A novel gene cluster in Fusarium graminearum contains a ... - PubAg

Fungal Genetics and Biology 44 (2007) 293–306 www.elsevier.com/locate/yfgbi

A novel gene cluster in Fusarium graminearum contains a gene that contributes to butenolide synthesis L.J. Harris a,¤, N.J. Alexander b, A. Saparno a, B. Blackwell a, S.P. McCormick b, A.E. Desjardins b, L.S. Robert a, N. Tinker a, J. Hattori a, C. Piché a, J.P. Schernthaner a, R. Watson a, T. Ouellet a a

Eastern Cereal and Oilseed Research Centre, Agriculture and Agri-Food Canada, Ottawa, Ont., Canada K1A 0C6 Mycotoxin Research Unit, National Center for Agricultural Utilization Research, Agricultural Research Service, U.S. Department of Agriculture, Peoria, IL 61604, USA

b

Received 9 May 2006; accepted 2 November 2006 Available online 18 December 2006

Abstract The development of expressed sequence tag (EST) databases, directed transformation and a sequenced genome has facilitated the functional analysis of Fusarium graminearum genes. Extensive analysis of 10,397 ESTs, derived from thirteen cDNA libraries of F. graminearum grown under diverse conditions, identiWed a novel cluster of eight genes (gene loci fg08077–fg08084) located within a 17 kb region of genomic sequence contig 1.324. The expression of these genes is concomitantly up-regulated under growth conditions that promote mycotoxin production. Gene disruption and add-back experiments followed by metabolite analysis of the transformants indicated that one of the genes, fg08079, is involved in butenolide synthesis. The mycotoxin butenolide is produced by several Fusarium species and has been suggested, but not proven, to be associated with tall fescue toxicoses in grazing cattle. This is the Wrst report of the identiWcation of a gene involved in the biosynthetic pathway of butenolide. Crown copyright © 2006 Published by Elsevier Inc. All rights reserved. Keywords: Gibberella zeae; Expressed Sequence Tags (ESTs); Cytochrome P450; Mycotoxin; Butenolide; Fescue foot

1. Introduction The genus Fusarium is capable of synthesizing a wide spectrum of secondary metabolites. These metabolites are produced via the isoprenoid pathway (e.g., trichothecenes, cyclonerols), through polyketide assembly (e.g., zearalenone, fumonisins, fusarins), and from amino acids (e.g., enniatins, butenolide) (Apsimon, 1994). Fusarium graminearum (teleomorph Gibberella zeae) is a broad host pathogen of wheat, barley, oats, rice, and maize and can cause severe epidemics of head blight or ear rot in temperate climates worldwide. Infection of the cereal reproductive structures results in mouldy grain, grain yield reduction,

*

Corresponding author. Fax: +1 613 759 6566. E-mail address: [email protected] (L.J. Harris).

and mycotoxin deposition (McMullen et al., 1997; Placinta et al., 1999). F. graminearum has been documented to produce 15-acetyldeoxynivalenol and related trichothecenes, zearalenone, culmorin, sambucinol, and butenolide under liquid culture conditions (Greenhalgh et al., 1986). In a study examining the secondary metabolites produced by Fusarium in culture, butenolide synthesis was initiated as the fungus approached nitrogen limitation but before the beginning of trichothecene synthesis (Miller and Blackwell, 1986). Butenolide (4-acetamido-4-hydroxy-2butenoic acid lactone) was discovered as a water-soluble toxic substance produced by Fusarium species isolated from toxic tall fescue (Yates et al., 1967). Cattle grazing on tall fescue can sometimes become aZicted with a non-infectious condition called fescue foot, characterized by an arched back, edema, lameness, and dry gangrenous loss of extremities (Yates et al., 1969). An ethanolic extract of toxic

1087-1845/$ - see front matter Crown copyright © 2006 Published by Elsevier Inc. All rights reserved. doi:10.1016/j.fgb.2006.11.001

294

L.J. Harris et al. / Fungal Genetics and Biology 44 (2007) 293–306

fescue hay could produce symptoms very similar to fescue foot (Jacobson et al., 1963). Administering pure butenolide to cattle causes some but not all symptoms of fescue foot (Grove et al., 1970; Tookey et al., 1972). It is possible that butenolide may act synergistically with another fungal and/ or plant metabolite to cause the fescue foot symptoms. However, the causal agent of fescue foot has not been determined (Garner and Cornell, 1978). Butenolide production has been documented in numerous Fusarium species, including F. cerealis, F. culmorin, F. poae, F. sambucinum, F. venenatum, and F. sporotrichioides (Thrane, 2001). There are several examples of gene clusters in fungi responsible for either secondary metabolite synthesis or low-molecular-weight nutrient utilization (Keller and Hohn, 1997). These gene clusters are usually not expressed during robust growth but are activated in response to nutrient limitation or competition. Genes coding for enzymes and regulatory factors involved in the utilization of proline, ethanol, quinate, and nitrate are clustered in a number of fungal genomes (Giles et al., 1991; Hull et al., 1989; Johnstone et al., 1990; Fillinger and Felenbok, 1996). The highly toxic and carcinogenic aXatoxins produced by Aspergillus species are synthesized by enzymes encoded by a cluster of 25 genes (Yu et al., 2004). The Fusarium core trichothecene biosynthetic gene cluster is comprised of 10–12 contiguous co-regulated genes although at least two other genes essential for trichothecene synthesis are unlinked (Brown et al., 2004; Kimura et al., 1998; McCormick et al., 2004). When we examined a F. graminearum expressed sequence tag database derived from a variety of F. graminearum cDNA libraries, we identiWed a gene cluster containing eight consecutive coding regions predominantly represented by ESTs isolated from culture conditions promoting trichothecene production or from infected plant tissues. These genes were found to be co-expressed during growth in a nutrient-limited liquid culture. Disruption and add-back mutants of one gene, fg08079, in the cluster were produced and shown to aVect butenolide production. 2. Materials and methods 2.1. Fungal strains and media Originally collected from maize caryopses in Ottawa, Canada, by G. A. Neish in 1981, F. graminearum wild-type strain DAOM180378 was provided by C. Babcock of the Canadian Collection of Fungal Cultures (CCFC/DAOM), Agriculture & Agri-Food Canada, Ottawa. The F. graminearum wild-type strain Z-3639 (FGSC 8630, Fungal Genetics Stock Center, Kansas City, KS) was isolated from scabby wheat by R. Bowden (Bowden and Leslie, 1992) and GZT-40 is a Tri5 deletion mutant and trichothecene-nonproducer (FGSC 9559; Proctor et al., 1995). Fungal cultures were initially grown on SNA plates or V-8 juice agar plates under an alternating 12 h, 25 °C light/12 h, 22 °C dark cycle. Agar plugs of fungal cultures were stored for longterm at ¡80 °C in 10% glycerol.

2.2. Fungal culture conditions To induce trichothecene production in liquid culture, a two-stage media protocol, modiWed from Miller and Blackwell (1986), was employed. F. graminearum was grown on a plate of potato dextrose agar (Difco, Detroit, MI) or 2% malt extract agar (Oxoid, Basingstoke, Hampshire, UK) until conXuent. A 1.5 cm square of plate culture in an actively growing region was excised with a scalpel, added to 20 ml sterile water, and macerated to an even consistency with a polytron using a 20 mm probe. An aliquot (2.5 ml) of the resulting suspension was used to inoculate 50 ml of 1st stage media (GYEP: 3 g NH4CL, 2 g MgSO4·7 H2O, 0.2 g of FeSO4·7H2O, 2 g KH2PO4, 2 g peptone, 2 g yeast extract, 2 g malt extract, 20 g glucose in 1 L distilled water) in 250 ml Erlenmeyer Xasks. The cultures were grown at 25 °C on a rotary shaker at 220 rpm in the dark for 48 h. The culture was then dispersed using a polytron and 2.5 ml of this 1st stage culture was added to each of 250 ml Xasks containing 50 ml 2nd stage media (modiWed MYRO: 1 g (NH4)2HPO4, 3 g KH2PO4, 0.2 g MgSO4·7H20, 5 g NaCl, 40 g sucrose, 10 g glycerol in 1 L of distilled water). The 2nd stage was grown at 28 °C, shaking at 220 rpm in the dark. For the time course study, samples were collected at the end of the 1st stage as well as every two days in the 2nd stage medium, up to and including day 14. Tissues were harvested and partially dried by Wltration through a 1 mm Whatman Wlter paper with a Buchner funnel, immediately frozen in liquid nitrogen, and stored at ¡80 °C. 15-ADON and DON concentrations were determined directly on the culture Wltrates by HPLC. Previous studies have shown that little or no trichothecenes are retained in the hyphae of such cultures (Miller and Blackwell, 1986). Total Wltrates were poured on ClinElut columns (Varian Canada, Mississauga, ON, Canada), which were extracted with 3 volumes of ethyl acetate and this extract was taken to dryness. The residues were then suspended in 0.5 ml CDCl3 for NMR analysis. To screen transgenic and progenitor strains for butenolide synthesis, the same two-stage protocol was used, with the following modiWcations. Strains were grown on V8 plates initiated with a plug from a hygromycin slant or with spores from a glycerol stock solution. Mycelia were washed from V8 plates with 3.5 ml water and used to inoculate 50 ml of 1st stage media in 250 ml Xasks. After three days, 1st stage cultures were transferred to a 250 ml beaker and dispersed with a Toastmaster stick blender. The macerated culture was transferred to a 50 ml conical tube and centrifuged 5 min at 1600 rpm. Half of the medium was removed and the remaining fungal mass and medium was mixed well. Second stage cultures were initiated by adding 1.5 ml of the concentrated 1st stage culture to 20 ml of 2nd stage medium in a 50 ml Xask. After 3 or 4 days, a 5 ml aliquot (fungal biomass and medium) was removed and extracted with 2 ml ethyl acetate. The extract was dried under a nitrogen stream, re-suspended in ethyl acetate and analyzed with GC–MS.


Fungal cultures were also prepared in complete media (CM), minimal media without a carbon source (MMC), and minimal media without a nitrogen source (MMN), as described by Trail et al. (2003). 2.3. cDNA library construction, EST sequencing and bioinformatics Fusarium graminearum strain DAOM180378 was the fungal strain used for all of the cDNA libraries described here. Unless noted otherwise, total fungal RNA was isolated by using the standard TRIzol method (Invitrogen, Carlsbad, CA), polyA RNA was isolated using the PolyATract system (Promega, Madison, WI), and ligated vectors were electroporated into Epicurean Sure cells (Stratagene, La Jolla, CA). The construction of the Fg03 and Fg05 libraries have been described previously (McCormick et al., 2004). (1) Fg02: RNA was extracted from a conXuent culture of F. graminearum grown on rich (V8) solid media and converted into cDNA using the Unizap XR library construction kit (Stratagene). cDNA was directly ligated into XhoI/EcoRI-restricted pBluescript SK+ (Stratagene). (2) Fg04: RNA was extracted from wheat heads (cv Roblin) that were spray inoculated with a suspension of F. graminearum spores (1 £ 105 spores/ml) and incubated for Wve days under high humidity conditions in a dew chamber set at 15 °C for the walls, 20 °C for the water, and 30 °C for the air. The cDNA was synthesized using the pBluescript II XR Library Construction kit (Stratagene), then size fractionated with a Chroma Spin-400 column (Clontech Laboratories, Inc., Mountain View, CA). Fractions containing cDNAs larger than 300 bp were pooled, precipitated, and ligated into XhoI/EcoRI-restricted pBluescript SK+. (3) Fg06: F. graminearum mycelia were grown on carrot agar at 20 °C with 24 h lighting for 5 days and perithecia were induced with a 2.5% Tween 60 (Sigma, St. Louis, MO) solution, as described by Trail and Common (2000). Fungal tissue, composed mainly of fruiting bodies late in perithecial development, was scraped from plates 20 days after induction. The GeneRacer kit (Invitrogen) was used to synthesize cDNA and Expand High Fidelity reverse transcriptase (Roche Diagnostics, Laval, Qc, Canada) was used to amplify the 1st strand cDNAs. cDNAs were cloned directly into the pGEMTeasy vector (Promega). (4) Fg08: RNA was extracted from F. graminearum cultures grown on a complex plant substrate containing wheat leaves treated to remove most low-molecularweight, water-soluble components. The insoluble wheat leaf fraction was prepared from leaf pieces of 35-day-old plants heated at 95 °C for 48 h in oxalate buVer (4 g/L oxalic acid and 16 g/L ammonium oxalate). After washing the leaves on a Wlter with water, they were frozen in liquid nitrogen and ground in a Waring blender. The fragments were suspended in

295

400 ml methanol, 800 ml CHCl3 was added, and stirred for 16 h. The leaf tissue was collected on Wlter paper, washed twice with 100 ml ethanol, then three times with 100 ml H2O and dried. To prepare actively growing cultures, 500 ml of insoluble wheat leaf medium (KH2PO4, 1.0 g/L; KNO3, 1.0 g/L; MgSO4·7 H2O, 0.5 g/L; KCl, 0.5 g/L; CH3COONa, 1.0 g/L; dried leaf tissue, 10 g/L) was inoculated with an agar plug from a freshly grown plate. The culture was shaken at 28 °C and monitored microscopically for 3–7 days until nearly fully grown. The culture was then added to 1 L of fresh insoluble wheat leaf medium in a Fernbach Xask and shaken for 48 h. Cells were harvested from actively growing cultures by Wltration and ground in liquid nitrogen using a mortar. RNA was extracted using guanidinium thiocyanate followed by pelleting through CsCl2. From total RNA, mRNA was prepared using a Poly (A) Pure Isolation Kit (Ambion, Austin TX). The libraries were constructed using a cDNA Synthesis Kit (Stratagene), ligated into pBlueScript II XR, and transformed into host strain DH10B. (5) Fg09: An agar plug from a freshly grown plate was used to inoculate 500 ml of a deWned liquid medium with casamino acids as sole carbon and energy source, containing: KH2PO4, 1.0 g/L; KNO3, 1.0 g/L; MgSO4· 7 H2O, 0.5 g/L; KCl, 0.5 g/L; CH3COONa, 1.0 g/L; casamino acids (Difco), 20 g/L. The culture was shaken at 28 °C and monitored microscopically for 3–7 days until nearly fully grown. The culture was then added to 1 L of fresh casamino acid medium in a Fernbach Xask and shaken for 24 h. The cells were harvested and a cDNA library prepared as outlined above for Fg08. (6) Fg10: One-half of a PDA agar plate with a fresh conXuent culture of F. graminearum was macerated and used as inoculum in 200 ml distilled water containing 0.8 g dextrin (Type IV, potato starch; Sigma) and 0.2 g NH4Cl in 500 ml Xasks. These cultures were grown for 7 days with shaking (200rpm) at 28 °C and the fungal tissue was collected and drained on Miracloth (Calbiochem, La Jolla, CA) using a Buchner funnel. Total RNA was isolated by the modiWed Chomczynski and Sacchi method (1987) using water saturated acid phenol urea/sarkosyl detergents. cDNA was synthesized using the GeneRacer kit (Invitrogen) and puriWed with Clontech Smart columns. cDNA fractions were cloned directly into the pGEMTeasy vector (Promega). (7) Fg11-14: The modiWed trichothecene-inducing two-step liquid culture protocol (Miller and Blackwell, 1986) described above was used to produce F. graminearum mycelia. Cultures were stopped after 12 days of growth in the second stage. The culture was Wltered using Whatman #1 Wlters and immediately frozen in liquid nitrogen. Total RNA was extracted with the CTAB method (Chang et al., 1993). PolyA+ mRNA was isolated with Dynabeads oligo(dT)25 (Dynal Biotech, Lake Success, NY) for all tissues (Piché and Schernthaner, 2003).

296


Full-length and partial-enriched cDNA libraries were obtained with the biotinylated CAP trapper method as described elsewhere (Carninci and Hayashizaki, 1999) with some modiWcations (Piché and Schernthaner, 2005). The cDNA was size fractionated on a CL-4B column equilibrated in STE buVer (0.1 M NaCl, 10 mM Tris–Cl [pH 8], 1mM EDTA [pH 8]). cDNAs greater than 300bp were separated into three fractions by size and ligated separately into the pHSX-Ci vector. pHSXCi is derived from pHelix1(+) (Roche Diagnostics) which was modiWed by inserting an adapter containing two SW I sites to accommodate directional cloning of cDNA inserts between the Eco RI and Kpn I sites (Piché and Schernthaner, 2005). The three ligation reactions were pooled and used to transform 100 l DH5 FT high eYciency competent cells, as recommended by the supplier (Invitrogen). (8) Fg_Ta07: Wheat plants (cv Roblin) were grown under a 16h light (20 °C)/8 h dark (16 °C) regime until midanthesis. Heads at mid-anthesis were point-inoculated with F. graminearum spores (10 l of 1 £ 105 spores/ml) at every fully developed spikelet. Water inoculation was used as an experimental control on separate plants. Inoculated plants were misted for 10s intervals every 15min for 2 days. Inoculated spikelets were harvested 4 days post inoculation. Total RNA was extracted using guanidinium thiocyanate followed by pelleting through CsCl2. Poly(A+)RNA was isolated following the manufacturer’s instructions using MPG Streptavidin Biotinylated Oligo (dT)25 Complex (CPG Inc., Lincoln Park, NJ). A subtraction suppression hybridization (SSH) library was generated with the PCR-Select cDNA Subtraction Kit (BD Biosciences, Mississauga, ON, Canada), using cDNA from F. graminearum-inoculated tissues as the tester, subtracted with water-inoculated cDNA as the driver. The enriched SSH PCR products were cloned into the pGEM T-easy vector (Promega). Single-pass, 5⬘ or 3⬘-end sequencing of random cDNA clones was conducted using a LI-COR 4200 sequencing system (LI-COR, Lincoln, NE) with an average processed read length of 597 nucleotides. Wheat-derived sequences were removed from the Fg_Ta07 sequences. Redundant ESTs were grouped into contigs using the Seqman II assembly program (DNASTAR Inc., Madison, WI) with a minimum match of 90% over a length of 30 bp, as described in Hattori et al. (2005). Bioinformatics analyses were performed with the Lasergene software package (DNASTAR, Inc.). BLAST searches were done with the TBLASTN program (http://www.ncbi.nlm.nih.gov/BLAST) using the default parameters. EST sequences have been deposited in Genbank (Table S2, Supplementary data). 2.4. Northern blot analysis Total RNA (10 g) was size separated and transferred to Magnacharge membrane (Osmonics Inc., Westborough,

MA), as per manufacturer’s instructions. SpeciWc cDNA clones were restriction enzyme-digested and represented the following F. graminearum gene loci: Fg02_05f07/EcoRI (Genbank Accession No. BI750270) for fg08076, Fg03_02f04/EcoRI (Genbank Accession No. CD456629) for fg08077, Fg13_03a22/SWI (EB530761) for fg08078, Fg03_05a03/EcoRI (CD456573) for fg08079, Fg03_02c08/ EcoRI (CO049325) for fg08081, Fg03_08d08/EcoRI (CN812022) for fg08082, Fg03_07d10/NotI (CD456121) for fg08083, Fg03_03c09/NotI (CD456404) for fg08084, Fg03_09a11/ EcoRI (CF075161) for Tri1, Fg03_05f10/ EcoRI (CD456524) for Tri4, and Fg03_09b09/EcoRI for fg03017 (CD456301). The restriction enzyme-digested fragments were random prime-labelled using the Prime-a-Gene Labelling System (Promega) and 32P-dCTP (Amersham Biosciences, Piscataway, NJ) for use as hybridization probes. Essentially, hybridizations were done in ULTRAhyb buVer (Ambion) overnight at 42 °C. Final washes were in 0.1£ SSC (1£ SSC is 0.15 M NaCl, 0.015 M sodium citrate) and 0.1% SDS at 65 °C. The blot was exposed to Kodak (Rochester, NY) BioMax MS Wlm at ¡70 °C using a Kodak BioMax TranScreen-HE intensifying screen. 2.5. Quantitative-PCR and RT-PCR analysis The expression of the fg08080 gene was analyzed by realtime quantitative PCR using the Xuorescent intercalating dye SYBR Green in a Chromo4 detection system (Bio-Rad, Richmond, CA). Primers were designed using PrimerSelect 5.0 (DNASTAR, Inc.). Total RNA from each time course was DNase-I treated (Ambion) and column puriWed (RNeasy Plant mini kit, Qiagen, Mississauga, ON, Canada). As a control for the absence of genomic DNA contamination, PCR was performed on the RNA after DNase treatment. Total RNA concentrations were measured by a Xuorimeter (F-2000 Fluorescence Spectrophotometer, Hitachi) using Quant-it™ RiboGreen RNA reagent (Invitrogen). A twostep RT-PCR procedure was performed in all reactions. Total RNA (20 g) was reversed transcribed with Superscript II (Invitrogen) using gene speciWc primers 295 and 304 for fg08080 and -tubulin (fg09530), respectively (Table 1). One twentieth of the resulting cDNA was used per sample reaction. The real-time PCR reactions were performed using iQ SYBR Green supermix kit (Bio-Rad), in triplicate, and with appropriate controls. All reactions were heated to 94 °C for 2 min, followed by 40 cycles of 95 °C for 15 s, 60 °C for 15 s and 72 °C for 15 s. After PCR, melt curves conWrmed that only the target sequence was ampliWed. The primer eYciencies from the set of target and reference genes were shown to be similar. The threshold cycle (Ct) was deWned as the Wrst ampliWcation cycle at which Xuorescence indicating PCR products became detectable. Ct values were obtained from at least 6 technical replicates performed on samples from three independent biological replicates. The expression of the fg08080 gene was normalized by expression of the reference control (-tubulin) and the pair-wise Wxed reallocation randomization test was


297

Table 1 Primer sequences used in this study Primer

Sequence 5⬘!3⬘

Gene

1 2 294 295 303 304 1623 1624 1694 1695 559 560 561 562 563 564 583 584 567 568 226 227

ATCCCGTGTTTGGCTGAAGTAA GGCGCGCCGCCCTCCAAAATCTCCATCGTGa TGGAATTACTCAAGGGTCAGG TAAAGAATCCGCTACGCTAAC CTGAGGCCGAGTCCAACAT AGGCGGCCGGTGATTTC CATCACCAGTCTCAGCAC TCTCCATCGTGTCGTCTC GCACTAATCTGCCCTACAG GGGTCAGGCTGTTGAAGG AAGGAGGGCGAGAAGTGGAATGT GGTGGAGATAGCCCGAGAGC CCACCAGGCAAAGGAACG GGCACACCACTCGACATAATAGA GCTCTCGCCGGCATTACCT CAGCCCTGTCGTGAGTCTTGTG CCGCCAGAACCTTGAGATTTTTGT GCGGCCCTGCATAAGACGAG AGGGAGCAGCCGTTGAGGATGAG TGATAAGAAGAGGCCCGAAAGAGC GGCGCGCCTCATCCAAATCGCTTCTACATACAa AAACATTACAAAGCCACAAAACTG

fg08079 fg08079 fg08080 fg08080 -tubulin; fg09530 -tubulin; fg09530 fg08079 fg08079 intergenic intergenic fg08075 fg08075 fg08076 fg08076 fg08085 fg08085 fg12216 fg12216 fg12217 fg12217 fg08082 fg08082

a

The italicized sequence indicates the inclusion of an AscI restriction recognition site in the primer sequence.

applied in REST analyses (PfaZ et al., 2002) for each time point in the time course study. The expression of genes Xanking the putative gene cluster was assayed by RT-PCR. Total RNA was isolated from mycelia grown under CM, MMN, MMC liquid culture conditions as well as the trichothecene-inducing time course experiment sampled at 0d, 6d, and 12d. The RNA was DNase-treated using the Turbo DNA-free kit (Ambion). Primers (Table 1) were designed to span introns. RT-PCR was performed on 0.2 g of RNA using SuperScript One Step RT-PCR system (Invitrogen) and using genomic DNA as a positive control. The PCR reactions were loaded on a 1% agarose gel and stained with SYBR Safe DNA gel stain (Invitrogen). 2.6. Trichothecene and butenolide analysis Trichothecenes were quantitated on a Shimadzu (Columbia, MD) HPLC by direct injection of the culture Wltrate onto a CSC Hypersil (C-18; 150 mm £ 4.6 mm) column using a methanol:water gradient from 15:85 to 60:40 over 25 min at a Xow rate of 1 ml/min. Under these conditions butenolide is retained at 2 min, DON (as well as 7,8dihydroxy-3-deacetylcalonectrin) at 11 min and 15-ADON at 24 min. NMR spectra of the crude ethyl acetate extracts of the culture Wltrate were acquired at 500.13 MHz on a Bruker ARX500 NMR spectrometer (Bruker Canada, Milton, ON) equipped with a XWINNMR data system. Transformants were screened by gas chromatography low resolution mass spectrometry (GC–MS) with a Hewlett Packard 6890 gas chromatograph Wtted with a HP-5MS column (30 m £ 0.25 mm Wlm thickness) and a 5973 mass

detector. The carrier gas was helium with a 20:1 split ratio and a 24.1 ml/min split Xow. The column was held at 120 °C at injection, heated to 210 °C at 15 °C/min and held for 1 min, then heated to 260 °C at 5 °C/min and held for 8 min. Under these conditions, butenolide is eluted at 3.9 min and 15-ADON at 14.1 min. 2.7. Gene disruption, add-back, and analysis The PCR primers 1 and 2 (Table 1) were used to amplify 1000 bp of fg08079 genomic DNA from strain DAOM180378 using Pfu polymerase (Stratagene) following the manufacturer’s recommendations and using the following parameters: 95 °C, 2 min; followed by 30 cycles of 95 °C, 30 s; 52 °C, 30 s; 72 °C, 2 min; followed by 72 °C, 10 min. The 3⬘ PCR primer 2 incorporates an AscI site into the ampliWed product. The PCR product was ligated directly into the PCR-II TOPO Blunt vector (Invitrogen) and the promoter 1/hygB selectable marker (Turgeon et al., 1987) was inserted into the AscI site. This insertion formed a disruption vector, named pLH79, consisting of a truncated portion of the coding region (1000 bp) beginning just upstream of the second intron and including most of the 3rd exon, followed by the hygromycin selectable marker. Fungal transformation was carried out as previously described (Proctor et al., 1995). Fungal transformants, named LH79D1 through D60, were analyzed with PCR using primers that tested sequences outside the cloned section for three types of sequence: sequence within the disruption vector, within the hygromycin sequence, and within plasmid sequence. For Southern analysis, genomic DNA of wild-type and transformants was digested with Bsu36I,

298


separated on a 1% agarose gel, transferred to Nytran SuperCharge membrane (Schleicher & Schuell, Keene, NH), and hybridized with a 32P-labelled (Ready-to-go kit, Amersham Biosciences) probe consisting of an 870 bp fragment of fg08079 sequence made using primers 1623 and 1624 (Table 1) on a Z-3639 genomic template. To make the add-back strains, which would contain the entire complementary fg08079 sequence, primer 1694 (Table 1), located 1028 bp upstream of the ATG start of fg08079, was paired with 1695 (Table 1), located 937 bp downstream of the stop signal. Both primers are located within intergenic sequence. The 3580 bp region was ampliWed with iProof enzyme (Bio-Rad) and cloned into pCR4Blunt-TOPO (Invitrogen). The geneticin marker (Desjardins et al., 2004) was cloned into a NotI site to complete the vector used in the transformation of disruption mutants LH79D6 and LH79D20. Sequencing (BigDye v. 3.1, Applied Biosystems, Foster City, CA using an ABI 3700 sequencer) conWrmed the intact structure of the selected sequence. Of the 213 geneticin-resistant transformants, named LH79D6-AB1 through AB105 and LH79D20-AB1 through AB108, 85 were analyzed for toxin production and 5 that made butenolide and 5 that didn’t make butenolide were selected for further study. PCR analysis was conducted on the 10 selected strains to ascertain whether an intact fg08079 was present. 2.8. Virulence assay Wheat head blight assays were conducted as in Proctor et al. (1995) using the head blight susceptible line Wheaton. Heads were inoculated by injecting a drop of macroconidial suspension containing approximately 103 macroconidia into one Xoret of a spikelet of each head. Control heads were injected with water. For each treatment, 10 replicate heads were injected. Seven separate genetic disruptants were analyzed as well as seven transformants containing ectopic insertions. Z-3639 inoculation served as the representative for disease production whereas transformant GZT-40 (Tri5¡) served as the representative for limited disease. Disease severity was calculated as the percentage of bleached spikelets in each head 17–21 days after inoculation. Mature heads were threshed individually to ensure that all scabby seeds were collected. Single factor analysis of variance (ANOVA) was conducted on strain comparisons in the greenhouse for percent of disease after a certain number of days post infection. SAS software was used for all statistical analyses. 3. Results 3.1. Transcripts isolated from trichothecene-producing cultures map to a gene cluster It is hypothesized that a subset of the genes present in the F. graminearum genome are expressed speciWcally

during plant infection or in growth conditions mimicking events required for infection. To identify such genes and to maximize the capture of unique expressed transcripts, thirteen F. graminearum cDNA libraries have been constructed from fungal cultures (isolate DAOM180378) grown under a variety of conditions (Table S2, Supplemental data). The conditions include growth in planta (libraries Fg04, Fg_Ta07) or plant-derived substrates (Fg05, Fg08), growth on solid media promoting the formation of mycelia or fruiting bodies (Fg02, Fg06), or under other nutrient stress (Fg09, Fg10). Several cDNA libraries were prepared from mycelia grown in liquid culture under conditions conducive to trichothecene production (Fg03, Fg11, Fg12, Fg13, and Fg14), These liquid culture conditions consist of a two-stage growth where the Wrst medium is designed for maximum mycelia growth while the second stage (modiWed MYRO) is rich in carbon source but minimal in nitrogen. Trichothecene production has been shown to be induced by nitrogen depletion (Miller and Blackwell, 1986). Under the liquid culture conditions used to produce the Fg10 dextrin-stressed library, the fungal hyphal tips displayed nuclear hypertrophy, asexual spore production was altered and no trichothecene production was observed (data not shown). Libraries Fg11, Fg12, and Fg14 were constructed using a CapTrapper method and are preferentially populated by cDNAs derived from full-length transcripts. A collection of 10,397 expressed sequence tags was compiled, which group into 1356 contigs and 2927 singletons. Using the MIPS F. graminearum genome database (FGDB; http://mips.gsf.de/genre/proj/fusarium/), ESTs were assigned to putative gene loci and functional category based on the classiWcation developed by MIPS (Guldener et al., 2006a). These functional categories are based on BLASTX results and functional assays have not been performed. Many of these ESTs have proven useful in the manual annotation of F. graminearum gene loci. The EST sequences described in this paper represent 2799 F. graminearum gene loci (Evalue > 1E-50) as well as at least 56 additional miscalled or potential loci (Table S3, Supplementary data). While mining our F. graminearum EST collection, we focused on genes expressed under conditions of trichothecene production and not expressed under most other growth conditions. We hypothesized that genes induced under conditions conducive to mycotoxin synthesis may also be induced during plant infection and could play a role in Wtness of the fungus. There are 47 gene loci represented by at least 10 ESTs in the trichothecene-producing F. graminearum cDNA libraries (Table S4, Supplementary data). This list included two genes involved in trichothecene biosynthesis, Tri4 and Tri9. The function of almost half (21) of the 47 genes is unknown. Among the genes most highly expressed under trichothecene-producing conditions, two genes, fg08077 and fg08082, were noted to be closely linked. Further electronic EST proWling revealed 50 ESTs isolated from the trichothe-

7 21

6 12

21

fg

12

80

0 fg

fg

08 08 fg

299

85

4

3

2

08 08

fg

08

08 fg

fg

08

08

08

1

0 08

9 fg

08

07

8 fg

07

7 fg

08

07

6 07

08 fg

08 fg

fg

08

07

5


2kb

Fig. 1. A gene cluster in a sub-region of contig 1.324. The cluster of co-expressed genes is represented by black arrows; Xanking genes are represented by white arrows. Arrow indicates direction of gene transcription. Intron/exon boundaries are not shown.

cene-induction family of cDNA libraries (Fg03, Fg05, Fg11–14) that mapped to a tight cluster of eight genes on F. graminearum genomic contig 1.324 (http:// www.broad.mit.edu/annotation/fungi/fusarium/) (Fig. 1, Table 5). In addition, ESTs for Wve of these genes were also isolated from F. graminearum-challenged wheat tissues as well as other challenged wheat and barley cDNA libraries deposited in NCBI (Genbank Accession Nos. BI950616 [fg08077], CN008424 [fg08081], BI948763[fg08082]). Only one EST mapping to this gene cluster, representing fg08077, was isolated from other F. gramineraum cDNA libraries (Fg02_07g02; BI749939). There are no ESTs representing these eight genes in the other publicly available F. gramineraum ESTs (7996 ESTs from carbon- and nitrogen-starved mycelia as well as maturing perithecia, Trail et al., 2003; 12,577 cDNA clones from carbon- and nitrogen-starved mycelia, http://www.broad.mit.edu/annotation/fungi/fusarium/index.html). In contrast, in the publicly available ESTs, only two predicted gene loci (fg08075 and fg08076) of the 27 Xanking the gene cluster on genomic contig 1.324 were found to be represented by ESTs (one or two ESTs each). The gene cluster includes genes predicted to encode Wve biosynthetic enzymes, a small molecule transporter (24.8% identity with a Rattus norvegricus monocarboxylate transporter of the major facilitator family), a putative regulatory protein (fg08080), and a conserved hypothetical protein (fg08082) (Table 5). The gene product of fg08082 shares 36% identity with a putative Aspergillus fumigatus acetyltransferase. The N-terminus of the putative gene product of fg08080 contains a Zn(2)–C6 fungal-type DNA-binding domain common in fungal transcription factors. 3.2. Eight adjacent genes on Fusarium graminearum genomic contig 1.324 are co-regulated Northern blot analysis of seven of the eight genes of the putative gene cluster on genomic contig 1.324 exhibited

very similar gene expression patterns during a time course of a trichothecene-producing F. graminearum liquid culture (Fig. 2A). Gene expression was Wrst detected at day 4, with maximum gene expression at day 10. No expression of this gene cluster was detected in GYEP, the rich medium used for the 1st stage of the culture (data not shown). For comparison, the gene expression of two trichothecene biosynthetic genes, Tri1 (fg00071) and Tri4 (fg03535), were also monitored and exhibited a similar induction pattern (Fig. 2B). In contrast, gene expression of the putative glycosidase-encoding fg03017 (represented by eleven EST clones isolated from trichothecene-producing conditions) was constant throughout the time course (Fig. 2C). Expression of the eighth gene within the cluster, fg08080 (coding for a putative regulatory protein), was not detectable above background by Northern blot analysis and was therefore analyzed by real-time quantitative PCR. All data were normalized to -tubulin which was determined through real-time PCR to be a suitable constitutive internal control across the experimental time course. fg08080 expression was signiWcantly up-regulated over the trichothecene-producing time course, compared to expression in 1st stage media, as monitored in three biological replicates (Table 6). The expression of predicted genes upstream and downstream of this gene cluster (Fig. 1) was examined using northern and/or RT-PCR analysis. For comparison, RTPCR analysis showed that the expression of fg08082 within the gene cluster is not detectable in CM, MMN, MMC or the start of trichothecene-inducing conditions but is strong at day 6 and day 12 (Fig. 3). The two genes just upstream of the predicted gene cluster, fg08075 and fg08076, showed no detectable expression in the trichothecene-producing time course or during CM, MMN, or MMC growth conditions (northern analysis of fg08076, data not shown; RT-PCR, Fig. 3). fg12216 exhibits low levels of expression in CM and at time 0, 6d and 12d of the

Table 5 Predicted gene cluster on F. graminearum genomic contig 1.324 Fg gene loci

Contig coordinates

Predicted protein function (E value)

fg08077 fg08078 fg08079 fg08080 fg08081 fg08082 fg08083 fg08084

23549–22251 24118–26068 26712–28339 30430–29183 34046–32937 35561–34963 36189–37804 38677–40109

NADH:Xavin oxidoreductase (7e-97) related to acetamidase (8E-114) cytochrome P450 CYP53A6; related to benzoate 4-monooxygenase (1.27E-158) hypothetical protein (zinc Wnger motif) 2OG-Fe(II) oxygenase (2e-18) conserved hypothetical protein related to glutamate decarboxylase (1e-59) related to monocarboxylate transporter (4e-32)

300


Fig. 2. Gene expression during F. graminearum growth under trichothecene-producing liquid culture conditions. Total RNA (10 g/lane) was isolated from wild-type strain DAOM180378 grown over the number of days (d) indicated, in the second stage media for trichothecene production (see Section 2.2). RNA from the same biological replicate was used for all northerns shown. The blots were exposed to Wlm for 0.5–3 h. (A) Northern blot analyses of predicted gene loci fg08077–fg08079 and fg08081– fg08084. (B) Northern blot analyses of Tri4 (fg03535) and Tri1 (fg00071). (C) Northern blot analysis of predicted gene loci fg03017. A representative ethidium bromide-stained gel prior to blotting is shown under the hybridization panel. Table 6 Quantitative PCR analysis of fg08080 Biological replicate

1 2 3

Expression ratio 4 days

6 days

9 days

P value

18.3 7.066 3.201

63.5 11.884 6.429

61.7 13.545 4.211

0.001 0.001 0.038

Real-time PCR proWles for the expression of fg08080 relative to time 0 over a 9-day time course study of F. graminearum DAOM180378 grown under trichothecene-inducing conditions.

trichothecene-inducing liquid culture whereas expression of fg12217 is detectable in CM, MMN, MMC, and during the trichothecene-inducing time course including the ini-

Fig. 3. RT-PCR analysis of genes Xanking the putative gene cluster. The expression of Wve genes Xanking the putative gene cluster as well as fg08082 within the cluster was assayed by RT-PCR using gene-speciWc primers Xanking introns. Lane 1 shows the RT-PCR product ampliWed from F. graminearum genomic DNA (control) while the remaining lanes show the RT-PCR products from total RNA extracted from F. graminearum grown under various culture conditions. Lane 2: CM, complete media; lane 3: MMN, minimal media lacking a nitrogen source; lane 4: MMC, minimal media lacking a carbon source; lanes 5,6,7: 0d, 6d, 12d time points of trichothecene-inducing liquid culture. The arrow indicates the size of RT-PCR band expected for the speciWc gene assayed. Two biological replicates were assayed.

tial time point. fg08085 is expressed at a low level at 6d and 12d of the trichothecene-inducing time course, much lower than the expression of fg08082. With the exception of the low expression of the putative regulatory gene fg08080, the genes in the fg08077–fg08084 region exhibit strong gene induction and expression during trichothecene-inducing culture conditions that is not observed with the genes Xanking the cluster. 3.3. The trichothecene-producing liquid culture also produces signiWcant amounts of butenolide To explore what other secondary metabolites may be synthesized under the two-stage trichothecene-producing conditions, HPLC and NMR analyses of the culture supernatant was performed (a representative proWle after 12 days in 2nd stage media is shown in Fig. 4). In parallel with the RNA analysis of the mycelia, metabolite production of the DAOM180378 fermentation as a function of time was


301

approximately day 4 and increased until day 14 to yield levels of »120 mg/L or more (data not shown). However, RNA quality was poor after day 12, suggesting decreased health of the culture. Butenolide production commenced at » day 2 and maximized at day 9, remaining constant for the rest of the fermentation. NMR analysis of the extracted supernatant showed no other metabolites were present in any signiWcant quantity other than butenolide and 15ADON, with a minor amount of the calonectrin derivative (Fig. 4B).While butenolide was not quantitated by HPLC, the molar ratio to 15-ADON could be measured from the 1 H NMR spectrum (data not shown). Generally, the butenolide:15-ADON ratio was 4:1 at day 4, 3:1 at day 6, 2:1 by day 9 and 1:1 by day 12. By day 14, there was more 15ADON than butenolide. The wild-type transformation progenitor strain, Z-3639, was also tested and produced the same metabolites as DAOM180378 but proved to be a better producer of 15-ADON under the same conditions, yielding almost 400 mg 15-ADON/L by day 14, up from 240 mg/L at day 6 (data not shown). Butenolide was present in a molar ratio of 1:2 (butenolide:15-ADON) at day 6 and dropped to 1:4 by day 12. Variation between runs generally showed that when 15-ADON production was greater, butenolide production was less and vice versa. 3.4. Gene disruption of fg08079 results in loss of butenolide production Fig. 4. Metabolite analysis of the trichothecene-producing liquid culture of F. graminearum isolate DAOM180378. (A) HPLC analysis of the culture Wltrate in modiWed MYRO medium at 12 days. Peak identiWcation was made with known standards. This represents » 100 mg/L 15-ADON. HPLC of the culture medium alone shows that the initial peak (at » 1.5 min) is due to residual media components (glycerol, sucrose byproducts). (B) 500 MHz 1H NMR spectrum of the ethyl acetate extract of the same 12 day culture Wltrate. B denotes resonances due to butenolide, A denotes resonances due to 15-ADON, and the associated number refers to the numbered carbon shown on the structures. Extra resonances are due to residual solvent (sample is an oil) and some non-polar cellular debris that is co-extracted by ethyl acetate.

quantitated by HPLC, and then the total supernatant was extracted and analyzed by NMR. Experience has shown that >90% of the 15-acetyldeoxynivalenol (15-ADON) is secreted into the medium (Miller and Blackwell, 1986). The major HPLC peaks observed were identiWed as butenolide and 15-ADON (Fig. 4A). Peak identiWcation was made with authentic standards. The small peak at »11 minutes has the same retention time as DON and was originally identiWed as DON. However, studies on larger scale growths of this isolate revealed that a second compound identiWed as 7,8-dihydroxy-3-deactylcalonectrin co-elutes with DON (B. Blackwell, unpublished results). Analysis of the Wner features of the NMR spectrum shows that it is this compound that is present, rather than DON, but in very small quantities (»5%). This compound likely represents the immediate oxidative precursor to 15-ADON. HPLC analysis revealed that 15-ADON production commenced at

After transformation of F. graminearum wild-type strain Z-3639 with the disruption vector pLH79, 60 fungal transformants, LH79D, were analyzed by PCR and Southern analysis to determine which mutants carried a genetically disrupted fg08079. Only seven were determined to be true gene disruptants; the remaining Wfty-three had ectopic insertions of the disruption vector. Fig. 5 shows the molecular analysis of fourteen of these transformants. Seven (Fig. 5A, lanes 3, 5, 7, 10, 11, 14, 15) were clearly shown to have a disrupted fg08079 coding region and seven (Fig. 4A, lanes 4, 6, 8, 9, 12, 16, and 17) had ectopic insertions as they had the same band as seen in the progenitor (Fig. 5A, lanes 2 and 13), indicating that fg08079 was not disrupted. Fig. 5B is the corresponding DNA gel showing the restriction of the genomic DNA by Bsu36I. The seven gene disruptants have a single insertion into the fg08079 region (PCR analysis, data not shown), but it is not known whether there may be other ectopic insertions in these transformants. All 60 transformants were analyzed by GC– MS to determine any unusual toxins or intermediates after 3 days of growth in the 2nd stage media. The Wfty-three transformants with ectopic insertions produced the trichothecenes 15-ADON, calonectrin, and 3,15-diacetyldeoxynivalenol (3,15-diADON) as well as butenolide while the seven disrupted fg08079 mutants produced only the three trichothecenes; no butenolide was detected (representative spectra shown in Fig. 6). One of these seven (LH79D27; Fig. 5, lane 7) was also assayed by both HPLC and NMR and the spectra conWrmed the presence of 15-ADON and

302


insertions) and seven did not (disruptants). All 14 transformants were as virulent in the wheat head blight assay as the wild-type (data not shown). 4. Discussion

Fig. 5. Genomic analysis of wild-type F. graminearum Z-3639 and 15 transformants (LH79D) selected from the gene disruption transformation. The Wgure was prepared by splicing two separate gels together between lanes 12 and 13. (A) Southern analysis. Probe was an 870 bp fragment of fg08079 (primers 1623/1624) labelled with 32P-dCTP. Genomic DNA was cut with Bsu36I. Lane 1: lambda DNA cut with HindIII/EcoRI; lanes 2 and 13: Z-3639; lanes 3–12, 14-17: transformants LH79D6, 13, 20, 21, 27, 32, 40, 43, 44, 45, 50, 52, 54, 34, respectively. Molecular sizes in kilobases. (B) Ethidium bromide-stained gel of the corresponding Southern in A.

the absence of butenolide (data not shown). No other metabolites were detected, although the yield of 15-ADON was less (»50 mg/L) than the parent. 3.5. Add-back transformants of fg08079 have regained the ability to synthesize butenolide To conWrm that fg08079 was involved with the formation of butenolide, two of the fg08079 mutants that did not make butenolide, LH79D6 and LH79D20, were transformed with an intact copy of fg08079, including »1 kb upstream and downstream of the coding region. Eighty-Wve transformants were analyzed by GC–MS. Sixty transformants made butenolide (representative spectrum in Fig. 6) and 25 did not. Five butenolide-producing and Wve nonproducing transformants were randomly selected for further study. PCR analysis showed that all 10 transformants carried the geneticin gene and the hygromycin gene (data not shown). Transformants that carried an intact fg08079 produced butenolide. Transformants that did not have an intact fg08079 did not produce butenolide (data not shown). 3.6. Butenolide does not play a major role in the spread of head blight in wheat Fourteen of the transformants created with the fg08079 disruption vector were analyzed in greenhouse virulence assays, along with the progenitor wild-type strain (Z-3639). Seven of the transformants produced butenolide (ectopic

The development of F. graminearum EST libraries and the sequencing of the F. graminearum genome have shifted research eVorts toward the functional characterization of all identiWed F. graminearum genes. By conducting gene expression proWling via electronic northern analysis and mapping ESTs to the genome sequence (http:// www.genome.wi.mit.edu), we have identiWed a novel cluster of genes that were more highly expressed under growth conditions that promoted mycotoxin expression. These eight genes mapped to consecutive loci on genome sequence contig 1.324. Through gene disruption studies, we were able to determine that at least one of the genes, fg08079, is involved with butenolide production. To prove that the loss of butenolide production was due to loss of fg08079 function, we added the intact gene with its endogenous promoter back into fg08079¡ transformants. Butenolide production was restored, thus supporting the hypothesis that fg08079 plays a role in butenolide production. The predicted function of the fg08079 protein product is that of a cytochrome P450, based on sequence similarity to other P450’s (NCBI BLAST search). It has low identity (