A simple method of DNA extraction for Eimeria species

Journal of Microbiological Methods 44 Ž2001. 131–137 www.elsevier.comrlocaterjmicmeth

A simple method of DNA extraction for Eimeria species Xiaomin Zhao ) , Donald W. Duszynski, Eric S. Loker Department of Biology, The UniÕersity of New Mexico, 167 Castetter Hall, Albuquerque, NM 87131-1091, USA Received 20 September 2000; received in revised form 11 December 2000; accepted 11 December 2000

Abstract A new, simple method is described for extracting DNA from coccidia ŽEimeriidae. oocysts. In our hands this method works well for all Eimeria oocysts and, presumably, will work equally well for oocysts of other coccidia genera. This method combines the two steps of breaking oocyst and sporocyst walls, and dissolving the sporozoite membrane in one step. This greatly simplifies the currently used DNA extraction procedures for Eimeria species and overcomes the disadvantages of existing DNA extraction methods based on glass-bead grinding and sporozoite excystation procedures. Because all the procedures are done in a 1.5-ml microfuge tube, which minimizes the loss of DNA in the extraction procedures, this method is especially suitable for samples with small number of oocysts. In addition, this method directly lyses the oocyst and sporocyst walls as well as the sporozoite membrane in a continuous incubation; therefore, it does not require the sporozoites to be alive. The results of PCR experiments indicate that this method generates better quality of DNA than what the existing glass-bead grinding method does for molecular analysis, and is suitable for both large or small number Ž- 10 2 oocysts. of living or dead oocyst samples. q 2001 Published by Elsevier Science B.V. Keywords: DNA extraction; Eimeria; Coccidia; PCR; Plastid

1. Introduction Members of the genus Eimeria are obligatory intracellular parasites found in a wide variety of wild and domestic vertebrates ŽDuszynski and Upton, 2001. and include many important pathogens of domestic animals ŽLevine, 1988.. The recent development of molecular methods has created a need for simple and efficient methods of DNA extraction for PCR amplification and related techniques in the study of Eimeria systematics, life cycle, epidemiology, genome analysis, evolution, diagnosis and drug de) Corresponding author. Tel.: q1-505-277-6804; fax: q1-505277-0304. E-mail address: [email protected] ŽX. Zhao..

velopment. The methodŽs. ought to be efficient with either large or small number of oocysts, alive or dead. Currently, several DNA extraction methods are available for Eimeria and other coccidia species, which can be divided into three types: Ž1. DNA is extracted from oocysts, which are homogenized mechanically by glass-bead grinding ŽHnida and Duszynski, 1999; MacPherson and Gajadhar, 1993; Molloy et al., 1998. or by grinding in liquid nitrogen ŽJinneman et al., 1998; Tsuji et al., 1999.; Ž2. DNA is extracted from sporocysts, which usually are released by glass-bead grinding and then purified by Percoll ŽBarta et al., 1997.; and Ž3. DNA is extracted from sporozoites that usually are obtained by excystation from purified sporocysts ŽDulski and Turner, 1988., and then the DNA is extracted from sporo-

0167-7012r01r$ - see front matter q 2001 Published by Elsevier Science B.V. PII: S 0 1 6 7 - 7 0 1 2 Ž 0 0 . 0 0 2 4 9 - 9

132

X. Zhao et al.r Journal of Microbiological Methods 44 (2001) 131–137

zoites either by standard DNA extraction procedures ŽDenny et al., 1998; Schnitzler et al., 1999. or by DNA extraction kit ŽBarta et al., 1998; Johnston and Fernando, 1995.. However, all these methods have some disadvantages. The first method is only suitable for large numbers of oocysts because with small numbers Ž- 10 3 ., oocysts walls do not break uniformly, thus greatly reducing the yield of DNA. The second method requires an extra purification procedure, which loses some parasites during the process. The third method requires the oocysts to be alive, because dead sporozoites cannot excyst. Thus, it cannot be applied to studies on old or preserved samples because long-term storage of oocysts eventually causes the death of, or greatly decreases, the excystation rate of sporozoites. Here, we describe a simple and effective alternative method for DNA extraction of Eimeria species, and the DNA quality is evaluated for molecular analysis.

2. Materials and methods 2.1. Parasites Large numbers of oocysts of Eimeria nieschulzi were obtained by inoculating 10 3 sporulated oocysts into laboratory-reared, coccidia-free Rattus norÕegicus, following the methods described by Upton et al. Ž1992.. The oocysts were sporulated, purified, and stored in 2% K 2 Cr2 O 7 solution at ; 48C until needed ŽDubey, 1996; Duszynski and Wilber, 1997.. 2.2. New method description for DNA extraction

centrifugation, followed by another 3 = washing in the above saline. The oocyst pellet was resuspended in 60 ml lysis buffer Ž660 mM EDTA, 1.3% Nlauroylsarcosine, 2 mgrml proteinase K, pH 9.5., and incubated at 658C for 45 min. Then, 350 ml sterile ddH 2 O was added to the mixture and the lysate was extracted with an equal volume of phenolrchloroformrisoamyl alcohol Ž25:24:1.. DNA was precipitated by adding 0.04 volumes of 4 M NaCl and 2–3 volumes of 100% cold ethanol. After 20–30 min incubation at y208C, DNA was pelleted and washed with 70% ethanol. The DNA pellet was air-dried and resuspended with MiliQ water or TE buffer Ž10 mM TRIS, 1 mM EDTA, pH 8.0.. 2.2.2. Protocol 2: DNA extraction by lysis buffer– CTAB Purified oocysts were washed, treated with sodium hypochlorite, and incubated in the lysis buffer as above. After a 45-min incubation with lysis buffer at 658C, 350 ml Cetyl–Trimethyl Ammonium Bromide ŽCTAB. buffer Ž2% wrv CTAB, 1.4 M NaCl, 0.2% b-mercapto-ethanol, 20 mM EDTA, 100 mM TRIS. was added and the suspension was incubated at 608C for 1 h. Then, DNA was extracted from the lysate by phenolrchloroform and precipitated by cold ethanol as described above. 2.2.3. Protocol 3: DNA extraction by lysis buffer– ddH2 O This protocol was used as control for the lysis buffer–CTAB method to determine if the CTAB can improve the DNA quality. DNA was extracted the same way as in DNA extraction by lysis buffer– CTAB except that ddH 2 O was used instead of CTAB.

We designed three protocols for the new method to get the best results.

2.3. DNA extraction by glass-bead grinding

2.2.1. Protocol 1: DNA extraction by lysis buffer Purified oocysts stored in 2% K 2 Cr2 O 7 solution were washed 4 = by centrifugation Ž1.4 = 10 3 rpm for 5 min, each wash. in autoclaved, high-salinity, phosphate-buffered saline Ž300 mM NaCl, 2.7 mM KCl, 10 mM Na 2 HPO4 , 1.7 mM NaH 2 PO4 . ŽReece et al., 1997.. The oocyst pellet was resuspended in 200 ml 5.75% sodium hypochlorite, and incubated on ice for 30 min. Oocyst suspension was then diluted with 1 ml sterile ddH 2 O and pelleted by

The DNA extraction by glass-bead grinding is currently the one most used for DNA extraction with Eimeria spp. To compare our new method with existing methods, we extracted DNA using a glassbead grinding method described by Hnida and Duszynski Ž1999., with minor modification. Briefly, the suspended oocysts in TE buffer were put in a sterile, 2-ml round bottom microfuge tube, 1–2 sterile, 4-mm glass beads were added, and the tube was vortexed vigorously. Breakage was monitored using


a compound microscope Ž40 = . at 2-min intervals until all the oocysts and their sporocysts appeared to be ruptured Žapproximately 10 min.. The suspension containing freed sporozoites was added to 1 ml of CTAB buffer containing proteinase K Ž100 mgrml., and incubated at 658C for 1 h. DNA was then purified by phenolrchloroform extraction followed by ethanol precipitation. The air-dried DNA pellet was resuspended in MiliQ water or TE buffer. 2.4. PCR amplification and identification of the PCR products The quality of DNA extracted by the different methods was evaluated by PCR for its use in molecular analysis. Both nuclear and organelle DNA were tested. The specific primers Žfor both 18S and 23S rDNA. were designed based on the published corresponding sequences of related species. For testing nuclear DNA, the18S rDNA was amplified using primers 18SF1, 5X -GCTTGTCTCAAAGATTAAGCC, and 18SR2, 5X-AGCGACGGGCGGTGTGTACAA. For organelle DNA testing, part of the plastid rDNA Inverted Repeats ŽplIR. that are a unique gene organization to plastid ŽDenny et al., 1998; Wilson et al., 1996. and part of the 23S rDNA in the plIR were amplified. For plIR: 16SR, 5XCCAGCMGCACCTTCCAGTACRGC; 23SFI, 5XCATTTCGGGGAGAACCAGCTAGCTCC; for 23S rDNA: 23SIF, 5X-CCTTTAAARAGTGCGTWAWAGCT, 23SIR, 5-CCCTAGAGTAACTTTTATCCGTT. PCR amplifications were carried out in 25 ml reactions under standard conditions using DNA Thermal Cycler 480 ŽPerkin Elmer.. The reaction mixture contained 1.25 U of Taq polymerase, 2.5 ml 10 = PCR buffer, 0.04 mM of each deoxynucleotide, 2.5 mM MgCl ŽPCR kit, Perkin Elmer., 1 mm of each amplification primer, 1 ml DNA template and MiliQ H 2 O to volume. The cycling profile was: 958C for 4 min in precycle, followed by 35 cycles of 928C denaturation for 45 s, primer annealing for 45 s Ž508C for plIR, 608C for 23S rDNA and 658C for 18S rDNA., and elongation at 728C for 1.5 min. Final primer extension continued for an addition of 7 min to allow the complete elongation of all amplifications. The resulting PCR bands were isolated from the agarose gel and the DNA was eluted from gel using

133

QIAEX II gel extraction kit ŽQiagen.. Sequencing was performed on both strands using a BigDye terminator cycle sequencing ready reaction kit ŽABI PRISM, Perkin Elmer.. PCR primers were used as two ends sequencing primers. To cover the full length of the inserted DNA fragments, some inner primers were designed to overlap the boundaries of primers. Identification of the sequences was performed by homology sequence searching using advanced BLASTn search in NCBI online blast search engine http:rrwww.ncbi.nlm.nih.govrblastrblast. cgi?Jforms 1..

3. Results 3.1. PCR results for plIR The part of plIR amplified in this study includes almost the full length of 16S rDNA Ž; 1450 bp., 900 bases of 23S rDNA at the 5X end and 7 tRNAs between the 16S and 23S rDNA, with 3 kb of total length. Amplifying large DNA fragments more than 2 kb long is more difficult and requires more precisely defined reaction conditions, such as the concentration of MgCl 2, and more copy numbers of DNA templates. DNA quality is also a determining factor for the success of long PCR. In this study, we successfully amplified a 3-kb fragment of using regular PCR procedures. The results show that although a 3-kb fragment of plIR can be amplified from the DNA templates extracted by all four procedures described in this study Žwhen as many as 10 6 ocysts are used., the lysis buffer–CTAB extracted DNA generates the strongest and clearest band. When 10 4 oocysts are used, only the lysis buffer–CTAB extracted DNA can generate a PCR band for the 3-kb fragment of plIR ŽFig. 1.. 3.2. PCR results for plastid 23S rDNA PCR results showed that DNAs extracted by all methods were equally good for PCR templates for the plastid 23S rDNA when G 10 3 oocysts were used ŽFig. 2, lanes 1–4.. For - 10 3 oocysts, the DNA extracted by lysis buffer–CTAB and lysis buffer–ddH 2 O generate the best PCR results ŽFig. 2, lanes 5–12.. For 50 oocysts, glass-bead extracted

134


DNA cannot generate a PCR band for the plastid 23S rDNA ŽFig. 2 lane 12.. For 20 oocysts, none of the DNA templates extracted by the different methods generated PCR bands for the plastid 23S rDNA Ždata not shown.. 3.3. PCR results for nuclear 18S rDNA

Fig. 1. PCR results of 3-kb plIR gene combinations amplified from E. nieschulzi DNA extracted using different methods. M: Molecular marker, HindIII digested l DNA, 500 ng loaded. Lanes 1 and 5: Lysis buffer–CTAB extracted DNA. Lanes 2 and 6: lysis buffer–ddH 2 O extracted DNA. Lanes 3 and 7: Lysis buffer extracted DNA. Lanes 4 and 8: Glass-beads extracted DNA. Lanes 1–4: DNA extracted from 10 6 oocysts. Lanes 5–8 DNA extracted from 10 4 oocysts. The negative results for no DNA controls are not included in the figure.

Fig. 2. PCR results of partial Ž1.3 kb. plastid 23S rDNA amplified from DNA extraction of E. nieschulzi. Lanes 1, 5, 9: Lysis buffer–CTAB extracted DNA. Lanes 2, 6, 10: Lysis buffer– ddH 2 O extracted DNA. Lanes 3, 7, 11: Lysis buffer extracted DNA. Lanes 4, 8, 12: Glass-beads extracted DNA. Lanes 1–4: DNA extracted from 10 3 oocysts. Lanes 5–8: DNA extracted from 10 2 oocysts. Lanes 9–12: DNA extracted from 50 oocysts. The negative results for no DNA controls are not ncluded in the figure.

All the DNA templates extracted by different protocols except for the glass-beads method generated good PCR bands for the nuclear 18S rDNA when as few as 10 oocysts were used ŽFig. 3.. Glass-beads extracted DNA generate weak bands for 10 2 and 50 oocysts, and no band for 10 oocysts. The PCR bands generated by DNA templates extracted by the other 3 procedures showed no difference in quality andror quantity. 3.4. Gene identification results The sequences of the nuclear 18S, plastid 23S and 16S rDNAs were determined from the cloned PCR products. The results of BLASTn search for homol-

Fig. 3. PCR results of partial Ž ;1.6 kb. nuclear 18S rDNA amplified from different DNA extraction of E. nieschulzi. Lanes 1, 5, 9: Lysis buffer–CTAB extracted DNA. Lanes 2, 6, 10: Lysis buffer–ddH 2 O extracted DNA. Lanes 3, 7, 11: Lysis buffer extracted DNA. Lanes 4, 8, 12: Glass-beads extracted DNA. Lanes 1–4: DNA extracted from 10 3 oocysts. Lanes 5–8: DNA extracted from 10 2 oocysts. Lanes 9–12: DNA extracted from 10 oocysts. The negative results for no DNA controls are not included in the figure.


ogy sequences showed that all the PCR products were from the expected genes. The sequence from the 18S rDNA PCR band had a BLAST score of 3092, 0.0 E-value, and 1576r1580 Ž) 99%. identity when compared with the E. nieschulzi small subunit ribosomal RNA gene of access aU40263. The sequences from the 23S rDNA band had 93% identity with the E. tenella plastid-like DNA ŽY14408.. The partial sequence Ž16S primer end. from plIR band had 97% identity with E. meleagrimitis plastid 16S rDNA ŽAF040970.. The results indicate that the PCR products generated in this study were from the expected nuclear 18S, plastid 23S, and plIR genes.

4. Discussion DNA extraction from prokaryotes and eukaryotes usually has two steps: rupture the cell to release DNA contents, followed by extraction of DNA from a lysate using a phenolrchloroform extraction and ethanol DNA precipitation protocol ŽSambrook et al., 1989.. However, because Eimeria have particularly thick oocyst wallŽs. that are highly resistant to mechanical and chemical forces ŽHammond and Long, 1973; Roberts and Janovy, 1996; Scholtyseck et al., 1971., additional steps to break the oocystrsporocyst walls to enable release of sporozoites are needed before the sporozoites can be solubilized. It has proven particularly difficult to break down the oocyst wallŽs. of Eimeria species because they generally are thick resistant structures composed of chitin-like substance ŽWilson and Fairbairn, 1961.. Current methods to extract DNA from Eimeria species must first mechanically break both oocyst and sporocyst walls to release the sporozoites. This is done by using either glass bead or grinding in liquid nitrogen. This may not suitable for small numbers of oocysts Že.g., - 10 3 ., because the technique is based on the frequent physical contact of oocysts to glass beads, to container wall, and to each other when vortexrgrinding. The fewer the number of oocysts, the less frequently oocysts contact something, which results in their breakage. Some oocysts may not be broken while others may be so disruptured that the sporozoites also are broken and DNA released. This will reduce the eventual yield of DNA because Ž1. not all sporozoites get released and Ž2. the DNA

135

from ruptured sporozoites sticks to the glass beads andror the container wall. Here, we described a new simple method for DNA extraction from Eimeria species. The principle is quite simple. The oocyst wall of Eimeria species usually consists of two or more layers ŽDuszynski et al., 1981; Hammond and Long, 1973; Long, 1982; Scholtyseck et al., 1971.: the outer Žskeletal. layer is a thick, elastic substance composed of a chitin-like material ŽWilson and Fairbairn, 1961. and quinone-tanned protein which can be dissolved in hypochlorite ŽHammond and Long, 1973.. The inner layerŽs. is composed of approximately 70% protein and 30% lipid, with the protein localized in the outermost portion and the lipid mainly distributed in innermost portion of the inner layer ŽHammond and Long, 1973.. Because the inner layer of the oocyst wall mainly is composed of protein and lipid, it can be digestedrdissolved by proteinase K and a high concentration of detergents such as EDTA and N-lauroylsarcosine once the outer layer of the oocyst wall is removed. In our oocyst purification process, sodium hypochlorite was used to strip off the outer layer of the oocyst wall ŽHammond and Long, 1973., but has no effect on the oocyst contents. Then, lysis buffer consisting of a high concentrations of EDTA, N-lauroylsarcosine, and proteinase K is used to dissolve the inner oocyst wall, sporocyst walls and sporozoite membranes in a continuous incubation at high temperature Ž658C. and to release the DNA. The CTAB had been used for DNA extraction in plants, which have high amounts of polysaccharides that interfere with DNA extraction ŽRogstad, 1992, 1993.. We used CTAB in one DNA extraction protocol to remove possible polysaccharides that might be combined with DNA. The lysis buffer–ddH 2 O protocol is designed as a control for the lysis buffer– CTAB protocol to see if the use of CTAB can improve the DNA quality. The results show that the CTAB incubation step can improve the DNA quality, especially for the plastid DNA and for a long PCR reaction. A major aim of this study was to develop a reliable, rapid, and simple method for routine DNA extraction for Eimeria species suitable for both large and small numbers Ž- 10 3 . of oocysts for use with live or dead oocyst samples. The results show that our described method meets this aim. The lysis–

136


buffer protocol requires only one step to solubilize cells and then is followed by standard DNA extraction techniques such as phenolrchloroform extraction and ethanol DNA precipitation. It is quite simple and rapid when compared to other existing methods. The DNA extracted by this method is of good quality for molecular analysis, and as few as 10 oocysts of E. nieschulzi can provide enough DNA to generate strong and clear PCR bands for nuclear 18S rDNA. Although the DNA from F 10 4 oocysts extracted by this protocol may not be good enough for a PCR template to amplify a large fragment Ž) 3 kb. of plastid gene combinations, it is good enough to serve as template for amplification of single plastid genes. DNA extraction from 50 oocysts can generate good quality PCR bands for the plastid 23S rDNA. Our new method combines the two steps of breaking oocysts and solubilizing cells Žsporozoites. into one step, which greatly simplifies the currently used DNA extraction methods and overcomes the disadvantages of DNA extraction using glass-bead grinding and sporozoite excystation. Because all the procedures are performed in a 1.5-ml microtube, which minimizes the loss of DNA in the extraction procedures, it is especially suitable for oocyst samples with small numbers. In addition, this method directly lyses the oocyst wall, sporocyst wall and sporozoites in a continuous incubation, so it does not require the sporozoites to be alive. This method also can be used to deal with large numbers of oocysts and other coccidia species. We have tried as many as 2.7 = 10 7 oocysts of E. nieschulzi and got the same results Ždata not shown.. 99% of 2.7 = 10 7 oocysts suspended in 100 ml lysis buffer were lysed after 45-min incubation at 658C. We applied this DNA extraction method to other coccidia species such as Hammondia, Neospora, Isospora, and Caryospora species and got similar results Ždata not shown..

Acknowledgements We are very grateful to the staff of the Biology Animal Resource Facility at UNM for their animal care, and Biology Molecular Facility Laboratory at UNM for running sequence gels. This work was supported, in part, by grants from the UNM Office

of Graduate Studies, UNM Graduate Students Association, and the Graduate Research Allocations Committee in Department of Biology, in part by a PEET grant ŽNSF, DEB-95-21687. to DWD. References Barta, J.R., Martin, D.S., Liberator, P.A., Dashkevicz, M., Anderson, J.W., Feighner, S.D., Eibrecht, A., Perkins-Barrow, A., Jenkins, M.C., Danforth, H.D., Ruff, M.D., Profous-Juchelka, H., 1997. Phylogenetic relationships among eight Eimeria species infecting domestic fowl inferred using complete small subunit ribosomal DNA sequences. J. Parasitol. 82, 262–271. Barta, J.R., Coles, B.A., Schito, M.L., Fernando, M.A., Martin, A., Danforth, H.D., 1998. Analysis of infraspecific variation among five strains of Eimeria maxima from North America. Int. J. Parasitol. 28, 485–492. Denny, P., Preiser, P., Williamson, D., Wilson, L., 1998. Evidence for a single origin of the 35 kb plastid DNA in apicomplexans. Protist 149, 51–59. Dubey, J.P., 1996. Infectivity and pathogenicity of Toxoplasma gondii oocysts for cats. J. Parasitol. 82, 957–961. Dulski, P., Turner, M., 1988. The purification of sporocysts and sporozoites from Eimeria tenella oocysts using percoll density gradients. Avian Dis. 32, 235–239. Duszynski, D.W., Speer, C.P., Chobotar, B., Marchiondo, A.A., 1981. Fine structure of the oocyst wall and excystation of Eimeria procyonis from the American raccoon Ž Procyon lotor .. Z. Parasitenkunde 65, 131–136. Duszynski, D.W., Wilber, P.G., 1997. A guideline for the preparation of species descriptions in the Eimeriidae. J. Parasitol. 83, 333–336. Duszynski, D.W., Upton, S.J., 2001. The common coccidia of wild mammals: Cyclospora, Eimeria ŽEimeriidae. and Cryptosporidium ŽCryptosporidiidae. spp. In: Samuel, W., Pybus, M., Kocan, A.A. ŽEds.., Parasitic Diseases of Wild Mammals. 2nd edn. Iowa State Univ. Press, Ames, IA, in press. Hammond, D.M., Long, P.L., 1973. The Coccidia. University Park Press, Baltimore, MD, USA, pp. 151–154. Hnida, J.A., Duszynski, D.W., 1999. Taxonomy and systematics of some Eimeria species of Murid rodents as determined by the ITS1 region of the ribosomal gene complex. Parasitology 119, 349–357. Jinneman, K.C., Wetherington, J.H., Hill, W.E., Asams, A.M., Johnson, J.M., Tenge, B.J., Dang, N., Manger, R.L., Wekell, M.M., 1998. Template preparation for PCR and RFLP of amplification products for the detection and identification of Cyclospora sp. and Eimeria spp. oocysts directly from raspberries. J. Food Prot. 61, 1497–1503. Johnston, D.A., Fernando, M.A., 1995. Eimeria spp. of the domestic fowl: analysis of genetic variability between species and strains using DNA polymorphisms amplified by arbitrary primers and denaturing gradient-gel electrophoresis. Parasitol. Res. 81, 91–97. Levine, N.D., 1988. The Protozoan Phylum Apicomplexa vol. I. CRC Press, Boca Raton, FL.

X. Zhao et al.r Journal of Microbiological Methods 44 (2001) 131–137 Long, P.L., 1982. The Biology of the Coccidia. University Park Press, Baltimore, USA, pp. 144–152. MacPherson, J.M., Gajadhar, A.A., 1993. Differentiation of seven Eimeria species by random amplified polymorphic DNA. Vet. Parasitol. 145, 257–266. Molloy, J.B., Eaves, F.W., Jeston, P.J., Minchin, C.M., Stewart, N.P., Lew, A.E., Jorgensen, W.K., 1998. Detection of Eimeria acerÕulina using the polymerase chain reaction. Avian Dis. 42, 119–123. Reece, K.S., Siddall, M.E., Burreson, E.M., Graves, J.E., 1997. Phylogenetic analysis of Perkinsus based on actin gene sequences. J. Parasitol. 83, 417–423. Roberts, L.S., Janovy Jr., J., 1996. Foundations of Parasitology. 5th edn. Wm. C. Brown Publishers, Boston, MA, USA, 118. Rogstad, S.H., 1992. Saturated NaCl–CTAB solution as a means of field preservation of leaves for DNA analyses. Taxon 41, 701–708. Rogstad, S.H., 1993. Surveying plant genomes for variable number of tandem repeat loci. Methods Enzymol. 224, 278–294. Sambrook, J.E., Fritsch, E., Maniatis, T., 1989. Molecular Cloning. A Laboratory Manual. 2nd edn. Cold Spring Harbor Laboratory Press, New York.

137

Schnitzler, B.E., Thebo, P.L., Tomley, F.M., Uggla, A., Shirley, M.W., 1999. PCR identification of chicken Eimeria: a simplified read-out. Avian Pathol. 28, 89–93. Scholtyseck, E., Mehlhorn, H., Hammond, D.M., 1971. Fine structure of macrogametes and oocysts of coccidia and related organisms. Z. Parasitenkunde 37, 1–43. Tsuji, N., Ohta, M., Kawazu, S., Kamio, T., Isobe, T., Shimura, K., Fujisaki, K., 1999. DNA polymorphism of srRNA gene among Eimeria tenella strains isolated in Japan. J. Vet. Med. Sci. 61, 1331–1333. Upton, S.J., Mcallister, C.T., Brilihart, D.B., Duszynski, D.W., Wash, C.W., 1992. Cross-transmission studies with Eimeria arizonensis-like oocysts ŽApicomplexa. in New World rodents of the geners Baiomys, Neotoma, Onychomys, Peromyscus, and Reithrodontomys ŽMuridae.. J. Parasitol. 78, 406–413. Wilson, R.J.M., Denny, P.W., Preiser, P.R., Rangachari, K., Roberts, K., Roy, A., Whyte, A., Strath, M., Moore, D.J., Moore, P.W., Williamson, D.H., 1996. Complete gene map of the plastid-like DNA of the malaria parasite Plasmodium falciparum. J. Mol. Biol. 261, 155–172. Wilson, P.A., Fairbairn, D., 1961. Biochemistry of sporulation in oocysts of Eimeria acerÕulina. J. Protozool. 8, 410–416.