A Novel Dominant Negative Mutation of OTX2 Associated with ...

ORIGINAL

ARTICLE

E n d o c r i n e

C a r e

A Novel Dominant Negative Mutation of OTX2 Associated with Combined Pituitary Hormone Deficiency Daniel Diaczok, Christopher Romero, Janice Zunich, Ian Marshall, and Sally Radovick Division of Pediatric Endocrinology (D.D., C.R., S.R.), Department of Pediatrics, The Johns Hopkins University School of Medicine, Baltimore, Maryland 21287; Department of Medical Genetics (J.Z.), Indiana University School of Medicine-Northwest, Gary, Indiana 46408; and Division of Pediatric Endocrinology (I.M.), University of Medicine and Dentistry, New Jersey (UMDNJ)-Robert Wood Johnson Medical School, New Brunswick, New Jersey 08901

Context: Combined pituitary hormone deficiency (CPHD) is characterized by deficiencies in more than one anterior pituitary hormone. Mutations in developmental factors responsible for pituitary cell specification and gene expression have been found in CPHD patients. OTX2, a bicoid class homeodomain protein, is necessary for both forebrain development and transactivation of the HESX1 promoter, but as of yet, has not been associated with CPHD. Objective: The goal of this study was to identify and characterize novel mutations in pituitary specific transcription factors from CPHD patients. Design: Genomic DNA was isolated from patients with hypopituitarism to amplify and sequence eight pituitary specific transcription factors (HESX1, LHX3, LHX4, OTX2, PITX2, POU1F1, PROP1, and SIX6). Characterization of novel mutations is based on structural and functional studies. Results: We describe two unrelated children with CPHD who presented with neonatal hypoglycemia, and deficiencies of GH, TSH, LH, FSH, and ACTH. Magnetic resonance imaging revealed anterior pituitary hypoplasia with an ectopic posterior pituitary. A novel heterozygous OTX2 mutation (N233S) was identified. Wild-type and mutant OTX2 proteins bind equivalently to bicoid binding sites, whereas mutant OTX2 revealed decreased transactivation. Conclusions: A novel mutation in OTX2 binds normally to target genes and acts as a dominant negative inhibitor of HESX1 gene expression. This suggests that the expression of HESX1, required for spaciotemporal development of anterior pituitary cell types, when disrupted, results in an absent or underdeveloped anterior pituitary with diminished hormonal expression. These results demonstrate a novel mechanism for CPHD and extend our knowledge of the spectrum of gene mutations causing CPHD. (J Clin Endocrinol Metab 93: 4351– 4359, 2008)

ombined pituitary hormone deficiency (CPHD), with an estimated incidence of 1:8000, is usually a sporadic disorder characterized by concomitant deficiencies of multiple hormones originating in the anterior pituitary (1). Chance mutations leading to mouse models of pituitary development and identification of mutations in congenital hypopituitary patients has helped determine many of the transcription factors responsible for pituitary ontogenesis, such as: HESX1 (2), LHX3 (3–5), LHX4 (6),

C

PITX2 (7), POU1F1 (8, 9), PROP1 (10), and SIX6 (11). The normal development and differentiation of the five cell types of the adenohypophysis require these factors to be expressed in a defined spatial and temporal pattern (12). Although these genes have been implicated in CPHD, variable penetrance and extrapituitary symptoms underscore the complexities of organogenesis (13). Thus, we embarked on a search for additional causative mutations using a candidate gene approach.

0021-972X/08/$15.00/0

Abbreviations: CPHD, Combined pituitary hormone deficiency; e, embryonic d; EV, empty pSG5 vector; MRI, magnetic resonance imaging; MUT, mutant; RLU, relative light unit; WT, wild type.

Printed in U.S.A. Copyright © 2008 by The Endocrine Society doi: 10.1210/jc.2008-1189 Received June 3, 2008. Accepted August 14, 2008. First Published Online August 26, 2008

J Clin Endocrinol Metab, November 2008, 93(11):4351– 4359

jcem.endojournals.org

4351

4352

Diaczok et al.

OTX2 Mutation Associated with CPHD

OTX2 (MIM 600037) belongs to the paired-class, bicoid subclass family of homeodomain genes, and is required for anterior brain and eye formation (14). Mammals have three OTX genes: OTX1, OTX2, and CRX (15). Mouse OTX1 and OTX2 are expressed in developing neural and sensory structures, including the brain, ear, nose, and eye (14). OTX2 expression is regulated in a spaciotemporal pattern with OTX2 expression proceeding and encompassing OTX1 expression domains during embryogenesis (16). OTX2 interacts with numerous proteins to coordinate cell determination and differentiation, including RX1, PAX6, SIX3, LHX2, MITF, GBX2, and HESX1 (17–22). Homozygous OTX2 knockout embryos die in midgestation due to severe brain abnormalities, whereas heterozygotes display highly variable phenotypes, from normal to severe craniofacial malformations, depending on the genetic background (23–25). Conditional ablation of OTX2 in retinal neural cells leads to failure of photoreceptor and pineal gland development (26). In humans, loss-of-function mutations in OTX2 have been associated with anophthalmia and microphthalmia, with highly pleiotropic phenotypical expression within an affected family. Humans with heterozygous mutations in OTX2 were reported to have a variety of structural eye malformations but without craniofacial abnormalities (27, 28). Although none of those patients was noted to have hypopituitarism, abnormal pituitary function has been described in two patients with heterozygous microdeletions in OTX2 (29, 30). Therefore, we undertook a mutational analysis of the OTX2 gene in patients with hypopituitarism. The three exons of the OTX2 gene map to the 14q22 human genomic region and encode a 297-aa protein. The protein has a homeodomain and a proline, serine, threonine-rich C-terminal region that contains a highly conserved SIWSPA peptide sequence and a tandemly repeated OTX tail. Normal control and patient DNA was assessed by direct sequencing. We identified two patients with a heterozygous mutation in the OTX2 gene (N233S). OTX2 is required for anterior neural plate induction, the region fated to become the anterior pituitary gland. OTX2 expression precedes and is required for initiation of HESX1 expression (31). HESX1 expression is maintained in the oral ectoderm and invaginating Rathke’s pouch until the onset of the PROP1 mediated cascade of gene activation (32, 33). Because OTX2 binding has been demonstrated on the HESX1 gene promoter, and found to be critical for expression (22), we used these elements for structural and functional studies to demonstrate that N233S mutant (MUT) OTX2 acts as a dominant inhibitor of target gene expression. Since expression of HESX1 plays a critical role in pituitary development and target gene expression (2, 22, 34 –36), inhibition


of HESX1 expression by the MUT OTX2 may result in hypopituitarism.

Patients and Methods Patients and controls Patients with hypopituitarism were recruited with informed consent and with appropriate institutional review board approval. Control DNA (n ⫽ 50) was obtained from healthy adults (Biochain, Hayward, CA). Genomic DNA was prepared from peripheral blood using the DNeasy Tissue Kit (QIAGEN, Inc., Valencia, CA). DNA from 19 patients with hypopituitarism was sequenced for mutations in eight genes (HESX1, LHX3, LHX4, OTX2, PITX2, POU1F1, PROP1, and SIX6). DNA from 31 additional patients with hypopituitarism was sequenced for mutations in exon 3 of the OTX2 gene.

PCR and sequencing The human OTX2 cDNA (GenBank accession no. CH471061.1) encodes three exons. Primers were designed to include the OTX2 coding regions and flanking intronic sequences (Table 1). For each PCR, 40 ng genomic DNA was amplified in a volume of 25 ␮l containing 800 ng of both forward and reverse primers, 0.8 ␮M deoxynucleotide triphosphate, 1 ␮l Taq (GeneChoice, Frederick, MD), and 10 ␮l 5⫻ Buffer I (Invitrogen Corp., Carlsbad, CA). PCR conditions were one cycle of 95 C for 4 min, 30 cycles of 95 C for 30 sec, 55 C for 30 sec, 72 C for 30 sec, and one cycle of 72 C for 7 min. PCR products were resolved by agarose gel electrophoresis to ensure adequate yield and to check for nonspecific products. Unincorporated primers and deoxynucleotide triphosphates were removed by incubating with ExoSap-IT (USB Corp., Cleveland, OH), an exonuclease I and shrimp alkaline phosphatase enzyme mix, for 15 min at 37 C, followed by 15 min at 80 C to inactivate the enzyme. Individual sequence traces were compared with wild type (WT) by visual inspection. A total of three PCR and sequencing reactions with new reagents were performed to verify fidelity. The exon 3 PCR product was cloned into the pTOPO cloning vector (Invitrogen) and sequenced using T7 and M13R primers to further confirm heterozygosity.

Plasmid construction The mOTX2 cDNA was obtained from Dr. Siew-Lan Ang (Mount Sinai Hospital, Toronto, Ontario, Canada), and subcloned into the BamHI/EcoRI site of the pSG5 expression vector (Stratagene, La Jolla, CA). The murine N233S MUT OTX2 plasmid, analogous to human N233S, was synthesized via site-directed mutagenesis. A HESX1 promoter-luciferase construct containing ⫺819 to ⫹119 bp of the human HESX1 promoter was obtained by PCR from human control DNA using homologous primers (sense 5⬘-CTTCCTGAAGGCTGGGAGACAT-3⬘, antisense 5⬘-CCCATCCCTCAAAAGATCAA-3⬘), and cloned into the KpnI/XhoI sites of the pGL3-basic luciferase reporter vector. Sequencing analysis of the reporter construct confirmed fidelity of the sequence and proper orientation. A multiple bicoid binding site promoter fragment was made by annealing complementary oligonucleotides containing six tandem repeats of an OTX2 consensus binding site sequence TTCTAATCCCT. The

TABLE 1. OTX2 PCR primer pairs and product sizes Exon 1 2 3A 3B

Sense strand (5ⴕ -> 3ⴕ)

Antisense strand (5ⴕ -> 3ⴕ)

PCR product (bp)

TTTAAAAGCCTCTGCCTCG GAGAGCATTGGTAGGCTCC GAGCCATTCTTGTCCTTAAGG CCACTGTCAGATCCCTTGT

GAACAGGGTGTTGCATCC TCTCCACAGTCCCATACTCG GAAGCTGGTGATGCATAG AATGCCTGGCTAAAACTGG

408 370 450 469

PCR of exon 3 is performed by two overlapping reactions. bp; Base pairs.


oligonucleotide containing designed KpnI and BglII overhangs was ligated into a KpnI/BglII linearized, alkaline phosphatase dephosphorylated pGL2-basic luciferase reporter vector. Sequencing analysis of the reporter construct confirmed fidelity of the sequence and proper orientation.

Site-directed mutagenesis An identical substitution of the patient’s OTX2 gene was made by changing nucleotide 674 (h698) of mOTX2 cDNA from an adenosine to a guanosine by in vitro site-directed-mutagenesis using the QuickChange kit (Stratagene). The PCR was performed with a double-stranded template generated from the WT cDNA in the plasmid vector, pSG5, and two complementary mutagenetic primers sense primer: 5⬘-CTCAGTCCCATGGGTACCAGTGCTGTTACCAGCCATCTC-3⬘; antisense primer: 5⬘GAGATGGCTGG TAACAGCACTGGTACCCATGGGACTGAG - 3⬘. After DNA amplification and Maxiprep kit purification (QIAGEN), the sequence, orientation, and presence of the mutation in the plasmid were confirmed by DNA sequencing.

EMSA EMSA was performed with OTX2 recombinant proteins and 32Plabeled DNA fragments. WT and MUT proteins were synthesized using the TNT coupled transcription and translation reticulocyte lysate system with T7 polymerase, according to the manufacturer’s protocol (Promega Corp., Madison, WI). To determine OTX2-DNA binding, a consensus OTX2 DNA binding site and three potential OTX2 binding sites located within HESX1’s proximal promoter region (BDI, BDII, and BDIII) were used (Table 2). These oligonucleotides were ␥32P-end labeled with T4 polynucleotide kinase. For each EMSA, in vitro translated proteins were mixed with radiolabeled probe for 30 min at room temperature, along with deoxyinosine-deoxycytosine, salmon sperm, and binding buffer [50 mM KCl, 20% glycerol, and 20 mM HEPES (pH 7.6 –7.8)]. Each sample was then separated by gel electrophoresis on a 5% nondenaturing acrylamide gel and analyzed by autoradiography. The OTX2 complexes were supershifted with a polyclonal OTX2 antibody. The binding was competed by addition of the unlabeled oligonucleotide in excess.

Transient transfection and cell culture Transient transfections were performed in 293T and GH3 cell lines. Cells were maintained in DMEM high glucose 1⫻ (4.5 g/liter D-glucose) (Life Technologies, Inc., Grand Island, NY), supplemented with L-glutamine, 1% antibiotic-antimycotic (100⫻) (Life Technologies), 110 mg/ liter sodium pyruvate, and 10% fetal bovine serum (Life Technologies). Cells were grown at 37 C in 5% CO2 and were transfected at 40 – 60% confluency. Total DNA was kept constant, and nonspecific effects of viral promoters were controlled using the empty pSG5 vector (EV). Luciferase activity in relative light units (RLUs) was measured at 48 h using the Lumat LB 9507 (Berthold Technologies, Oak Ridge, TN). 293T transient transfections were performed in six-well tissue culture plates using a calcium-phosphate technique (Invitrogen). For functional studies, the pSG5-mOTX2 cDNA was used. A total of 50 ng of a HESX1 proximal promoter luciferase vector was cotransfected with 100 ng WT OTX2, 50 ng EV/50 ng WT OTX2, 25 ng EV/50 ng WT OTX2/25 ng MUT OTX2, or 50 ng WT OTX2/50 ng MUT OTX2. In separate experiments, a total of 50 ng of a multiple bicoid binding site promoter luciferase vector was cotransfected with 100 ng WT OTX2, 50


4353

ng EV/50 ng WT OTX2, 25 ng EV/50 ng WT OTX2/25 ng MUT OTX2, or 50 ng WT OTX2/50 ng MUT OTX2. GH3 transient transfections were performed in six-well tissue culture plates using the Lipofectamine-plus technique (Invitrogen). A total of 25 ng of a HESX1 proximal promoter luciferase vector was cotransfected with 100 ng WT OTX2, 50 ng EV/50 ng WT OTX2, or 50 ng WT OTX2/50 ng MUT OTX2. Separately, a total of 200 ng of a multiple bicoid binding site promoter luciferase vector was cotransfected with 400 ng WT OTX2, 200 ng EV/200 ng WT OTX2, or 200 ng WT OTX2/ 200 ng MUT OTX2. Transfections were performed in triplicate for each condition within a single experiment, and experiments were repeated at least three times using different plasmid preparations of each construct. The relative luciferase activity for each control (EV) was set to one, and results were expressed as fold-promoter activation and represented as the SEM of representative experiments.

Statistical methods Transient transfection results are expressed as the SEM. Statistical analysis was performed using GraphPad Prism 4 (GraphPad Software Inc., San Diego, CA). The data were normalized to empty vector expression, and graphs depict fold change over empty vector. Group means were compared using single ANOVA and Tukey’s multiple comparison test, with P values less than 0.05 considered statistically significant.

Generation of polyclonal OTX2 antibody Anti-OTX2 antiserum was generated in rabbits immunized with the peptide SCPAATPRKQRRERT (residues 37–51) (Invitrogen). This peptide is identical in humans and mice.

Chemicals and reagents Unless otherwise indicated, all chemicals and reagents were obtained from Sigma-Aldrich Corporation (St. Louis, MO). Restriction enzymes were obtained from New England Biolabs (Beverly, MA).

Results Patient phenotype and characterization Patient 1 is a 6-yr-old male, who had a neonatal course complicated by hypoglycemia, hyperbilirubinemia, and poor feeding. Informed consent was obtained from the patient’s parents for genetic evaluation after a complete clinical and biochemical workup had been completed. Two weeks after his birth, the blood glucose level was 47 mg/dl and was associated with a low serum insulin level. Two GH levels of 2 and 3.7 ng/ml were obtained during hypoglycemia, and the IGF-I level was 5 ng/ml. An ACTH stimulation test (0.5 ␮g/m2) revealed cortisol levels of 1 ␮g/dl at baseline, 4 ␮g/dl at 30⬘, and 2 ␮g/dl at 60⬘. Further evaluation included T4 (4 ␮g/dl), free T4 index (4.6), and TSH (2.8 mIU/ml) levels. FSH (0.3 mIU/ml), LH (0.15 mIU/ml), and testosterone (⬍20 ng/dl) were also measured. These studies in-

TABLE 2. Electrophoretic Mobility Shift Assay sense strand oligonucleotides Consensus

5ⴕ-ggctgggtttTAATCCcttagaatgg-3ⴕ

BDI (⫺576 to ⫺571 bp) BDII (⫺432 to ⫺427 bp) BDIII (⫺410 to ⫺405 bp)

5⬘-tcctatgaatTAATCCaggcacttgg-3⬘ 5⬘-attttcatcaGAATTActgtaatagc-3⬘ 5⬘-tagcattaagAGATTAttattttttc-3⬘

BD I, II, and III are potential OTX2 binding domains within the human HESX1 proximal promoter.

4354

Diaczok et al.



of 158 cm and weight of 59 kg. The patient has one older brother who is in good health. Current hormone replacement for patient 1 includes levothyroxine, hydrocortisone, and recombinant GH. Patient 2 was a full-term female infant who presented with neonatal respiratory distress, hypoglycemia, and seizures. Informed consent was obtained from the patient’s parents for participation in this study. Shortly after birth, the patient required intubation and extra corporeal membrane oxygenation during her Neonatal Intensive Care Unit admission. A newborn screen showed abnormal thyroid results, and reFIG. 1. Sagittal MRI before and after contrast of patient 1 performed at 6.25 yr. A, Bright spot representing an ectopic neurohypophysis (arrow). B, Hypoplastic adenohypophysis along with absent or peat studies were consistent with central hyseverely hypoplastic stalk (arrow). pothyroidism. Further evaluation revealed both ACTH and GH deficiency. MRI at 2 dicate GH, ACTH, TSH, and gonadotropin deficiencies. months showed hypoplasia of the pituitary with a posterior Chromosomal analysis revealed a normal karyotype (46 XY), bright spot. There was no family history of pituitary dysfunction. and fluorescent in situ hybridization excluded Prader-Willi The patient’s mother is 168 cm tall, father is 188 cm, sister (age syndrome. 20 yr) is 163 cm, and her brother (age 16 yr) is 191 cm. The At 5 wk of age, the stretched phallus length was 2.5 cm; testes patient was 14 yr at participation in the current study, and evalwere descended and measured at 0.8 cm in longest diameter uation by her endocrinologist revealed Tanner I breast developbilaterally. An initial magnetic resonance imaging (MRI) at birth ment and a lack of pubic hair. Current hormone replacement for was reported as normal; however, repeat MRI at age 6.25 yr patient 2 includes levothyroxine, hydrocortisone, recombinant revealed an ectopic neurohypophysis, along with a hypoplastic GH, and estradiol. adenohypophysis and absent or severely hypoplastic pituitary stalk (Fig. 1). Mutation in OTX2 The family medical history was unremarkable for pituitary Genomic DNA was extracted from blood, and the transcripdysfunction or other endocrinopathies. At the child’s birth, the tion factors, HESX1, LHX3, LHX4, OTX2, PITX2, POU1F1, father was a healthy 23-yr-old male with a height of 178 cm and PROP1, and SIX6, were analyzed by sequencing coding regions weight of 82 kg. The patient’s mother was 22 yr old with a height and intron-exon borders. Sequencing analysis revealed a heterozygous base change of an adenosine to guanosine in codon 233, resulting in an amino acid change of an asparagine to serine (Fig. 2). No other mutations were identified in the other genes or intron-exon borders. This transition mutation is located in the C-terminal region, within the OTX1 transcription factor region believed to be involved in the recruitment of accessory proteins that determine transactivation capacity (37). This mutation was not found in 50 control patients or in 50 other patients diagnosed with CPHD. In addition, we sequenced HESX1’s proximal promoter region and verified the presence of all three potential bicoid binding sites (data not shown).

FIG. 2. Schematic illustration of OTX2 (297aa) showing the N-terminal domain (1– 47aa), homeodomain (HD) (47–102aa), poly-glutamine stretch (PolyQ) (102–109aa), SIWSPA region (158 –163aa), and repeated OTX-tail motif (Otx1 TF) (263–275aa and 281–293aa). A heterozygous mutation, A698G, was visualized by electropherogram and results in a change from an asparagine to a serine residue (codon 233). This mutation is located in the previously described OTX1 transcription factor region and was found in two unrelated patients of nonconsanguineous mating. ex, Exon.

The N233S MUT protein displays normal DNA binding EMSA analysis revealed that both WT and N233S MUT OTX2 proteins were able to bind to a high-affinity OTX2 consensus site in a concentration-dependent manner


(Fig. 3A). In addition, WT and MUT OTX2 proteins were able to bind equivalently to two sites within the HESX1 proximal promoter region, BDI and BDIII (Fig. 3B). Conversely, neither WT nor MUT OTX2 exhibited binding to BDII of the HESX1 promoter. The binding was specific for OTX2 because the addition of excess nonlabeled specific oligonucleotide eliminated the protein-DNA complex (data not shown), and the complex was supershifted by addition of the OTX2 polyclonal antibody (Fig. 3C). The N233S MUT has decreased transactivation capacity on the HESX1 promoter and a multiple bicoid binding site promoter Functional analysis of the mutation was assessed using luciferase reporter gene assays. Reporter and expression vectors were cotransfected into either a heterologous 293T human embryonal cell line or the GH producing GH3 cell line (Fig. 4). The HESX1 proximal promoter, spanning ⫺819 to ⫹119 bp, was fused to the pGL3-basic luciferase vector. This promoter region contains three predicted OTX2 binding sites, a PAX6 site, a Lim-binding site, and the TATA box. The multiple bicoid binding site fragment contains six consensus OTX2 binding sites, separated by spacer bases, fused to pGL2-basic luciferase vector. In the heterologous 293T cells, WT OTX2 alone induced a 1.30 ⫾ 0.05-fold increase (23%) in the activity of the luciferase gene fused to the ⫺819-bp HESX1 promoter. A 1.39 ⫾ 0.15-fold increase (28%) was obtained when equal amounts of EV and WT were cotransfected. In the GH producing GH3 cells, WT induced a similar 1.32 ⫾ 0.07-fold increase (24%), as did equivalent amounts of EV and WT, 1.53 ⫾ 0.10 (35%). Equal amounts of WT and N233S MUT OTX2 were coexpressed in 293T or GH3 cells, resulting in decreased transactivation capacity on the HESX1 promoter reporter construct, 0.63 ⫾ 0.03-fold (52%) and 0.56 ⫾ 0.07-fold (57%), respectively. In addition, a synthetic multiple bicoid binding site oligonucleotide was fused to a luciferase reporter gene. In 293T cells, WT induced a 2.08 ⫾ 0.17-fold increase (52%) in the activity of the luciferase gene. Equivalent amounts of EV and WT had a 2.16 ⫾ 0.18-fold increase (54%) in transactivation. When equal amounts of WT and MUT were cotransfected, a 0.67 ⫾ 0.07-fold decrease compared with WT alone was observed, representing a 68% decrease in transactivation. Cotransfection of WT and the multiple bicoid binding site reporter construct into GH3 cells induced a 4.47 ⫾ 0.39 (78%) increase in transactivation over EV alone. A 3.48 ⫾ 0.21-fold increase (71%) in activity was observed with equivalent amounts of EV and WT. When equal amounts of WT and MUT were cotransfected with the multiple bicoid binding site reporter in GH3 cells, a 1.43 ⫾ 0.19-fold increase over WT alone was observed, representing a 68% decrease in transactivation.

Discussion We report two unrelated patients of nonconsanguineous mating with no family history of pituitary abnormalities who presented with multiple pituitary hormone deficiencies: GH, TSH, LH,


4355

FSH, and ACTH. In addition, neuroimaging (MRI) indicated anterior pituitary hypoplasia and an ectopic posterior pituitary (but no midline or optic nerve abnormalities). In both families there is no history of hypopituitarism or consanguinity Sequencing analysis of coding regions (including intron-exon borders) of the pituitary specific transcription factors, including HESX1, LHX3 and 4, OTX2, PITX2, POU1F1, PROP1, and SIX6 revealed a novel heterozygous mutation in OTX2. The mutation is in the C-terminal domain, which has been shown to interact directly with HNF-3B and LIM1, enhancing OTX2’s transactivation of a target sequence in culture (37). These results indicate the importance of OTX2’s C-terminal region in the potential association with various transcriptional proteins and subsequent control of target gene expression. Ragge et al. (27) reported eight families with heterozygous coding-region changes in OTX2, presenting with varying ocular malformations ranging from bilateral anophthalmia to retinal defects. They also reported that most of these patients had below average height, weight, and occipital-frontal circumference. A patient with a de novo deletion at 14q22-23, which includes the genes BMP4, OTX2, RTN1, SIX6, SIX1, and SIX4, has recently been described with anophthalmia, pituitary hypoplasia, and ear anomalies. This child exhibited small, undescended testes, a low IGF-I, poor GH response to glucagon stimulation, normal thyroid function, and a normal cortisol response to stress. Brain MRI at 6 months revealed an absent pituitary gland and an ectopic posterior pituitary along with optic abnormalities. His height at 5 yr of age was below the first percentile (29). This is the fourth patient reported in the literature with similar phenotypical characteristics and a deletion at 14q22-q23 (30, 38, 39). However, because a large genetic region spanning greater than 50 MB is deleted, which includes several genes implicated in pituitary development, it is not possible to implicate a specific gene product in the development of hypopituitarism in these patients. OTX2 is a member of the bicoid class of homeodomain proteins that recognize a TAATCC core sequence and functions as a transcriptional regulator of the rostral neuroectoderm during embryogenesis (14). Studies of Drosophila revealed the importance of orthodenticle, an orthologue of OTX2, in the development of the nervous system and visual structures (40). Subsequently, studies of OTX2 knockout mice confirmed the importance of OTX2 in anterior neuroectoderm specification during gastrulation because these mice lack the rostral neuroectoderm fated to become forebrain, midbrain, and rostral hindbrain. Depending on their genetic background, heterozygous OTX2⫹/⫺ knockout mice present with varying degrees of craniofacial and brain malformations, and mice show head abnormalities similar to otocephalic phenotypes (23–25). Detailed murine studies showed that OTX2 is necessary for craniofacial development [until embryonic days (e) 10.5], postnatal survival (e10.5-12.5), body growth (e12.5-14.5), superior colliculi identity (e10.5-14.5), ventral midbrain neuronal differentiation (e10.5-14.5), caudal mesencephalon development (e10.5-16.5), and posterior cerebellum development (e16.5 and onwards) (41). Because understanding the mechanisms involved in potentially mediating the effects of OTX2 on anterior brain

4356

Diaczok et al.



FIG. 3. A, An EMSA was performed using the consensus OTX2 binding sequence incubated with in vitro transcribed and translated empty vector, WT or N233S (MUT) OTX2 protein. Lanes 2– 4 and 5–7 demonstrate increased intensity of binding with the addition of increasing quantities of in vitro translated OTX2 (2, 4, or 8 ␮l). The OTX2 complex is denoted by an arrowhead. B, Probes containing consensus, BDI, BDII, and BDIII sites were incubated with in vitro translated WT or MUT OTX2. Binding of both WT and MUT OTX2 was observed, as shown in lanes 1 and 2 (CON), 3 and 4 (BDI), and 7 and 8 (BDIII), whereas no binding was seen in lanes 5 and 6 (BDII) of the EMSA (denoted by arrowhead). Lane 9 is empty vector incubated with consensus sequence. C, Consensus, BDI, and BDIII probes were incubated with WT or MUT OTX2 protein, followed by addition of a polyclonal OTX2 antibody resulting in “supershifted” (SS) protein-DNA complexes by EMSA (denoted by the double arrowhead).

development and gene expression involves identifying target genes, Zakin et al. (42) used serial analysis of gene expression to quantify gene expression from libraries constructed from OTX2⫺/⫺ mice at an early gastrulation stage (6.5 days post-

coitum). Over 100 mRNA tags were identified, and, for several, an anatomical developmental analysis was performed (42). OTX2 is a specifier of the mammalian forebrain and has been shown to activate HESX1 promoter activity. Rathke’s pouch



4357

report a patient with a homozygous HESX1 mutation (I26T) that led to partial loss of repression through recruitment of a corepressor, resulting in anterior pituitary hypoplasia but with no midline or optic nerve abnormalities. Cohen et al. (36) report a patient with a dominant negative mutation of HESX1, resulting in increased repression of target genes due to increased binding to PROP1, thus impeding the normal PROP1 mediated activation. Analysis of murine OTX2 knockout MUTs suggested a direct interaction with HESX1 because some forebrain-specifying genes failed to be transcribed in the anterior neural plate, notably HESX1 (31). The proximal promoter region of HESX1 contains three potential OTX2 binding sites, and whereas OTX2 is necessary for the transactivation of HESX1, dosage analysis revealed that excess OTX2 does not increase HESX1 expression (22). Therefore, we sought to characterize the ability of the murine N233S OTX2 MUT protein to bind DNA and transactivate target gene expression. Because human and mouse OTX2 proteins are identical, we perFIG. 4. A and B, Transient transfection studies were performed in a heterologous cell line, 293T (A), or a formed our in vitro analysis using murine GH expressing cell line, GH3 (B). The HESX1 proximal promoter and 5⬘ untranslated region (⫺819 to ⫹119 bp) were fused to the luciferase reporter construct and transfected along with expression vectors OTX2 (44). First, we performed EMSA, containing WT OTX2, MUT OTX2, or an empty pSG5 (EV). The promoter activity seen with WT OTX2 which demonstrated that both WT and overexpression or equal amounts of either EV/WT or WT/MUT OTX2 were compared with that seen with MUT OTX2 bound equally well to two sites EV. In addition, in 293T cells WT concentration was held constant as the amount of MUT expression vector was increased. Percent expression of HESX1 reporter plasmid is calculated with respect to WT. Each in the 5⬘ flanking region of the HESX1 gene independent experiment was performed in triplicate. The graphs show the mean ⫾ SEM of the fold change and that their binding is specific. This was from at least 10 representative experiments. For each experiment the coefficient of variation values were expected because the mutation lies outside less than 10%. C and D, Transient transfection studies were performed in a heterologous cell line, 293T (C), or a GH expressing cell line, GH3 (D). A multiple bicoid binding site luciferase reporter construct was the domains responsible for DNA binding. transfected along with expression vectors containing WT OTX2, MUT OTX2, or empty pSG5 (EV). The Functional studies in heterologous 293T promoter activity seen with OTX2 expression or equal amounts of either EV/WT or WT/MUT OTX2 were cells display a dominant negative effect on compared with that seen with EV. In addition, in 293T cells WT OTX2 concentration is held constant as the concentration of MUT OTX2 expression vector was increased. Percent expression of the multiple bicoid both the proximal promoter region of binding site reporter plasmid is calculated with respect to WT. Each independent experiment was HESX1 and a multiple bicoid binding site performed in triplicate. The graphs show the mean ⫾ SEM of the fold change from at least 10 reporter construct. Similarly, studies in the representative experiments. For each experiment the coefficient of variation values were less than 10%. *, P ⬍ 0.01; **, P ⬍ 0.001. GH producing GH3 cells showed that expression of the MUT N233S OTX2 repressed reporter expression. Thus, this heterozygous mutation in homeobox, also referred to as HESX1, is a paired-like homeOTX2 acts as a dominant inhibitor of the HESX1 gene. Because odomain transcription factor required for the normal develthe mutation lies within a region important for protein-protein opment of the forebrain, eye, and other anterior structures. In interactions, it is plausible that the dominant negative effect is mice, HESX1 knockouts demonstrate defects in midline strucassociated with interaction with yet unidentified proteins. tures, including the optic nerves and Rathke’s pouch. ComDisruption of early developmental events has been shown to pared with WT littermates, the HESX1 MUT anterior pituresult in anterior pituitary hormone deficiencies. HESX1 mutaitary was smaller and less “intimately” associated with the tions affecting the homeodomain were described in two patients posterior lobe (2). with pituitary aplasia, but normally located posterior pituitary In humans, HESX1 mutations have been described and exand no optic nerve abnormalities. Functional analysis indicates hibit a range of phenotypes, from septooptic dysplasia to isolated that these mutations are unable to inhibit PROP1 activity (45). pituitary hormone deficiencies. HESX1 is expressed early in the In addition, transgenic mouse models overexpressing PROP1 developing anterior pituitary gland and acts as a repressor of early in development results in pituitary hypoplasia (33). The downstream gene expression. Subsequent PROP1 expression absence of HESX1 or the early expression of PROP1 results in an extinguishes HESX1 expression and leads to the PROP1 meabsent anterior pituitary gland. It is plausible that this mutation diated cascade of gene activation (33, 36). Carvalho et al. (43)

4358

Diaczok et al.


in OTX2, resulting in a decrease in expression of HESX1, may similarly be prematurely activating the PROP1 mediated cascade, resulting in a hypoplastic anterior pituitary. In summary, we have identified an OTX2 mutation (N233S) in two patients with anterior pituitary hormone deficiencies. This MUT OTX2 binds normally to target genes but acts as a dominant inhibitor of the HESX1 gene. This suggests that hypopituitarism may be due to diminished expression of HESX1 during anterior pituitary development, interrupting the normal cascade of spaciotemporal events leading to pituitary organogenesis and gene expression. This mutation expands our current knowledge of transcription factors responsible for anterior pituitary development.


11.

12. 13.

14.

15. 16.

Acknowledgments We thank the patients who participated in our study, along with Dr. Thierry A. G. M. Huisman for interpretation of magnetic resonance imaging scans. We give special thanks to Fredric Wondisford, Andrew Wolfe, Sara Divall, Helen Kim, Ronald Cohen, Yewade Ng, George Park, and David Cooke for their expert contributions. Address all correspondence and requests for reprints to: Sally Radovick, M.D., Division of Pediatric Endocrinology, The Johns Hopkins University School of Medicine, 600 North Wolfe Street, CMSC 406, Baltimore, Maryland 21287. E-mail: [email protected]. This work was supported by National Institutes of Health, R01 HD34551-06 (to S.R.). Disclosure Summary: The authors have nothing to disclose.

References 1. Dattani MT, Robinson IC 2000 The molecular basis for developmental disorders of the pituitary gland in man. Clin Genet 57:337–346 2. Dattani MT, Martinez-Barbera JP, Thomas PQ, Brickman JM, Gupta R, Martensson IL, Toresson H, Fox M, Wales JK, Hindmarsh PC, Krauss S, Beddington RS, Robinson JC 1998 Mutations in the homeobox gene HESX1/Hesx1 associated with septo-optic dysplasia in human and mouse. Nat Genet 2:125–133 3. Zhadanov AB, Bertuzzi S, Taira M, Dawid IB, Westphal H 1995 Expression pattern of the murine LIM class homeobox gene Lhx3 in subsets of neural and neuroendocrine tissues. Dev Dyn 4:354 –364 4. Mbikay M, Tadros H, Seidah NG, Simpson EM 1995 Linkage mapping of the gene for the LIM-homeoprotein LIM3 (locus Lhx3) to mouse chromosome 2. Mamm Genome 11:818 – 819 5. Bach I, Rhodes SJ, Pearse 2nd RV, Heinzel T, Gloss B, Scully KM, Sawchenko PE, Rosenfeld MG 1995 P-Lim, a LIM homeodomain factor, is expressed during pituitary organ and cell commitment and synergizes with Pit-1. Proc Natl Acad Sci USA 7:2720 –2724 6. Li H, Witte DP, Branford WW, Aronow BJ, Weinstein M, Kaur S, Wert S, Singh G, Schreiner CM, Whitsett JA 1994 Gsh-4 encodes a LIM-type homeodomain, is expressed in the developing central nervous system and is required for early postnatal survival. EMBO J 12:2876 –2885 7. Semina EV, Reiter R, Leysens NJ, Alward WL, Small KW, Datson NA, SiegelBartelt J, Bierke-Nelson D, Bitoun P, Zabel BU, Carey JC, Murray JC 1996 Cloning and characterization of a novel bicoid-related homeobox transcription factor gene, RIEG, involved in Rieger syndrome. Nat Genet 4:392–399 8. Bodner M, Castrillo JL, Theill LE, Deerinck T, Ellisman M, Karin M 1988 The pituitary-specific transcription factor GHF-1 is a homeobox-containing protein. Cell 3:505–518 9. Ingraham HA, Chen RP, Mangalam HJ, Elsholtz HP, Flynn SE, Lin CR, Simmons DM, Swanson L, Rosenfeld MG 1988 A tissue-specific transcription factor containing a homeodomain specifies a pituitary phenotype. Cell 3:519 –529 10. Sornson MW, Wu W, Dasen JS, Flynn SE, Norman DJ, O’Connell SM,

17.

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

Gukovsky I, Carriere C, Ryan AK, Miller AP, Zuo L, Gleiberman AS, Andersen B, Beamer WG, Rosenfeld MG 1996 Pituitary lineage determination by the Prophet of Pit-1 homeodomain factor defective in Ames dwarfism. Nature 6607:327–333 Jean D, Bernier G, Gruss P 1999 Six6 (Optx2) is a novel murine Six3-related homeobox gene that demarcates the presumptive pituitary/hypothalamic axis and the ventral optic stalk. Mech Dev 84:31– 40 Cohen LE, Radovick S 2002 Molecular basis of combined pituitary hormone deficiencies. Endocr Rev 4:431– 442 Kelberman D, Dattani MT 2006 The role of transcription factors implicated in anterior pituitary development in the aetiology of congenital hypopituitarism. Ann Med 8:560 –577 Simeone A, Acampora D, Mallamaci A, Stornaiuolo A, D’Apice MR, Nigro V, Boncinelli E 1993 A vertebrate gene related to orthodenticle contains a homeodomain of the bicoid class and demarcates anterior neuroectoderm in the gastrulating mouse embryo. EMBO J 7:2735–2747 Germot A, Lecointre G, Plouhinec JL, Le Mentec C, Girardot F, Mazan S 2001 Structural evolution of Otx genes in craniates. Mol Biol Evol 9:1668 –1678 Simeone A, Acampora D, Gulisano M, Stornaiuolo A, Boncinelli E 1992 Nested expression domains of four homeobox genes in developing rostral brain. Nature 6388:687– 690 Vernay B, Koch M, Vaccarino F, Briscoe J, Simeone A, Kageyama R, Ang SL 2005 Otx2 regulates subtype specification and neurogenesis in the midbrain. J Neurosci 19:4856 – 4867 Zuber ME, Gestri G, Viczian AS, Barsacchi G, Harris WA 2003 Specification of the vertebrate eye by a network of eye field transcription factors. Development 21:5155–5167 Rath MF, Munoz E, Ganguly S, Morin F, Shi Q, Klein DC, Moller M 2006 Expression of the Otx2 homeobox gene in the developing mammalian brain: embryonic and adult expression in the pineal gland. J Neurochem 2:556 –566 Martinez-Morales JR, Dolez V, Rodrigo I, Zaccarini R, Leconte L, Bovolenta P, Saule S 2003 OTX2 activates the molecular network underlying retina pigment epithelium differentiation. J Biol Chem 24:21721–21731 Heimbucher T, Murko C, Bajoghli B, Aghaallaei N, Huber A, Stebegg R, Eberhard D, Fink M, Simeone A, Czerny T 2007 Gbx2 and Otx2 interact with the WD40 domain of Groucho/Tle corepressors. Mol Cell Biol 1:340 –351 Spieler D, Baumer N, Stebler J, Koprunner M, Reichman-Fried M, Teichmann U, Raz E, Kessel M, Wittler L 2004 Involvement of Pax6 and Otx2 in the forebrain-specific regulation of the vertebrate homeobox gene ANF/Hesx1. Dev Biol 2:567–579 Acampora D, Mazan S, Lallemand Y, Avantaggiato V, Maury M, Simeone A, Brulet P 1995 Forebrain and midbrain regions are deleted in Otx2⫺/⫺ mutants due to a defective anterior neuroectoderm specification during gastrulation. Development 10:3279 –3290 Ang SL, Jin O, Rhinn M, Daigle N, Stevenson L, Rossant J 1996 A targeted mouse Otx2 mutation leads to severe defects in gastrulation and formation of axial mesoderm and to deletion of rostral brain. Development 1:243–252 Matsuo I, Kuratani S, Kimura C, Takeda N, Aizawa S 1995 Mouse Otx2 functions in the formation and patterning of rostral head. Genes Dev 21: 2646 –2658 Nishida A, Furukawa A, Koike C, Tano Y, Aizawa S, Matsuo I, Furukawa T 2003 Otx2 homeobox gene controls retinal photoreceptor cell fate and pineal gland development. Nat Neurosci 12:1255–1263 Ragge NK, Brown AG, Poloschek CM, Lorenz B, Henderson RA, Clarke MP, Russell-Eggitt I, Fielder A, Gerrelli D, Martinez-Barbera JP, Ruddle P, Hurst J, Collin JR, Salt A, Cooper ST, Thompson PJ, Sisodiya SM, Williamson KA, Fitzpatrick DR, van Heyningen V, Hanson IM 2005 Heterozygous mutations of OTX2 cause severe ocular malformations. Am J Hum Genet 6:1008 –1022 Henderson RA, Williamson K, Cumming S, Clarke MP, Lynch SA, Hanson IM, FitzPatrick DR, Sisodiya S, van Heyningen V 2007 Inherited PAX6, NF1 and OTX2 mutations in a child with microphthalmia and aniridia. Eur J Hum Genet 8:898 –901 Nolen LD, Amor D, Haywood A, St Heaps L, Willcock C, Mihelec M, Tam P, Billson F, Grigg J, Peters G, Jamieson RV 2006 Deletion at 14q22–23 indicates a contiguous gene syndrome comprising anophthalmia, pituitary hypoplasia, and ear anomalies. Am J Med Genet A 16:1711–1718 Elliott J, Maltby EL, Reynolds B 1993 A case of deletion 14(q22.1-⬎q22.3) associated with anophthalmia and pituitary abnormalities. J Med Genet 3:251–252 Rhinn M, Dierich A, Le Meur M, Ang S 1999 Cell autonomous and non-cell autonomous functions of Otx2 in patterning the rostral brain. Development 19:4295– 4304 Hermesz E, Mackem S, Mahon KA 1996 Rpx: a novel anterior-restricted homeobox gene progressively activated in the prechordal plate, anterior neural plate and Rathke’s pouch of the mouse embryo. Development 122:41–52


33. Dasen JS, Barbera JP, Herman TS, Connell SO, Olson L, Ju B, Tollkuhn J, Baek SH, Rose DW, Rosenfeld MG 2001 Temporal regulation of a paired-like homeodomain repressor/TLE corepressor complex and a related activator is required for pituitary organogenesis. Genes Dev 23:3193–3207 34. McNay DE, Turton JP, Kelberman D, Woods KS, Brauner R, Papadimitriou A, Keller E, Keller A, Haufs N, Krude H, Shalet SM, Dattani MT 2007 HESX1 mutations are an uncommon cause of septooptic dysplasia and hypopituitarism. J Clin Endocrinol Metab 2:691– 697 35. Tajima T, Hattorri T, Nakajima T, Okuhara K, Sato K, Abe S, Nakae J, Fujieda K 2003 Sporadic heterozygous frameshift mutation of HESX1 causing pituitary and optic nerve hypoplasia and combined pituitary hormone deficiency in a Japanese patient. J Clin Endocrinol Metab 1:45–50 36. Cohen RN, Cohen LE, Botero D, Yu C, Sagar A, Jurkiewicz M, Radovick S 2003 Enhanced repression by HESX1 as a cause of hypopituitarism and septooptic dysplasia. J Clin Endocrinol Metab 10:4832– 4839 37. Nakano T, Murata T, Matsuo I, Aizawa S 2000 OTX2 directly interacts with LIM1 and HNF-3␤. Biochem Biophys Res Commun 1:64 –70 38. Bennett CP, Betts DR, Seller MJ 1991 Deletion 14q (q22q23) associated with anophthalmia, absent pituitary, and other abnormalities. J Med Genet 4:280 –281 39. Lemyre E, Lemieux N, Decarie JC, Lambert M 1998 Del(14)(q22.1q23.2) in a patient with anophthalmia and pituitary hypoplasia. Am J Med Genet 2:162–165


4359

40. Finkelstein R, Smouse D, Capaci TM, Spradling AC, Perrimon N 1990 The orthodenticle gene encodes a novel homeo domain protein involved in the development of the Drosophila nervous system and ocellar visual structures. Genes Dev 9:1516 –1527 41. Fossat N, Chatelain G, Brun G, Lamonerie T 2006 Temporal and spatial delineation of mouse Otx2 functions by conditional self-knockout. EMBO Rep 8:824 – 830 42. Zakin L, Reversade B, Virlon B, Rusniok C, Glaser P, Elalouf JM, Brulet P 2000 Gene expression profiles in normal and Otx2⫺/⫺ early gastrulating mouse embryos. Proc Natl Acad Sci USA 26:14388 –14393 43. Carvalho LR, Woods KS, Mendonca BB, Marcal N, Zamparini AL, Stifani S, Brickman JM, Arnhold IJ, Dattani MT 2003 A homozygous mutation in HESX1 is associated with evolving hypopituitarism due to impaired repressorcorepressor interaction. J Clin Invest 8:1192–1201 44. Leuzinger S, Hirth F, Gerlich D, Acampora D, Simeone A, Gerhing WJ, Finkelsteain R, Furukubo-Tokunaga K, Reichert H 1998 Equivalence of the fly orthodenticle gene and the human OTX genes in embryonic brain development of Drosophila. Development 125:1703–1710 45. Sobrier ML, Maghnie M, Vie-Luton MP, Secco A, di Iorgi N, Lorini R, Amselem S 2006 Novel HESX1 mutations associated with a life-threatening neonatal phenotype, pituitary aplasia, but normally located posterior pituitary and no optic nerve abnormalities. J Clin Endocrinol Metab 11: 4528 – 4536