Absence of hybridisation between Fuscospora ...

This article was downloaded by: [PB Heenan] On: 07 August 2015, At: 17:30 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: 5 Howick Place, London, SW1P 1WG

New Zealand Journal of Botany Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/tnzb20

Absence of hybridisation between Fuscospora species at a site in Arthur's Pass National Park, New Zealand a

a

a

a

RD Smissen , C Mitchell , M Roth & PB Heenan a

Allan Herbarium, Landcare Research, Lincoln, New Zealand Published online: 05 Aug 2015.

Click for updates To cite this article: RD Smissen, C Mitchell, M Roth & PB Heenan (2015): Absence of hybridisation between Fuscospora species at a site in Arthur's Pass National Park, New Zealand, New Zealand Journal of Botany, DOI: 10.1080/0028825X.2015.1040422 To link to this article: http://dx.doi.org/10.1080/0028825X.2015.1040422

PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms &

Downloaded by [PB Heenan] at 17:30 07 August 2015

Conditions of access and use can be found at http://www.tandfonline.com/page/termsand-conditions

New Zealand Journal of Botany, 2015 http://dx.doi.org/10.1080/0028825X.2015.1040422

SHORT COMMUNICATION Absence of hybridisation between Fuscospora species at a site in Arthur’s Pass National Park, New Zealand RD Smissen*, C Mitchell, M Roth** and PB Heenan Allan Herbarium, Landcare Research, Lincoln, New Zealand


(Received 20 January 2015; accepted 9 April 2015) We analysed simple sequence repeat markers for a selection of red beech (Fuscospora fusca) and mountain beech (Fuscospora cliffortioides) trees growing together and for seeds collected from them. Our analysis detected neither hybrid trees nor hybrid seeds within our sample. We suggest prezygotic reproductive isolating mechanisms such as differences in flowering time may be important in maintaining boundaries between Fuscospora species despite extensive sympatry. Keywords: Fuscospora; Fuscospora cliffortioides; Fuscospora fusca; hybridisation; microsatellite; New Zealand; Nothofagaceae; reproductive isolation; southern beech; sympatry

Introduction Hybrids between species of southern beech, Fuscospora (R.S. Hill & J. Read) Heenan & Smissen, in New Zealand have long been known, with Cockayne (1926) reporting them as occurring ‘ … in nature in great numbers’ wherever entire- and serrated-leaved species grow together. Wardle (1984, p. 44) reports hybrids as outnumbering the parents in some localities and Ogden (1989) characterised the New Zealand species of Fuscospora as a coenospecies—that is, a group of species which form fertile or semi-fertile hybrids and are thus capable of exchanging genes (Turesson 1922; Stebbins 1950). Hybrids have also been produced artificially and wild hybrids produce viable seed (Poole 1951). Wilcox & Ledgard (1983) report that hybrids with Fuscospora solandri (sensu lato including both Fuscospora cliffortioides and F. solandri) were prevalent in seedlots from several provenances despite the seed being taken from typical Fuscospora fusca, but they did not report quantitative data.

However, at some sites where the species grow together, recognisable hybrids are rare or absent, some plants of hybrid origin resemble closely one parent over the other, and it is likely that backcrosses or second-generation hybrids could be difficult to discern. Smissen et al. (2014) found no evidence of gene flow extending beyond immediate areas of contact between most species of Fuscospora, suggesting that the frequency of hybridisation may have been exaggerated. Certainly red beech, F. fusca (Hook.f.) Heenan & Smissen, and mountain beech, F. cliffortioides (Hook.f.) Heenan & Smissen, persist in sympatry over much of New Zealand (Wardle 1984; Smissen et al. 2014). The mechanism(s) responsible for this reproductive isolation is not clear and could involve both pre-zygotic and postzygotic factors. Although there is no question that interspecific Fuscospora hybrids occur, their frequency and the circumstances under which they arise is not known nor is it clear whether this leads to introgression

*Corresponding author. Email: [email protected] **Current addresss: Faculty of Environment and Natural Resources, University of Freiburg, Germany Supplementary data available online at www.tandfonline.com/10.1080/0028825X.2015.1040422 © 2015 The Royal Society of New Zealand

2

RD Smissen et al.


(i.e. transfer of genes between species via repeated backcrossing). To better understand the extent of hybridisation among sympatric species of Fuscospora and in particular to assess the rate at which hybrid seed may be set, we examined the genotypes of seeds collected from trees in a mixed stand of F. cliffortioides and F. fusca in the context of an F. cliffortioides-dominated forest. In the absence of strong reproductive isolating mechanisms operating before the maturation of seed we hypothesised that the numerical dominance of F. cliffortioides would lead to a high proportion of seed set on F. fusca trees being hybrid.

Materials and methods Sampling We sampled foliage from 16 F. fusca and 19 F. cliffortioides saplings and adult trees from two sites on the Andrews Valley Track (42°58.95′S, 171° 48.18′E, and 42°58.57′S, 171°48.55′E), Arthur’s Pass National Park, Canterbury, on 14 April 2013 and 13 March 2014. Fuscospora cliffortioides is the dominant forest tree in this area with F. fusca occurring in sporadic and discrete patches. We saw no trees in the area that appeared to be hybrids between the species. DNA was extracted using the 2× CTAB method (Doyle & Dickson 1987), except that foliage samples (unopened leaf buds) were subjected to a phenol–chloroform extraction and recovery using Zymo spin columns (Zymo Research Corp., Irvine, CA, USA) instead of ethanol precipitation. Seed was also sampled from five of these F. fusca trees and six of the F. cliffortioides trees at 42°58.57′S, 171°48.55′E on 13 March 2014. Mast seeding is a feature of Fuscospora species (e.g. Allen & Platt 1990; Allen et al. 2014) and the phenomenon occurred in the 2013/14 season. All the seed samples were taken from an area of approximately 50 × 50 m. Embryos were dissected from fruits for genotyping, to avoid including maternal tissue in the sample, and DNA was extracted by the 2 × CTAB method without further purification. Twelve seeds were sampled from each tree. The Andrews Valley Track samples were analysed along with

previously collected samples of both species from a nearby (4 km west) site at Woolshed Hill (42° 59.21′S, 171°45.32′E: Canterbury) and samples of F. fusca from Otira Valley (42°47.52′S, 171°36.41′ E: Westland), 24 km northwest of Andrews Valley. The distribution of Fuscospora species and rare hybrids among them in this area is described in Burrows & Lord (1993). Simple sequence repeat genotyping We examined 11 simple sequence repeat SSR loci: seven loci described in Smissen et al. (2012), three novel loci (not26, not36 and not37) developed using the same library and approach, and ncutas13 from Jones et al. (2004). The novel primer sequences (not including the 5′ M13f tail; and where f = forward primer, r = reverse primer) were: not26f CATCCGAATCAAATTCAAGTAA CC, not26r CCTCTTTCGACGTCATTTAGGC; not36f ACTGAGGGACTAACATGGTTTAATTG, not36r GCTGCGTCATCAATACGGG; not37f GC GGTGCTTCGAGCATTAAG, not37r CACTATA CACATTCTGACATTCCTTTC. Annealing temperatures were 55 °C for not26, 50 °C for not36 and 60 °C for not37. Primers were labelled using the tailing procedure described in Boutin-Ganache et al. (2001). Polymerase chain reactions used Roche FastStart Taq polymerase and reagents. Capillary electrophoresis was conducted using an Applied Biosystems 3100-Avant Genetic Analyzer (Foster City, CA, USA) and was carried out at Landcare Research, Auckland. Analysis We used the correlated allele frequency model in program Structure 2.3.3 to estimate the ancestry of seeds and trees. We used the USEPOPINFO model to assign trees to species and test the ancestry of seeds. The Markov Chain Monte Carlo algorithm was run for 1,000,000 repeats, discarding the first 200,000 as burn-in. The data input to Structure is detailed in Table S1 and the results are given in File S2. We also used the program NewHybrids 1.1b3 (Anderson & Thompson 2002) to assign individuals to genotype classes considering the

Table 1 Sample statistics by population. Major allele frequency

Genotype number

Sample size

Obs

Allele number

Availability

HE

HO

PIC

0.52 0.54 0.70 0.74

8.27 11.09 3.27 5.00

23.00 55.00 12.00 42.00

21.82 52.64 10.18 33.45

5.64 5.91 2.91 3.45

0.95 0.96 0.85 0.80

0.60 0.57 0.39 0.37

0.50 0.55 0.40 0.33

0.56 0.54 0.35 0.33

0.76 0.54 0.74

2.55 5.45 3.27

9.00 11.00 10.00

7.73 10.82 9.09

2.45 4.18 2.91

0.86 0.98 0.91

0.33 0.56 0.35

0.30 0.52 0.29

0.29 0.52 0.31

Major allele frequency

Genotype number

Obs

Allele number

Availability

HE

HO

PIC

0.19 0.99 0.34 0.62 0.53 0.83 0.59 0.76 0.51 0.42 0.43 0.57

44.00 3.00 16.00 9.00 19.00 7.00 14.00 6.00 22.00 31.00 19.00 17.27

149.00 162.00 143.00 159.00 113.00 161.00 153.00 160.00 159.00 146.00 98.00 145.73

13.00 3.00 7.00 5.00 11.00 5.00 6.00 4.00 10.00 11.00 8.00 7.55

0.92 1.00 0.88 0.98 0.70 0.99 0.94 0.99 0.98 0.90 0.60 0.90

0.88 0.02 0.74 0.56 0.65 0.30 0.57 0.38 0.69 0.76 0.73 0.57

0.84 0.02 0.45 0.46 0.61 0.30 0.39 0.34 0.59 0.56 0.57 0.47

0.86 0.02 0.70 0.51 0.60 0.27 0.52 0.33 0.66 0.73 0.69 0.54

Availability, Obs∕sample size; HE, expected heterozygosity; HO, observed heterozygosity; Obs, average number of genotypes observed per locus; PIC, polymorphism information content (Botstein et al. 1980).

3

Andrews Valley F. cliff. F. cliff. seed F. fusca F. fusca seed Other sites Otira F. fusca Woolshed F. cliff. Woolshed F. fusca

Absence of hybridisation between Fuscospora species at a site in Arthur’s Pass


Population

Availability, Obs∕sample size; HE, expected heterozygosity; HO, observed heterozygosity; Obs, average number of genotypes observed per locus; PIC, polymorphism information content (Botstein et al. 1980); F. cliff., Fuscospora cliffortioides.

Table 2 Summary statistics by locus; Fuscospora sample size was 162 individuals. Marker BC9 ncutas13 notssr2 notssr6 notssr8 notssr13 notssr18 notssr22 notssr26 notssr36 notssr37 Mean

4

RD Smissen et al.


two parental species and two generations of hybrids. We used uniform priors for Θ and Π, ran the Markov Chain Monte Carlo for 12,062,487 sweeps and allowed a burn-in of 50,079 sweeps (repeated preliminary runs suggested that this was more than sufficient). The data input to NewHybrids is provided in File S3 and the results in File S4. Summary statistics for each population and each locus and genetic distances were computed using PowerMarker and a neighbour-joining tree generated using Splitstree 4.10.

Results Summary statistics for populations and loci are shown in Tables 1–2. All seeds were estimated by Structure to be almost pure (i.e. > 0.97 proportion of ancestry from the same species as its mother tree). A Structure bar plot illustrating this is shown as Fig. 1. For most seeds, the lower bound of the 95% probability interval for the ancestry estimate was also above 0.9 ancestry

from the same species as the mother tree (not shown). For seven seeds collected from F. cliffortioides trees and three seeds collected from F. fusca trees the lower bound for the 95% probability interval was between 0.646 and 0.900, so potentially encompassing backcrosses but not F1 hybrids. Some other model settings in Structure produced results indicating a higher level of admixture over all, but in no cases was it suggested that the seed population sampled from either species was more admixed than the parents (i.e. included hybrids). NewHybrids estimates the probability that a sample genotype belongs to one of a number of predetermined genotype classes (in this case one of six classes representing parent 0, parent 1, F1 hybrids, F2 hybrids, backcrosses to parent 0 and backcrosses to parent 1). For all samples the probability of belonging to one of the two parental types was the highest (all > 0.80). For 150 of the 162 samples (89 of the 97 seeds) analysed probability of belonging to one of the two parental types was > 0.95. The

Figure 1 Structure bar plot for ancestry estimation of individual Fuscospora samples. Note the low levels of admixture.


Absence of hybridisation between Fuscospora species at a site in Arthur’s Pass

5

Figure 2 Neighbour-joining tree of genetic distance among Fuscospora populations.

highest estimated probability that a sample belonged to the F1 class was 0.02528 (for a seed collected from an F. cliffortioides mother). The full set of estimates is reported in Table S1. A neighbour-joining tree produced using Nei’s (1972) genetic distances of populations (treating

each species at each site as a separate population and treating seeds as different to trees) is shown in Fig. 2. The seed populations of both species are no more similar to the other species than the mature tree populations, suggesting that no hybrid seeds were included.

Figure 3 Fruits from Andrews Valley Fuscospora trees. Row A, Fuscospora cliffortioides; Row B, Fuscospora fusca. Scale = 5 mm.

6

RD Smissen et al.


While processing the samples we became aware that the fruits and seeds of F. fusca were consistently much larger than those of F. cliffortioides (Fig. 3). Discussion Although our sample size is small, and the presence of hybrid seeds at a low frequency cannot be excluded, we see this result as indicating a high level of reproductive isolation between F. cliffortioides and F. fusca at the study site in this mast seeding year. Our Structure analysis suggests that none of the seeds we sampled were first-generation hybrids, although we cannot exclude that some represented backcross or other later-generation hybrids. However, given the absence (or at least rarity) of mature hybrid trees in the area it is most unlikely that any of the seeds we sampled were sired by hybrid trees and therefore backcrosses are unlikely. The probability of belonging to the F1 hybrid class estimated by NewHybrids was < 0.05 for all seeds and the most likely assignment for all samples was to one of the parental genotype classes. Nuts of F. fusca are generally slightly larger than those of F. cliffortioides (7 mm versus 5–7 mm; Poole & Adams 1963), but it is possible that the pronounced difference in size we observed reflects earlier flowering and therefore more advanced development in F. fusca. If this is the case then the absence of hybrid seeds in our sample can be explained by a lack of overlap in the flowering period of the species. Indeed, Wardle reports differences in flowering phenology among Fuscospora species, with F. fusca flowering earlier than F. cliffortioides (Wardle 1984, p. 254; citing A.L. Poole, unpubl. data). Flowering time varies within species according to a number of factors (e.g. latitude and elevation), so it is not clear how much of the reproductive isolation among Fuscospora species can be generally explained by it. Although other mechanisms may be involved in reproductive isolation among Fuscospora species (e.g. pollen–pistil interactions), the collection of phenological observations and environmental data across the range of the species, especially where they grow together, could provide considerable insight.

Acknowledgements The authors thank Landcare Research colleagues Sarah Richardson, for discussion at all stages of this work, Katherine Trought, for firearms support in collecting the samples, Renee Hutchens, for seed dissection, and Shelley Myers, for capillary separation of genotyping reactions. This paper benefitted from the input of two anonymous referees. This work was supported by the New Zealand Ministry of Business, Innovation and Employment (Capability Fund).

Associate Editor: Dr Leon Perrie.

Supplementary data Table S1. Input file for Structure analysis. File S2. Results from Structure analysis. File S3. Input file for NewHybrids analysis. File S4. Probability estimates of class membership for individuals from NewHybrids analysis.

Disclosure statement No potential conflict of interest was reported by the authors.

References Allen RB, Platt KH 1990. Annual seedfall variation in Nothofagus solandri (Fagaceae), Canterbury, New Zealand. Oikos 57: 199–206. Allen RB, Hurst JM, Portier J, Richardson SJ 2014. Elevation-dependent responses of tree mast seeding to climate change over 45 years. Ecology and Evolution 4: 3525–3537. Anderson EC, Thompson EA 2002. A model-based method for identifying species hybrids using multilocus genetic data. Genetics 160: 1217–1229. Botstein D, White RL, Skolnick M, Davis RW 1980. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. American Journal of Human Genetics 32: 314–331. Boutin-Ganache I, Raposo M, Raymond M, Deschepper CF 2001. M13-tailed primers improve the readability and usability of microsatellite analyses performed with two different allele-sizing methods. BioTechniques 31: 24–28. Burrows CJ, Lord JM 1993. Recent colonisation by Nothofagus fusca at Cass, Canterbury. New Zealand Journal of Botany 31: 139–146.


Absence of hybridisation between Fuscospora species at a site in Arthur’s Pass Cockayne L 1926. Monograph of the New Zealand beech forests. Part 1. The ecology of the forests and taxonomy of the beeches. Wellington, Government Printer. Doyle JJ, Dickson EE 1987. Preservation of plant samples for DNA restriction endonuclease analysis. Taxon 36: 715–722. Jones RC, Vaillancourt RE, Jordan GJ 2004. Microsatellites for use in Nothofagus cunninghamii (Nothofagaceae) and related species. Molecular Ecology Notes 4: 14–16. Nei M 1972. Genetic distance between populations. American Naturalist 106: 283–291. Ogden J 1989. On the coenospecies concept and tree migrations during the oscillations of the Pleistocene climate. Journal of the Royal Society of New Zealand 19: 249–262. Poole AL 1951. Hybrid southern beeches. New Zealand Journal of Forestry 6: 144–145. Poole AL, Adams NM 1963. Trees and shrubs of New Zealand. Wellington, Government Printer.

7

Smissen RD, Morse CW, Prada D, Ramón-Laca A, Richardson SJ 2012. Characterisation of seven polymorphic microsatellites for Nothofagus subgenus Fuscospora from New Zealand. New Zealand Journal of Botany 50: 227–231. Smissen RD, Richardson SJ, Morse CW, Heenan PB 2014. Relationships, gene flow and species boundaries among New Zealand Fuscospora (Nothofagaceae: southern beech). New Zealand Journal of Botany 52: 389–406. Stebbins GL 1950. Variation and evolution in plants. New York, Columbia University Press. Turesson G 1922. The genotypical response of the plant species to the habitat. Hereditas 3: 211–350. Wardle JA 1984. The New Zealand beeches: ecology, utilisation and management. Wellington, New Zealand Forest Service. 447 p. Wilcox MD, Ledgard NJ 1983. Provenance variation in the New Zealand species of Nothofagus. New Zealand Journal of Ecology 6: 19–31.