A onestep multiplex RTPCR assay for ... - Wiley Online Library

Letters in Applied Microbiology ISSN 0266-8254

ORIGINAL ARTICLE

A one-step multiplex RT-PCR assay for simultaneous detection of four viruses that infect peach Y. Yu1,2, Z. Zhao1,3, D. Jiang1,2, Z. Wu2 and S. Li1 1 State Key Laboratory of Biology of Plant Diseases and Insect Pests, Institute of Plant Protection, Chinese Academy of Agricultural Sciences, Beijing, China 2 Institute of Plant Virology, Fujian Agriculture and Forestry University, Fuzhou, China 3 China Agriculture University, Beijing, China

Significance and Impact of Study: The mRT-PCR assay described in this study was developed for the simultaneous detection of four peach viruses from infected peach samples is reliable and sensitive. In contrast to conventional uniplex RT-PCR, mRT-PCR is more efficient, reducing costs, time and handling when testing large numbers of samples. This rapid and simple method is useful for large-scale surveys of viruses that infect peach.

Keywords detection assays, ELISA, multiplex RT-PCR, peach viruses. Correspondence Shifang Li, State Key Laboratory of Biology of Plant Diseases and Insect Pests, Institute of Plant Protection, Chinese Academy of Agricultural Sciences, Yuanmingyuan West Road No 2, Haidian District, Beijing 100193, China. E-mails: [email protected] and [email protected] 2013/0060: received 10 January 2013, revised 3 June 2013 and accepted 13 June 2013 doi:10.1111/lam.12120

Abstract A multiplex reverse transcription polymerase chain reaction (mRT-PCR) assay was developed to enable the simultaneous detection and differentiation of four viruses that infect peach, namely Apple chlorotic leaf spot virus (ACLSV), Cherry green ring mottle virus (CGRMV), Prunus necrotic ringspot virus (PNRSV) and Apricot pseudo-chlorotic leaf spot virus (APCLSV). In this study, four pairs of primers, one specific for each virus, were designed; the corresponding PCR products were 632, 439, 346 and 282 bp in length for ACLSV, CGRMV, PNRSV and APCLSV, respectively, and the fragments could be distinguished clearly by agarose gel electrophoresis. The sensitivity and specificity of the method were tested using individual RT-PCR and enzyme-linked immunosorbent assay (ELISA), and the identity of the RT-PCR amplification products was also confirmed by DNA sequencing. The results of RT-PCR and ELISA, along with batch detection using samples collected from peach orchards, revealed that this rapid and simple technique is an effective way to identify the four viruses simultaneously.

Introduction Apple chlorotic leaf spot virus (ACLSV), Cherry green ring mottle virus (CGRMV), Prunus necrotic ringspot virus (PNRSV) and Apricot pseudo-chlorotic leaf spot virus (APCLSV) are four major viruses that infect peach (Prunus persica). Among these viruses, ACLSV and PNRSV are distributed worldwide, CGRMV was originally found in North America and was subsequently detected in Europe, New Zealand, Africa, Japan and China (Parker et al. 1976; N′emeth 1986; Gentit et al. 2001; Isogai et al. 2004; Zhou et al. 2011), and APCLSV is limited to Campania (Barone et al. 2008), the Czech Republic (Safarova et al. 2012) and China (Niu et al. 2012). Both serological and molecular methods, including the enzyme-linked immunosorbent assay (ELISA) and 350

polymerase chain reaction (PCR), have been used to detect viruses that infect peach. An ELISA-based assay was originally developed for ACLSV detection in Flegg and Clark 1979 by Flegg and Clark, and later reverse transcription (RT)-PCR, immunocapture reverse transcription PCR and multiplex IC-RT-PCR were employed for the detection of ACLSV by Nemchinov et al. (1995). A sophisticated realtime PCR assay for ACLSV detection was reported by Salmon et al. in 2002. RT-PCR and plate trapping (PT)RT-PCR assays have been used for the detection of CGRMV (Li and Mock 2005; Komorowska et al. 2008). Several methods have been utilized for the detection of PNRSV, including RT-PCR, ELISA and hybridization (Sanchez-Navarro et al. 1998). Additionally, double-antibody sandwich ELISA, triple-antibody sandwich (TAS)ELISA (Liberti et al. 2005) and RT-PCR (Niu et al. 2012)

Letters in Applied Microbiology 57, 350--355 © 2013 The Society for Applied Microbiology

Y. Yu et al.

Detection of four peach viruses by multiplex RT-PCR

have been used for the detection of APCLSV. A major limitation of all these assays is that usually only a single pathogen is detected per assay. Procedures that allow simultaneous detection and/or identification of different viruses are desirable for routine diagnosis because they require less time, labour and cost than single RT-PCR assays (Jarosova and Kundu 2010). Multiplex RT-PCR (mRT-PCR), which enables simultaneous amplification of many targets of interest in a single reaction that contains several primer pairs, has become a valuable tool for the detection of different viruses (Bertolini et al. 2001; Ito et al. 2002; Dovas and Katis 2003; Ragozzino et al. 2004; Uga and Tsuda 2005). Multiplex RT-PCR is more efficient and cost-effective than other PCR-based techniques. A survey of peach viruses was previously carried out in the main peach-growing areas of China, and four viruses were identified from collected samples using RT-PCR and ELISA method. It is worth noting that phenomenon of mixed infections is frequent. This makes survey of peach viruses by RT-PCR to be laborious, time-consuming and costly because of more repeat detection, especially for large-scale samples. Multiplex RT-PCR could solve such problem. The simultaneous detection of eight stone fruit viruses including ACLSV and PNRSV was described by Sanchez-Navarro et al. in 2005. Jarosova and Kundu (2010) reported an RT-PCR assay for the simultaneous detection of PNRSV, PPV and PDV. However, the simultaneous detection of ACLSV, CGRMV, PNRSV and APCLSV from infected peach has not been reported. In this study, we describe a one-tube mRT-PCR-based protocol for the simultaneous detection of these four viruses in infected peach leaves. Results and discussion

products of the expected viral DNA fragments without nonspecific bands were obtained (lane 1, ACLSV; lane 2, CGRMV; lane 3, PNRSV; lane 4, APCLSV). To confirm the specificity of the mRT-PCR in different virus combinations, two to four extracts from peach leaves infected with individual viruses were mixed and analysed by mRT-PCR; as a result, fragments of the expected sizes for the different viruses were amplified in all tested combinations (Fig. 1a, lanes 5–15). Optimization of mRT-PCR This mRT-PCR amplification technique was optimized to enable the simultaneous amplification of all four viruses using specific primers. Different concentrations of primer sets and annealing temperatures were tested (data not shown). The concentrations of individual primer pairs were varied between 40 and 300 nmol l 1, and thermal gradients between 45 and 55°C were also tested for annealing temperatures. Sensitivity of uniplex and multiplex RT-PCR A series of 10-fold dilutions of RNA extracts from peach leaves infected with single virus were tested by uniplex and multiplex RT-PCR using the designed primer pairs. In the uniplex RT-PCR analysis, ACLSV, CGRMV, PNRSV and APCLSV could be detected when the RNA extracts were diluted by approx. 10 4, and occasionally even 10 5 (100 000-fold). In the mRT-PCR assays, all virus-specific bands could be detected at dilutions of 10 3, and ACLSV (632 bp) and PNRSV (346 bp) could be amplified when the sample was diluted by 10 5, although the PNRSV-specific band was not very distinct (Fig. 1f).

Primer specificity and compatibility

Confirmation of PCR specificity by DNA sequencing

The mRT-PCR assay containing all eight primers listed in Table 1 was initially optimized by amplifying specific virus fragments from peach leaves infected with the individual virus; as shown in Fig. 1a, specific amplification

To determine the specificity of the mRT-PCR assays, the amplicons generated by mRT-PCR from each virus were cloned and sequenced. Sequencing analysis revealed that all the amplicons were specific to the corresponding

Table 1 Virus-specific primers used in the one-step multiplex RT-PCR assay Primer

Sequence (5′–3′)

Product size (bp)

Location

Reference

ACLSV-F ACLSV-R CGRMV-F CGRMV-R PNRSV-F PNRSV-R APCLSV-F APCLSV-R

CCATCTTCGCGAACATAGC GTCTACAGGCTATTTATTATAAG TTCCAAAGAAGCCACAGAC TTCCAGATCACTGGCGCATA GAACCTCCTTCCGATTTAG GCTTCCCTAACGGGGCATCCAC ACATCTGCCCTCCACACAA TCTGAGTAAGCTGATCCAGC

632

6902–6921 7537–7518 68–86 487–506 527–545 884–863 262–280 543–524

NC001409

439 346 282


JF810672 AJ133208 AY713380

351

Y. Yu et al.


bp M

1

2

3

4

5

6

7

8

9

10 11 12 13 14 15 16

750 500

bp 632 439 346 282

250 (a)

bp 750 500 250 bp 750 500 250

M 100 10–1 10–210–3 10–4 10–5 10–6 bp 750 500 250 (b) M

100

10–1 10–210–3 10–4 10–5 10–6

bp 750 500 250

M 100 10–1 10–210–3 10–4 10–5 10–6

(c)

M

100

10–1 10–210–3 10–4 10–5 10–6

(d)

bp

M

100

(e)

10–1 10–2 10–3 10–4 10–5 10–6

750 500

ACLSV CGRMV PNRSV APCLSV

250

(f) Figure 1 (a) Detection and differentiation of ACLSV, CGRMV, PNRSV and APCLSV by one-step multiplex RT-PCR. Lane M, DL2000 DNA marker; lanes 1–4, samples infected with individual viruses (ACLSV, 632 bp; CGRMV, 439 bp; PNRSV, 346 bp; APCLSV, 282 bp); lanes 5–15, samples infected with different viruses; lane 16, healthy peach. (b–f) Detection limits of single and multiplex RT-PCR assays for the detection of four viruses. Amplicons from 10-fold serial dilutions of extracts from peach leaves infected with a single virus (b–e, ACLSV, CGRMV, PNRSV and APCLSV) and a mixture of total extracts from individually infected samples (f). Lane M, DL 2000 DNA marker.

viruses, which reconfirmed the identity of each amplicon, and also established the specificity and reliability of the assay. Validation of the multiplex RT-PCR result by ELISA and RT-PCR To validate the reliability of mRT-PCR assay in field applications, 239 leaf samples of peach were collected from seven regions of China and tested by mRT-PCR, ELISA and RT-PCR. In ELISA, four kinds of antiserum (Agdia, Elkhart, USA) were used to determine ACLSV, CGRMV, PNRSV and APCLSV, respectively. The results of the mRT-PCR assay demonstrated that ACLSV was positive in 57 samples (238%), CGRMV in 12 samples (50%), PNRSV in 23 samples (96%) and APCLSV in two samples (08%). Most samples were infected with a single virus, only a few were found to be infected with two viruses. Results of the ELISA showed that all samples that tested positive by ELISA were also positive according to the mRT-PCR assay. However, three samples shown to be positive for ACLSV in the mRT-PCR assay were negative 352

in the ELISA, indicating that the sensitivity of ELISA was lower than mRT-PCR. Furthermore, all positive samples tested by mRT-PCR were also found to be infected with peach viruses, even sensitivity of mRT-PCR was an order of magnitude lower RT-PCR. Our results showed that the mRT-PCR can be a more effective method to detect different viruses from peach in large-scale field surveys. Rapid and reliable detection of viruses is still one of the most challenging tasks in plant virology. In this study, we developed a rapid and simple one-step mRT-PCR assay for the simultaneous detection of four viruses (ACLSV, CGRMV, PNRSV and APCLSV) that infect peach in China, and we demonstrated that this method was highly sensitive and specific. Primer interaction is a crucial factor involved in the successful development of mRT-PCR (Wei et al. 2008). In this study, a range of parameters, such as the compatibility of primer pairs, primer concentration, annealing temperature, extension time and cycle number, were evaluated to optimize the mRT-PCR. Firstly, the primers should be designed so that they cannot create self-dimers. Secondly, the annealing temperatures of all primers should be similar so that high


Y. Yu et al.

specificity can be achieved, and the same is true for annealing times. Finally, the concentration of individual primers can be adjusted to solve the problem of ‘strong amplifiers’ primers by decreasing their concentration and increasing the concentration of ‘weak amplifiers’ primers. In our study, the primer pair ACLSV-F/ACLSV-R worked well in the uniplex RT-PCR; however, the expected fragment of 632 bp could not be detected in the mRT-PCR assay until the final concentration of the ACLSV-specific primers was increased to 250 nmol l 1, which increased the quantity of the target product to the point where it could be detected. This may be due to competition between the ACLSV primer pairs and other primer pairs in the complex mRT-PCR. The detection limit of the mRT-PCR assay was up to an order of magnitude less than that of the individual assays for any given virus (Fig. 1e). The reduction in the sensitivity of the mRT-PCR assay may result from competition among primer pairs, as has been previously reported for several virus mRT-PCR assays (Roy et al. 2005; Uga and Tsuda 2005; Gambino and Gribaudo 2006). ELISA has been a reliable method for assaying a large-number of virus-infected samples; however, this method lacks sensitivity when the viruses to be detected are present at low titres. Moreover, the identification of different viruses by ELISA requires a different antiserum for each virus (Canning et al. 1996). In this study, the results of batch detection revealed that the mRT-PCR assay was more sensitive and reliable in detecting and differentiating the four different viruses from peach than the ELISA. In conclusion, the mRT-PCR assay described here that was developed for the simultaneous detection of ACLSV, CGRMV, PNRSV and APCLSV from infected peach samples is reliable and sensitive. In contrast to conventional uniplex RT-PCR, mRT-PCR is more efficient, reducing costs, time and handling when testing large numbers of samples. This rapid and simple method will be useful for large-scale surveys of viruses that infect peach and also helpful for studies of the epidemiology of the four viruses. Materials and methods Plant materials and RNA extraction Two hundred and thirty-nine samples were collected from different peach orchards in China. After homogenization of leaf samples using tissue grinding apparatus (HerosBio, DHS, Beijing, China), total RNA was extracted from 100 mg samples of peach leaves using TRIzol (Invitrogen, CA, USA) according to the manufacturer’s instructions, and this was then used as template for the synthesis of first-strand cDNA.


Design of virus-specific primers Several pairs of primers were designed based on specific and conserved regions of each individual virus to amplify virus-specific products of different sizes (Table 1). Primer PREMIER 5.0 (http://www.bbioo.com/download/58-166-1. html) was used to ensure that annealing temperatures for all the primers were designed to be similar so as to facilitate mRT-PCR amplification. Single PCR First-strand cDNA synthesis was performed using 1 ll of total RNA treated with DNase, 2 ll dNTPs (25 mmol l 1, TaKaRa, Dalian, China), 2 ll Moloney murine leukaemia virus (M-MLV) 5 9 buffer, 05 ll murine leukaemia virus (MLV) reverse transcriptase (200 U, Promega, Madison, WI, USA), 05 ll recombinant RNasin ribonuclease inhibitor (40 U, TaKaRa), 05 ll (20 lmol l 1) reverse primers and 35 ll distilled water. The reverse transcriptase reaction mixture (10 ll) was incubated for 60 min at 42°C, followed by 5 min at 98°C. The PCR mix (25 ll) contained 2 ll of cDNA, 16 ll 2 9 Long Taq mix (Tiangen Biotech, Beijing, China), 05 ll of each primer (Table 1) and 6 ll distilled water. Cycling conditions consisted of an initial denaturation at 94°C for 5 min, followed by 35 cycles of 94°C for 30 s, 48–52°C for 30 s, 72°C for 1 min and a final extension at 72°C for 10 min. Multiplex polymerase chain reaction Four different specific PCR primer pairs, one for each of the four viruses, were selected so that the amplification products were of different sizes and could be readily distinguished by agarose gel electrophoresis (Table 1). The optimal concentrations were 250, 200, 50 and 200 nmol l 1 for the ACLSV, CGRMV, PNRSV and APCLSV primer pairs, respectively. Optimal reaction conditions were determined to be an initial incubation at 42°C for 60 min for cDNA synthesis, followed by 5 min at 94°C and then 35 cycles of denaturation at 94°C for 30 s, primer annealing at 50°C for 30 s, primer extension at 72°C for 1 min, and a final extension at 72°C for 7 min. The reaction components and conditions yielded fragments specific to ACLSV (632 bp), CGRMV (439 bp), PNRSV (346 bp) and APCLSV (282 bp). Detection limits of uniplex and multiplex RT-PCR To determine the detection limits of the assay, extracts from infected trees were serially diluted 10-fold (100– 10 6) and tested in both individual and multiplex RT-PCR assays.


353

Y. Yu et al.


Cloning and sequencing To confirm the identity of the amplified products, PCR products were analysed on 2% agarose/TAE gels stained with DNAGREEN (TIANDZ, Beijing, China) and purified using a PCR purification kit (Tiangen). The purified fragments were cloned into the pMD18-T vector (TaKaRa) and then transformed into Escherichia coli DH5a. Positive clones were sequenced using an automated DNA sequencer (ABI Prism 3730XL DNA Analyzer; ABI, Carlsbad, CA, USA), and the identity of the viral sequences was then verified by a BLAST search against the NCBI nucleotide databases (http://blast.ncbi.nlm.nih.gov/Blast). Acknowledgments This work was supported by grants from the Earmarked Fund for China Agriculture Research System (CARS-31), the National Basic Research and Development Program of China (973 Program) (No. 2009CB119200), the Special Fund for Agro-scientific Research in the Public Interest (No. 201203076 and 200903004) and the National Natural Science Foundation of China (Nos. 31171819 and 31000842). References Barone, M., Alioto, D., Ragozzino, A. and Candresse, T. (2008) Investigation on occurrence of Tricho-, Fovea- and Capilloviruses in ancient fruit tree cultivars in Campania. Acta Hortic 781, 53–58. Bertolini, E., Olmos, A., Martinez, M.C., Gorris, M.T. and Cambra, M. (2001) Single-step multiplex RT-PCR for simultaneous and colourimetric detection of six RNA viruses in olive trees. J Virol Methods 96, 33–41. Canning, E.S., Penrose, M.J., Barker, I. and Coate, D. (1996) Improved detection of Barely yellow dwarf viruses in single aphids using RT-PCR. J Virol Methods 56, 191–197. Dovas, C.I. and Katis, N.I. (2003) A spot nested RT-PCR method for the simultaneous detection of members of the Vitivirus and Foveavirus genera in grapevine. J Virol Methods 107, 99–106. Flegg, C.L. and Clark, M.F. (1979) The detection of Apple chlorotic leafspot virus by a modified procedure of enzymelinked immunosorbent assay (ELISA). Ann Appl Biol 91, 61–65. Gambino, G. and Gribaudo, I. (2006) Simultaneous detection of nine grapevine viruses by multiplex reverse transcription-polymerase chain reaction with co-amplification of a plant RNA as internal control. Virology 96, 1223–1229. Gentit, P., Foissae, X., Svanetia-Dumas, L., Peypelut, M., Macquaire, G. and Candresse, T. (2001) Biological properties and partial characterization of two different

354

foveavirus associated with similar disorders of cherry trees. Acta Hortic 550, 161–168. Isogai, M., Aoyagi, J., Nakagawa, M., Kubodera, Y., Satoh, K., Katoh, T., Inamori, M., Yamashita, K. et al. (2004) Molecular detection of five cherry viruses from sweet cherry trees in Japan. J Gen Plant Pathol 70, 288–291. Ito, T., Ieki, H. and Ozaki, K. (2002) Simultaneous detection of six citrus viroids and Apple stem grooving virus from citrus plants by multiplex reverse transcription polymerase chain reaction. J Virol Methods 106, 235–239. Jarosova, J. and Kundu, J.K. (2010) Simultaneous detection of stone fruit tree viruses by one-step multiplex RT-PCR. Sci Hortic 125, 68–72. Komorowska, B., Cieslin′ska, M., Caglayan, K. and Ertunc, F. (2008) Detection and characterization of some isolates of Cherry green ring mottle virus. Acta Hortic 781, 65–69. Li, R.H. and Mock, R. (2005) An improved reverse transcription-polymerase chain reaction (RT-PCR) assay for the detection of two cherry flexiviruses in Prunus spp. J Virol Methods 129, 162–169. Liberti, D., Marais, A., Svanella-Dumas, L., Dulucq, M.J., Alioto, D., Ragozzino, A., Rodoni, B. and Candresse, T. (2005) Characterization of Apricot pseudo-chlorotic leaf spot virus, a novel trichovirus isolated from stone fruit trees. Phytopathology 95, 420–426. N′emeth, M. (1986). Virus, Mycoplasm and Richettsia Disease of Fruit Trees. Dordrecht: Martinus Nijhoff. Nemchinov, L., Hadidi, A., Candresse, T., Foster, J.A. and Verderevskaya, T. (1995) Sensitive detection of Apple chlorotic leafspot virus from infected apple or peach tissue using RT-PCR, IC-RT-PCR, or multiplex IC-RT-PCR. Acta Hortic 386, 51–61. Niu, F.Q., Pan, S., Wu, Z.J., Jiang, D.M. and Li, S.F. (2012) First report of Apricot pseudo-chlorotic leaf spot virus infection of peach in China. J Plant Pathol 1, 1. Parker, K.G., Fridland, P.R. and Gilmer, G.M. (1976) Green Ring Mottle. In: Virus diseases and noninfectious diseases of stone fruit in North America. US Department of Agriculture, Agriculture Handbook No. 437, 193–199. Ragozzino, E., Faggioli, F. and Barba, M. (2004) Development of a one tube-one step RT-PCR protocol for the detection of seven viroids in five genera: Apscaviroid, Hostuviroid, Pelamoviroid and Pospiviroid. J Virol Methods 121, 25–29. Roy, A., Fayad, A., Barthe, G. and Brlansky, R.H. (2005) A multiplex polymerase chain reaction method for reliable, sensitive and simultaneous detection of multiple viruses in citrus trees. J Virol Methods 129, 47–55. Safarova, D., Navratil, M., Candresse, T. and Marais, A. (2012) First report of Apricot pseudo-chlorotic leaf spot virus infecting plum (Prunus domestica) in the Czech Republic. Plant Dis 96, 461. Salmon, M.A., Vendrame, M., Kummert, J. and Lepoivre, P. (2002) Detection of Apple chlorotic leaf spot virus using a 5’ nuclease assay with a fluorescent 3’ minor groove binder-DNA probe. J Virol Methods 104, 99–106.


Y. Yu et al.

Sanchez-Navarro, J.A., Aparicio, F., Rowhani, A. and Palla, V. (1998) Comparative analysis of ELISA, nonradioactive molecular hybridization and PCR for the detection of Prunus necrotic ringspot virus in herbaceous and Prunus hosts. Plant Pathol 47, 780–786. Sanchez-Navarro, J.A., Aparicio, F., Herranz, M.C., Minafra, A., Myrta, A. and Pallas, V. (2005) Simultaneous detection and identification of eight stone fruit viruses by one-step RT-PCR. Eur J Plant Pathol 111, 77–84. Uga, H. and Tsuda, S. (2005) A one-step reverse transcriptionpolymerase chain reaction system for the simultaneous


detection and identification of multiple Tospovirus infection. Phytopathology 95, 166–171. Wei, T., Lu, G. and Clover, G. (2008) Novel approaches to mitigate primer interaction and eliminate inhibitors in multiplex PCR, demonstrated using an assay for detection of three strawberry viruses. J Virol Methods 151, 132–139. Zhou, J.F., Wang, G.P., Kuang, R.F., Wang, L.P. and Hong, N. (2011) First report of Cherry green ring mottle virus on cherry and peach grown in China. Plant Dis 95, 1319.


355