cryophilius EF493672; Pristimantis curtipes EF493513; Pristimantis devillei EF493688; Pristimantis diadematus EU186668; Pristimantis dissimulatus EF493522; Pristimantis duellmani AY326003; Pristimantis eriphus EU186671; Pristimantis euphronides EF493527; Pristimantis fenestratus EF493703; Pristimantis galdi EU186670; Pristimantis gentryi EF493511; Pristimantis glandulosus EF493676; Pristimantis inguinalis EU186676; Pristimantis inusitatus EF493677; Pristimantis labiosus EF493694; Pristimantis lanthanites EF493695; Pristimantis latidiscus EF493698; Pristimantis leoni EF493684; Pristimantis lirellus EF493521; Pristimantis luteolateralis EF493517; Pristimantis lymani EF493392; Pristimantis malkini EU186663; Pristimantis marmoratus EU186692; Pristimantis nyctophylax EF493526; Pristimantis ockendeni EF493519; Pristimantis ocreatus EF493682; Pristimantis orcesi EF493679; Pristimantis orestes EF493388; Pristimantis parvillus EF493352; Pristimantis peruvianus EF493707; Pristimantis phoxocephalus EF493349; Pristimantis pluvicanorus AY843586; Pristimantis prolatus EU186701; Pristimantis pycnodemis EF493680; Pristimantis pyrrhomerus EF493683; Pristimantis quinquagesimus EF493690; Pristimantis ramagii JX267318, JX267319, JX267447, JX267380; Pristimantis rhabdolaemus EF493706; Pristimantis rhodoplichus EF493674; Pristimantis ridens EF493355; Pristimantis riveti EF493348; Pristimantis rozei EF493691; Pristimantis sagittulus AY964073; Pristimantis schultei EF493681; Pristimantis shrevei EF493692; Pristimantis simonbolivari EF493671; Pristimantis simonsii EU186665; Pristimantis skydmainos EF493393; Pristimantis spinosus EF493673; Pristimantis stictogaster EF493704; Pristimantis subsigillatus EF493525; Pristimantis supernatis AY326005; Pristimantis terraebolivaris EU186650; Pristimantis thymalopsoides EF493514; Pristimantis thymelensis EF493516; Pristimantis toftae EF493353; Pristimantis trepidotus EF493515; Pristimantis truebae EF493512; Pristimantis unistrigatus EF493387; Pristimantis urichi EF493699; Pristimantis verecundus EF493686; Pristimantis versicolor EF493389; Pristimantis vertebralis EF493689; Pristimantis walkeri EF493518; Pristimantis w-nigrum AY326004; Pristimantis zectotylus EF376052, EF376082; Psychrophrynella iatamasi AM039712, AM039644; Psychrophrynella wettsteini EU186696; Strabomantis anomalus EF493534; Strabomantis biporcatus EU186691; Strabomantis bufoniformis DQ283165, FJ784451, FJ784410; Strabomantis necerus EF493535; Strabomantis sulcatus EF493536; Yunganastes fraudator FJ539065; Yunganastes mercedesae FJ539071.


AMARO ET AL.