A simplified method for obtaining plant viral RNA for

Journal of Virological Methods 125 (2005) 67–73

A simplified method for obtaining plant viral RNA for RT-PCR Noriko Suehiro, Kazunori Matsuda, Seiichi Okuda, Tomohide Natsuaki ∗ Laboratory of Plant Pathology, Faculty of Agriculture, Utsunomiya University, Mine-machi 350, Utsunomiya 321-8505, Japan Received 13 August 2004; received in revised form 25 December 2004; accepted 11 January 2005

Abstract An easy and fast procedure (named the simple-direct-tube (SDT) method) was developed for preparing plant virus RNA for cDNA synthesis. The SDT method can be completed in approximately 15 min and does not require the use of antiserum, filtering or centrifugation. The procedure to grind plant tissues in phosphate-buffered saline containing Tween-20 (PBST) and to place the extract in a microfuge tube for a few minutes allow adsorption of the virus particles to the tube wall. The sap is then removed and the tube is washed with PBST before the addition of RNase-free water. This manipulation can be performed at room temperature. Using this method followed by reverse transcription-polymerase chain reaction (RT-PCR), infections by turnip mosaic virus, cucumber mosaic virus, and cucumber green mottle mosaic virus (CGMMV) were readily detected, indicating that the SDT method can be used in assays to detect different viruses. For the detection of CGMMV, it was necessary to heat the tubes before cDNA synthesis, suggesting that the immobilized CGMMV particles required disruption by heat treatment to release RNA. © 2005 Elsevier B.V. All rights reserved. Keywords: Turnip mosaic virus (TuMV); Cucumber green mottle mosaic virus (CGMMV); Cucumber mosaic virus (CMV); Simple direct tube method; Virus detection; RT-PCR

1. Introduction The polymerase chain reaction (PCR) and reverse transcription-PCR (RT-PCR) are powerful tools for highly sensitive detection of plant viruses with DNA and RNA genomes (Henson and French, 1993; Fenby et al., 1995; Singh, 1998). For some plant RNA viruses, development of a PCR assay would provide a significant improvement over current detection technology. The necessary nucleotide sequences for the design of PCR primers are readily available for many viruses but nucleic acid extraction from plant tissues is a laborious and time-consuming step in RT-PCR procedures. During the last decade, there have been many reports of simple and rapid techniques to detect plant viruses using RTPCR. Among them, direct binding (DB)-RT-PCR (Rowhani et al., 1995) and tube capture (TC)-RT-PCR (James, 1999) are ∗

Corresponding author. Tel.: +81 28 649 5449; fax: +81 28 649 5401. E-mail address: [email protected] (T. Natsuaki).

0166-0934/$ – see front matter © 2005 Elsevier B.V. All rights reserved. doi:10.1016/j.jviromet.2005.01.002

easy and useful protocols to detect viruses of woody plants without the use of phenol–chloroform extraction and antibodies, and are based on binding virus particles to the test tubes without any initial treatment. Because these methods require several hours to obtain virus RNAs, attempts were made to improve these techniques so as to simplify and shorten the time required for RNA extraction. A protocol has been developed and named the simple-direct-tube (SDT) method. It minimizes incubation times and omits centrifuging steps to obtain viral RNA from crude sap. In this study, the feasibility of the SDT-RT-PCR protocol was evaluated using turnip mosaic virus (TuMV) as a model. ˇ c TuMV is an important pathogen of cruciferous plants (Suti´ et al., 1999; Walsh and Jenner, 2002). It has filamentous particles and is a member of the genus Potyvirus, family Potyviridae. Because the main objective of this study was to improve the extraction of virus RNA, RT-PCR procedures were not considered. In order to apply and utilize this method for the detection of various plant viruses, representative important viruses with morphologically different particles, cucumber

68

N. Suehiro et al. / Journal of Virological Methods 125 (2005) 67–73

green mottle mosaic virus (CGMMV; genus Tobamovirus, rod-shaped particles) and cucumber mosaic virus (CMV; genus Cucumovirus, spherical particles) were examined as well.

50 ␮l of crude sap was added to each pre-coated PCR tube. The following steps were the same as those used for the standard SDT method. 2.4. RT-PCR

2. Materials and methods 2.1. Virus isolates and plants Three plant viruses, TuMV, CGMMV, and CMV, collected in Tochigi Prefecture, Japan were used in this study. TuMV (isolate Tu-3) was maintained in Brassica oleracea L. var. capitata L. (Suehiro et al., 2004). CMV and CGMMV were isolated and propagated in Nicotiana rustica or Lagenaria siceraria, respectively. Infected leaves were stored at −80 ◦ C. 2.2. Simple-direct-tube method: standard procedure Virus-infected leaves were ground 1:1 (w/v) in the phosphate-buffered saline (PBS) solution containing 0.05% Tween-20 (PBST) that is routinely used for enzyme-linked immunosorbent assays (ELISA). The resulting crude sap (50 ␮l) was carefully placed into a PCR tube (0.5 ml, polypropylene) using a truncated tip to avoid trapping any air bubbles. After incubation at room temperature for 15 min, the sap was removed with a truncated tip. The tube was then washed twice with 50 ␮l of PBST to remove residual tissue. Thirty microlitres of diethylpyrocarbonate-treated water (DEPC-water) containing 15 units (U) of RNase inhibitor (Takara) was added to the tube, which was then immediately incubated at 95 ◦ C for 1 min (denaturation), and cooled on ice for 1 min. The resulting solution was then used for RTPCR. During development of the SDT-method, the optimum denaturation temperature and time for different viruses were found to differ. Crude sap from TuMV-infected leaves was used to evaluate the effect of different conditions on the standard procedure. The conditions examined were: (1) incubation temperatures of the crude sap in the PCR tube at 0, 4, 16, 25 or 37 ◦ C. (2) Incubation of the crude sap in the PCR tube for 1, 5, 10, 15 or 30 min, (3) dilution of crude sap 1-, 5-, 10-, 20-, 50- or 100-fold in PBST. (4) Denaturation before cDNA synthesis for 1, 2, 3, 5 or 10 min or no denaturation (tubes were left on ice for 1–2 min). (5) Denaturation before cDNA synthesis at 65, 75, 85 or 95 ◦ C. Each experiment was repeated three or four times. 2.3. Immunocapture (IC-method) An IC-method was performed to compare the sensitivity of virus detection. Crude sap was prepared as in the standard SDT procedure. PCR tubes (0.5 ml, polypropylene) were incubated with 50 ␮l of anti-TuMV rabbit antiserum diluted 1000-fold with PBS at 37 ◦ C for 15 min. After washing twice with PBST,

The reverse transcription reaction was performed using a First-strand cDNA Synthesis Kit (Amersham Biosciences). The reaction mixture consisting of a total of 7.5 ␮l (4 ␮l of the final solution containing viral RNA, 0.5 ␮l of 200 mM DTT, 0.5 ␮l of 50 ␮M primer, and 2.5 ␮l of bulk first-strand cDNA mix containing M-MuLV reverse transcriptase) was incubated at 37 ◦ C for 1 h. Primers that can anneal to the 3 ends of each viral genome were used for the RT-reaction. One microlitre of the synthesized cDNA was added to 24 ␮l of the reaction mixture containing 2.5 ␮l of 10× PCR buffer, 1 ␮l of a mix containing 25 mM of each dNTP, 0.5 ␮l each of the 50 ␮M forward and reverse primers, 0.5 ␮l of Tth DNA polymerase (1 U/␮l, TOYOBO) and 19 ␮l of sterile distilled water. The tubes were heated at 94 ◦ C for 2 min and then subjected to 35 cycles of amplification: 1 min at 94 ◦ C for denaturation, 1 min at 60 ◦ C for annealing, and 1 min at 72 ◦ C for extension. Sequences of the primers used in this study are listed in Table 1. The primers TuMV5 F and Tu-2480R were used for long PCR with KOD Dash DNA polymerase (TOYOBO). The PCR solution contained 1 ␮l of the synthesized cDNA, 2.5 ␮l of 10× PCR buffer, 2 ␮l of 2 mM dNTPs, 0.5 ␮l of each 50 ␮M forward and reverse primer, 0.5 ␮l of DNA polymerase and was made up to a total of 25 ␮l with sterile distilled water. The tubes were heated at 94 ◦ C for 2 min and then subjected to 35 cycles of amplification: 30 s at 94 ◦ C for denaturation, 20 s at 58 ◦ C for annealing, and 90 s at 74 ◦ C for extension, except that the annealing step of the first 3 cycles was 53 ◦ C for 20 s. 2.5. Polyacrylamide gel electrophoresis (PAGE) Four microlitres of the amplified product (25 ␮l) mixed with 3 ␮l of loading buffer (0.25% bromophenol blue, 0.25% xylene cyanol, and 30% glycerol) was electrophoresed in a 5% polyacrylamide gel in TBE buffer at 20 mA for 40 min. A 1 kb DNA ladder (Invitrogen) was used as a molecular weight marker.

3. Results 3.1. Optimization and evaluation of crude sap conditions for TuMV detection Crude sap of infected leaves ground in PBST was used to determine the optimum conditions of temperature, time of incubation, and sap dilution to obtain recovery of the viral nucleic acid. We attempted to amplify three regions in the TuMV genome (Fig. 1A, I–III, and Table 1) in order


69

Table 1 Oligonucleotide primers for used in this study Virus

Primer

Sequence (5 –3 )

Position in Fig. 1

TuMV

Tu-135F Tu-400R Tu-5824F Tu-6358R Tu-8207F Tu-8822R TuMV5 F Tu-2480R NotI-d(T)18 a

AGCAGTTACATTCGCATCAGC CGGCTTCACTGCAGCTAACG TGTCGAGTTCTTGGAGGTGG TTGCGTGAGGATCCCACACCT GTGGAATTCCAAGTGAGTTGC TCCTTCTTCTCCTTCTCCGC GGCAAGCTTTAAAAATATAAAAACTC CGTGGGATCCAGTCGACAGTGACC AACTGGAAGAATTCGCGGCCGCAGGAA(T)18

I I II II III III IV IV Poly(A)

3F 2R 5F 4R 6Ra

AGTGGTTATTGTTGCCAGCC CCTCGTCAACATAGACAGCG TCTGAATATCCGGCCTTGC CCATAGACCACATCCAAGCC TCAACCTCACACGTAAGAGG

I I II II 3 -end

RNA1-5 F 708R 556F 1216R 13002F RNA2-5 F 254R 22710F RNA3-5 F 655R 31871F 3 Ra

GTTTTATTTACAAGAGCGTACGGTTC GTTCCGTGAGCATTCATCG GAACGATCCACAACAGTTCG GGCAATCTCTTCAGTCTCACG ACAARGTCACRTTCCGCTAC GTTTATTTACAAGAGCGTACGGTTC TGACACTCTCGCTGACATCC ATTGGTTCGCCGGTAACG TACGACTCACTATATACGTAATCTTACCAC TACACACGCTAGCTGTGGTACC CGAGCACCAACGYATTC CGCCCTGCAGTGGTCTCCTTTTGGA

I I II II III IV IV V VI VI VII III, V, VII

CGMMV

CMV

Product size (bp) 266 535 615 2511

458 316

708 660 359 254 336 655 344

Nucleotides shown in italic script are artificial sequences containing restriction enzyme recognition sites. a Specifically anneals to 3 -ends of viral RNAs and was used for cDNA synthesis.

Fig. 1. Schematic representations of the genome organization of the three viruses used in this study and regions amplified by SDT-RT-PCR. (A) Turnip mosaic virus (TuMV; genus Potyvirus); (B) cucumber mosaic virus (CMV; genus Cucumovirus); (C) cucumber green mottle mosaic virus (CGMMV; genus Tobamovirus). I–VII indicate amplified regions.

70


Fig. 2. Evaluation of incubation conditions of crude sap prepared from TuMV infected leaves. (A) Effect of temperature. Lanes 1–5; the crude sap was incubated at 0, 4, 16, 25 or 37 ◦ C, respectively, for 15 min. (B) Effect of time. Lanes 1–5; the crude sap was incubated for 1, 5, 10, 15 or 30 min, respectively, at room temperature. Lane M: 1 kb DNA ladder.

to determine the size of the first-strand cDNA synthesized from the template after using the SDT method. 3.1.1. Temperature and time of sap incubation As shown in Fig. 2A, any temperature, from 0 to 37 ◦ C, allowed detection of PCR products of the expected sizes with all three primer-pairs. It was not unexpected that the firststrand cDNA was synthesized from the 3 - to 5 -regions of the TuMV genome using the oligo-dT primer. However, at higher temperatures (25 and 37 ◦ C), amplified fragments had a tendency to degrade, especially, in region II (Fig. 2A, lanes 4 and 5). Altering the lengths of the incubation times had no effect, all regions were amplified under all the incubation times used (Fig. 2B). Remarkably, just 1 min of incubation was enough to amplify viral RNA (Fig. 2B, lane 1). These results indicate that virus particles will adsorb to the test tube at room temperature (cooler conditions, 0–16 ◦ C, are better) in approximately 1 min. 3.1.2. Dilution of sap, and sensitivity of SDT-RT-PCR compared to IC-RT-PCR The relative sensitivities of SDT-RT-PCR and IC-RT-PCR were compared using serial dilutions of crude sap containing TuMV particles (Fig. 3). PAGE of the PCR products indicated that by the SDT method regions I and II were not amplified when sap was diluted more than 20-fold (lanes 4 and 5). However, PCR products of region III (proximal to the 3 -end of the viral genome) were detected in dilutions of up to 1:50 (lane 5). IC-RT-PCR was more sensitive than SDT-RT-PCR. Although tubes pre-coated with antiserum were incubated for only 15 min, PCR products of the 5 -end of the genome were obtained from dilutions of up to 1:100 (Fig. 3, lane 11 of panel I), suggesting that IC-RT-PCR might be able to amplify more than 100-fold dilution. Taken together, the sensitivity of SDT-RT-PCR was less than that of IC-RT-PCR, although it was possible to detect TuMV reliably in a 10-fold dilution of the crude sap in PBST.

Fig. 3. Comparison of the respective sensitivities of SDT-RT-PCR (lanes 1–5) and IC-RT-PCR (lanes 6–11). Lanes 1–5; TuMV infected leaves were ground in PBST and diluted 1-, 5-, 10-, 20- or 50-fold, respectively. Lanes 6–11; IC-RT-PCR with crude sap diluted 1-, 5-, 10-, 20-, 50- or 100-fold, respectively.

3.2. Evaluation of denaturation conditions required to release viral RNA 3.2.1. Incubation temperature and time for the virus-containing solution Suitable conditions for the denaturation time were tested and the results indicated that 1 min was the best time for denaturation at 95 ◦ C (Fig. 4A, lane 1 of panels I–III). In turn, when the denaturation time was fixed for 1 min, 85 ◦ C was found to be the best temperature to obtain amplifiable RNA from TuMV particles (Fig. 4B, lane 3 of panel I).

3.2.2. cDNA synthesis without denaturation of the virus-containing solution When attempts were made to synthesize cDNA without prior heat treatment, all regions were amplified (Fig. 4C), showing that SDT-RT-PCR detection of TuMV does not require the denaturation treatment to release viral RNA from particles before cDNA synthesis. Further analysis, using long PCR, was carried out at region IV located at the 5 -end of the TuMV genome (Fig. 1A). Large fragments were detectable with or without heat denaturation (Fig. 4D, lanes 1 and 2), and the products were confirmed as TuMV-specific by comparing the sizes of fragment generated by restriction enzyme digestion to those predicted from the available sequence information (DDBJ Accession no. AB105134). IC-RT-PCR amplified the same PCR products with or without a denaturation step (Fig. 4D, lanes 3 and 4), and the results indicated that IC-RT-PCR is more sensitive than SDT-RT-PCR. These results also indicated that for long PCR of TuMV, it is preferable to use cDNA synthesized from samples prepared without using the denaturation step.


71

Fig. 6. Detection of CGMMV from Lagenaria siceraria by SDT-RT-PCR. (A) Effect of denaturation treatments on CGMMV-containing solutions. Lanes 1–3; amplification was not obtained without using denaturation. Lanes 4–6; the standard procedure modified using a 95 ◦ C denaturation step for 3 min. CGMMV crude sap was diluted 1-fold (lanes 1 and 4), 10-fold (lanes 2 and 5) or 100-fold (lanes 3 and 6), respectively. The amplified fragments were from region I as shown in Fig. 1C. (B) Comparison of incubation times in the denaturation step. The amplified fragments were from region II as given in Fig. 1C. Lanes 1–5; DEPC-treated water was added to virusadsorbed tubes prepared by the standard procedure followed by incubation at 95 ◦ C for 1.5, 3, 5, 10 or 15 min, respectively.

Fig. 4. Evaluation of denaturation conditions on the tubes with adsorbed TuMV particles. (A) Effect of time. Lanes 1–5; DEPC-treated water was added to virus-adsorbed tubes followed by incubation at 95 ◦ C for 1, 2, 3, 5 or 10 min, respectively. (B) Effect of temperature. Lanes 1–4; the tubes were incubated at 65, 75, 85 or 95 ◦ C, respectively, for 1 min. (C) Effect of no denaturation. After DEPC-treated water was added to virus-adsorbed tubes, the solution was subjected to cDNA synthesis without denaturation. Lanes 1–3; the amplified fragments of genomic regions I–III given in Fig. 1A, respectively. (D) Comparison of SDT-RT-PCR (lanes 1 and 2) and IC-RTPCR (lanes 3 and 4). The PCR to amplify the region IV of TuMV genome was carried out using solutions that did not undergo denaturation conditions (lanes 1 and 3) or denaturation at 85 or 95 ◦ C for 1 min (lanes 2 and 4).

which agrees with the results of DB-/TC-RT-PCR (Rowhani et al., 1995; James, 1999). On the other hand, no amplification was detected from CGMMV samples that had not been denatured (Fig. 6A, lanes 1–3). This result indicated that the denaturation step was essential to detect CGMMV by SDT-RT-PCR, as shown in Fig. 6A lanes 4–6, in contrast to the results with TuMV and CMV samples. In order to optimize detection of CGMMV, five different denaturation times ranging from 1.5 to 15 min were tested. As shown in Fig. 6B, the best result was obtained with incubation at 95 ◦ C for 3 min.

4. Discussion 3.3. CMV and CGMMV detections Detection of CMV was done using the standard method. All seven regions of the CMV tripartite genome were correctly amplified (Fig. 5A). However, the low intensities of products from regions I and VI suggest that it might be difficult to amplify large fragments including 5 -ends. Fig. 5B also shows that the denaturation step before cDNA synthesis was not required for CMV detection, as seen with TuMV, and

Fig. 5. Detections of CMV in Nicotiana rustica by SDT-RT-PCR. (A) Detection by standard conditions. Lanes 1–7; the amplified fragments of genomic regions I–VII given in Fig. 1B, respectively. (B) Detection without a denaturing step before cDNA synthesis. The other procedure was the same as the standard conditions. Lanes 1–2; the amplified fragments of genomic regions II and VI as shown in Fig. 1B, respectively.

The SDT-RT-PCR method is a very convenient technique to obtain template viral RNA for RT-PCR. The time required is less than 15 min before cDNA synthesis can be performed even when the number of samples is increased. This incubation period can be used to prepare the reverse transcription mixture. As shown in Fig. 2B, it is not necessary to monitor the incubation time precisely because successful amplification was obtained for all incubation times. In CGMMV detection, cDNA fragments could not be amplified without subjecting the tubes to denaturation temperatures, strongly suggesting that while the viral particles were trapped on the tube walls by the SDT method, the CGMMV rod-shaped particles were very stable in water and required heat treatment to release the RNA. TuMV and CMV were also detected by the SDT method, suggesting that particles of many different viruses can be directly immobilized onto polypropylene tubes within a few minutes. This phenomenon is probably the same as that involved in indirect-ELISA (Koenig and Paul, 1982) in which the conventional ELISA step of coating the surface of wells with antiserum was omitted. The SDT method worked equally well with all types of PCR tube used in our laboratory (data not shown). The method also produced detectable products from the crude

72


sap prepared with just phosphate buffer (0.1 M, pH 7.5) that is used for mechanical inoculation. These data indicate that to identify viruses only small amounts of crude sap such as might remain after ELISA or mechanical inoculation are enough for SDT-RT-PCR. The results presented here showed that the sensitivity of the SDT method was not high. The DB and TC methods using direct immobilization described previously by Rowhani et al. (1995) and James (1999) have higher sensitivities than the SDT method. However, much more time is required to obtain results with these methods. According to James (1999), the best grinding buffer is PBS containing 2% polyvinylpyrrolidone, giving results consistent with ICRT-PCR. The objective of this study was to facilitate virus detection by obtaining template viral RNAs for RT-PCR by the shortest and simplest procedure. The SDT method proved to be one of the fastest and most reliable protocols for detection of plant RNA viruses by RT-PCR. If more sensitivity is necessary, it is easy to change the protocol. For example, by adding the cDNA synthesis solution directly to the tube instead of DEPC-water and/or incubating crude sap (after filtration or centrifugation) for a longer period as with the DB and TC methods. For accurate detection by SDT-RT-PCR, the critical points are (1) washing the tube after crude sap incubation, i.e., residual plant material should be completely eliminated and (2) timing the addition of DEPC-treated water and the denaturing period of the tube containing the immobilized virus particles. Plant species contain polyphenolic compounds or polysaccharides that affect the extraction of intact nucleic acids (Newberry and Possingham, 1977; Demeke and Adams, 1992), and numerous workers have been confronted with this problem (Rowhani et al., 1993; Thomson and Dietzgen, 1995; Singh et al., 1998). In our study, it was possible to eliminate this problem by picking up visible material in the tube with a truncated tip. Depending on the circumstances, two or more washes may be required until the debris disappears. After washing, PBST should be completely removed using normal tips. It is important to avoid degradation of the viral RNA in the tube before cDNA synthesis, so DEPC-water should be added after preparing the RT-reaction mixture and adjusting the temperature of heat block. When every step is carried out carefully and quickly, only DEPC-water without RNase inhibitor, can be used to release viral RNA from attached particles in the tube without RNA degradation (data not shown). Because adsorption of virus particles to the tubes is thought to be caused by non-specific attachment, SDT-RTPCR and DB-/TC-RT-PCR are very useful tools for the detection of viruses especially when PCR primers for the target virus RNA are available but antisera against the virus particles are not. For example, the SDT method might be available to detect viruses with universal primers for potyviruses (Chen et al., 2001; Gibbs and Mackenzie, 1997; Gibbs et al., 2003), closteroviruses (Tian et al., 1996), and cucumoviruses (Choi et al., 1999). It is also likely that several viruses could be detected in a single sample by this method in a manner similar

to that used by James (1999). Moreover, it was demonstrated that a large fragment at the 5 region of the TuMV genome was amplified by SDT-RT-PCR, suggesting that it may be possible to synthesize the full-length cDNA of TuMV this way as reported by Chachulska et al. (1997) for potato virus Y. We suggest that in addition to its application in the detection of virus pathogens, the rapidity and simplicity of the SDT method could make it useful in general virological reaserch work. Acknowledgements This work was supported in part by the Special Coordination Funds for Promoting Science and Technology Leading Research Utilizing Potential of Regional Science and Technology of the Ministry of Education, Culture, Sports, Science and Technology of the Japanese Government. The authors gratefully acknowledge Dr. M.A. Mayo for correcting English of the manuscript. References Chachulska, A.M., Fakhfakh, H., Robaglia, C., Granier, F., Zag´orski, W., Vilaine, F., 1997. Synthesis of full-length potyvirus cDNA copies suitable for the analysis of genomic polymorphism. J. Virol. Methods 67, 189–197. Chen, J., Chen, J., Adams, M.J., 2001. A universal PCR primer to detect members of the Potyviridae and its use to examine the taxonomic status of several members of the family. Arch. Virol. 146, 757–766. Choi, S.K., Choi, J.K., Park, W.M., Ryu, K.H., 1999. RT–PCR detection and identification of three species of cucumoviruses with a genusspecific single pair of primers. J. Virol. Methods 83, 67–73. Demeke, T., Adams, R.P., 1992. The effects of plant polysaccharides and buffer additives on PCR. Biotechniques 12, 332–334. Fenby, N.S., Scott, N.W., Slater, A., Elliott, M.C., 1995. PCR and nonisotopic labeling techniques for plant virus detection. Cell. Mol. Biol. 41, 639–652. Gibbs, A., Mackenzie, A., 1997. A primer pair for amplifying part of the genome of all potyvirids by RT-PCR. J. Virol. Methods 63, 9–16. Gibbs, A.J., Mackenzie, A.M., Gibbs, M.J., 2003. The ‘potyvirid primers’ will probably provide phylogenetically informative DNA fragments from all species of Potyviridae. J. Virol. Methods 112, 41–44. Henson, J.M., French, R., 1993. The polymerase chain reaction and plant disease diagnosis. Annu. Rev. Phytopathol. 31, 81–109. James, D., 1999. A simple and reliable protocol for the detection of apple stem grooving virus by RT-PCR and in a multiplex PCR assay. J. Virol. Methods 83, 1–9. Koenig, R., Paul, H.L., 1982. Variants of ELISA in plant virus diagnosis. J. Virol. Methods 5, 113–125. Newberry, H.J., Possingham, J.V., 1977. Factors affecting the extraction of intact ribonucleic acid from plant tissues containing interfering phenolic compounds. Plant Physiol. 60, 543–547. Rowhani, A., Chay, C., Golino, D.A., Falk, B.W., 1993. Development of a polymerase chain reaction technique for the detection of grapevine fanleaf virus in grapevine tissue. Phytopathology 83, 749– 753. Rowhani, A., Maningas, M.A., Lile, L.S., Daubert, S.D., Golino, D.A., 1995. Development of a detection system for viruses of woody plants based on PCR analysis of immobilized virions. Phytopathology 85, 347–352.

N. Suehiro et al. / Journal of Virological Methods 125 (2005) 67–73 Singh, R.P., 1998. Reverse-transcription polymerase chain reaction for the detection of viruses from plants and aphids. J. Virol. Methods 74, 125–138. Singh, R.P., Singh, M., King, R.R., 1998. Use of citric for neutralizing polymerase chain reaction inhibition by chlorogenic acid in potato extracts. J. Virol. Methods 74, 231–235. Suehiro, N., Natsuaki, T., Watanabe, T., Okuda, S., 2004. An important determinant of the ability of Turnip mosaic virus to infect Brassica spp. and/or Raphanus sativus is in its P3 protein. J. Gen. Virol. 85, 2087–2098. ˇ c, D.D., Ford, R.E., Toˇsi´c, M.T., 1999. Vegetable virus diseases. In: Suti´ Handbook of Plant Virus Diseases. CRC Press, Boca Raton, Florida, USA, pp. 125–219.

73

Thomson, D., Dietzgen, R.G., 1995. Detection of DNA and RNA plant viruses by PCR and RT-PCR using a rapid virus release protocol without tissue homogenization. J. Virol. Methods 54, 85–95. Tian, T., Klaassen, V.A., Soong, J., Wisler, G., Duffus, J.E., Falk, B.W., 1996. Generation of cDNAs specific to lettuce infectious yellows closterovirus and other whitefly-transmitted viruses by RT-PCR and degenerate oligonucleotide primers corresponding to the closterovirus gene encoding the heat shock protein 70 homolog. Phytopathology 86, 1167–1173. Walsh, J.A., Jenner, C.E., 2002. Turnip mosaic virus and the quest for durable resistance. Mol. Plant Pathol. 3, 289–300.