A Novel Frameshift Mutation in a Brazilian Patient with the Classical ...

0013-7227/01/$03.00/0 Printed in U.S.A.

The Journal of Clinical Endocrinology & Metabolism 86(12):5877–5880 Copyright © 2001 by The Endocrine Society

H28ⴙC Insertion in the CYP21 Gene: A Novel Frameshift Mutation in a Brazilian Patient with the Classical Form of 21-Hydroxylase Deficiency IVY F. LAU, FERNANDA C. SOARDI, SOFIA H. V. LEMOS-MARINI, GIL GUERRA JR., MARIA TEREZA M. BAPTISTA, AND MARICILDA P. DE MELLO Centro de Biologia Molecular e Engenharia Gene´tica (I.F.L., F.C.S., M.P.D.M.); Departamento de Pediatria/Centro de Investigaçaõ em Pediatria (S.H.V.L.-M., G.G.); and Disciplina de Endocrinologia-Faculdade de Cieˆncias Me´dicas (M.T.M.B.), Universidade Estadual de Campinas, 13083-970 Campinas, Saõ Paulo, Brasil In the classical form of 21-hydroxylase deficiency, CYP21affected genes either carry mutations present in the CYP21P pseudogene (microconversions) or bear a chimeric gene that replaces the active gene as a result of large conversion or deletion mutational events. Previous genotyping of 41 Brazilian patients revealed 64% microconversion, whereas deletions and large gene conversions accounted for up to 21% of the molecular defect. The present paper describes a new mutation disclosed by sequencing an entire gene in which no

C

ONGENITAL ADRENAL HYPERPLASIA (CAH) due to 21-hydroxylase deficiency is one of the most common inborn errors of metabolism. The classical form of 21hydroxylase deficiency may result in two distinct phenotypes: salt-wasting (SW) and simple virilizing (SV). Cortisol biosynthesis is impaired in both SW and SV forms (1). The main consequence is an increased production of androgens, generally causing ambiguous external genitalia at birth in females, precocious puberty in males, and acceleration of somatic growth in both males and females. The SW form also involves impairment of aldosterone production, causing failure to thrive and dehydration due to salt loss (1). Gene deletions, gene conversions, and mutations normally present in the pseudogene account for 90 –95% of the diseasecausing alleles in all populations (1). Therefore, about 5–10% of 21-hydroxylase-deficient alleles do not bear any of the nine most frequent mutations related to the classical form. To date, a total of 52 CYP21 gene mutations have been deposited in the Cardiff Human Gene Mutation Database (2). More than 30 mutations are rare and have been described in specific families with SW- or SV-affected children (3–14). Although the great majority of rare mutations are considered to be present only in the CYP21 gene, some of them can be found in some CYP21P alleles, according to Wedell and Luthman (15). In two previous papers (16, 17), the results of deletions, gene conversions, and microconversion analyses involving a total of 41 Brazilian families with children presenting the classical form of 21-hydroxylase deficiency were reported. Twenty-one percent of the affected alleles showed deletion Abbreviations: ASO, Allele-specific oligonucleotide; CAH, congenital adrenal hyperplasia; SV, simple virilizing; SW, salt-wasting.

pseudogene-originated mutation had been found. The patient with the classical form of 21-hydroxylase deficiency is the daughter of a consanguineous marriage, and she is homozygous for a novel frameshift H28ⴙC within exon 1. The mutation causes a stop codon at amino acid 78. Both parents are heterozygous for the mutation as confirmed by allele-specific oligonucleotide PCR. The H28ⴙC is not present in the published CYP21P sequences and is likely to result in an enzyme with no activity. (J Clin Endocrinol Metab 86: 5877–5880, 2001)

or large gene conversion, 64% carried microconversions, and 15% remained undetermined. This paper describes one novel mutation found in a homozygous patient with no pseudogene-originated mutation. Materials and Methods The study was undertaken under an institutionally approved protocol, and informed consent was obtained from all subjects.

Patient A Caucasian girl was delivered normally after the uneventful pregnancy of a 33-yr-old mother. Parents are first-degree cousins, and both are healthy. CAH was diagnosed in the patient’s second week of life. She had clitoromegaly, complete fusion of the labioscrotal folds (Prader grade III), no palpable gonads, hyponatremia (Na 126 mEq/liter), and high levels of urinary 17-ketosteroids, and she failed to thrive. Treatment with oral prednisone and fludrocortisone was started. Clitoroplasty and vaginoplasty were performed twice at the ages of 1 and 8 yr. In our first examination, at the age of 7, her bone age was 9 yr of age, according to Greulich and Pyle’s method; she weighed 20.5 kg (z ⫽ ⫺0.07), her height was 113.5 cm (z ⫽ ⫺0.82), and she had clitoral enlargement (3 cm) with posterior fusion of the labioscrotal folds but no acne or hirsutism. The karyotype was 46,XX. After treatment with prednisone and fludrocortisone, neither dehydration nor abnormal plasmatic renin activity has occurred. She had normal puberty (menarche at 12). At age 14, the patient decided to stop the treatment and went 4 months without medication. During that period she had no clinical symptoms of adrenal insufficiency, but when she returned for treatment she presented dark skin, irregular menses, and high 17-hydroxyprogesterone and androstenedione4 serum levels with normal plasmatic renin activity.

DNA analysis CYP21 gene was amplified from genomic DNA into two segments by PCR using selective primers (18) (Table 1). Internal primers were used in the sequencing reactions or in nested-PCR before the sequencing procedures (Table 1). The amplified fragments were treated with the PCR Product Pre-sequencing Kit (Amersham Pharmacia

5877

5878

J Clin Endocrinol Metab, December 2001, 86(12):5877–5880

Lau et al. • Novel Mutation on CYP21-Affected Alleles

TABLE 1. CYP21 gene primers used in PCR and sequencing Purpose

Primer

CYP21 gene selection

Ex6naa Ex6nsa 5⬘21B1s Int10as 5⬘21B2 ProEx1s Int1as Int2as Int2s Ex3nsa Ex3nasa Int3as Int4as Int4s Int6as Int6s Int7as Int7s Int8as Ex81naa 21Bex9s Int2/Aa Int2/Ca Int2/Ga H28norsense H28mutsense

Sequencing

ASO-PCR

Sequence (5⬘–3⬘)

AGCTGCATCTCCACGATGTGA GAGGGATCACATCGTGGAGATG GAGTGAGTGCCCACAAAGC GAAACTGAGGTACCCGGC AGTAAACTGGCCCACGGTG GGATGGCTGGGGCTCTTGAG CAGCCAAAGCAGCGTCAGCG CACACTTGAGGCTGAGGTGG CCTTCATCAGTTCCCACCCTC CGGACCTGTCCTTGGGAGACTAC TCCAGAGCAGGGAGTAGTCTC CTGTGAGAGGCGAGGCTGAC CAGTTCAGGACAAGGAGAGGC GTGCCTCACAGCCCCTCAG GGTGAAAGGAGCGGGCTGAG CAGTGATGCTACCGGCCTC CAGAGCTGAGTGAGGGTG CCGGCACTCAGGCTCACT GGGCTGGAGTTAGAGGCTGG TTCGTGGTCTAGCTCCTCCTG TTGGGGATGAGTGAGGAAAG TTCCCACCCTCCAGCCCCCAA TTCCCACCCTCCAGCCCCCAC TTCCCACCCTCCAGCCCCCAG GAAGCTCCGGAGCCTCCACC GAAGCTCCGGAGCCTCCCAC

Tm (C)

Nucleotide position

64.0 63.0 60.0 58.0 60.0 66.0 66.0 64.0 60.0 70.0 70.0 60.0 62.0 64.0 66.0 62.0 60.0 60.0 62.0 67.0 60.0 70.0 70.0 70.0 68.0 68.0

1380 –1400 1373–1395 (⫺655)–(⫺637) 2732–2749 (⫺352)–(⫺334) (⫺58)–(⫺39) 272–291 498 –517 629 – 649 692–714 707–727 856 – 875 1078 –1098 1036 –1054 1555–1574 1454 –1472 1841–1858 1891–1908 2219 –2238 1999 –2019 2177–2196 635– 656 635– 656 635– 656 66 – 85 66 – 85

s, Sense; as, antisense; Ex, exon; Int, intron. Numbers in primer names indicate the corresponding exon or intron. Primers described by Wilson et al. (18).

a

Biotech, Arlington Heights, IL) and were directly sequenced with Thermo-Sequenase Radiolabeled Terminator Cycle Sequencing Kit (Amersham Pharmacia Biotech). Sequencing data were compared with the CYP21 gene sequence described by Higashi et al. (19) (GenBank Accession no. M12792). Allele-specific oligonucleotide (ASO)-PCR analysis for 656A/C3 G polymorphism/mutation was carried out as described by Wilson et al. (18), whereas the ASO-PCR for H28⫹C mutation was performed using primers described in Table 1. The reaction mixture for the latter experiment consisted of: 1 ␮g genomic DNA, 1⫻ Taq polymerase buffer (Life Technologies, Inc., Gaithersburg, MD), 1.5 mm MgCl2, 0.2 mm dNTP, 1% BSA, 20 pmol of each primer, 2.0 U Taq DNA polymerase (Life Technologies, Inc.) in a final volume of 30 ␮l. PCR steps were: 94 C for 5 min (1 cycle); 12 cycles of 94 C for 1 min, a touchdown annealing step at 72– 65 C for 1 min (⫺0.5 C per step), 72 C for 1 min; 30 cycles of 94 C for 1 min, 65 C for 1 min, 72 C for 1 min; and a final cycle at 72 C for 5 min.

Results

In the present study, the 21-hydroxylase disease-causing allele in a Brazilian girl with the classical form of 21-hydroxylase deficiency was analyzed. Sequencing the entire CYP21 gene (10 exons and 9 introns, 655 nucleotides upstream to the transcription initiation codon and 469 nucleotides downstream to the 3⬘ end) revealed one single sequence divergence when compared with the CYP21 gene sequence published by Higashi et al. (19). The insertion of one cytosine between nucleotides 82 and 83 in exon 1 modified the second nucleotide of codon 28, which normally codes for a histidine (Fig. 1A, left sequencing gel). The insertion of a C at this position changes the amino acid in codon 28 to a proline and causes a reading frame shift from this point on leading to an in-frame stop codon at amino acid 78 (Fig. 1C). Sequencing gel showed the patient to be homozygous for the mutation. The patient’s mother is heterozygous for the mutation, because the sequencing gel

shows double bands for each nucleotide above the point of the insertion, corresponding to the normal and the mutated allele, which is one nucleotide longer (Fig. 1A, middle sequencing gel). The father tested normal (Fig. 1A, right sequencing gel). Because the father and the mother are firstdegree cousins, they should be carriers of the same mutation. To verify the presence of H28⫹C in the disease-causing paternal allele, allele-specific primers for the normal and mutated sequences were designed (Table 1), and an ASO-PCR was performed. The correct segregation of the mutation was confirmed for the whole family (Fig. 1B), indicating the occurrence of an allele dropout either throughout the first CYP21 selective PCR or throughout the sequencing procedures in the father-sequenced sample. Further support for the father to be heterozygous other than normal homozygous was given by the ASO-PCR analysis of the A/C656G most frequent CYP21 mutation at nucleotide 656 in intron 2. This experiment evaluates the occurrence of an A, C, or G nucleotide at the 656 position separately. The analysis of the family showed that the father is heterozygous A/C, and both the mother and the patient are homozygous C/C at this position (Fig. 2). Therefore the C656 variant is associated with the H28⫹C mutation, and this was not amplified in the A/C heterozygous father. The C656 allele dropout in PCR procedures is not uncommon among A/C or G/C heterozygous individuals (20). Discussion

This paper describes the novel H28⫹C frameshift mutation found in a homozygous patient with the classical form of 21-hydroxylase deficiency. No other sequence divergence was found in the affected allele. A CYP21 gene PCR allelic


J Clin Endocrinol Metab, December 2001, 86(12):5877–5880 5879

FIG. 1. Direct sequencing analysis of CYP21 gene, showing the H28⫹C mutation. A, Part of the sequencing gel of the fragment amplified with the primer pair 5⬘21B2-Ex3na and sequenced with primer Int1as, which reads the entire exon 1 sequence. Individuals are indicated on the top of each set of sequencing lanes (G, A, T, C). The insertion of a C between nucleotides 82 and 83 is visualized in the homozygous affected patient (left set of sequencing lanes) and the heterozygous mother (middle set), and it is not observed in the obligatory heterozygous father (right set). The gel was loaded in the nucleotide order G, A, T, and C as indicated below the figure. B, Allele-specific PCR for the H28⫹C mutation: no. 1, father; no. 2, mother; no. 3, normal son; no. 4, affected daughter; no. 5, normal control. N, PCR for normal sequence; M, PCR for mutant sequence. C, Normal and mutant sequence of CYP21 gene showing the insertion point, the reading frameshift, the amino acid changes, and the creation of a stop codon at amino acid 78.

FIG. 2. ASO-PCR genotyping for A, C, or G alleles at the nucleotide position 656. Figure shows the agarose gel for the individuals of the family. Lane 1, father; lane 2, mother; lane 3, affected child; lanes 4, 5, and 6, positive controls. Genotypes of each individual are indicated below the gel. Molecular weight marker (M) is the 100-bp ladder (Life Technologies, Inc.).

dropout artifact (20) was observed in the study of the family. In genotyping all individuals of the family for the A/C3 G nucleotide variation/mutation at the 656 position, it was observed that the father is A/C, whereas the mother and the affected child genotyped C/C (Fig. 2). Therefore, the H28⫹C allele bears the 656C variant. Because the A/C heterozygous father always seemed to be a normal homozygous for H28⫹C mutation in the sequencing gel, it could be concluded that in this case the 656C variant carrying the mutation was never amplified when Ex6na-5⬘21B1s or Ex6na-Int2s primer pairs were used for the CYP21 gene selective PCR performed before the sequencing experiments. Thereafter, the mutation segregation in the family could only be determined by ASOPCR for the H28⫹C mutation (Fig. 2B). Because nucleotides A and G are purines and C is a pyrimidine, it seems that DNA conformational effects cause the 656A or 656G-bearing CYP21 allele preferential amplification when the 656C allele is present in the same genotype. A similar dropout effect is not observed in the 656A/G genotypes, probably because both

nucleotides are purines. When the PCR was performed with H28⫹C specific primer that anneals only in the 656C-bearing allele, the dropout effect did not occur, and the carrier status of the father was verified. The observation of dropout artifacts in this study confirms the data reported before by Day et al. (20) and reinforces the idea that it is important to always be aware of this common artifact when looking for sporadic CYP21 mutations in families with CAH, especially in procedures that use a selective PCR for the region comprising intron 2 prior sequencing. The insertion of a C at the beginning of the gene sequence within exon 1 alters the protein structure due to a reading frameshift with the formation of a stop codon in position 78. The resulting protein is completely inactivated because it has 50 amino acid changes in addition to the premature termination of translation at codon 78. This will produce a severely truncated protein lacking most of the important residues for the enzyme activity and stability (21, 22). The mutation was not present in the published CYP21P sequence (19) (GenBank

5880

J Clin Endocrinol Metab, December 2001, 86(12):5877–5880

accession no. M12793). In addition, after an ASO-PCR screening, the H28⫹C mutation was not found in either CYP21 genes of any other patient or the genes of 20 normal controls. Therefore, it consists of a rare allele found only in this family. Several CYP21 rare missense mutations associated with classical and nonclassical forms of the disease have been described. However, there are only 11 cases of rare CYP21 frameshift mutations reported so far (1, 2). Of those, seven are deletions, two are insertions, and two are combined insertion-deletions. The H28⫹C described here is the second CYP21 insertional mutation found in exon 1. Ezquieta et al. (23) described the W22⫹T mutation that consists of a T insertion between nucleotides 64 and 65. Both H28⫹C and W22⫹T mutations cause the appearance of a stop codon at amino acid 78. Although the nucleotide insertion described here is different from the one reported by Ezquieta et al. (23), both might produce similarly truncated proteins leading to severe salt loss symptoms, once both mutations cause a stop codon at the 78 amino acid position. Their patient was a homozygous boy presenting severe SW symptoms 10 d after birth who, with continuous treatment, developed well. Our female patient showed less severe clinical features. She did not experience clinical signs or symptoms of salt loss even after discontinuing the treatment, except failure to thrive in her second week of life. Certainly, the genital ambiguity at birth led to an early diagnosis and treatment, which prevented SW crises. Another rare mutation, G424S, has been reported in several SV Brazilian patients (24). It was always associated with C4A⫹CYP21P gene deletions and with the human leukocyte antigen DR17 on the same haplotype, suggesting linkage disequilibrium and representing a probable founder effect for a rare affected allele. The H28⫹C mutation is the second rare mutation to be reported in a patient with the classical form of 21-hydroxylase deficiency in Brazil, and it seems to be an isolated case because it was not found in any other SV or SW patient. Acknowledgments We are grateful to Maria Madalena V. Rosa for technical assistance. Received June 5, 2001. Accepted August 31, 2001. Address all correspondence and requests for reprints to: Maricilda Palandi de Mello, Ph.D., Centro de Biologia Molecular e Engenharia Gene´ tica, Universidade Estadual de Campinas, Caixa Postal 6010, CEP 13083-970, Campinas, SP Brasil. E-mail: [email protected]. This work was supported by Fundaç a˜ o de Amparo a` Pesquisa do Estado de Sa˜ o Paulo, Sa˜ o Paulo, SP, Brasil, (proc. n° 97/07622-2). I.F.L. received a personal grant from Fundaç a˜ o Coordenaç a˜ o de Aperfeiç oamento de Pessoal de Nı´vel Superior.

References 1. White PC, Speiser PW 2000 Congenital adrenal hyperplasia due to 21hydroxylase deficiency. Endocr Rev 21:245–291


2. Krawczak M, Cooper DN 1997 The human gene mutation database. Trends Genet 13: 121–122 3. Nunez BS, Lobato MN, White PC, Meseguer A 1999 Functional analysis of four CYP21 mutations from Spanish patients with congenital adrenal hyperplasia. Biochem Biophys Res Commun 262:635– 637 4. Krone N, Braun A, Roscher AA, Schwarz HP 1999 A novel frameshift mutation (141delT) in exon 1 of the 21-hydroxylase (CYP21) in a patient with the salt wasting form of congenital adrenal hyperplasia. Hum Mutat 14:90 –91 5. Ohlsson G, Muller J, Skakkebaek NE, Schwartz M 1999 Steroid 21-hydroxylase deficiency: mutational spectrum in Denmark, three novel mutations, and in vitro expression analysis. Hum Mutat 13:482– 486 6. Witchel SF, Smith R, Suda-Hartman M 1999 Identification of CYP21 mutations, one novel, by single strand conformational polymorphism (SSCP) analysis. Hum Mutat 13:172 7. Kirby-Keyser L, Porter CC, Donohoue PA 1997 E380D: a novel point mutation of CYP21 in an HLA-homozygous patient with salt-losing congenital adrenal hyperplasia due to 21-hydroxylase deficiency. Hum Mutat 9:181–182 8. Lajic S, Wedell A 1996 An intron 1 splice mutation and a nonsense mutation (W23X) in CYP21 causing severe congenital adrenal hyperplasia. Hum Genet 98:182–184 9. Lee HH, Chao HT, Lee YJ, Shu SG, Chao MC, Kuo JM, Chung BC 1998 Identification of four novel mutations in the CYP21 gene in congenital adrenal hyperplasia in the Chinese. Hum Genet 103:304 –310 10. Asanuma A, Ohura T, Ogawa E, Sato S, Igarashi Y, Matsubara Y, Iinuma K 1999 Molecular analysis of Japanese patients with steroid 21-hydroxylase deficiency. J Hum Genet 44:312–317 11. Wedell A, Luthman H 1993 Steroid 21-hydroxylase deficiency: two additional mutations in salt-wasting disease and rapid screening of disease-causing mutations. Hum Mol Genet 2:499 –504 12. Wedell A, Ritzen EM, Haglund-Stengler B, Luthman H 1992 Steroid 21hydroxylase deficiency: three additional mutated alleles and establishment of phenotype-genotype relationships of common mutations. Proc Natl Acad Sci USA 89:7232–7236 13. Wedell A, Luthman H 1993 Steroid 21-hydroxylase deficiency: two additional mutations in salt-wasting disease and rapid screening of disease-causing mutations. Hum Mol Genet 2: 499 –504 14. Lajic S, Levo A, Nikoshkov A, Lundberg Y, Partanen J, Wedell A 1997 A cluster of missense mutations at Arg356 of human steroid 21-hydroxylase may impair redox partner interaction. Hum Genet 99:704 –709 15. Wedell A, Luthman H 1993 Steroid 21-hydroxylase (P450c21): a new allele and spread of mutations through the pseudogene. Hum Genet 91: 236 –240 16. Araujo M, Sanches MR, Suzuki LA, Guerra Jr G, Farah SB, De Mello MP 1996 Molecular analysis of CYP21 and C4 genes in Brazilian families with the classical form of steroid 21-hydroxylase deficiency. Braz J Med Biol Res 29: 1–13 17. Paulino LC, De Araujo M, Guerra Jr G, Marini SHVL, De Mello MP 1999 Mutation distribution and CYP21/C4 locus variability in Brazilian families with the classical form of the 21-hydroxylase deficiency. Acta Paediatr 88: 275–283 18. Wilson RC, Wei JQ, Cheng KC, Mercado AB, New MI 1995 Rapid deoxyribonucleic acid analysis by allele-specific polymerase chain reaction for detection of mutations in the steroid 21-hydroxylase gene. J Clin Endocrinol Metab 80:1635–1640 19. Higashi Y, Yoshioka H, Yamane M, Gotoh O, Fuji-Kuriyama Y 1986 Complete nucleotide sequence of 2 steroid 21-hydroxylase genes tandemly arranged in human chromosome: a pseudogene and a genuine gene. Proc Natl Acad Sci USA 83:2841–2845 20. Day DJ, Speiser PW, Schulze E, Bettendorf M, Fitness J, Barany F, White PC 1996 Identification of non-amplifying CYP21 genes when using PCR-based diagnosis of 21-hydroxylase deficiency in congenital adrenal hyperplasia (CAH) affected pedigrees. Hum Mol Genet 5: 2039 –2048 21. Lewis DF, Lee-Robichaud P 1998 Molecular modelling of steroidogenic cytochromes P450 from families CYP11, CYP17, CYP19 and CYP21 based on the CYP102 crystal structure. J Steroid Biochem Mol Biol 66:217–233 22. Nikoshkov A, Lajic S, Vlamis-Gardikas A, Tranebjaerg L, Holst M, Wedell A, Luthman H 1998 Naturally occurring mutants of human steroid 21hydroxylase (P450c21) pinpoint residues important for enzyme activity and stability. J Biol Chem 273: 6163– 6165 23. Ezquieta B, Oyarzabal M, Jariego CM, Varela JM, Chueca M 1999 A novel frameshift mutation in the first exon of the 21-OH gene found in homozygosity in an apparently nonconsanguineous family. Horm Res 51:135–141 24. Billerbeck AE, Bachega TA, Frazatto ET, Nishi MY, Goldberg AC, Marin ML, Madureira G, Monte O, Arnhold IJ, Mendonca BB 1999 A novel missense mutation, GLY424SER, in Brazilian patients with 21-hydroxylase deficiency. J Clin Endocrinol Metab 84:2870 –2872