J Mol Evol (2000) 51:205–213 DOI: 10.1007/s002390010082
© Springer-Verlag New York Inc. 2000
A New Appraisal of the Prokaryotic Origin of Eukaryotic Phytochromes Michael Herdman, The´re`se Coursin, Rosmarie Rippka, Jean Houmard,* Nicole Tandeau de Marsac Unite´ de Physiologie Microbienne (CNRS URA 2172), Institut Pasteur, 28 Rue du Dr. Roux, 75724 Paris Cedex 15, France Received: 9 December 1999 / Accepted: 10 May 2000
Abstract. The evolutionary origin of the phytochromes of eukaryotes is controversial. Three cyanobacterial proteins have been described as “phytochromelike” and have been suggested to be potential ancestors of these essential photoreceptors: Cph1 from Synechocystis PCC 6803, showing homology to phytochromes along its entire length and known to attach a chromophore; and PlpA from Synechocystis PCC 6803 and RcaE from Fremyella diplosiphon, both showing homology to phytochromes most strongly only in the Cterminal region and not known to bind a chromophore. We have reexamined the evolution of the photoreceptors using for PCR amplification a highly conserved region encoding the chromophore-binding domain in both Cph1 and phytochromes of plants and have identified genes for phytochrome-like proteins (PLP) in 11 very diverse cyanobacteria. The predicted gene products contain either a Cys, Arg, Ile, or Leu residue at the putative chromophore binding site. In 10 of the strains examined only a single gene was found, but in Calothrix PCC 7601 two genes (cphA and cphB) were identified. Phylogenetic analysis revealed that genes encoding PLP are homologues that share a common ancestor with the phytochromes of eukaryotes and diverged before the latter. In contrast, the putative sensory/regulatory proteins, including PlpA and RcaE, that lack a part of the chromophore lyase domain essential for chromophore attachment on the apophytochrome, are only distantly related to phytochromes. The Ppr protein of the anoxygenic photosynthetic bacterium
* Present address: Laboratoire de Photore´gulation et Dynamique des Membranes Ve´ge´tales, Ecole Normale Supe´rieure, CNRS URA 1810, 46 Rue d’Ulm, 75230 Paris Cedex 05, France Correspondence to: M. Herdman;
[email protected]
Rhodospirillum centenum and the bacterial phytochrome-like proteins (BphP) of Deinococcus radiodurans and Pseudomonas aeruginosa fall within the cluster of cyanobacterial phytochromes. Key words: Cyanobacteria — Higher plants — Algae — Evolution — Phylogeny — Photoreceptors — Sensory/regulatory proteins
Introduction Photosynthetic eukaryotes are able to sense and respond to the wavelength, intensity, direction, and duration of incident light. Their complex photoreceptor systems (reviewed by Chory 1997) include those that detect ultraviolet light (the UV-A and UV-B receptors), blue/UV-A light (cryptochromes), and red/far-red light (phytochromes). The red/far-red responses are best documented and are mediated by photoconversion between two stable isomers of phytochromes, Pr (absorbing red light, max ⳱ 660 nm) and Pfr (absorbing far-red light, max ⳱ 730 nm). Many of the organisms examined to date contain multiple phytochromes encoded by different genes, for example, PhyA to PhyE in Arabidopsis (Clack et al. 1994) and an additional PhyF in tomato (Hauser et al. 1995). These different major classes of phytochromes are most frequently found in higher plants, although some examples are emerging in more primitive organisms, such as the Gymnosperms Picea and Pseudotsuga (Schneider-Poetsch et al. 1998). The phytochrome molecule is divisible into two major domains. The Nterminal region, comprised of about 600 amino acids, covalently binds a linear tetrapyrrole chromophore to a
206
Cys residue and is responsible for the Pr-Pfr photoconversion. This domain is highly conserved, not only in the different classes of phytochromes within a single organism but also among those of plants considered to be either “primitive” or “advanced” in evolutionary terms. By contrast, the C-terminal domain, required for the homodimerization of two monomeric molecules and involved in signal transduction, is more variable. This region was shown by Schneider-Poetsch and colleagues (reviewed by Elich and Chory 1997; Quail 1997a) to exhibit sequence homology to the sensor histidine kinases of bacterial two-component regulatory systems. Recently, Yeh and Lagarias (1998) established that eukaryotic phytochromes are light-regulated serine/ threonine protein kinases with histidine kinase ancestry. The cyanobacteria are oxygenic photosynthetic prokaryotes that also respond to changes in incident light (see Tandeau de Marsac and Houmard 1993). Evidence for the origin of the chloroplast of an early eukaryotic organism from an ancestral endosymbiotic cyanobacterium, followed by transfer of genetic information to the nucleus of the primitive eukaryote, is well documented (see Gray and Doolittle 1982). Since the phytochromes of eukaryotes are encoded by nuclear genes, in this paper we address their potential evolutionary origin from an ancestral cyanobacterium. The sequencing of the entire genome of Synechocystis PCC 6803 (Kaneko et al. 1996) has revealed a gene (phy, slr0473) coding for a protein that shows similarity to the phytochromes of eukaryotes along its entire length and to bacterial sensory kinases in the C-terminal region (Lamparter et al. 1997; Quail 1997a). This protein was subsequently named Cph1 (Yeh et al. 1997). In vitro, Cph1 binds a linear tetrapyrrole chromophore, phycocyanobilin (PCB), to produce a photochromic holoprotein (Lamparter et al. 1997). The Pr form of this cyanobacterial phytochrome mediates phosphorylation, reversible by far-red light, of the small response regulator Rcpl (encoded by ORF slr0474), a protein of 147 amino acids with homology to the CheY superfamily of response regulators (Yeh et al. 1997). The discovery of a cyanobacterial phytochrome has important implications for the evolution of photoreceptors of eukaryotes. However, the picture is obscured by suggestions that two other proteins, PlpA and RcaE, are potential ancestors of eukaryotic phytochromes. The evidence is confined to sequence similarities within the Cterminal region of the cyanobacterial proteins and plant phytochromes. This region appears to be inappropriate for deducing the origin of phytochromes, since even the Synechocystis PCC 6803 Cph1 molecule shows only 20% identity and 52% similarity to the corresponding region of Arabidopsis phyE between amino acids 938 and 1,187, whereas the N-terminal domain is more highly conserved, exhibiting 36% identity and 60% similarity to phyE between residues 119 and 640 (see Quail 1997a). By contrast, PlpA of Synechocystis PCC 6803,
encoded by ORF sll1124, shows homology with several bacterial histidine kinases and to the ethylene response regulator of Arabidopsis, in the C-terminal domain (Wilde et al. 1997). The central region of PlpA was reported to be homologous to the chromophore-binding site of phytochromes even though the region immediately preceding the chromophore attachment site is absent. Similarly, the protein RcaE (Kehoe and Grossman 1996) of Fremyella diplosiphon, a mutant of Calothrix PCC 7601 (see legend of Table 1), comprises a Cterminal domain that shows similarity to the histidine kinase domain of proteins involved in two-component regulatory systems; the N-terminal domain of about 260 amino acids has very little similarity to the chromophore binding domain of phytochromes and, like PlpA, lacks 20 amino acids preceding the putative Cys chromophore attachment site. This region of the phytochrome molecule is part of the chromophore lyase region essential for covalent attachment of the chromophore to the apoprotein (Quail 1997a), and chromophore binding by PlpA and Rca has never been demonstrated. Therefore, neither of the latter proteins appears to be a phytochrome, although PlpA is photoactive in a blue light response (Wilde et al. 1997) and RcaE has been shown to be involved in complementary chromatic adaptation (Kehoe and Grossman 1996). We have thus examined the evolutionary origin of phytochromes of eukaryotes by searching for potential relatives of such photoreceptors in a variety of cyanobacteria that show a wide range of morphological and physiological diversity. This was achieved by amplifying and sequencing the region encoding the more highly conserved chromophore binding domain. The sequences were compared to those of Cph1, PlpA, and RcaE, 46 phytochromes from eukaryotes, and four further proteins of Synechocystis PCC 6803 (Kaneko et al. 1996) (ethylene response sensor protein, slr1212; histidine kinase sensor protein, slr1393; hypothetical proteins, sll0821 and sll1473) that were selected from a number showing homologies to Cph1 in our database searches. Like RcaE and PlpA, these proteins all lack part of the chromophore-binding domain, and we distinguish all six by the term putative “sensory/regulatory proteins” (SRP). Ppr, a photoreceptor of the anoxygenic photosynthetic bacterium Rhodospirillum centenum (Jiang et al. 1999) and two phytochrome-like proteins (BphP) from the nonphotosynthetic bacteria Deinococcus radiodurans and Pseudomonas aeruginosa (Davis et al. 1999) were also included in the analyses.
Materials and Methods Strains, Culture Conditions, and DNA Extractions. Cyanobacterial strains (Table 1) were grown in media recommended by Rippka and Herdman (1992) and illuminated with fluorescent lamps (OSRAM L18W/25 universal white) providing a photosynthetic photon flux den-
207 Table 1.
Relevant properties of the cyanobacterial strains Heterotrophy CCAa
Motility
Light
Dark
N2 fixation
Other properties
Unicellular Synechocystis PCC 6803 Stanieria PCC 7437c Filamentous nonheterocystous Leptolyngbya PCC 7375d Leptolyngbya PCC 7376d Oscillatoria agardhii PCC 7821 Pseudanabaena PCC 6903 Pseudanabaena PCC 7409d Geitlerinema PCC 9228f
— III
+ +(ba)
+ +
— +
— —
Euryhalineb
I I I — III —
— — + + + +
ND — + — — ND
ND — ND — — ND
+(an) ND ND — +(an) +(an)g
C-PE rich; marine C-PE rich; marine Hepatotoxine
Filamentous heterocystous Nostoc PCC 7120 i Nostoc PCC 73102 Nostoc PCC 8009 Calothrix PCC 7601j Fremyella diplosiphon k
— II II III III
— +(ho) +(ho) +(ho) —
— + + + +
— + + + +
+ + — +(an) ND
PEC synthesis
Halophile; facultative anaerobic photosynthesis (H2S)h
Het− mutant Het− mutant Het− mutant
Unless otherwise specified, the nomenclature and strain properties are from the Pasteur Culture Collection of Cyanobacteria (PCC) (Rippka and Herdman 1992); additional information can be found in Rippka and Herdman (1992) and at http://www.pasteur.fr/recherche/banques/PCC. Abbreviations: ba, baeocyte; Het, heterocyst; ho, hormogonium; an, anaerobiosis; CCA, complementary chromatic adaptation; C-PE, Cphycoerythrin; PEC, phycoerythrocyanin. ND, not determined. a Groups for complementary chromatic adaptation: I, strains that do not adapt chromatically; II, strains that synthesize phycoerythrin only in green light; III, strains that synthesize phycoerythrin in green light and an inducible phycocyanin in red light (Tandeau de Marsac 1977). b Richardson et al. (1983). c Previously named Dermocarpa (Rippka et al. 1979). d Previously classified in the LPP group (Rippka et al. 1979). e Berg and Soli (1985). f Originally known as Oscillatoria limnetica (Cohen et al. 1975). g Belkin et al. (1988). h Cohen et al. (1975). i Commonly published as Anabaena PCC 7120. j Generic name as commonly published; more correctly Tolypothrix PCC 7601 (Rippka and Herdman 1992). k A mutant of Calothrix PCC 7601 designated Fremyella diplosiphon SF33 (Cobley et al. 1993) or Fd33 (Kehoe and Grossman 1996).
sity of 10 mol m−2s−1 measured with a LI-COR LI-185B quantum/ radiometer/photometer equipped with a LI-190SB quantum sensor. After 3–6 weeks of incubation at 30°C, cells from liquid cultures (40 ml) were collected to extract total DNA according to Cai and Wolk (1990). DNA Amplification and Cloning. Two degenerated primers, 5⬘CGGCATGACTGGTTTTGATCGIGTIATG3⬘ and 5⬘GGCAGIACTTCIGGICGA/GAACCA3⬘, were based on a conserved motif of the Nterminal amino acid sequence corresponding to the chromophore binding site region in the phytochromes from plants and from the cyanobacterium Synechocystis PCC 6803 (Kaneko et al. 1996). These primers were used to amplify the corresponding regions from total genomic DNA isolated from 11 cyanobacterial strains (Table 1). The reaction mixture (50 l of 1 × TaqPlus Long™ low salt buffer) contained 100–500 ng DNA, 12.5 nmol dNTP, 50 pmol of each primer, and 2.5 U TaqPlus Long (Stratage`ne). The PCR was performed in a DNA Thermal Cycler (Perkin Elmer Cetus): 4 min at 95°C, 2 min at 35°C, 2 min at 72°C; 5 cycles of 30 s at 95°C, 2 min at 35°C, 2 min at 72°C; 35 cycles of 30 s at 95°C, 2 min at 40°C, 2 min at 72°C; a final cycle of 30 s at 95°C, 2 min at 40°C, 5 min at 72°C. After separation on agarose gel, the PCR products were purified with the Qiaquick Kit (Qiagen), cloned in the pGEM-T vector (Promega), and sequenced with the T7 sequencing kit (Pharmacia) using universal and appropriately designed primers synthesized as the determination of the nucleotide sequences proceeded. The nucleotide sequences have been deposited in GenBank under accession numbers AF202132–AF202143.
Sequence Alignment and Phylogenetic Analysis. DNA sequences for phylogenetic studies were aligned using Clustal W version 1.6 (Thompson et al. 1994) with default parameter values. Amino acid homologies of the translated sequences (Fig. 1b) were calculated on the basis of physicochemical properties of the side chains (Bartley et al. 1990). Phylogenetic trees were inferred by transversion analysis of the DNA sequences with the program package TREECON (Van de Peer and De Wachter 1994) and by analysis of either all codon positions or only positions 1 and 2 of each codon with distance matrix methods in TREECON and the PHYLIP package (Felsenstein 1993), by parsimony (PHYLIP), and by fastDNAml (Olsen et al. 1994). For all methods, the variable gap-containing region 117–135 (Fig. 1b) was excluded from the analysis. Published phytochrome sequences were obtained from Genbank under the following designations: Adiantum capillus-veneris, D13519; Angiopteris evecta, X98620; Arabidopsis thaliana PhyA, X17341; A. thaliana PhyB, X17342; A. thaliana PhyC, X17343; A. thaliana PhyD, X76609; A. thaliana PhyE, X76610; Avena sativa type 3, M18822; Carmichaelia sp. PhyE, U78839; Ceratodon purpureus “conventional,” X89725; Chara foetida, X80291; Cucurbita pepo, M15265; Enterolobium cyclocarpum PhyE, U78827; Ephedra major, X80292; Equisetum arvense, X80299; Funaria hygrometrica, X80294; Ginkgo biloba, X98698; Glycine max PhyA, L34844; G. max PhyB, L34843; Gnetum gnemon, X80295; Ipomoea nil PhyE, U39787; Marchantia polymorpha, X80296; Marsilea quadrifolia, X80300; Mesotaenium caldariorum, U31284; Metasequoia glyptostroboides, X80297; Mougeotia scalaris, S52048; Nicotiana tabacum PhyA,
208
209 X66784; N. tabacum PhyB, L10114; Ophioglossum vulgatum X98621; Oryza sativa, X14172; O. sativa PhyB, X57563; O. sativa PhyC, AB018442; Petroselinum crispum PhyA, X75412; Physcomitrella patens “distantly B related”, X75025; Picea abies, U60264; P. abies, X80298; Piper nigrum, X80321; Pisum sativum, X14077; Pseudotsuga menziasii, U22458; Psilotum nudum, X74931; P. nudum, Y13806; Selaginella martensii, X61458; Selaginella serpens X98700; Solanum tuberosum PhyB, S51538, S. tuberosum PhyA, S84872; Sorghum bicolor PhyC, U56731. The F. diplosiphon RcaE sequence is Genbank U59741; the sequences of Synechocystis PCC 6803 phytochrome (slr0473), Etr1 (slr1212), PlpA (sll1124), histidine kinase (slr1393), and hypothetical proteins (sll0821 and sll1473) are from Cyanobase (Kaneko et al. 1996). The sequence published (Jiang et al. 1999) as R. centenum Ppr is GenBank AF064527 (deposited as Rhodocista centenaria Pph); the bacterial phytochrome-like proteins (BphP) of D. radiodurans R1 and P. aeruginosa PAO1 were described by Davis et al. (1999) and are available from the genome sequences in GenBank (accession number AE001862) and the Pseudomonas Genome Project (www.pseudomonas.com/index.html), respectively.
Results Sequence Homology We cloned and sequenced the region encoding the putative chromophore attachment domain of phytochromelike proteins (PLP) of 11 cyanobacterial strains. A single amplicon was obtained for all strains except Calothrix PCC 7601, where two amplicons were recovered. Their predicted products were found to exhibit only 57% identity (67% similarity), and they are therefore distinct genes that, in accordance with standard genetic nomenclature, we have named cphA and cphB. The 12 DNA sequences were aligned to the corresponding region of 46 phytochromes of eukaryotes, the phytochrome of Synechocystis PCC 6803, 6 cyanobacterial putative SRP molecules, the Ppr photoreceptor of the anoxygenic photosynthetic bacterium R. centenum, and the bacterial phytochrome-like proteins (BphP) of D. radiodurans and P. aeruginosa. The amino acid sequence alignment shown (Fig. 1b) contains only a limited selection of the sequences of phytochromes of eukaryotes and reveals, throughout the entire length, many regions of high similarity between these (represented by phytochromes A to E of Arabidopsis and the single phytochrome of a more “primitive” organism, the moss Ceratodon), the 12 cyanobacterial PLP sequences determined
in this study and the published sequences of the phytochrome of Synechocystis PCC 6803 (Kaneko et al. 1996) and Ppr of R. centenum (Jiang et al. 1999). The bacterial BphP proteins (not included in Fig. 1b) show high similarity to Arabidopsis phytochrome B, the phytochrome of Synechocystis PCC 6803 and R. centenum Ppr (Davis et al. 1999). By contrast, RcaE, PlpA, and the remaining cyanobacterial SRP (Fig. 1b) show very little similarity to the phytochromes within the region studied. Surrounded by highly conserved domains, the chromophore attachment site is a Cys residue in all phytochromes of eukaryotes. Of the two PLP of Calothrix PCC 7601, CphA carries a Cys residue at the putative attachment site, whereas CphB contains a Leu residue (Fig. 1b). The Cys residue is shared by six of the other cyanobacterial PLP; the remaining five contain Leu, Ile, or Arg at this position, but show a high degree of identity to the Cys-containing cyanobacterial PLP throughout the remainder of the sequence. Although the six SRP sequences shown in Fig. 1b, including RcaE and PlpA, all contain a Cys residue that, perhaps fortuitously, can be aligned to the chromophore attachment site of the phytochromes, they all lack the adjacent 20 amino acids towards the N-terminus. This region is present in the Ppr of R. centenum (Fig. 1b) and in BphP of D. radiodurans and P. aeruginosa (Davis et al. 1999), which respectively carry a Met, Ile, or Val residue at the position equivalent to the chromophore attachment site of the phytochromes.
Phylogenetic Analysis To further define the evolutionary relationships between the cyanobacterial SRP, PLP, and the phytochromes of eukaryotes, we performed phylogenetic analyses. A tree (Fig. 2) including all cyanobacterial PLP sequences, three of the six SRP, Ppr from the photosynthetic bacterium R. centenum, BphP from the nonphotosynthetic bacteria D. radiodurans and P. aeruginosa, and five major classes of phytochromes was inferred using all codon positions of the nucleotide sequences. The analysis revealed that RcaE is a distantly related sister sequence of the cyanobacterial PLP. Two SRP sequences (PlpA and Etr1) cluster together but are also distant from the PLP (Fig. 2). The remaining SRP sequences (Fig. 1b) group
< Fig. 1. Schematic representation of entire proteins (a) and alignment of the region around the chromophore binding site (b) of eukaryotic phytochromes (Phy), cyanobacterial phytochrome-like proteins (PLP) and putative sensory/regulatory proteins (SRP), and Ppr from the anoxygenic photosynthetic bacterium R. centenum. a: Shaded areas indicate the region shown in Fig. 1b, boxes on the phytochromes represent the chromophore; numbers refer to amino acid positions; letters indicate conserved residues (chromophore-binding domain) or the conserved motifs H, N, D, G1, F, and G2 (C-terminal domain) defined by Parkinson and Kofoid (1992). b: Regions showing greater than 70% identity and 70% similarity are shaded in black and gray, respectively; the arrow indicates the chromophore attachment site. The aligned region starts at position 175 of the Synechocystis PCC 6803 Cph1 protein. The alignment contains (from top to bottom) PhyA to PhyE of Arabidopsis thaliana (A. th.), a single phytochrome of Ceratodon purpureus (Ceratodon), 13 cyanobacterial PLP containing cysteine (including the phytochrome Cph1 of Synechocystis PCC 6803), leucine, isoleucine, or arginine (C, L, I, and R, respectively) at the putative chromophore binding site, Ppr from R. centenum (R. ce. Ppr) and six SRP sequences: RcaE from Fremyella diplosiphon (F. di. RcaE), hypothetical proteins (s110821 and s111473), histidine kinase sensor protein (slr1393), Etr1 (slr1212), and PlpA (sll1124) from Synechocystis PCC 6803 (PCC 6803).
210 Fig. 2. Phylogenetic tree showing the relationships between the cyanobacterial and bacterial phytochrome-like proteins (PLP), three putative sensory/regulatory proteins (SRP) of cyanobacteria, and five major classes of eukaryotic phytochromes (Arabidopsis PhyA to PhyE). With the exception of the protein Cph1 (Yeh et al. 1997) of Synechocystis PCC 6803, the cyanobacterial PLP are annotated with A, C, I, or L to indicate the amino acid present at the putative chromophore binding site. The tree was constructed by analysis of all codon positions of the nucleotide sequence in TREECON (Van de Peer and De Wachter 1994), omitting the region equivalent to residues 117–135 of the alignment (Fig. 1b), using the distance algorithm of Jin and Nei (1990), and subjected to 1,000 bootstrap cycles. Only bootstrap values greater than 50% are shown. The nucleotide sequence of protein Etr1 of Synechocystis PCC 6803 was employed as outgroup. Similar topologies were found with the other algorithms employed. Bar marker represents 0.5 nucleotide substitutions per position.
with PlpA and Etr1 (data not shown), but their long branch lengths hinder bootstrap analysis and they have been excluded from the tree. When rooted by the SRP sequences, the PLP show an early divergence of two clusters that contain Ile or Leu at the putative chromophore binding site; one of these clusters contains CphB of Calothrix PCC 7601. The Cys-containing PLP, including CphA of Calothrix PCC 7601, diverge later and form several clusters, Cph1 of Synechocystis PCC 6803 being closely related to CphA. Surprisingly, Ppr of the anoxygenic photosynthetic bacterium R. centenum and BphP of D. radiodurans and P. aeruginosa fall within the cyanobacterial PLP, with the Arg variant of Geitlerinema PCC 9228 as closest relative. The phytochromes of eukaryotes diverge after the cyanobacterial and bacterial PLP and all these proteins share a common ancestor. Phylogenetic analysis of a larger set of phytochromes of eukaryotes was rendered difficult by differences in the overall composition (mol % G + C) of the sequences and by potentially different rates of evolutionary change in the various eukaryotic branches of the tree (SchneiderPoetsch et al. 1998). Although trees could be prepared using all available methods of phylogenetic analysis, their resulting topologies were conflicting, since almost any of the major phytochrome types could be found at the base of the eukaryotic branch. These problems were overcome in two ways: (a) by applying only transversion analysis (Woese et al. 1991) and (b) by excluding the third position of each codon (Gaut et al. 1992). Both methods gave trees of similar topology. Such analyses suggest the following scenario of phytochrome evolution among eukaryotes (Fig. 3): an early divergence of the
phytochromes of the green algae (represented by Chara, Mougeotia, and Mesotaenium) is followed by that of four Bryophytes (Marchantia, Ceratodon, Funaria, and Physcomitrella) and two Pteridophytes (Selaginella, represented by two sequences, and Equisetum). Phytochromes of a second group of Pteridophytes (the ferns Psilotum, represented by two sequences, Marsilea, Adiantum, Angiopteris, and Ophioglossum) separate at about the same time as those of a group of Gymnosperms (Ginkgo, Picea, Metasequoia, and Gnetum) and phytochromes B, D, and E of the Angiosperms. The grouping of Adiantum with other ferns appears to be correct but is in contrast to earlier studies where it was found to occupy a basal position, probably as a result of attraction of long branches (Mathews and Sharrock 1997). The last branch of the tree (Fig. 3) contains sequences of another group of Gymnosperms (Ephreda, Pseudotsuga, and a second phytochrome of Picea) plus phytochromes C and A of the Angiosperms. It is also noteworthy that the monocotyledenous plants (Avena, Oryza, and Sorghum) contain, like the dicotyledons, multiple classes of phytochromes of which three are shown for Oryza.
Discussion We wished not only to screen a variety of cyanobacteria for putative phytochromes but also to attempt to correlate their presence with the properties of the strains. We therefore examined 11 axenic and well-characterized strains from the Pasteur Culture Collection of Cyanobacteria that exhibit a broad range of morphological and physiological diversity (Table 1). Proteins related to
211
Fig. 3. Phylogenetic tree showing evolutionary relationships between eukaryotic phytochromes. The tree was inferred by analysis of the first two positions of each codon in TREECON (Van de Peer and De Wachter 1994), omitting the region equivalent to residues 117–135 of the alignment (Fig. 1b), and subjected to 1,000 bootstrap cycles. Nucleotide sequences of PLP of Synechocystis PCC 6803 and Pseudanabaena PCC 6903 were employed as outgroup. Only bootstrap values greater than 50% are shown. Similar topologies were found with the other algorithms employed. Bar marker represents 0.1 nucleotide substitutions per position.
these photoreceptors appear to be widespread in the cyanobacterial phylum, having been found in all strains examined. The alignment of their sequences (Fig. 1b) revealed a set of 13 cyanobacterial proteins that all share high homology with eukaryotic phytochromes throughout the region studied. The alignment within the conserved regions is comparable to those proposed previously (Kehoe and Grossman 1996; Quail 1997b; Davis et al. 1999; Jiang et al. 1999) but differs slightly at the extremities of the variable regions (positions 63–66, 91– 94, 115–122, and 133–135; Fig. 1b). The latter difference may be an important improvement because it is based on an extensive data set of 66 sequences, in contrast to those previously published that contained at most 6 sequences.
The two distinct PLP of Calothrix PCC 7601, CphA and CphB, show a difference of potential functional importance at the putative chromophore binding site, where they carry a Cys and Ile residue, respectively. The single PLP of each of the remaining strains contains either Cys, Arg, Ile, or Leu at this position. Although four of these cluster with CphA and one with CphB, the phylogenetic groupings of the six remaining PLP suggest that they may be encoded by at least four additional genes. No clear correlation exists between the phylogenetic position of the cyanobacterial PLP and the known morphological or physiological properties of the strains (Table 1), and further investigation of the role of these proteins will therefore require site-directed mutagenesis. Although Cph1 of Synechocystis PCC 6803 contains a
212
Cys residue at the putative chromophore binding site and has been shown to covalently attach a PCB chromophore in vitro (Lamparter et al. 1997), it is not yet known whether proteins lacking the Cys residue may do so in a noncovalent manner or on a different residue. The proteins Ppr of the anoxygenic photosynthetic bacterium R. centenum and BphP of the nonphotosynthetic bacteria D. radiodurans and P. aeruginosa are strikingly similar to the PLP of cyanobacteria and to the phytochromes of eukaryotes throughout most of their length but lack the essential Cys residue (Jiang et al. 1999; Davis et al. 1999). The phylogenetic position of these bacterial proteins (Fig. 2) indicates that their phytochrome-like domains are closely related to those of the putative phytochromes of cyanobacteria. Site-directed mutagenesis revealed that the D. radiodurans BphP protein binds a PCB chromophore by a Schiff base linkage to His260, situated immediately adjacent to the typical Cys binding site of phytochromes (Davis et al. 1999). This His residue is conserved in the cyanobacterial PLP (except in Nostoc PCC 73102, Fig. 1b), and, in those that lack the adjacent Cys residue, may be the site of attachment of the chromophore. By contrast, Ppr of R. centenum, although homologous to the cyanobacterial PLP within their chromophore-binding region, carries an N-terminal extension that is virtually identical to the photoactive yellow proteins of Ectothiorhodospira halophila, Rhodobacter sphaeroides, and Rhodobacter capsulatus. A Cys residue in this extension binds a p-hydroxycinnamic acid chromophore that confers the ability to respond to blue light (Jiang et al. 1999) and, despite its phylogenetic position, this protein is therefore markedly different functionally from the others included in the present study. The SRP molecules, which show only limited homology to cyanobacterial PLP and eukaryotic phytochromes and lack 20 amino acids within a region essential for chromophore binding, are phylogenetically distant from all other photoreactive proteins. Phylogenetic analysis of the chromophore binding domain of the cyanobacterial PLP and the homologous regions of the bacterial Ppr and BphP proteins showed that they form a sister clade with the phytochromes of eukaryotes. In view of the confirmed origin of chloroplasts from an endosymbiotic cyanobacterium (see Gray and Doolittle 1982) this was predictable, but has not been previously demonstrated. Based on the region studied, the closest eukaryotic relatives of the cyanobacterial PLP are the phytochromes of the green algae (Fig. 3). This hypothesis was previously proposed on strictly hypothetical reasoning in trees for which the algal sequences themselves were used as outgroups (Kolukisaoglu et al. 1995; Winands and Wagner 1996). This relationship is consistent with the finding that even though these algae do not contain phycobiliproteins, PCB is the immediate chromophore precursor in Mesotaenium (Wu et al. 1997), whose phytochrome shows a blue-shift similar to
the PCB adduct (Lamparter et al. 1997) of Cph1 of Synechocystis PCC 6803. The phylogenetic tree of the phytochromes of eukaryotes (Fig. 3) is in agreement with that of Schneider-Poetsch et al. (1998) except that the latter authors did not find a close relationship between the phytochromes of the ferns Angiopteris and Ophioglossum. The division of both Gymnosperms and Pteridophytes into two groups suggests that, as in the Angiosperms, members of these taxa contain multiple classes of phytochromes, as confirmed by the two sequences of Picea, which fall into different clades of the tree. Phytochrome sequences are thus valuable for the study of the evolution of this class of proteins but give little information concerning the phylogenetic relationships between the organisms that contain them. Acknowledgments. This work was supported by the Institut Pasteur, by the Centre National de la Recherche Scientifique (URA 1129), and in part by contract BIO4-CT96-0256 (BASIC) of the EEC BIOTECH program (Life Sciences and Technologies, Biotechnology Programme, 1994–1998).
References Bartley GE, Schmidhauser TJ, Yanofsky C, Scolnik PA (1990) Carotenoid desaturases from Rhodobacter capsulatus and Neurospora crassa are structurally and functionally conserved and contain domains homologous to flavoprotein disulfide oxidoreductases. J Biol Chem 265:16020–16024 Belkin S, Shahak Y, Padan E (1988) Anoxygenic photosynthetic electron transport. Meth Enzymol 167:380–386 Berg K, Soli NE (1985) Toxicity studies with the blue-green alga Oscillatoria agardhii from two eutrophic Norwegian lakes. Acta Vet Scand 26:363–373 Cai Y, Wolk CP (1990) Use of a conditionally lethal gene in Anabaena sp. strain PCC 7120 to select for double recombinants and to entrap insertion sequences. J Bacteriol 172:3138–3145 Chory J (1997) Light modulation of vegetative development. Plant Cell 9:1225–1234 Clack T, Mathews S, Sharrock RA (1994) The phytochrome apoprotein family in Arabidopsis is encoded by five genes: the sequences and expression of PHYD and PHYE. Plant Mol Biol 25:413–427 Cobley JG, Zerweck E, Reyes R, Mody A, Seludo-Unson JR, Jaeger H, Weerasuriya S, Navankasattusas S (1993) Construction of shuttle plasmids which can be efficiently mobilized from Escherichia coli into the chromatically adapting cyanobacterium, Fremyella diplosiphon. Plasmid 30:90–105 Cohen Y, Padan E, Shilo M (1975) Facultative anoxygenic photosynthesis in the cyanobacterium Oscillatoria limnetica. J Bacteriol 123:855–861 Davis SJ, Vener AV, Vierstra RD (1999) Bacteriophytochromes: phytochrome-like photoreceptors from nonphotosynthetic eubacteria. Science 286:2517–2520 Elich TD, Chory J (1997) Phytochrome: if it looks and smells like a histidine kinase, is it a histidine kinase? Cell 91:713–716 Felsenstein J (1993) PHYLIP (Phylogeny inference package), version 3.5c. University of Washington, Seattle, WA Gaut BS, Muse SV, Clark WD, Clegg MT (1992) Relative rates of nucleotide substitution at the rbcL locus of monocotyledonous plants. J Mol Evol 35:292–303 Gray MW, Doolittle WF (1982) Has the endosymbiont hypothesis been proven? Microbiol Rev 46:1–42 Hauser BA, Cordonnier-Pratt MM, Daniel-Vedele F, Pratt LH (1995)
213 The phytochrome gene family in tomato includes a novel subfamily. Plant Mol Biol 29:1143–1155 Jiang Z, Swem LR, Rushing BG, Devanathan S, Tollin G, Bauer CE (1999) Bacterial photoreceptor with similarity to photoactive yellow protein and plant phytochromes. Science 285:406–409 Jin L, Nei M (1990) Limitations of the evolutionary parsimony method of phylogenetic analysis. Mol Biol Evol 7:82–102 Kaneko T, Sato S, Kotani H, Tanaka A, Asamizu E, Nakamura Y, Miyajima N, Hirosawa M, Sugiura M, Sasamoto S, Kimura T, Hosouchi T, Matsuno A, Muraki A, Nakazaki N, Naruo K, Okumura S, Shimpo S, Takeuchi C, Wada T, Watanabe A, Yamada M, Yasuda M, Tabata S. (1996) Sequence analysis of the genome of the unicellular cyanobacterium Synechocystis sp. strain PCC6803. II. Sequence determination of the entire genome and assignment of potential protein-coding regions. DNA Res 3:109–136 Kehoe DM, Grossman AR (1996) Similarity of a chromatic adaptation sensor to phytochrome and ethylene receptors. Science 273:1409– 1412 Kolukisaoglu HU, Marx S, Wiegmann C, Hanelt S, Schneider-Poetsch HAW (1995) Divergence of the phytochrome gene family predates angiosperm evolution and suggests that Selaginella and Equisetum arose prior to Psilotum. J Mol Evol 41:329–337 Lamparter T, Mittmann F, Ga¨rtner W, Bo¨rner T, Hartmann E, Hughes J (1997) Characterization of recombinant phytochrome from the cyanobacterium Synechocystis. Proc Natl Acad Sci USA 94:11792– 11797 Mathews S, Sharrock RA (1997) Phytochrome gene diversity. Plant Cell Env 20:666–671 Olsen GJ, Matsuda H, Hagstrom R, Overbeek R (1994) fastDNAml: a tool for construction of phylogenetic trees of DNA sequences using maximum likelihood. Comput Appl Biosci 10:41–48 Parkinson JS, Kofoid EC (1992) Communication modules in bacterial signaling proteins. Annu Rev Genet 26:71–112 Quail PH (1997a) An emerging molecular map of the phytochromes. Plant Cell Environ 20:657–665 Quail PH (1997b) The phytochromes: a biochemical mechanism of signaling in sight? BioEssays 19:571–579 Richardson DL. Reed RH, Stewart WDP (1983) Synechocystis PCC6803: a euryhaline cyanobacterium. FEMS Microbiol Lett 18: 99–102 Rippka R, Herdman M (1992) Pasteur culture collection of cyanobac-
terial strains in axenic culture Catalogue and taxonomic handbook, Institut Pasteur, Paris pp 1–103 Rippka R, Deruelles J, Waterbury JB, Herdman M, Stanier RY (1979) Generic assignments, strain histories and properties of pure cultures of cyanobacteria. J Gen Microbiol 111:1–61 Schneider-Poetsch HAW, Kolukisaoglu U, Clapham DH, Hughes J, Lamparter T (1998) Non-angiosperm phytochromes and the evolution of vascular plants. Physiol Plantarum 102:612–622 Tandeau de Marsac N (1977) Occurrence and nature of chromatic adaptation in cyanobacteria. J Bacteriol 130:82–91 Tandeau de Marsac N, Houmard J (1993) Adaptation of cyanobacteria to environmental stimuli: new steps towards molecular mechanisms. FEMS Microbiol Rev 104:119–190 Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680 Van de Peer Y, De Wachter R (1994) TREECON for Windows: a software package for the construction and drawing of evolutionary trees for the Microsoft Windows environment. Comput Appl Biosci 10:569–570 Wilde A, Churin Y, Schubert H, Bo¨rner T (1997) Disruption of a Synechocystis sp. PCC 6803 gene with partial similarity to phytochrome genes alters growth under changing light qualities. FEBS Lett 406:89–92 Winands A, Wagner G (1996) Phytochrome of the green alga Mougeotia: cDNA sequence, autoregulation and phylogenetic position. Plant Mol Biol 32:589–597 Woese CR, Achenbach L, Rouviere P, Mandelco L (1991) Archaeal phylogeny: reexamination of the phylogenetic position of Archaeoglobus fulgidus in light of certain composition induced artificacts. Sys Appl Microbiol 14:364–371 Wu S-H, McDowell MT, Lagarias JC (1997) Phycocyanobilin is the natural precursor of the phytochrome chromophore in the green alga Mesotaenium caldariorum. J Biol Chem 272:25700–25705 Yeh K-C, Lagarias JC (1998) Eukaryotic phytochromes: lightregulated serine/threonine protein kinases with histidine kinase ancestry. Proc Natl Acad Sci USA 95:13976–13981 Yeh K-C, Wu S-H, Murphy JT, Lagarias JC (1997) A cyanobacterial phytochrome two-component light sensory system. Science 277: 1505–1508
