At least 50 plaques were counted in each experiment for each recombinant type. ND, not determined. (B) Statistical analysis of Ï+L context-dependence in ...
Supplementary material
Unexpected DNA context-dependence identifies a new determinant of Chi recombination hotspots AF Taylor, SK Amundsen, and GR Smith Bacteriophage construction by recombineering We created various L alleles in gam using ss oligonucleotides bearing the desired mutation (Supplementary Table S2) and 816 (red-3 cI857), 2025 (susJ6 red3 int-4 cI857), or
MMS540 (int-4 red-3 susR5) by recombineering in E. coli strains DY378 or V3509 which express Exo, Beta, and Gam after thermal induction (1). Recombination between the oligonucleotide bearing a Chi site and the infecting phage inactivated gam and allowed selection for the desired red gam mutants on a P2 lysogen of strain C600 (2,3). Chi-minus phage were constructed by recombination between a Chi-containing parental phage and oligonucleotides bearing the -206 allele 5’ GTTGGTGG 3’ (Schultz et al, 1981). Plating on strain C600 revealed small plaques caused by the Chi-minus mutation. E. coli strains were infected at an moi of 3, incubated at 42° for 15 min to induce recombination functions, and prepared for electroporation with oligonucleotides (100 ng) in 0.1 cm cuvettes at 1.8 kV. Mutagenic oligonucleotides targeting gam (Supplementary Table S2) were 70 – 90 nucleotides long with the desired changes approximately in the center. red gam mutant recombinants, selected on E. coli strain C600(P2), occurred at a frequency of approximately 10-3 to 10-6 depending on the oligonucleotide. Plaques were picked into SM and streaked on strains V66 (recBCD+) and V67 (recB21) or, for susJ or susR parental phage, on C600 (supE44 recBCD+) and V3477 (supE44 recD1013). Phage forming large plaques on recBCD+, indicating the presence of Chi, were retested for growth on C600(P2); as expected, all formed large plaques on V67 or V3477, which allows concatemer formation via rolling circle replication. After a second purification on V66, C600, or V3477, an isolated plaque was picked into SM for PCR amplification and sequence analysis, and for the preparation of high-titer stocks on strain V3477, JC9387, JM1, or V66 (4). Lambda DNA was sequenced from small volume lysates prepared by spotting 50 μl of SM containing an isolated plaque on strain JM1, JC9387, or V3477. After overnight incubation at 37° the spots were harvested into 300 μl of SM with 5 μl of chloroform. DNA in the lysate
1
was amplified for sequencing using primers OL3314 and OL3009 (Supplementary Table S2) and the following thermocycler program: segment 1, 98° for 5 min; segment 2, 30 cycles of 94° for 30 sec, 55° for 30 sec, 72° for 1 min; segment 3, 72° for 3 min. Briefly, 5 µl of the phage lysate was added to a PCR tube containing 10 µl of H2O; after segment 1, 15 µl of 2x PCR reaction mix (as described for Platinum Taq, Invitrogen) was added and the cycling continued. Analysis of the DNA sequence of ~500 bp centered on L confirmed the presence of the desired Chi sequence and the absence of any other nucleotide changes nearby. We constructed susJ6 cI857 or cI+ susR5 derivatives of each red-3 +L cI857 phage by lytic crosses between 2016 (susJ6) or 2017 (cI+ susR5) as described (5).
DNA sequence determinations DNA sequencing libraries were prepared using the KAPA HTC DNA Library Preparation Kit (Kapa Biosystems, Inc., Wilmington, MA) with the following modifications. DNA from the RecBCD reactions had 3’ A overhangs (from the MnlI cut at the left end and Klenow polymerization at the right end; Figure 3B and Supplementary Figure S1A) to which adaptors were ligated. A magnetic-bead cleanup was performed using Agencourt Ampure XP beads (Beckman Coulter Inc., Brea, CA) in a 3:1 ratio of beads to sample. No sonication step was performed on the DNA, and 9 cycles of PCR were used to enrich the library after adapter ligation using standard KAPA PCR temperatures. Library size distributions were validated using an Agilent 2200 TapeStation (Agilent Technologies, Santa Clara, CA). Additional library quality control, blending of pooled indexed libraries, and cluster optimization were performed using a Qubit 2.0 Fluorometer (Life Technologies-Invitrogen, Carlsbad, CA). DNA sequencing libraries were pooled and clustered onto a flow-cell lane using an Illumina cBot. Sequencing was performed using an Illumina HiSeq 2500 in Rapid mode employing a paired-end, 50-base readlength (PE50) sequencing strategy. Image analysis and base calling were performed using Illumina's Real Time Analysis v1.18.66.3 software, followed by “demultiplexing” of indexed reads and generation of FASTQ files, using Illumina's bcl2fastq v1.8.4 software (http://www.illumina.com/software.ilmn).
Sequence analysis Filtered reads (i.e., those not passing the Illumina quality control step) and those with errors (about 25 – 70% of the total) in the 30-nucleotide invariant part of the 50 nucleotide sequence (Supplementary Figure S1, purple arrow) were discarded. This left 2.8 to 9.1 million reads (Supplementary Table S4) for analysis using Unix utilities, Microsoft Excel, and Weblogo3 via
2
the Fred Hutch implementation of Galaxy. Nucleotide and oligonucleotide frequencies were normalized to the corresponding frequencies in the unreacted substrate from the same synthesis, processed and sequenced in parallel to the experimental samples. References 1. 2.
3. 4.
5. 6.
7. 8. 9. 10. 11.
Thomason, L.C., Oppenheim, A.B. and Court, D.L. (2009) Modifying bacteriophage lambda with recombineering. Methods Mol Biol, 501, 239-251. Zissler, J., Signer, E. and Schaefer, F. (1971) In Hershey, A. D. (ed.), The Bacteriophage Lambda. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, pp. 469-475. Lindahl, G., Sironi, G., Bialy, H. and Calendar, R. (1970) Bacteriophage lambda; abortive infection of bacteria lysogenic for phage P2. Proc Natl Acad Sci U S A, 66, 587-594. Arber, W., Enquist, L., Hohn, B., Murray, N.E. and Murray, K. (1983) In Hendrix, R. W., Roberts, J. W., Stahl, F. W. and Weisberg, R. A. (eds.), Lambda II. Cold Spring Harbor Laboratory, NY, pp. 433-466. Schultz, D.W., Swindle, J. and Smith, G.R. (1981) Clustering of mutations inactivating a Chi recombinational hotspot. J. Mol. Biol., 146, 275-286. Schultz, D.W., Taylor, A.F. and Smith, G.R. (1983) Escherichia coli RecBC pseudorevertants lacking Chi recombinational hotspot activity. J. Bacteriol., 155, 664680. Amundsen, S.K., Neiman, A.M., Thibodeaux, S.M. and Smith, G.R. (1990) Genetic dissection of the biochemical activities of RecBCD enzyme. Genetics, 126, 25-40. Appleyard, R.K. (1954) Segregation of new lysogenic types during growth of a doubly lysogenic strain derived from Escherichia coli K-12. Genetics, 39, 440-452. Weigle, J. (1966) Assembly of phage lambda in vitro. Proc Natl Acad Sci U S A, 55, 1462-1466. Gillen, J.R. (1974) Thesis, University of California, Berkeley, California. Stahl, F.W., Stahl, M.M., Malone, R.E. and Crasemann, J.M. (1980) Directionality and nonreciprocality of Chi-stimulated recombination in phage λ. Genetics, 94, 235-248.
3
Supplementary Table S1. Bacterial and phage strains and their genotypes. Strain V66 V67 V222 DY378 C600 V2909 V3477 594 C600(P2) LT778 V3509 JC9387
JM1
801 816 872 1404 1407 1832 1841 1847 1848 1900 1901 1910 1911 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009
Genotype argA21 recF143 hisG4 met rpsL31 galK2 xyl-5 - FAs V66, plus recB21 As V66, plus recD1013 IN(rrnD-rrnE)1 rph-1 (cI857 Δ(cro-bioA)) Fthr-1 leuB6 thi-1 lacY1 tonA21 supE44 rfbD1 - FrecD2741 recF143 hisG4 met rpsL31 galK2 xyl-5 FAs C600, plus recD2741 lac-3350 galK2 galT22 rpsL179 - FAs C600, plus P2 As C600, plus (cI857 Δcro-bioA)) As LT778, plus recD2741 thr-1 leuB6 ara-14 proA2 lacY1 tsx-33 galK2 hisG4 rpsL31 xyl-5 mtl-1 argE3 thi-1 recB21 recC22 sbcA+ sbcB15 sup+ - Fthr-1 leuB6 Δ(gpt-proA)62 lacY1 tyrT5888 hisG4 rpsL31 argE3 - FWild type red-3 cI857 b1453 cI857 imm434 susR5 susJ6 imm434 red-3 +L251 cI857 red-3 +L252 cI857 red-3 +L253 cI857 red-3 +L254 cI857 red-3 +L2-4 cI857 red-3 +L4-2 cI857 red-3 +L3-2 cI857 red-3 +L2-3 cI857 susJ6 red-3 +L251 cI857 susJ6 red-3 +L252 cI857 susJ6 red-3 +L253 cI857 susJ6 red-3 +L254 cI857 susJ6 red-3 +L2-4 cI857 susJ6 red-3 +L4-2 cI857 susJ6 red-3 +L3-2 cI857 susJ6 red-3 +L2-3 cI857 red-3 +L251 cI+ susR5 red-3 +L252 cI+ susR5 red-3 +L253 cI+ susR5 red-3 +L254 cI+ susR5
4
Ref. or sourcea (6) (6) (7) See ref to add (8) Our collection V2909 x C600 (9) (6) L. Thomason V2909 x LT778 (10)
(11) Our collection Our collection Our collection Our collection Our collection R 3015816 R 3074816 R 3074816 R 3074816 R 3149816 R 3150816 R 3161816 R 3160816 2016 x 1832 2016 x 1841 2016 x 1847 2016 x 1848 2016 x 1900 2016 x 1901 2016 x 1910 2016 x 1911 2017 x 1832 2017 x 1841 2017 x 1847 2017 x 1848
2010 2011 2012 2013 2016 2017 MMS317 MMS540 2025 2026 2027 2028 2029 2030 2031 2032 2033 2034 2035
2017 x 1900 2017 x 1901 2017 x 1910 2017 x 1911 1407 x 801 1404 x 801
red-3 +L2-4 cI+ susR5 red-3 +L4-2 cI+ susR5 red-3 +L3-2 cI+ susR5 red-3 +L2-3 cI+ susR5 susJ6 susR5 susJ6 int-4 red-3 cI+
L. Thomason
+
int-4 red-3 cI susR5
L. Thomason
872 X MMS317 R 3461 2025 R 3462 2025 R 3463 2025 R 3464 2025 R 3461 MMS540 R 3462 MMS540 R 3463 MMS540 R 3464 MMS540 R 3502 2026 R 3502 2030
susJ6 int-4 red-3 cI857 susJ6 int-4 red-3 L259 cI857 susJ6 int-4 red-3 +L260 cI857 susJ6 int-4 red-3 +L261 cI857 susJ6 int-4 red-3 +L262 cI857 int-4 red-3 +L259 cI+ susR5 int-4 red-3 +L260 cI+ susR5 int-4 red-3 +L261 cI+ susR5 int-4 red-3 +L262 cI+ susR5 susJ6 int-4 red-3-L259 cI857 int-4 red-3 -L259 cI+ susR5 +
*A x B indicates a cross between the indicated phages or a P1 transduction in which A is the donor strain and B is the recipient strain of E. coli. R indicates recombineering in which the indicated oligonucleotide is the donor and the indicated phage is the recipient.
5
Supplementary Table S2. Oligonucleotides. Oligo
Use
Sequence (5’ → 3’)
2938 3009 3015
Sequencing of L Sequencing of L
3074
3149
Random n4 +L n4 in gam; construction of +L252, +L253, and +L254 Construction of +L2-4
3150
Construction of +L4-2
3160
Construction of +L2-3
3161
Construction of +L3-2
3314 3461
Sequencing of L
3462
Construction of +L260
3463
Construction of +L261
3464
Construction of +L262
3499
Construction of -L252
3502
Construction of -L259
TTTCCATGTCGTCTGCCAGTTC GCCATTGCAGGGTGGCCTGTTGCTG CGGGCTGATTAGGAAAACAGGAAAGGGGGT TAGTGATGCTGGTGGTTGATCTCAGTTTCAG TATTAATATCCAT GCCGGGCTGATTAGGAAAACAGGAAAGGGG GTTAGNNNNGCTGGTGGNNNNTCTCAGTTT CAGTATTAATATCCATTTTTTATAAGCG GCCGGGCTGATTAGGAAAACAGGAAAGGGG GTTAGCCATGCTGGTGGAGACTCTCAGTTTC AGTATTAATATCCATTTTT TATAAGCG GCCGGGCTGATTAGGAAAACAGGAAAGGGG GTTAGCATAGCTGGTGGACGGTCTCAGTTT CAGTATTAATATCCATTTTT TATAAGCG GCCGGGCTGATTAGGAAAACAGGAAAGGGG GTTAGCCATGCTGGTGGCGACTCTCAGTTT CAGTATTAATATCCATTTTTTATAAGC GCCGGGCTGATTAGGAAAACAGGAAAGGGG GTTAGCAAAGCTGGTGGACGGTCTCAGTTT CAGTATTAATATCCATTTTTTATAAGC GGTTGGCAACGATCAGTAATG CGGGCTGATTAGGAAAACAGGAAAGGGGGT TAGTGATGCTGGTGGTCGAAAACAGTTTCAG TATTAATATCCATTTTTTATAAGCG CGGGCTGATTAGGAAAACAGGAAAGGGGGT TAGTGATGCTGGTGGTCGAAGGCAGTTTCA GTATTAATATCCATTTTTTATAAGCG CGGGCTGATTAGGAAAACAGGAAAGGGGGT TAGTGATGCTGGTGGGGGCTTTCAGTTTCA GTATTAATATCCATTTTTTATAAGCG CGGGCTGATTAGGAAAACAGGAAAGGGGGT TAGTGATGCTGGTGGGGGCTTCCAGTTTCA GTATTAATATCCATTTTTTATAAGCG CGGGCTGATTAGGAAAACAGGAAAGGGGGT TAGCCATGTTGGTGGACGGTCTCAGTTTCA GTATTAATATCCAT CGGGCTGATTAGGAAAACAGGAAAGGGGGT TAGTGATGTTGGTGGTCGAAAACAGTTTCAG TATTAATATCCATTTTTTATAAGCG
Construction of +L251
Construction of +L259
6
Supplementary Table S3. Context-dependence of Chi hotspot activity. (A) Chi hotspot activities in wild-type and recBCD mutant hosts
+L allelea +L251 +L252 -L252 +L253 +L254 +L2-3 +L2-4 +L3-2 +L4-2 +L259 -L259 +L260 +L261 +L262
Chi hotspot activity (c/t ratio)b Host strain recBCD allele + B21::IS186 recD1013 3.9 ± 0.3 (6) 1.4 ± 0.2 (4) 1.1 ± 0.1 (5) 4.9 ± 0.2 (7) 1.3 ± 0.2 (5) 0.9 ± 0.1 (5) 1.9 ± 0.1 (5) 1.1 ± 0.03 (5) 0.9 ± 0.04 (5) 3.5 ± 0.3 (6) 1.4 ± 0.5 (4) ND 3.0 ± 0.1 (6) 1.5 ± 0.2 (4) ND 3.5 ± 0.4 (6) 1.5 ± 0.4 (4) ND 2.8 ± 0.2 (6) 1.5 ± 0.2 (4) ND 5.3 ± 0.8 (6) 1.5 ± 0.2 (4) ND 5.0 ± 0.8 (6) 1.7 ± 0.3 (4) ND 14.1 ± 0.7 (8) 1.1 ± 0.2 (5) 1.0 ± 0.1 (5) 2.1 ± 0.1 (6) 1.0 ± 0.1 (5) 0.8 ± 0.1 (5) 13.1 ± 1.1 (8) 0.9 ± 0.1 (5) 1.1 ± 0.2 (5) 9.5 ± 0.2 (8) 1.2 ± 0.1 (5) 0.9 ± 0.1 (5) 7.5 ± 0.3 (8) 1.1 ± 0.05 (5) 1.1 ± 0.2 (5)
a
See Figure 2B and Supplementary Table S5 for sequences flanking the indicated +L allele. -L alleles have 5’ GTTGGTGG 3’ in place of the Chi octamer flanked by the same sequences as the corresponding +L allele. b Chi activity is expressed as the ratio of clear (cI857) to turbid (cI+) plaques among selected J+ R+ recombinants (Figure 2A). Data are the mean ± SEM from (n) experiments. At least 50 plaques were counted in each experiment for each recombinant type. ND, not determined. (B) Statistical analysis of +L context-dependence in recBCD+ host crosses Comparison 251 252 253 254 252 0.0158 253 0.3680 0.0021 254 0.0174
