Journal of Applied Microbiology 2005, 99, 758–766
doi:10.1111/j.1365-2672.2005.02680.x
A multiplex polymerase chain reaction to detect and differentiate Campylobacter fetus subspecies fetus and Campylobacter fetus -species venerealis: use on UK isolates of C. fetus and other Campylobacter spp. K. Willoughby1, P.F. Nettleton1, M. Quirie1, M.A. Maley1, G. Foster2, M. Toszeghy3 and D.G. Newell3 1
Moredun Research Institute, Bush Loan, Penicuik, Midlothian, UK, 2SAC Veterinary Services, Drummondhill, Stratherrick Road, Inverness, UK, and 3Veterinary Laboratories Agency (Weybridge), New Haw, UK
2004/1281: received 8 November 2004, revised 22 April 2005 and accepted 6 May 2005
ABSTRACT K. WILLOUGHBY, P.F. NETTLETON, M. QUIRIE, M.A. MALEY, G. FOSTER, M. TOSZEGHY AND D . G . N E W E L L . 2005.
Aims: Subspeciation of Campylobacter fetus subsp. fetus (CFF) and Campylobacter fetus subsp. venerealis (CFV) is important for international animal import regulations. Phenotyping can be unreliable, and genotyping by techniques like pulsed field gel electrophoresis is difficult in routine diagnostic laboratories. A PCR subspeciation technique has been reported [Aust Vet J (1997) 75, 827]; we aimed to develop this PCR and investigate its use on UK C. fetus isolates. Methods and Results: We augmented the PCR with further primers, and tested 76 isolates of C. fetus and 16 isolates of other Campylobacter spp. PCR failed to correlate well with phenotyping, especially for CFV. We characterized the amplicon of the CFV-specific primers (reported as plasmid derived, but unavailable on the public databases); and predicted a parA gene sequence, anticipated to be plasmid-associated. However, although plasmid isolations from selected CFV isolates demonstrated the presence of several plasmids, there was no correlation between plasmid profile and PCR result. Further, the parA sequence was not detected by PCR in any of the plasmid bands. Conclusions: This PCR is not suitable for subspeciation of C. fetus in the UK. The results suggest that this is a reflection of the presence of an unusual clone of CFV currently present in cattle in this country. Significance and Impact of the Study: PCR cannot substitute for phenotyping of C. fetus isolates in the UK. The reasons for failure of PCR genotyping may reflect local strains and/or plasmid profiles. Further study is required to better elucidate molecular sub-speciation of C. fetus. Keywords: Campylobacter, fetus, PCR, plasmid, UK, venerealis.
INTRODUCTION Campylobacter fetus is an important veterinary pathogen, which has been subdivided into two subspecies; C. fetus subsp. fetus (CFF) and C. fetus subsp. venerealis (CFV). In Correspondence to: Kim Willoughby, Virus Surveillance Unit, Moredun Research Institute, Bush Loan, Penicuik, Midlothian, EH26 0PZ, UK (e-mail:
[email protected]).
classical clinical descriptions (Skirrow 1994; Caldow and Taylor 1997), CFV is isolated from the bovine reproductive tract of both sexes and causes infertility, while in contrast, infection with CFF causes sporadic abortion in both cattle and sheep and is not restricted to the reproductive tract, also being capable of colonizing the intestine. Human infection is rare, but may occur with CFF, or, very rarely, with CFV; disease with either subspecies is usually reported in immunocompromised individuals. For veterinary purposes ª 2005 The Society for Applied Microbiology
C. FETUS SUBSP. DIFFERENTIAL MPCR
discrimination between these subspecies is essential as CFVassociated infection is subject to international import regulations (Vallat and Edwards 2004; Wagenaar and van Bergen 2004). The two organisms are very closely related and phenotyping usually relies upon a single biochemical test; CFF can grow in 1% glycine and CFV cannot (Smibert 1984; Prescott 1990; Wagenaar and van Bergen 2004). However, this characteristic can be variable, and it is possible for CFV to develop resistance to glycine (Chang and Ogg 1971). Additionally, CFF can produce disease clinically similar to CFV, given suitable conditions (Schurig et al. 1973; MacLaren and Agumbah 1988), so clinical history may not be helpful. Previous studies have investigated the use of PCR, pulsed field gel electrophoresis (PFGE) and amplified fragment length polymorphism (AFLP) typing for subspeciation. Such studies demonstrated good correlation among PCR genotyping, PFGE and AFLP (On and Harrington 2001; Wagenaar et al. 2001; Vargas et al. 2003). However, the previously reported PCR relies upon the absence of an amplicon specific for CFV to subspeciate an isolate as CFF (Hum et al. 1997; On and Harrington 2001; Wagenaar et al. 2001; Muller et al. 2003). In the study reported here, we have added a primer pair previously reported to be specific for CFF in an effort to give a positive identification of CFF, and a further primer pair directed at the 23S sequence of Campylobacteriaceae, and other closely related species, to act as a positive internal control (Wang et al. 2002). The aim of this study was to validate this multiplex PCR on culture collection and veterinary field isolates of CFF and CFV in order to assess its usefulness for subspeciation of C. fetus isolates and its performance on clinical material.
MATERIALS AND METHODS Bacterial isolates Ninety-two bacterial isolates were obtained from either culture collections or clinical material. Isolate details are given in Tables 1 and 2. There were 44 isolates which had been characterized as CFF, 32 isolates characterized as CFV and 16 isolates which were classified as other Campylobacter species using standard phenotyping methods. Bacterial culture details Isolates were cultured on columbia agar base (Oxoid) supplemented with 5% of citrated sheep blood under microaerobic conditions (Oxoid CampyGenTM) for 48–72 h at 37C. Isolates were stored at )70C by suspending growth from columbia blood agar in nutrient broth No. 2 (Oxoid) supplemented with agar (0Æ15% w/v), glycerol (15% v/v) and Campylobacter growth supplement (Oxoid, 0Æ8% v/v).
759
DNA isolation DNA was isolated from a sweep (taken using a disposable loop) of colonies grown on culture plates as above. Genomic DNA was extracted using a proprietary kit (DNeasy, Qiagen, Crawley, UK), following suspension of the sweep in 180 ll of buffer ATL, as per the manufacturer’s protocol for Gram negative bacterial DNA extraction. DNA was eluted in 100 ll of buffer AE1 and stored at )20C until use. Plasmid isolation Plasmids were isolated from six UK CFV isolates using a proprietary kit [Plasmid mini kit (tip 20), Qiagen]; a colony sweep was resuspended in 300 ll of buffer P1 and processed exactly as per the manufacturer’s protocol. Gel purification of individual plasmid bands Plasmid bands were excised individually from a 0Æ75% agarose/TAE/ethidium bromide gel and DNA extracted using a QIAEX II gel extraction kit (Qiagen) as per the manufacturers protocol. PCR protocol Four primer pairs were used in a multiplex PCR (mPCR). Details of the primers used, target genes, amplicon sizes and previous citations are given in Table 3. One discrepancy of note is in the primer pair MG3F + MG4R; these were originally reported as generating an amplicon for both subspecies of 960 bp in size (Hum et al. 1997; On and Harrington 2001), but the amplicon has been more recently reported and sequenced as 750 bp (Wagenaar et al. 2001; Muller et al. 2003). All oligonucleotide primers were produced by MWG Biotech AG (Ebersberg, Germany). The mPCR was optimized in a proprietary multiplex reaction mix (Qiagen multiplex PCR kit). Primer concentrations, effect of PCR improver Q-solution (Qiagen), annealing and extension temperatures were individually optimized as per the method of Henegariu et al. (1997). The final mPCR comprised 0Æ2 lmol l)1 of primers MG3F, MG4R, 23SF, 23SR, CFF, CFV, 0Æ4 lmol l)1 primers VenSF and VenSR and 0Æ5X Q-solution (Qiagen) in 1X multiplex mix (Qiagen). The cycling parameters were one cycle of 95C for 15 min, 35 cycles of 95C for 30 s, 54C for 90 s and 72C for 90 s before a final cycle of 72C for 10 min. Samples were held at 4C prior to analysis. PCR reactions were analysed by electrophoresis of 5 ll PCR product through a 1Æ8% agarose gel in 1X TAE buffer (Sambrook et al. 1989) and visualized by staining with ethidium bromide and ultraviolet transillumination.
ª 2005 The Society for Applied Microbiology, Journal of Applied Microbiology, 99, 758–766, doi:10.1111/j.1365-2672.2005.02680.x
760 K . W I L L O U G H B Y ET AL.
Table 1 Sources and subspecies of C. fetus isolates, showing phenotyping and PCR genotyping results
Source
Clinical origin
Phenotype
MG3F/4R 750 bp
23SF/R 650 bp
CFF/R 435 bp
VenSF/R 142 bp
PCR genotype
*NCTC 10842 *NCTC 5850 C106751/100342 (Perth) C106751/200156 (Perth) C106751/300392 (Perth) C106751/300309 (Perth) C106751/300393 (Perth) C106751/500297 (Perth) C106751/700376 (Perth) C516/97/1 (Inverness) C340/98/1 (Inverness) C701413/00/1 (Inverness) C604133/01/1 (Inverness) C604683/01/1 (Inverness) C610005/03/1 (Inverness) C610598/03/1 (Inverness) C610601/03/1 (Inverness) S115/96/1 (Inverness) S315/97/1 (Inverness) S389/97/1 (Inverness) S184/98/1 (Inverness) S203/98/1 (Inverness) S60086/99/1 (Inverness) S60106/99/1 (Inverness) S60115/99/1 (Inverness) S600953/00/1 (Inverness) S601571/01/1 (Inverness) S602577/03/1 (Inverness) M605961/03 (Inverness) S600918/00/1 (Inverness) C107242/18 (Perth) C107242/19 (Perth) C107242//33 (Perth) C107242//35 (Perth) C107242//36 (Perth) C107290 (Perth) C107364B (Perth) C20458/11/85 (Aberdeen) M606077/03/1 (Inverness) S103186:1 (Perth) S103186:2 (Perth) S103209/599 (Perth) S103209/600 (Perth) C320785/2 (Auchincruive) *NCTC 10354 *NCTC 12476 29/20-12 (Winchester) 29/C65/10/03 (Aberystwyth) *CCUG 7477 *CCUG 11287 *CCUG 24260 *CCUG 33871 *CCUG 33872
Ovine, fetus brain Ovine abortion Bovine Bovine Bovine Bovine Bovine Bovine Bovine Bovine, abortion Bovine, abortion Bovine, preputial washing Bovine, preputial washing Bovine, abortion Bovine, abortion Bovine, abortion Bovine, preputial washing Ovine, abortion Ovine, abortion Ovine, abortion Ovine, abortion Ovine, abortion Ovine, abortion Ovine, abortion Ovine, abortion Ovine, abortion Ovine, abortion Ovine, abortion Kangaroo, small intestine Ovine, abortion Bovine, vaginal mucus Bovine, vaginal mucus Bovine, vaginal mucus Bovine, vaginal mucus Bovine, vaginal mucus Bovine, abortion Bovine, vaginal mucus Bovine Equine, faeces Ovine, abortion Ovine, abortion Ovine, abortion Ovine, abortion Bovine Bovine, vaginal mucus unknown, 1980 Bovine, abortion Bovine, abortion Bovine, abortion Human, blood Bovine Unknown Unknown
fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus venerealis venerealis venerealis venerealis venerealis venerealis venerealis venerealis venerealis
+ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ + ) ) ) ) ) ) ) ) ) ) + ) + ) + ) ) ) ) ) ) ) ) ) ) + + + ) ) ) ) ) ) ) + + + + ) ) ) ) ) + + ) ) ) ) )
) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) + + ) ) + + + ) +
fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus venerealis venerealis fetus fetus venerealis venerealis venerealis fetus venerealis
ª 2005 The Society for Applied Microbiology, Journal of Applied Microbiology, 99, 758–766, doi:10.1111/j.1365-2672.2005.02680.x
C. FETUS SUBSP. DIFFERENTIAL MPCR
761
Table 1 Continued
Source
Clinical origin
Phenotype
MG3F/4R 750 bp
23SF/R 650 bp
CFF/R 435 bp
VenSF/R 142 bp
PCR genotype
*CCUG 33901 *CCUG 33902 *CCUG 34111 *CCUG 34335 *CCUG 35156 BT 12/98 (VLA) BT 13/98 (VLA) BT 14/98 (VLA) BT 36/98 (VLA) BT 37/98 (VLA) BT 59/98 (VLA) BT 60/98 (VLA) BT 21/00 (VLA) BT 22/00 (VLA) BT 27/00 (VLA) BT 28/00 (VLA) BT 102/00 (VLA) BT 77/01 (VLA) BT 23/02 (VLA) BT 48/02 (VLA) BT 113/02 (VLA)§ BT 114/02 (VLA)§ BT 212/02 (VLA)
Unknown Bovine, prepuce Bovine, abortion unknown Bovine, abortion Bovine, abortion Bovine, abortion Bovine, abortion Bovine, abortion Bovine, abortion Bovine, abortion Bovine, abortion Bovine, vaginal mucus Bovine, vaginal mucus Bovine, vaginal mucus Bovine, vaginal mucus Bovine, abortion Bovine, abortion Bovine, abortion Bovine Bovine Bovine Bovine, abortion
venerealis venerealis venerealis venerealis venerealis venerealis venerealis venerealis venerealis venerealis venerealis venerealis venerealis venerealis venerealis venerealis venerealis venerealis venerealis venerealis venerealis venerealis venerealis
+ + + + + + + + + + + + + + + + + + + + + + +
+ + + + + + + + + + + + + + + + + + + + + + +
) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) )
+ + + + + ) ) ) ) ) ) ) ) ) ) ) + ) ) ) + + )
venerealis venerealis venerealis venerealis venerealis fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus fetus venerealis fetus fetus fetus venerealis venerealis fetus
*Culture collection strains; NCTC, national collection of type cultures; UK, CCUG, culture collection of the university of Go¨teborg, Sweden. Has been previously genotyped by PCR and AFLP (Wagenaar et al. 2001). This is the same isolate from the original (Aberystwyth) and the typing (Winchester) laboratories. §From same herd.
Cloning and sequencing of PCR product The 142 bp amplicon of the primers VenSF and VenSR was cloned into plasmid pCR4-TOPO (Invitrogen, Paisley, UK) and transformed into One ShotTOP10 chemically competent Escherichia coli (Invitrogen). Recombinant colonies were selected by ampicillin resistance using standard methods (Sambrook et al. 1989). Minipreps were prepared using a Wizard SV kit (Promega, Southampton, UK). Sequencing was performed using Big Dye terminator v1 and 1.1 (Applied Biosystems, Warrington, UK) on a Perkin Elmer Biosystems 377 DNA sequencer. RESULTS A representative analytical agarose gel is shown in Fig. 1. Results of the PCR genotyping investigations are summarized in Tables 1 and 2. Of the 44 CFF isolates, both the isolates supplied from culture collections gave the anticipated three amplicons, at 750 bp (MG3F + 4R), 650 bp (23SF + 23SR) and 435 bp (CFF + CFR). Of the 42 clinical isolates, all genotyped as C. fetus, based on the presence of amplicons from
MG3F + 4R and 23SF + 23SR, but only 10 produced an amplicon for the CFF-specific primer pair (CFF + CFR). In none of the 44 isolates was an amplicon from the VenSF + VenSR (CFV-specific) primer pair detected. Thirty-two CFV isolates were investigated: 12 from culture collections and 20 field isolates. Eleven of the 12 culture collection isolates gave the anticipated three amplicons at 750 bp (MG3F + 4R), 650 bp (23SF + 23SR) and 142 bp (VenSF + VenSR); the remaining culture collection isolate gave the two larger amplicons but not the CFVspecific one. All field isolates were genotyped as C. fetus, based on the presence of an amplicon for the MG3F + MG4R primer pair. However, the presence of an amplicon for the CFV-specific primer pair was detected in only three of these 19 isolates. In two isolates, 29/20-12 and 29/C65/10/03, an amplicon for the CFF-specific primer pair (CFF + CFR) was detected; these isolates had had the same clinical origin but were supplied by both the original laboratory and the reference typing laboratory. For the 16 isolates supplied as representatives of other Campylobacters, an amplicon was detected with the Campylobacter/Helicobacter/Arcobacter primer pair, 23SF + 23SR, but for none of the other primer pairs.
ª 2005 The Society for Applied Microbiology, Journal of Applied Microbiology, 99, 758–766, doi:10.1111/j.1365-2672.2005.02680.x
762 K . W I L L O U G H B Y ET AL.
Table 2 Sources and species of other Campylobacter spp. isolates, showing PCR typing results
Source
Species
Isolate identity
MG3F/4R 23SF/R CFF/R VenSF/R PCR 750 bp 650 bp 435 bp 142 bp typing
C1243/96/1 (Inverness)
Bovine
C. jejuni. doylei
)
+
)
)
S602060/02/1 (Inverness)
Ovine
C. jejuni jejuni
)
+
)
)
M603416/00/1 (Inverness) Canine
C. upsaliensis
)
+
)
)
S602625/03/1 (Inverness)
Ovine
C. coli
)
+
)
)
S602765/03/2 (Inverness)
Ovine
C. coli
)
+
)
)
C602837/02/3 (Inverness)
Bovine
C. sputorum bubulus
)
+
)
)
M1837/96/1 (Inverness)
Lapine
Campylobacter spp.
)
+
)
)
Campylobacter spp.
)
+
)
)
Campylobacter spp.
)
+
)
)
Campylobacter spp.
)
+
)
)
Campylobacter spp.
)
+
)
)
Campylobacter jejuni. )
+
)
)
M203/00/3 (Inverness)
Phocine (common Seal) M64/01/3 (Inverness) Delphine (Risso’s dolphin) M60361/99/1 (Inverness) Cervine (Roe deer) M600909/99/1 (Inverness) Sciurine (red Squirrel) M60403/99/2 (Inverness) Cervine (Roe deer) C608237/02/2 (Inverness) Bovine
C. sputorum bubulus
)
+
)
)
C409827 (Dumfries)
Bovine
Campylobacter spp.
)
+
)
)
C107364A (Perth)
Bovine
C. sputorum bubulus
)
+
)
)
S600944/00/1 (Inverness)
Ovine
C. jejuni
)
+
)
)
Campylo/helico/arcobacter, not C. fetus Campylo/helico/arcobacter, not C. fetus Campylo/helico/arcobacter, not C. fetus Campylo/helico/arcobacter, not C. fetus Campylo/helico/arcobacter, not C. fetus Campylo/helico/arcobacter, not C. fetus Campylo/helico/arcobacter, not C. fetus Campylo/helico/arcobacter, not C. fetus Campylo/helico/arcobacter, not C. fetus Campylo/helico/arcobacter, not C. fetus Campylo/helico/arcobacter, not C. fetus Campylo/helico/arcobacter, not C. fetus Campylo/helico/arcobacter, not C. fetus Campylo/helico/arcobacter, not C. fetus Campylo/helico/arcobacter, not C. fetus Campylo/helico/arcobacter, not C. fetus
Table 3 Primer sequences, target genes and species detected Primer
Sequence (5¢–3¢)
Target gene
Amplicon size (bp)
Species detected
MG3F* MG4R* VenSF* VenSR* CFF CFR 23SF
ggtagccgcagctgctaagat tagctacaataacgacaact cttagcagtttgcgatattgccatt gcttttgagataacaataagagctt gcaaatataaatgtaagcggagag tgcagcggccccacctat tataccggtaaggagtgctggag
Carbon starvation protein gene
750
C. fetus (both subspecies)
Unknown plasmid
142
C. fetus venerealis
CFF sapB2
435
C. fetus fetus
23S RNA
650
Campylobacter, Arcobacter and Helicobacter spp.
23SR
atcaattaaccttcgagcaccg
Primers originally reported by *Hum et al. 1997 and Wang et al. 2000. Reported as a plasmid by Panaccio et al. (1993) but no sequence is available in the public databases.
Sequencing of the cloned amplicon of the VenSF + VenSR primer pair produced a nucleotide sequence 142 bp long with a partial open reading frame of 47 amino acids. The
sequence has been deposited in GenBank and granted the accession number AY750964. It is identical to that previously reported but not made available in the public databases
ª 2005 The Society for Applied Microbiology, Journal of Applied Microbiology, 99, 758–766, doi:10.1111/j.1365-2672.2005.02680.x
C. FETUS SUBSP. DIFFERENTIAL MPCR
M 1
Fig. 1 Agarose gel of amplicons obtained with C. fetus mPCR. Lane M contains 5 ll molecular weight marker Bio/100 (Biogene) with selected sizes indicated. Lanes 1–7 contain amplicons from representative C. fetus fetus clinical isolates. Lane 8 contains amplicons from C. fetus venerealis NCTC 12476; lane 9 contains amplicons from C. fetus fetus strain NCTC 10842 as positive control; lane 10 contains amplicons from C. fetus venerealis strain NCTC 10354 as positive control; lane 11 contains a no template control (water). The amplicon sizes are indicated on the right-hand side of the figure
2
3
4
5
6
7
763
8 9 10 11
3000 bp 2000 bp 1500 bp 1000 bp 800 bp
MG3F + MG4R: 750 bp 23SF + 23SR: 650 bp
600 bp 500 bp 400 bp 300 bp
CFF + CFR: 435 bp
200 bp VenSF + VenSR: 142 bp 100 bp
(Panaccio et al. 1993). Submitting the predicted amino acid sequence to BLAST (NCBI) and WU-BLAST2 (EMBLEBI) demonstrated 55% identity to the ParA protein (plasmid partitioning protein) homologue encoded by Wolinella succinogenes (Baar et al. 2003), 53% identity to Cjp26, a parA homologue on a plasmid (pVir) contained within Campylobacter jejuni (Bacon et al. 2000, 2002) and approximately 30% to a variety of other parA proteins or homologues. This would be consistent with the report that the target sequence for the primers VenSF and VenSR derives from a plasmid (Panaccio et al. 1993). In an attempt to further characterize this putative plasmid target, plasmid isolations were made from six CFV isolates, three of which had given a negative PCR result (BT22/00, BT60/98 and BT28/00), and three of which had given a positive result (BT102/00, BT113/02 and BT114/02) for the VenSF and VenSR primer pairs. On electrophoresis, at least five bands were detected in BT22/00, three in BT113/ 02 and BT114/02, one in BT60/98, two in 28/00 and four in BT102/00 (Fig. 2). Plasmid profiles suggested that between one and at least three plasmids were present. There was no obvious relationship between plasmid profile and the previous PCR result. VenSF and VenSR uniplex PCR generated a product from the plasmid preparation of BT102/00, BT113/ 02 and BT114/02, but no PCR product was detected in BT22/00, BT60/98 or BT28/00. However, when VenSF and VenSR uniplex PCR was performed on individual plasmid bands isolated from an agarose gel, no VenSF + VenSR amplicons were detected, suggesting that the initial result may have been due to carryover of chromosomal DNA. DISCUSSION An mPCR was developed and used to investigate the genotypes of 76 C. fetus strains, provided from veterinary
M
1
2*
3
4
5*
6*
c. 20 kb c. 14 kb 6 kb 2·4 kb
Fig. 2 A quantity of 0Æ75% agarose/TAE/ethidium bromide gel of plasmid isolations from C. fetus spp. Lane M contains 5 ll molecular weight marker Hyperladder I (Bioline), showing fragments of 10 000, 8000, 6000, 5000, 4000, 3000, 2500, 2000, 1500, 1000, 800, 600, 400 and 200 bp. Lanes 1–6 contain plasmid DNA isolated from BT22/00, BT114/02, BT60/98, BT28/00, BT102/00 and BT 113/02, respectively. Isolates (and plasmid preparations) which gave a positive PCR result are shown by *. The isolates in lane 2 and lane 6 are from the same outbreak. The bands at c.20 and c.14 kb may represent relaxed and supercoiled forms of the same plasmid. The bands at 6 and 2Æ4 kb may represent relaxed and supercoiled forms of a second plasmid. In lanes 2, 4, 5 and 6, therefore, at least two plasmids are detected. In lane 3, at least one plasmid is present, while in lane 1 at least three plasmids are present
culture collections or as field isolates, subspeciated by standard phenotypic methods. Previous work has used the primers MG3F, MG4R, VenSF and VenSR in a mPCR, where the presence of an amplicon for MG3F + MG4R is taken to indicate that the organism is C. fetus, while subspeciation relies upon the absence of an amplicon for the
ª 2005 The Society for Applied Microbiology, Journal of Applied Microbiology, 99, 758–766, doi:10.1111/j.1365-2672.2005.02680.x
764 K . W I L L O U G H B Y ET AL.
primer pair VenSF + VenSR for CFF and the presence of that amplicon to subspeciate as CFV (Hum et al. 1997; On and Harrington 2001; Wagenaar et al. 2001; Muller et al. 2003; Vargas et al. 2003). In an effort to provide a positive indicator for CFF, the primer pair CFF + CFR was introduced, as these primers had been shown to amplify CFF and not CFV (Wang et al. 2002). Additionally, primers 23SF and 23SR were included to act as an internal amplification control within the PCR reaction; these primers are previously reported to amplify all Campylobacter (and some closely related) species (Wang et al. 2002). The results of our study indicate that the genotypes and phenotypes of the culture collection isolates, in general, correlated well. However, the same was not true for the field isolates. The failure of the CFF + CFR primers, to produce an amplicon in the majority (74%) of phenotypically identified CFF field isolates, was particularly interesting. These primers were designed from the published sapB2 gene sequence (Casademont et al. 1998; Wang et al. 2002). Both subspecies of C. fetus possess multiple homologous copies (generally up to nine) of the sap genes. These genes have a 3¢ region, which is essential for binding to LPS, and is highly conserved among serotype A strains but differs from that highly conserved among serotype B strains. All CFV strains are serotype A (with sapA genes) while CFF strains can be either serotype A or B (with either sapA or sapB genes). Downstream of this LPS-binding region, the nucleotide sequences of all the sap genes are initially conserved and then become progressively variable towards the 3¢ end. The primers, CFF and CFR, are positioned quite close to the 3¢ end of the gene. Although the 5¢ (forward) primer (CFF) is positioned in a region which is relatively well conserved across all the sapA gene homologues and those sapB homologues published to date, the 3¢ (reverse) primer (CFR) is positioned in a region of the sapB2 gene, which is not in the sap conserved region but remains highly homologous with sapA2. Why these primers were selected is unclear as there is no published evidence that this region of the sap gene is subspecies-specific, and the previous results may reflect the small number of isolates investigated (Wang et al. 2002). Given the high degree of homology (98%) in the sapA2 and sapB2 genes in the 2038 bp region beginning 540 bp after the initiation codon (Casademont et al. 1998), it seems likely that this will be conserved in both CFF and CFV strains. Certainly, by Southern blotting the sap2 genes appear conserved in both serotype A and B strains (Tu et al. 2004). Nevertheless, primers CFF and CFR only produced an expected amplicon in about 25% of the CFF strains tested. Similar results have also been obtained by other laboratories (M. van Bergen, I-D Lelystad, pers. comm.). The most likely explanation is that the genetic diversity in this region of the sap genes of C. fetus precludes primer binding. Such problems may be overcome
by building degeneracy into the primers or by reducing the annealing temperature. However, reduction of the annealing temperature from 54 to 50C also failed to produce an amplicon of the anticipated size (data not shown). An additional explanation is the plasticity of the sap locus (Tu et al. 2003). This plasticity provides the opportunity for homologous recombination to occur among the sap genes and potentially contributes to the antigenic diversity of the S-layer proteins over and above the presence of the eight homologues of the sap genes. Such recombination events might modify or relocate the primer-binding sites for CFF or CFR so that the production of an amplicon is no longer possible. With the failure of the CFF + CFR primer pair, the genotypic identification of CFF isolates was forced to rely on the presence of an amplicon with MG3F + 4R primers, as evidence for C. fetus, and the absence of an amplicon with VenSF + VenSR primers, for subspecies differentiation, as has been previously described (Hum et al. 1997). On this basis, the VenSF + VenSR primers gave no false positives for phenotypically identified CFF isolates; all 44 CFF isolates being PCR genotyped as CFF. However, this approach was less successful for the genotypic subspeciation of phenotypically identified CFV isolates. The combination of primers identified 11 out of the 12 culture collection isolates as CFV, but did not perform well on the field strains, identifying only three out of 19 field isolates as CFV. Interestingly, for the two variants of one isolate (29/20-12 and 29/C65/10/03), the CFF-specific PCR amplicon was detected with primers CFF + CFR, suggesting that the phenotyping of this isolate was erroneous. In fact, this isolate had anomalous phenotypic properties, as identified at the VLA Campylobacter Reference Laboratory, but overall was more consistent with a designation of CFV than CFF. Explanation of the negative results with the remaining CFV strains is more difficult. These strains clearly possessed CFV phenotypic properties yet no amplicon was identified with the VenSF + VenSR primer set either in the multiplex or in a uniplex (data not shown) formats, which is in contrast with previously published reports (On and Harrington 2001; Wagenaar et al. 2001; Muller et al. 2003; Vargas et al. 2003). This primer set apparently detects a plasmid-encoded DNA sequence present in CFV but not CFF (Panaccio et al. 1993), however, the DNA sequence of the PCR product has not previously been available in the public databases. The sequence detected and described here (AY750964) is predicted to have homology with parA, encoding a protein associated with DNA segregation during prokaryote cell division (Draper and Gober 2002). In C. jejuni 81-176 a parA homologue is located on a proposed virulence plasmid (Bacon et al. 2002) though its role in plasmid replication or mainten-
ª 2005 The Society for Applied Microbiology, Journal of Applied Microbiology, 99, 758–766, doi:10.1111/j.1365-2672.2005.02680.x
C. FETUS SUBSP. DIFFERENTIAL MPCR
ance appears to be unclear. The detection of this sequence by PCR has been previously shown to correlate with subspeciation of CFF and CFV (Hum et al. 1997; On and Harrington 2001; Wagenaar et al. 2001; Muller et al. 2003), raising the possibility that biovar may be plasmid associated, with the implication that plasmid loss or gain may be associated with differing virulence. Plasmids, of varying number and size, are known to occur in CFF (Boosinger et al. 1990; Varga 1991) and CFV but there appear to be no obvious differences between the plasmid profiles of these subspecies (S. Cawthraw, pers. comm.). In the 6 CFV isolates investigated in this study, there was no correlation between PCR positivity and plasmid profile. Interestingly, although a PCR product was obtained with the preliminary plasmid preparation, none was observed with any purified plasmid band, suggesting that the PCR target may be chromosomal rather than plasmid-associated. Thus the relationship between plasmid-encoded ParA and C. fetus subspecies remains debatable; further work on plasmid characterization and carriage in C. fetus spp. is required to help resolve this issue. Further, differences in the genomic content of CFF and CFV strains are also recognized. In particular, CFF is reported to have a smaller genome (1Æ1 Mb) than CFV strains (1Æ3– 1Æ5 Mb) (Salama et al. 1992). Moreover, preliminary subtractive hybridization studies (Schober et al. 2001) indicated genetic differences in genes encoding surface proteins, virulence factors, LPS biosynthesis-associated proteins, flagellin and Gyr A as well as plasmid encoded proteins associated with macromolecule transport. It remains to be seen whether such differences are conserved and can be used to distinguish CFF from CFV. In the meantime, genotypic confirmation of phenotypic subspecies designation will require further investigation by multiple techniques including AFLP (Newell et al. 2000; Wagenaar et al. 2001). It is of interest that all of the phenotypically designated CFV field strains with the CFF genotype (n ¼ 15) were isolated from the UK between 1998 and 2002 and most (14/15) were recovered from vaginal mucous or aborted fetuses. Fourteen of these 15 strains have detailed source information available: four were from Scotland (Perth and Edinburgh) and a further seven from the North of England suggesting that there is some geographical association and raising the possibility that these strains represent an emerging clone of C. fetus with anomalous properties which may be related to the absence of the specific target of the previously reported PCR assay. In contrast, two of the three strains that were designated CFV by phenotyping and genotyping were from the same herd in the South of England while the other strain was from the Aberdeen region. As there is no information on cattle movements associated with these events, it will be
765
of interest to determine, by techniques such as AFLP, if there is a geographical association with subtype in these strains. In conclusion, the results presented indicate that the genotypic methods tested cannot, at present, substitute for phenotypic subspeciation methods in the UK. The reasons for this are unclear but may reflect the strains circulating in this country and, potentially, their plasmid profiles. ACKNOWLEDGEMENTS We thank the staff of the Scottish Agricultural Colleges Disease Surveillance Centres for supplying many of the Campylobacter fetus subsp. fetus isolates, Enevold Falsen at the Culture Collection of the University of Go¨teborg for his help in supplying C. fetus subsp. venerealis isolates, Kevin McLean and Jason Maini at the Functional Genomics Unit, Moredun Research Institute for performing the sequencing and Professor David Smith, Moredun Research Institute, Dr Ann Ridley, Veterinary Laboratories Agency and Dr Jaap Wagenaar, Institute for Animal Science and Health, Lelystad for helpful discussions. Moredun Research Institute and SAC receive financial support from the Scottish Executive Environmental Rural Affairs Department (SEERAD). REFERENCES Baar, C., Eppinger, M., Raddatz, G., Simon, J., Lanz, C., Klimmek, O., Nandakumar, R., Gross, R. et al. (2003) Complete genome sequence and analysis of Wolinella succinogenes. Proc Natl Acad Sci USA 100, 11690–11695. Bacon, D.J., Alm, R.A., Burr, D.H., Hu, L., Kopecko, D.J., Ewing, C.P., Trust, T.J. and Guerry, P. (2000) Involvement of a plasmid in virulence of Campylobacter jejuni 81-176. Infect Immun 68, 4384–4390. Bacon, D.J., Alm, R.A., Hu, L., Hickey, T.E., Ewing, C.P., Batchelor, R.A., Trust, T.J. and Guerry, P. (2002) DNA sequence and mutational analyses of the pVir plasmid of Campylobacter jejuni 81176. Infect Immun 70, 6242–6250. Boosinger, T.R., Blevins, W.T., Heron, J.V. and Sunter, J.L. (1990) plasmid profiles of six species of Campylobacter from human beings, swine, and sheep. Am J Vet Res 51, 718–722. Caldow, G.L. and Taylor, D.W. (1997) Experiences with venereal Campylobacter infection in Suckler herds. Cattle Pract 5, 327–334. Casademont, I., Chevrier, D. and Guesdon, J.L. (1998) Cloning of a sapB homologue (sapB2) encoding a putative 112-kDa Campylobacter fetus S-layer protein and its use for identification and molecular genotyping. FEMS Immunol Med Microbiol 21, 269–281. Chang, W. and Ogg, J.E. (1971) Transduction and mutation to glycine tolerance in Vibrio fetus. Am J Vet Res 32, 649–653. Draper, G.C. and Gober, J.W. (2002) Bacterial chromosome segregation. Annu Rev Microbiol 56, 567–597. Henegariu, O., Heerema, N.A., Dlouhy, S.R., Vance, G.H. and Vogt, P.H. (1997) Multiplex PCR: critical parameters and step-by-step protocol. Biotechniques 23, 504–511.
ª 2005 The Society for Applied Microbiology, Journal of Applied Microbiology, 99, 758–766, doi:10.1111/j.1365-2672.2005.02680.x
766 K . W I L L O U G H B Y ET AL.
Hum, S., Quinn, K., Brunner, J. and On, S.L. (1997) Evaluation of a PCR assay for identification and differentiation of Campylobacter fetus subspecies. Aust Vet J 75, 827–831. MacLaren, A.P. and Agumbah, G.J. (1988) Infertility in cattle in south-west Scotland caused by an intermediate strain of Campylobacter fetus subspecies fetus (formerly Campylobacter fetus intestinalis). Br Vet J 144, 29–44. Muller, W., Hotzel, H. and Schulze, F. (2003) [Identification and differentiation of Campylobacter fetus subspecies by PCR] Identifizierung und Differenzierung der Campylobacter-fetus-Subspezies mittels PCR. Deutsch Tierarztl Wochenschr 110, 55–59. Newell, D.G., Duim, B., Bergen, M.A.P., Grogono-Thomas, R. and Wagenaar, J.A. (2000) Speciation, subspeciation and subtyping of Campylobacter spp. associated with bovine infertility and abortion. Cattle Pract 8, 421–425. On, S.L. and Harrington, C.S. (2001) Evaluation of numerical analysis of PFGE-DNA profiles for differentiating Campylobacter fetus subspecies by comparison with phenotypic, PCR and 16S rDNA sequencing methods. J Appl Microbiol 90, 285–293. Panaccio, M., Stephens, L. and Widders, P. (1993) Field Evaluation of a PCR-Based Test for the Diagnosis of Bovine Campylobacteriosis. pp. 1–39. Australia: Dairy Research and Development Corporation. Prescott, J. F. (1990) Campylobacter. In Diagnostic Procedures in Veterinary Bacteriology and Mycology ed. Carter, G.R. and Cole, J.R. pp. 61–75. San Diego: Academic Press Inc. Salama, S.M., Garcia, M.M. and Taylor, D.E. (1992) Differentiation of the subspecies of Campylobacter fetus by genomic sizing. Int J Syst Bacteriol 42, 446–450. Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989) Molecular Cloning. Cold Spring Harbor: Cold Spring Harbour Laboratory Press. Schober, C., Gorkiewicz, G. and Zechner, R. (2001) Identification of differential DNA fragments associated with the pathogenicity of Campylobacter fetus species by subtractive hybridization. Int J Med Microbiol 291, 122–123. Schurig, G.D., Hall, C.E., Burda, K., Corbeil, L.B., Duncan, J.R. and Winter, A.J. (1973) Persistent genital tract infection with Vibrio fetus intestinalis associated with serotypic alteration of the infecting strain. Am J Vet Res 34, 1399–1403.
Skirrow, M.B. (1994) Diseases due to Campylobacter, Helicobacter and related bacteria. J Comp Pathol 111, 113–149. Smibert, R. M. (1984) Campylobacter. In Bergey’s Manual of Systematic Bacteriology ed. Kreig, N.R. and Holt, J.G. pp. 111–118. Baltimore: Williams and Wilkins. Tu, Z.C., Wassenaar, T.M., Thompson, S.A. and Blaser, M.J. (2003) Structure and genotypic plasticity of the Campylobacter fetus sap locus. Mol Microbiol 48, 685–698. Tu, Z.C., Hui, J. and Blaser, M.J. (2004) Conservation and diversity of sap homologues and their organization among Campylobacter fetus isolates. Infect Immun 72, 1715–1724. Vallat, B. and Edwards, S. (2004) Manual of Diagnostic Tests and Vaccines for Terrestrial Animals (Mammals, Birds and Bees). Paris: Office International Des Epizooties. Varga, J. (1991) Comparison of surface antigens of some Campylobacter fetus subsp. fetus strains of ovine origin by polyacrylamide gel electrophoresis and immunoblotting. Zentralblat Veterinarmed B 38, 497–504. Vargas, A.C., Costa, M.M., Vainstein, M.H., Kreutz, L.C. and Neves, J.P. (2003) Phenotypic and molecular characterization of bovine Campylobacter fetus strains isolated in Brazil. Vet Microbiol 93, 121– 132. Wagenaar, J.A. and van Bergen, M.A.P. (2004) Bovine genital campylobacteriosis. In OIE Manual of Diagnostic Tests and Vaccines for Terrestrial Animals (Mammals, Birds and Bees) ed. Vallat, B. and Edwards, S. pp. 439–450. Paris: Office International Des Epizooties. Wagenaar, J.A., van Bergen, M.A., Newell, D.G., Grogono-Thomas, R. and Duim, B. (2001) Comparative study using amplified fragment length polymorphism fingerprinting, PCR genotyping, and phenotyping to differentiate Campylobacter fetus strains isolated from animals. J Clin Microbiol 39, 2283–2286. Wang, G., Clark, C.G., Taylor, T.M., Pucknell, C., Barton, C., Price, L., Woodward, D.L. and Rodgers, F.G. (2002) Colony multiplex PCR assay for identification and differentiation of Campylobacter jejuni, C. coli, C. lari, C. upsaliensis, and C. fetus subsp. fetus. J Clin Microbiol 40, 4744–4747.
ª 2005 The Society for Applied Microbiology, Journal of Applied Microbiology, 99, 758–766, doi:10.1111/j.1365-2672.2005.02680.x
