Abstract

Medical Mycology, 2018, 56, S1–S159 doi: 10.1093/mmy/myy036

Abstract S1.1 Basic mechanisms of antifungal immunity S1.1a Basic mechanisms of antifungal immunity Michail S. Lionakis NIH, BETHESDA, USA Invasive candidiasis (IC), mainly caused by C. albicans, is the most common deep-seated human fungal infection in the western hemisphere. Mortality of patients with IC exceeds 40% despite the administration of antifungal therapy; hence, IC is an unmet medical condition for which better understanding of its immunopathogenesis is essential. The mouse model of IC following intravenous yeast injection that mimics human skin-derived bloodstream candidiasis has been extensively used to study the innate immune response against IC. In this model, the microbiological progression of the infection is organ-specific, with kidney being the main target organ, associated with organ-specific innate immune responses. At the cellular level, neutrophils, monocytes, resident macrophages and CD11b+ dendritic cells, but not lymphocytes or CD103+ dendritic cells, are critical for host defense against IC. Indeed, depletion of neutrophils or mononuclear phagocytes leads to accelerated mortality in the model. Of interest, neutrophils have different effects in the model depending on the phase of the infection; specifically, whereas early neutrophil presence is protective, late neutrophil accumulation mediates tissue injury and immunopathology that results in renal failure and mortality. In recent years, the molecular factors that mediate early protective versus late detrimental neutrophil effects in the model have been emerging and their discovery holds promise for the identification of novel genetic risk factors for IC and targeted therapeutic interventions, respectively. With regard to the protective role of mononuclear phagocytes, the discovery of the prominent role of CCR2-recruited monocytes and CX3CR1-expressing macrophages as well as the unveiling of the orchestrated monocyte/dendritic cells/NK cell axis that drives GM-CSF-mediated activation of neutrophils have shed further light into the pathogenesis of IC. At the molecular level, several studies have demonstrated the orchestrated role of pattern-recognition receptors (e.g., C-type lectins and Toll-like receptors), pro-inflammatory cytokines (e.g., IL-1, IL-6, IFN-g, TNF-a), the inflammasome (e.g., Nlrp3, Nlrp10), the complement cascade (e.g., C5a), and the reactive oxygen species generation machinery (e.g., NADPH oxidase, iNOS) in effective anti-Candida innate host defense. Population-genetic approaches have translated several findings to humans with the prospect of devising improved individualized risk stratification and prognostication strategies in patients with IC and better outcomes after IC.

S1.1b Protection and pathology in pulmonary aspergillosis L. Romani University of Perugia, PERUGIA, Italy Aspergillus may lead to a spectrum of clinical syndromes in the lung, depending on the host’s immune status or pulmonary structure. Invasive pulmonary aspergillosis occurs primarily in critically ill patients patients, such as those with severe immunodeficiency or chronic obstructive pulmonary disease. It is now clear that a three-way interaction between host, fungi, and microbiota dictates the types of host-fungus relationship. Indeed, microbial dysbiosis predisposes to a variety of chronic fungal infections and diseases at local and distant sites. We have explored metagenomics for deciphering the contribution of the microbiota to fungal commensalism and parasitism and metabolomics for capturing the dialogue between the mammalian host and its microbiota. By correlating changes in metabolite profiles with microbiota metagenomic composition, we have defined several functional nodes by which certain bacteria species contribute to or subvert host-fungal symbiosis and mucosal homeostasis in the gut and lung. A microbial tryptophan metabolic pathway activated through the indoleamine 2, 3-dioxygenase 1 (IDO1) enzyme led to the production of the indole-3-aldehyde (IAld). IAld preserved immune physiology at mucosal surfaces while inducing antifungal resistance through the activation of the aryl hydrocarbon receptor (AhR), eventually impacting on mucosal immune homeostasis and host/fungal symbiosis. Thus, the regulatory loop involving AhR and IDO1 may be exploited for the development of multi-pronged host- and microbiota-directed therapeutic approaches in pulmonary aspergillosis. This work is supported by the Specific Targeted Research Project FUNMETA (ERC-2011-AdG-293714).

S1.1c Protective immune responses during cryptococcosis C. Coelho Johns Hopkins Bloomberg School of Public Health, BALTIMORE, USA Cryptococcus neoformans is a fungal pathogen with worldwide distribution and responsible for around 180 000 deaths each year. Exposure to this pathogen is very frequent, but healthy individuals either clear infection or control it as a latent infection, and very rarely develop disease. Instead the overwhelming majority of cases is due to immunosuppression, in particular HIV-mediated immunosuppression. We discuss the existence of predisposing factors to C. neoformans infection, and what constitutes an adequate immune response to this fungal pathogen. Most C. neoformans cells are found to closely associate with monocyte and macrophages, effector cells of innate and adaptive immunity, and so we will focus on murine and human monocyte and macrophages interactions. We also examine the strategies that C. neoformans uses to achieve survival, latency and growth within a mammalian host. The intracellular lifestyle of C. neoformans requires it to survive nutrient starvation and toxicity by host antimicrobial molecules in the phagosome and to counteract the host immunity to ensure its survival. Recent work shows that some of these strategies involve C. neoformansmediated host damage at the molecular and cellular level. There is evidence that the intracellular lifestyle is successful enough that it can provide a protective niche to C. neoformans. We will integrate the intracellular lifestyle of C. neoformans with the current views in immunometabolism and immunoregulation.

S1.1d Evolution of Candida albicans colonization and anti-Candida innate and adaptive immunity in patients having undergone surgical resection for Crohn’s disease D. Poulain1 , S. Loridant2 , H. Sarter3 , C. Cunisse4 , N. Francois1 , R. Aijjou5 , S. Jawhara6 , C. Gower-Rousseau7 , J.F. Colombel8 , B. Sendid1 1 Inserm U995/University Hospital of Lille, LILLE, France 2 University Hospital of Lille, LILLE, France 3 U995/Lille University Hospital, LILLE, France 4 Lille University Hospital, LILLE, France 5 Inserm U995/lille University Hospital, LILLE, France 6 Inserm U995/University of Lille, LILLE, France 7 Inserm U995/Lille University Hospital, LILLE, France 8 Mount Sinai Hospital, NEW YORK, USA Objective: In order to explore a possible role for C. albicans in Crohn’s disease (CD) a pilot double blind study assessed the effect of 6 months fluconazole (FCZ) treatment versus placebo on endoscopic recurrences after surgical resection. Despite the study was not conclusive clinically at 6 month at the tested FCZ dose (200 mg daily) the collected material was used for a longitudinal biological analysis yeast colonization, biomarkers of CD, and /or biomarkers of C. albicans-host interplay. Methods: The study concerned 28 CD patients randomized in two groups,14 with FCZ, 14 with placebo. Patients were examined and sampled for mycological and serological analysis before surgery and 1, 2, 3, 6 months after surgery. Qualitative and quantitative evolution of colonization was assessed in mouth and stool. Serological kinetic analysis concerned levels of i) CRP, calprotectin and anti-glycan antibodies biomarkers of CD ii) biomarkers of C. albicans saprophytic/pathogenic transition: anti-C. albicans mannan and anti-C. albicans Hwp1 protein iii) Innate immunity lectins involved in C.albicans sensing: galectin-3 and Mannose Binding Lectin (MBL). Results: The major finding was that independently of antifungal treatment, surgery was followed by a significant decrease of C. albicans colonization. In parallel, biomarkers of C. albicans pathogenic transition decrease to non significant levels. Anti-glycan antibodies levels decreased as well but remain above the cut-off discriminating patients with CD. Galectin 3 exhibited a steady decreases which correlated with the one of calprotectin. MBL levels inversely correlating with anti-C. albicans antibodies before surgery remain stable. Conclusion: With regard to previous evidence that inflammation favors C. albicans thriving which, in turn, aggravates inflammation, this is the first evidence that reduction of CD inflammation decreases C. albicans colonisation and biomarkers associated with its pathogenic development.

S1.2 Mycoctic keratitis S1.2a Update and Epidemiology of mycotic infections of the eye L. Prajna Aravind Eye Care Syatem, MADURAI, India Fungi have replaced bacteria as the most common cause of infectious keratitis in the developing world, where 2/3rd of the global population reside. It is an ocular emergency and an important cause of visual loss worldwide. An update on the current epidemiological patterns, incidence, organisms profile and treatment option are important for clinicians, laboratory personnel and other scientists to be better equipped in the diagnosis, management and ultimately in the prevention of this disease. It affects young active working population in their prime earning period, thus causing significant loss of man years of productivity. Since it also affects people from the lower socio economic background, the dimension of economic loss becomes even more paramount. The incidence of Mycotic keratitis varies with the geographical regions and also over time. It is often cited as a public health problem inviting some investigators to term it as a silent epidemic. In India, it is estimated to affect 300,000 people annually. In contrast, in 2011, a combined total of 100 cases per year were reported from 11 centres in the USA. There was a large outbreak of Fusarium keratitis associated with use of a contact lens solution a few years back in many countries like USA, Singapore and Hong Kong. After this outbreak, the base line incidence of fungal keratitis in the USA showed an increase even after the outbreak subsided. More importantly, at least one third of those affected have significant visual morbidity, even after undergoing treatment. Even in a single geographical location, cases of fungal keratitis may be higher than the yearly average at certain times of the year, such as during the harvest or windy seasons, or when there is increased relative humidity (before the rainy season). Causative organisms may differ by geographic location and the risk factors. Filamentous fungi like Fusarium sps and Aspergillus flavus are the most common fungal organism in tropical countries. In these countries the majority of patients suffer an injury with vegetative matter making trauma the most important risk factor in developing fungal keratitis. In addition, there is a large group of hyaline and demataceious fungi that are not identifiable by conventional methods that is responsible for mycotic keratitis as well. In more temperate climate Candida sps predominate and the majority of these patients are immunocompromised. Interestingly, within India itself the distribution of the different fungal species is different with Aspergillus flavus being more common in the northern parts of India and Fusarium keratitis more in southern states. The precise reason for this variation is unknown and has to be investigated further. This observation assumes importance in the context that newer studies show that Aspergillus and Fusarium differ with regard to their susceptibility pattern to different antifungal drugs. Mycotic keratitis is generally associated with a poor clinical outcome. Currently drugs like natamycin and voriconazole are used in the management. At least a third of the patients may require a corneal transplant and that too with suboptimal visual outcomes. Regular surveys at different geographic locations help us to understand the magnitude of the condition so as to plan effective management strategies. Awareness of this condition and effective public health intervention strategies to prevent this catastrophic problem is the need of the hour.

 C The Author(s) 2018. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: [email protected]

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

S1

S2

S1.2b Molecular characterization, diagnosis and antifungal susceptibility patterns of clinically relevant Fusarium species A.M.S. Al-Hatmi Ministry of Health, IBRI, Oman In human, Fusarium species cause a broad spectrum of opportunistic infections, which are often chronic and recalcitrant including superficial infections of skin and nails and keratitis are mostly seen in immunocompetent hosts, while disseminated infections are mostly restricted to immunodeficient patients. The molecular studies on the disease causative agents have broadened our knowledge on the diversity of the Fusarium species. Ten Fusarium species complex (SC) have been involved in human infections, most of the isolated pathogens belong to F. solani SC, F. oxysporum SC and F. fujikuroi SC. As morphological species identification is problematic, discrimination among different species requires multi locus sequence analysis. This can be performed by using multi-gene analysis of BT, TEF-1α, TOPO1, PGK, RPB2 and ITS. At this moment, 74 taxonomic species have been suggested to cause human infections, judging from their isolation from clinical samples and this number is expanding. The F. solani (SC) is the clinically most important Fusarium species complex, accounting for 40–60% of the reported cases of fusariosis. Phylogenetic determinations based on gene sequences not only permitted the Fusarium identity to be clarified, but provided the basis for species distinctions within the genus. Hence, the definitive identification tools are the molecular based methods which in general are cost effective. To overcome these limitations therefore MALDI-TOF MS is applied. The DNA sequence validated Fusarium strains have then subjected to MALDI-TOF MS in order to identify clinical Fusarium isolates. MALDI-TOF MS approach can be performed with minimal amounts of sample and takes only 15–30 minutes ad cheap. However, MALDI TOF MS is an important tool and recommended for the identification of pathogenic Fusarium species, provided databases is available. Studies of local and global epidemiology of Fusarium species have been hampered by the lack of rapid, discriminatory and exchangeable typing methods. Fusarium species are frequently isolated from human infections. Investigations of the epidemiologic relation between environmental and clinical isolates molecular typing techniques have been applied. AFLP fingerprinting has successfully applied with a large numbers of clinical and environmental strains. Fusariosis is distributed globally, with a focus in (sub)tropical areas. Considerable species diversity is observed, with no differences between clinical and environmental origins. This suggests that infections with Fusarium species are truly opportunistic. Fusarium species are resistant to most antifungal drugs complicating the management of these infections. Large inter-and intra-species variability in in vitro antifungal susceptibility is observed. In vitro antifungal testing is important to investigate the differences in susceptibility between Fusarium species and the importance of correct species identification for treatment. Amphotericin B is most potent drug against most Fusarium species (MICs 0.25- μg/ml) although some species demonstrate high MICs (>4 μg/ml). Amphotericin B, voriconazole are the antimycotics with the best overall activity, having broad-spectrum activity against Fusarium species. However, the appropriate treatment may differ depending on the infecting species. Minimal in vitro activity was found for isavuconazole although some species within F. fujikuroi SC had low MICs (1–2 μg/ml). Moderate activity was found for natamycin (MICs 4–8 μg/ml). The two novel imidazoles, luliconazole and lanoconazole have demonstrated very low GM MIC values of 0.005 μg/ml and 0.013 μg/ml. Antifungal belongs to echinocandins has high MICs of >16 μg/ml against majority of clinically related Fusarium species. Synergistic interactions were observed for the combinations of amphotericin B with caspofungin, rifampin, 5-flucytosine, voriconazole or natamycin and voriconazole with micafungin or terbinafine. For keratitis cases, combination of voriconazole and natamycin showed (70%) in vitro synergistic effects against Fusarium isolates. However, there still is a lack of evidence to support treatment choices for disseminated fusariosis caused by multi-drug resistant Fusarium.

S1.2c Two Aspergillus species, A. flavus and A. fumigatus - a comparative study of their conidial surface properties and immunological reactivities V. Aimanianda1 , S. Sze Wah Wong1 , L. Prabha Venugopalan1 , A. Karnam2 , A. Beaussart3 , J. Bayry2 , J. Maheshwari Jayapal4 , D. Kuppamuthu4 , J-P. Latg´e1 , L. Prajna4 1 Institut Pasteur, PARIS, France 2 UMR S 872, Centre de Recherche des Cordeliers, PARIS, France 3 Universit´e de Lorraine, NANCY, France 4 Aravind Medical Research Foundation, MADURAI, India Though belonging to the Aspergillus genus, Aspergillus fumigatus is the major causative agent of fatal invasive aspergillosis, the systemic infection in immunocompromised, while A. flavus causes keratitis, a superficial health hazardous infection in immunocompetent individuals. In the present study, we have been exploring these two Aspergillus species in understanding differences in their preferred sites of infection. Structurally, there was a difference in their conidial sizes. A. fumigatus conidia were uniformly labelled by calcofluor white, negative for FITC conjugated Concanavalin-A or wheat-germ agglutinin labelling, while A. flavus conidia showed heterogenous labelling. The A. fumigatus conidia surface was covered by a uniform rodlet layer whereas A. flavus conidia showed heterogeneity; some conidia showing rodlet layer, but others with additional amorphous structure. A. flavus conidial cell wall contained significantly higher amount of chitin and lower amount of glucan in the alkali-insoluble fraction compared to A. fumigatus conidial cell wall. Whereas, in the mycelial morphotype, the A. flavus cell wall showed a significantly lower amount of glucan in cell wall and higher amounts of chitin and galactosamine containing polysaccharide in the alkali-insoluble fraction. A. fumigatus condia failed to activate human monocyte derived macrophages, dendritic cells and isolated neutrophils, but A. flavus conidia were immuno-stimulatory in their effect. Interestingly, though macrophages secreted both pro- and anti-inflammatory cytokines, dendritic cells and neutrophils secreted only IL-8 upon A. flavus conidial interaction. These observations may reason for their preferred mode and thus the site of infection.

S1.2d Fungal keratitis in The Netherlands C. Oliveira dos Santos1 , H.A. Van der Lee1 , A.M.S. Al-Hatmi2 , E. Kolwijck1 , C.A. Eggink1 , P.E. Verweij1 1 Radboudumc, NIJMEGEN, Netherlands 2 Westerdijk Fungal Biodiversity Institute, UTRECHT, Netherlands Objective: Fungal keratitis is a common eye infection in the (sub)tropical regions. In temperate climates fungal keratitis is uncommon, and if present usually associated with contact lens wear. We noticed an increase of Fusarium isolates sent to our reference laboratory and investigated the frequency of Fusarium keratitis in the Netherlands. Methods: Between 2008 and 2017 the Mycology Reference Laboratory received Fusarium strains isolated from 89 Dutch fungal keratitis patients. Ophthalmologists were approached to collect clinical information regarding risk factors, treatment and outcome. All isolates were identified up to the species level using sequencing of the ITS1-5.8S-ITS2 region of the rDNA and TEF1 gene. Antifungal susceptibility testing (AFST) was performed according to EUCAST [6,7]. The antifungal agents tested were amphotericin B, voriconazole and natamycin. Susceptibility to the antisepticum chlorhexidine was also tested. Results: Of the 89 cases one occurred before 2010 while all others were diagnosed in the last 7 years indicating a clear increase of cases. The male to female ratio was 1 : 3 (P = 0.014). The use of contact lenses in this cohort was 67.4%, while only 4.5% of patients reported no use of contact lenses. Therapy failure was defined as the need of a cornea transplantation (n = 20) or enucleation of the affected eye (n = 5), this was the case in 28.1% (25 of 89 cases). The time between start of symptoms to the diagnosis of fungal keratitis was significantly longer in the group with therapy failure opposed to the group with restored vision; respectively 22 days versus 15 days (P = 0.024). If we consider the subgroup of cases with known usage of contact lenses, the use of contact lenses was significantly higher in the patients with therapy failure (P = 0.002). Identification and susceptibility is depicted in table 1. Conclusion: Fusarium keratitis appears to be an increasingly observed infection in the Netherlands, with a high failure rate. A wide diversity of species was identified with commonly high MICs of antifungal agents. Chlorhexidine showed promising activity and might be an option for therapy of Fusarium keratitis. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 423078 7bd7f02c-770b-4dc0-a362-0842 e34915e4.jpg Caption 1: Table 1. Molecularly identified fusarial keratitis isolates and their susceptibility profile including chlorhexidin.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Medical Mycology, 2018, Vol. 56, No. S2

S1.3 DNA Barcoding S1.3b Fungal feelings in the Irritable Bowel Syndrome R.M. Van den Wijngaard Tytgat Institute, Academic Medical Center, AMSTERDAM, Nederland This abstract discusses the newly discovered role of the gut mycobiome as a possible driving force for abdominal pain complaints in the Irritable Bowel Syndrome (IBS). IBS is a highly prevalent functional gastrointestinal disorder in which recurring symptoms (altered bowel habits and abdominal pain) cannot be attributed to structural or biochemical abnormalities. As a result, the diagnosis of IBS is symptom based. In particular abdominal pain is an unmet clinical need, most likely due to the lack of pathophysiological understanding. Nevertheless, increased sensitivity to distension of the distal gastrointestinal tract (so called visceral hypersensitivity) is present in 35–60% of the IBS patients. It can be triggered by stress and is hypothesized to be a key mechanism in the generation of abdominal pain. There is vast attention for the bacterial gut microbiome in relation to abdominal pain/visceral hypersensitivity. Possibly because they are a minor component of the gut ecosystem, fungi were largely excluded from this type of investigations so far. Recent evidence that resident fungi can play a role in inflammatory bowel disease (IBD) led us to assess the possible role of fungi in visceral hypersensitivity/IBS. Using ITS-1 based metabarcoding we compared fecal samples of healthy volunteers, normally sensitive IBS and hypersensitive IBS patients. Alpha diversity and mycobiome signature (stability selection) of both groups of patients differed from healthy volunteers, and the mycobiome signature of hypersensitive IBS patients differed from that of normally sensitive patients. To address the possible relevance of these findings, we used the IBS-like rat model of maternal separation that mimics early adverse life events that are associated with increased risks of IBS later in life. In this model, rat pups are separated from the dam for 3 hours daily from postnatal day 2 to 14 and left undisturbed throughout further development. Acute water avoidance stress at adult age induces visceral hypersensitivity in maternally separated rats whereas non-handled rats remain normally-sensitive. We previously showed that stress-induced mast cell degranulation and subsequent histamine-1 receptor ligation lead to visceral hypersensitivity. These results were successfully translated to IBS patients, but triggers for mast cell activation remained unknown. In recent investigations we treated maternally separated rats, prior to water avoidance, with different fungicides. This prevented the occurrence of visceral hypersensitivity. In addition, rats that already developed post water avoidance visceral hypersensitivity could be normalized by fungicide treatment. Subsequent repopulation experiments indicated that visceral hypersensitivity was conferred by a unique mycobiome: administration of ceacal mycobiomes from maternally separated rats, but not non-handled rats, restored hypersensitivity to distension. Gut mycobiome differences between maternally separated and non-handled rats were confirmed by ITS-1 sequencing. Finally, we obtained evidence that recognition of fungi/fungal antigens by the host immune system, via the Dectin-1/Syk pathway, was key to the observed visceral hypersensitivity. In vivo administration of soluble β-glucans or a SYK inhibitor reduced visceral hypersensitivity. Moreover, in ex vivo mesenteric windows mast cell degranulation could be induced by particulate β-glucans, and incubation of the human mast cell line HMC-1 with fungal antigens resulted in histamine release. Our data indicated that fungal antigens represent a thus far unrecognized trigger for mast cell activation leading to abdominal pain complaints in IBS (Botschuijver et al. Gastroenterology 2017). Based on this, we now focus on inhibition of fungal-induced mast cell activation and modulation of the aberrant mycobiome as novel treatment strategies. S1.3d Gastrointestinal Microbiota Alteration Induced by Mucor circinelloides in a murine model S.C. Lee1 , K. Mueller1 , H. Zhang1 , E.Y. Huh1 , Y. Wang1 , J. Heitman2 University of Texas at San Antonio, SAN ANTONIO, USA Duke University, DURHAM, NC, USA

1 2

Objective: Mucor circinelloides is a pathogenic fungus and etiologic agent of mucormycosis. In 2013, cases of gastrointestinal illness after yogurt consumption were reported to the US FDA, and the producer found that its products were contaminated with Mucor. A previous study found that the Mucor strain isolated from an open contaminated yogurt exhibited virulence in a murine systemic infection model and showed that this strain is capable of surviving passage through the gastrointestinal tract of mice. In this study, we examined if Mucor alters the gut microbiota in a murine host model. Methods: DNA extracted from a ten-day course of stool samples was used to analyze the microbiota in the gastrointestinal tracts of mice exposed via ingestion of Mucor spores. The bacterial 16S rRNA gene and fungal ITS1 sequences obtained were subject to Illumina-sequencing to identify taxa of each kingdom. Demultiplexing and classification of 16S rRNA gene sequence data were performed utilizing the Quantitative Insights Into Microbial Ecology (QIIME) pipeline. Open reference operational taxonomic units (OTUs) were clustered utilizing the Uclust algorithm based on a 97% threshold for sequence similarity. Taxonomic classification was determined using the Greengenes database. Classification of ITS1 data were performed utilizing the PIPITS pipeline, which clusters OTUs at a 97% sequencing similarity threshold by utilizing the RDP classifier. Fungal taxonomic classification was determined using the UNITE database. Bacterial and fungal OTU diversity were estimated, through OTU counts and Chao1 indices, and were tested for outliers using Cook’s distance. Differences in alpha diversity between exposed and unexposed mice were tested with a multiple linear regression. Beta diversity analysis was performed with principle coordinate analysis of Bray-Curtis distances and permutational analysis of variance using adonis implementation in R. Statistical significance of groups was determined using the Kruskal-Wallis test together with false discovery rate (FDR) correction. Taxa analysis was confirmed and visualized using the LEfSe web application. Results: Linear regressions revealed higher bacterial abundance in the gastrointestinal tracts of exposed, compared to unexposed, mice. In beta diversity, there was a significant effect for bacteria and fungi on several days. Furthermore, we found an increased abundance of the bacterial genus Bacteroides and a decreased abundance of the bacteria Akkermansia muciniphila in the gastrointestinal tracts of exposed mice. Measurements of abundances show shifts in relative levels of multiple bacterial and fungal taxa between mouse groups. Conclusion: These results support the hypothesis that ingestion of Mucor induced an alteration in the gastrointestinal microbiota of these mice and, more importantly, illustrate an interaction between the intestinal mycobiota and bacteriota. Understanding how the gut microbiota is shaped is important to understand the basis of potential methods of treatment for gastrointestinal illness. This study provides evidence that fungal microbiota, though understudied, may play an important role in disease of the human gut. S1.4 Chromoblastomycosis: the role of immunity S1.4b Transformation into muriform cells links to refractory murine chromoblastomycosis due to F. pedrosoi involving a chitininduced impairment of IFN-gamma production B. Dong Center for Infectious Skin Diseases/No.1 Hospital of Wuhan, WUHAN, China F. pedrosoi is the most common agent of chromoblastomycosis. Transformation of this fungus from its saprophytic phase into parasitic muriform cells in tissue is an essential link to chronicity of this infection. Notably, we have demonstrated that the muriform cells of F. pedrosoi can reproduce daughter cells without reverse transformation into hyphal form, and thus can cause an invasive infection in the footpads of athymic (nu/nu-) BALB/c mice. Furthermore, experimental studies in murine models have shown that the absence of CD4+ T cells impairs host defense against F. pedrosoi infection. Although the agents of chromoblastomycosis including F. pedrosoi usually invade individuals with fully functional immunity by traumatic inoculation, clinical research suggestes that a relatively low level of the Th1 cytokine INF-γ and inefficient T cell proliferation are simultaneously present in patients with severe chromoblastomycosis upon in vitro stimulation with ChromoAg, an antigen prepared from F. pedrosoi. In the present study, we show that in mice intraperitoneally infected with F. pedrosoi-spores, -hyphae or in vitro-induced muriform cells respectively, the transformation of this causative agent into muriform cells contributes to a compromised Th1 cytokine production in the earlier stage of infection with impaired generation of neutrophil reactive oxygen species (ROS) and pan-inhibition of Th1/Th2/Th17 cytokine production with disseminated infection in the later stage by using a CBA murine Th1/Th2/Th17 cytokine kit. In addition, we have further demonstrated that intraperitoneal administration of recombinant mouse IFN-γ (rmIFN-γ ) effectively reduces the fungal load in the infected mouse spleen, and dampens the peritoneal dissemination of muriform cells. Meanwhile, exogeneous rmIFN-γ contributes to the formation and maintenance of micro-abscess, and restores the decrease in neutrophil ROS generation in the mouse spleen infected with F. pedrosoi-muriform cells. Of note, we have once again demonstrated that it is a chitin-like component, but not β-glucans or mannose moiety, that exclusively accumulates on the outer cell wall of F. pedrosoi-muriform cells which were induced in vitro or isolated from the spleens of intraperitoneally infected BALB/c mice. In addition, our results indicate that decreased accumulation of chitin on the surface of live F. pedrosoi-muriform cells after chitinase treatment can be self-compensated in a time-dependent manner. Importantly, we have for the first time demonstrated that exclusive accumulation of chitin on the transformed muriform cells of F. pedrosoi is involved in an impaired murine Th1 cytokine profile, therefore promoting the chronicity of experimental murine chromoblastomycosis.

ABSTRACT

S1.4d Chromoblastomycosis and sporotrichosis in Madagascar: an update on epidemiology, clinical presentation and molecular diagnosis T. Rasamoelina1 , O. Raharolahy2 , N. Rakotozandrindrainy3 , I. Ranaivo2 , M. Andrianarison2 , B. Rakotonirina4 , D. Maubon5 , F.A. Rakotomalala1 , M. Rakoto Andrianarivelo1 , A. Andriantsimahavandy6 , F. Rapelanoro Rabenja2 , L.S. Ramarozatovo2 , M. Cornet5 1 Centre d’Infectiologie Charles M´erieux, Ankatso, Universit´e d’Antananarivo, ANTANANARIVO, Madagascar 2 USFR Dermatologie-Rhumatologie, HUJRB Antananarivo, ANTANANARIVO, Madagascar 3 UPFR Parasitologie-Mycologie, HUJRA Antananarivo, ANTANANARIVO, Madagascar 4 Institut Malgache de Recherches Appliqu´ees, Fondation RAKOTO-RATSIMAMANGA, ANTANANARIVO, Madagascar 5 Univ. Grenoble Alpes, CNRS, Grenoble INP, CHU Grenoble Alpes, TIMC-IMAG, GRENOBLE, France 6 Facult´e des Sciences, Universit´e d’Antananarivo, ANTANANARIVO, Madagascar Objective: Chromoblastomycosis (CBM) and sporotrichosis (SPT) are endemic and neglected infections in Madagascar. These implantation mycoses occur following plant injury or telluric contamination. CBM is mostly due to Fonsecaea spp. or Cladophialophora carrionii and affects the subcutaneous tissue, whereas SPT is caused by Sporothrix schenckii and develops in secondary lesions arising along the lymphatic system of the arms and legs. In Madagascar, no data have been obtained to establish SPT epidemiology whereas previous studies identified this country as the leading focus of CBM worldwide (Incidence at about 1/200,000 inhabitants). However, since 1994, no further studies on CBM have been performed. The study main objective was to assess the current prevalence of these mycoses in Madagascar. The specific objectives were to characterize the causative fungal species; to set up a sustainable clinical and laboratory network; to provide a molecular-based species identification and to create a reference database for the MALDI-ToF mass spectrometry (MS) identification. Methods: A longitudinal and observational study has started in March 2013 and is still ongoing. Patients were recruited during field investigations based on chronic cutaneous lesions. Clinical samples (skin biopsies, scrapping or pus) were analyzed by histopathological and mycological methods. A 2-step PCR strategy using both pan-fungal (D1D2 and ITS) and specific methods was developed. Species identification was confirmed by ITS sequencing and MALDI-ToF main spectrum profiles have been built to develop Mass Spectrometry (MS) identification. Results: To date, 151 patients have been enrolled. Their mean age was 48.8 years. Men were preeminent (74.2%). Overall, 49.0% were farmers, 27.8% self-employed, 13.9% students and 9.3% unemployed. Clinically, 39.0% of patients were suspected having CBM and presented with crusted, verrucous and tumoral lesions; 30.6% of cases were suggestive of SPT with ulcerative and nodular lesions of the lymphatic system of the lower limbs. Mycological, molecular and histopathological analyses confirmed 54 (36.0%) SPT and 36 (24.0%) CBM cases. Four mycetoma (2.6%), probably of bacterial origin, were also found. CBM cases were predominant in the northeast, east and south part of the island, whereas SPT cases were located mainly in the central highlands. The specific PCRs and ITS/D1D2 sequencing identified 54 strains of Sporothrix schenckii, 7 Cladophialophora carrionii and 29 Fonsecaea nubica. Using MALDI-ToF MS, 32 strains (3 C. carrionii, 7 F. nubica, 1 F. pedrosoi, 1 F. monophora and 20 S. schenckii) were analyzed and used as reference database and 33 other strains were tested for the identification. Conclusion: This study revealed that SPT is highly prevalent and confirmed that CBM persists at a high frequency in Madagascar. The molecular analysis of the Fonsecaea spp. strains established and reclassified Malagasy strains as F. nubica instead of F. pedrosoi. The MALDI-TOF MS demonstrated to be useful for the identification of etiologic agents at the species level. The availability of a reliable PCR tool in routine and the clinical expertise gained during this study will help to set up a proper program for surveillance and control. An environmental survey is ongoing to describe the fungal burden to prevent contamination.

S1.5 EFISG/ECMM Aspergillus guidelines S1.5a Guidance in times of antifungal resistance/Current perspective for antifungal resistance in aspergillosis P.E. Verweij Radboud University Medical Center, NIJMEGEN, Nederland Resistance to antifungal agents is an increasing problem in aspergillus diseases. Aspergillus species can be intrinsically resistant to polyenes and azoles, or may acquire resistance following exposure to azole and echinocandin compounds. Acquired resistance to azoles is mainly found in Aspergillus fumigatus and is now reported globally. Azole resistance may also develop through exposure to azole fungicides in the environment. Mutations are commonly found in the Cyp51A-gene which is the target for azole compounds. As resistant spores are present in ambient air, patients may present with azole-resistant aspergillus disease without previous azole therapy. Individual Aspergillus colonies from a single specimen may harbor different resistance profiles, hence multiple colony testing (up to 5 colonies) is recommended to increase sensitivity for azole-resistance detection (BIII). In clinical laboratories, species identification to the complex level is recommended for all clinically significant isolates (BIII). Some species are intrinsically resistant to either azoles or amphotericin B. Antifungal susceptibility testing of Aspergillus isolates should be performed in patients with invasive disease with the exception of azole-naive patients in regions with no resistance found in contemporary surveillance programs and regularly for epidemiological purposes including approximately 100 isolates. This is particularly important in patients who are unresponsive to antifungal treatment, or in patients who are clinically suspected of having an azole-resistant pathogen (AIII). If MIC testing is not available, routine agar screening can be used to detect azole resistance. However, such isolates should be referred to a mycology reference laboratory for MIC testing. Clinical breakpoints for interpretation of azole and amphotericin B MICs against Aspergillus are currently available for the EUCAST microdilution method but remain undetermined for CLSI methodology. Accordingly, EUCAST (AII) or CLSI broth microdilution methods (BII) can be used for determination of routine MICs for clinical guidance and for epidemiological resistance surveillance (AII). Both itraconazole and voriconazole (AII) should be tested to ensure detection of the voriconazole resistance mutation TR46 /Y121F/T289A. EUCAST (BIII) or CLSI broth microdilution methods (CIII) can be used to determine amphotericin B MICs but although a correlation between MIC and clinical outcome exists for A. terreus and A. flavus, it remains to be documented for other Aspergillus species. Voriconazole and isavuconazole are recommended for the treatment of IA due to species showing high amphotericin B MICs. Liposomal amphotericin B (L-AmB) or amphotericin B lipid complex (ABLC) are recommended for species with intrinsic high azole MICs. In aspergillosis due to A. fumigatus specifically, voriconazole or isavuconazole are recommended if the isolate is voriconazolesusceptible (EUCAST MIC ≤1 mg/L) (AI). If resistant (voriconazole MIC >2 mg/L), L-AmB therapy is recommended (AIIu). It is unknown if patients infected with A. fumigatus with voriconazole MIC 2 mg/L (intermediate), respond less well to voriconazole monotherapy. These patients may have an increased probability of failing voriconazole monotherapy, and combination therapy with an echinocandin or L-AmB monotherapy should be considered for invasive disease (AIII). In azole-resistant CPA, L-AmB or micafungin can be considered (BII) if surgical intervention is precluded. In settings with environmental azole resistance, no change to the primary regimen for IA is recommended when resistance rates are 10%, first-line therapy with voriconazole plus echinocandin (BIII) or L-AmB (BIII) is recommended.

S1.5d How to properly diagnose invasive aspergillosis? Recommendations on mycological diagnosis of invasive aspergillosis ¨ C. Lass-Florl Medical University of Innsbruck, INNSBRUCK, Austria Invasive aspergillosis (IA) is an important cause of morbidity and mortality in immunocompromised patients. Early diagnosis is a challenge. A panel of experts of the European Fungal Infection Study Group (EFISG) of the European Society of Clinical Microbiology and Infectious Diseases (ESCMID) and European Confederation of Medical Mycology (ECMM) undertook a data review and compiled recommendations for the clinical utility and accuracy of different diagnostic tests and procedures for the detection of IA. The recommendations underline the role of proper handling and processing of specimens and indicate the usefulness of microscopy in rapid diagnosis (A-III). Culture should always be attempted and specific media are recommended (A-III). Galactomannan detection in body fluids is more sensitive than culture for diagnosis of IA and a 0.5 cutoff in serum resulted in a high sensitivity in haematological patients and without anti-mould prophylaxis (A-I). Moderate evidence supports use of molecular assays for blood specimens in immunocompromised patients (B-II). Aspergillus PCR has been applied to bronchoalveolar lavages (B-II), however, a combination of biomarkers increases the diagnosis of IA (A-II). A limited role is given for the b-1-3-D-glucan test in detecting IA (C-II). Performances and limitations of the available assays are discussed and recommendations are provided on when and how to use them and how to interpret the results.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

S3

S1.6 ISHAM Working group: Genotyping of Cryptococcus S1.6b Genotypes of Cryptococcus neoformans and C. gattii species complex in Europe M. Cogliati Universita` degli Studi di Milano, MILANO, Italy Objectives: Recently, several isolates of Cryptococcus neoformans (CN) and C. gattii (CG) species complex originated from both clinical and arboreal sources in Europe have been typed by MLST. In the present study, these MLST data have been integrated and analyzed in order to produce new information about the genotypes present in Europe and in the Mediterranean area, the relationship between clinical and environmental isolates, and the genetic structure of cryptococcal populations. Methods. A total of 476 isolates (309 CN var. grubii, 151 CN var. neoformans, and 16 CG) from both clinical and arboreal sources were included in the study. Phylogenetic analysis was performed by minimum spanning, maximum likelihood, and network algorithms, whereas population genetics analysis included different parameters such as haplotype diversity, linkage disequilibrium, recombinant events, genetic divergence between populations, and gene flow. Results: MLST analysis identified 78 sequence types (ST) among CN var. neoformans (VNIV), 65 STs among CN var. grubii (56 VNI, 8 VNII, 1 VNB), and 5 STs among CG species complex (4 VGI and 1 VGIV) isolates. ST23 was the most prevalent genotype (21%) among VNI populations followed by ST63 (9%). ST23 was present in four different countries (Italy, France, Germany, and Turkey) and in both clinical and environmental isolates. In addition, it was closely correlated with many others genotypes present in the Mediterranean area forming a large cluster. In contrast, among VNIV isolates, a prevalent genotype was not identified but for a few dispersed clusters. Minimum spanning tree also showed that 17% of the STs in the VNI population included both clinical and environmental isolates whereas only 4% were present in the VNIV population. Both maximum likelihood and network phylogenetic reconstruction of CN species complex isolates produced a tree, which distinguished the four molecular types. The 16 European CG species complex isolates analyzed in the present study were all from the environment, four isolates from Italy belonged to genotype ST156 and ST197, six from Spain to ST194 and ST367, and six from Greece to ST204. Population genetics analysis confirmed that VNI and VNIV populations have a different population structure, the first characterized by low variability and clonal expansion and the second by higher variability and recombinant events. But interestingly, when VNI environmental and VNI clinical populations were analyzed independently, the former resulted in a structure more similar to the VNIV population than the latter which was characterized by low variability and a more clonal structure. Analysis of populations present in different countries showed a significant genetic flow between some countries, which allowed the drawing of a map of the spreading of the different genotypes. Conclusions: This is the largest MLST analysis focusing on CN and CG species complex isolates from European and the Mediterranean area. The results confirmed the different genetic structure of VNI and VNIV populations as well as some differences between arboreal and clinical populations. With respect to the CG species complex, all VGI isolates in the present study clustered in a Mediterranean cluster with differences observed between a cluster that included Italian and Spanish isolates, and one including Greek isolates.

S1.6c Molecular epidemiology of Cryptococcus in South Africa S.D. Naicker National Insitute for Communicable Diseases, JOHANNESBURG, South Africa Cryptococcus is the most common cause of meningitis among adults in southern Africa. Two cryptic species complexes within the genus cause most human disease: Cryptococcus neoformans and Cryptococcus gattii. Their ecological niche overlaps in southern Africa. We aimed to describe the molecular epidemiology of these species using multi-locus sequence typing (MLST). We conducted a cross-sectional study nested within national laboratory-based surveillance for cryptococcosis from 2005 to 2013. We included confirmed cases of cryptococcosis by any one of the following positive tests during a 30-day period: cerebrospinal fluid (CSF) India ink, blood or CSF cryptococcal antigen test and/or culture of Cryptococcus from any specimen. We included cases with viable isolates only. Isolates were screened using Niger seed and canavanine-glycine-bromothymol blue agar. We randomly selected approximately fifty cases of C. neoformans disease from each year, 2005 through 2009. All C. gattii isolates from HIVseronegative persons and a random selection from HIV-seropositive persons were included. Using a consensus scheme, MLST was performed for seven housekeeping genes. We used logistic regression models to determine the association between patient characteristics and genotype for cases of C. neoformans and C. gattii disease. We also examined the association between C. neoformans genotype and in-hospital death. From 2005 through 2013, approximately 97% (n = 24 871) of all cases with viable isolates were identified as C. neoformans while 3% (n = 781) were identified as C. gattii. We genotyped 251 C. neoformans isolates and found 74 different sequence types (ST), including ST5 (47/251, 19%), ST93 (26/251, 10%) and ST23 (23/251, 9%). Molecular types were distributed as follows: VNI (207, 82%), VNII (24, 10%), VNB (15, 6%) and VNIV (5, 2%). Most isolates (n = 249; 99%) had the mat-α mating type and 1% were mat-a (2 VNI isolates). On adjusted analysis, males were more likely than females to be infected with a non-VNI genotype (78% vs. 22%, P = 0.001). Patients receiving fluconazole treatment alone (30% vs. 19%, P = 0.01) or a combination of fluconazole and amphotericin B (35% vs. 22%, P = 0.05) were more likely to survive than those who received no antifungal treatment. Patients who had a CSF white cell count of less than 5 cells/μl were more likely to die than those who had more than 5 cells/μl (56% vs. 29%, P = 0.006). Among 781 C. gattii cases, HIV infection status was recorded for 387 patients, of whom 374 were HIV-seropositive and 13 were HIV-seronegative. One hundred and thirty six C. gattii isolates were randomly selected from the 374 HIV-seropositive cases; all 13 isolates from HIV-seronegative persons were selected but ten were viable. In total, 146 C. gattii isolates from unique cases were genotyped. There were 95 different sequence types (ST), including ST294 (14/146, 10%) and ST155 (10/146, 7%). Molecular types were distributed as follows: VGIV (101, 70%), VGI (40, 27%), VGII (3, 2%) and VGIII (2, 1%). Most isolates (n = 139; 95%) had the mat-α mating type and 5% were mat-a (5 VGIV and 2 VGI isolates). HIV-seronegative patients were significantly less likely than HIV-seropositive patients to be infected with VGIV isolates (20% vs. 73%, P = 0.006). Most cases (116/145; 80%) were diagnosed in the northern provinces of South Africa. Patients in these provinces were also more likely to be infected with a VGIV isolate vs. patients in the south (78% vs. 38%, P = 0.001). We found high genetic diversity in clinical Cryptococcus strains from South Africa. Among cases of C. neoformans disease, VNI was the major genotype though males were more likely to be infected with a non-VNI genotype. Among cases of C. gattii disease, HIV-seropositive patients and those from the northern regions of South Africa were more likely to be infected with the dominant VGIV genotype.

S4

Medical Mycology, 2018, Vol. 56, No. S2

S1.6d Molecular epidemiology of Cryptococcus neoformans and Cryptococcus gattii in Latin America

S2.1c Nutrient sensing and Cryptococcal virulence

C. Firacative Universidad del Rosario, BOGOTA, Colombia

´ ´ Leon-Hing J. W. Kronstad, G. Bairwa, M. Caza, H. Ding, L. Horianopoulos, G. Hu, F. Mayer, E. Sanchez University of British Columbia, VANCOUVER, Canada

Objective: To combine and analyse data reported from Latin America that has contributed to the identification, genotyping, molecular epidemiology, geographical distribution, ecological niche identification, and population genetics of the aetiological agents of cryptococcosis, a life-threatening mycosis acquired from the environment, that is caused by the encapsulated yeasts Cryptococcus neoformans and C. gattii. In Latin America, the study of cryptococcosis and its aetiological agents has become increasingly important as this mycosis has significant morbimortality, with more than 5000 individuals affected with cryptococcal meningitis yearly and 2400 attributable annual deaths. Additionally, the number of immunocompromised patients in the region constantly increases, with about 100000 new HIV infections annually, which is the main condition predisposing to cryptococcosis. Methods: Search on the studies on the molecular epidemiology of Cryptococcus and cryptococcosis was performed in English and Spanish in PubMed and Google databases using the keywords “cryptococcus” or “cryptococcosis” combined with each name of the 20 Latin American countries. Results: Analysis of the combined molecular data of 2110 clinical and 1029 environmental cryptococcal isolates from Latin America showed that, as worldwide, C. neoformans molecular type VNI is the most common cause of cryptococcosis (69.6%), affecting predominantly HIV patients, followed by C. gattii molecular type VGII (16.1%), which generally affects otherwise healthy individuals. Interestingly, in the environment these two molecular types also predominate with slightly different proportions (55.1% for VNI and 26.7% for VGII). However, whilst the environmental reservoir of C. neoformans is mainly avian guano, decaying organic matter and soil, the C. gattii niche is associated with several tree species. In Brazil and Colombia, the countries with the largest number of isolates, VNI and VGII are the most common molecular types, although in Colombia, the prevalence of VGIII is very similar to that of VGII. In Mexico and Argentina, however, after VNI, the molecular types VGIII and VGI are the most common among C. gattii isolates, respectively. By multi-locus sequence typing and whole genome sequencing, further advance to understand C. gattii populations has been also achieved in Latin America. Firstly, the global study of C. gattii VGII isolates provided evidence on the evolution of this pathogen in North America and gave support to the extensive evolution in, and dispersal from, South America, most likely from the Amazonia and the Northeast of Brazil, where VGII strains have shown to be the most variable genetically compared to worldwide isolates. Additionally, Mexico and Colombia have been proposed to be the likely origin of the VGIII population, as isolates from these countries are the basal group of isolates recovered worldwide. Conclusion: This work summarizes the significant progress that has been made in the recent years towards the molecular epidemiology of cryptococcal isolates in Latin America, that contribute to understand how these pathogenic yeasts have spread around the world and what is their population structure, and to better define some disease aspects of cryptococcosis, an important mycosis in the region.

Cryptococcus neoformans causes an estimated 15% of deaths in patients with HIV/AIDS. To contribute information in support of new therapeutic interventions, we are investigating the molecular mechanisms by which C. neoformans senses and interprets nutrient signals to support proliferation in vertebrate hosts. In particular, we are using molecular genetic, proteomic and transcriptomic approaches to identify functions required for iron sensing and uptake because metal availability influences elaboration of the polysaccharide capsule that is the major virulence factor of the fungus. In parallel, we are investigating the role of signal transduction pathways in the control of virulence factor production. A fruitful approach has been to screen collections of deletion and insertion mutants on chemicals such as lithium, brefeldin A, and bortezomib that are known to inhibit capsule formation. Additionally, we are screening for mutants with impaired ability to proliferate on inorganic iron or heme, or with increased sensitivity to non-iron metalloprotoporphyrins. As an example of our findings, the analysis of mutants with increased sensitivity to the proteasome inhibitor bortezomib revealed multiple functions that influence capsule formation. These functions include proteins that may shuttle proteins to the proteasome for degradation, transcription factors, signal transduction pathway components and, interestingly, the Cap60 protein that is implicated in capsule formation. The connection between the proteasome and capsule formation is relevant to nutrient sensing because we previously showed that manipulation of the cAMP signaling pathway regulates the abundance of regulatory particle subunits of the proteasome. In the context of iron sensing and uptake, our screens revealed a role for clathrin-mediated endocytosis and the endomembrane system in the trafficking of heme to the vacuole and, potentially, to mitochondria. For example, mutants defective in the clathrin heavy chain gene and other components of CME have altered sensitivity to non-iron metalloprotoporphyrins and are defective in heme trafficking. Additionally, the Sec1/Munc18 (SM) protein Vps45, which has a regulatory role in vesicle trafficking through interactions with SNARE proteins, contributes to endocytosis, iron acquisition, trafficking of iron uptake functions, and virulence in a mouse model of cryptococcosis. Overall, the combination of genetic screens and the focused use of inhibitors and iron sources are providing novel insights into connections between nutrient acquisition and cryptococcal virulence.

S2.1 Nutrition and stress S2.1a Carbon metabolism, immune suppression, and virulence in Candida albicans.

In human hosts, the opportunistic fungal pathogen Candida albicans often proliferates in sugar-poor niches (e.g. the gut), but is exposed to sugars in other niches (e.g. the bloodstream). Carbon sensing regulates several aspects of fungal physiology including growth, metabolism, cell wall architecture and elasticity, and virulence. In addition, yeast cell division exposes pathogen-associated molecular patterns (PAMPs) at the cell surface that are known to be immune-stimulatory (e.g. β-glucan). Host niches, morphogenesis and antifungal drugs have been implicated in PAMP exposure. However, little is known about which host signals influence PAMP exposure and the molecular mechanisms that modulate this exposure. We have shown that lactate, an alternative carbon source present in mucosal niches and produced by activated innate immune cells, acts as a signaling molecule to modulate β-glucan exposure. Lactate-induced β-glucan masking is driven via a non-canonical signal transduction pathway resulting in a calcineurinindependent activation of the transcription factor Crz1. However, it remains unknown whether the reduction in β-glucan exposure is the result of PAMP camouflaging by other cell wall components, by PAMP modification, or via a combination of both. Therefore, we are characterizing the signaling pathways and downstream effectors that affect PAMP exposure in response to different carbon sources and other key environmental inputs that C. albicans encounters in host niches. Our results from a combination of transcript profiling, proteomics, molecular dissection and cell biology approaches suggest that PAMP masking is a polygenic trait whereby multiple downstream factors contribute to PAMP masking in response to host signals. Furthermore, we are examining the impact of PAMP exposure on human disease. Our data support the view that C. albicans is a moving target for the immune system, exploiting local signals to modulate PAMP exposure and promote immune evasion in certain host niches.

M. Lorenz1 , R. Williams1 , E. Vesely1 , S. Vylkova2 University of Texas McGovern Medical School, HOUSTON, USA Freidrich Schiller University, JENA, Germany

1 2

The interaction of Candida albicans with innate immune phagocytes is both important and intricate. It is important because these cells are a key barrier to dissemination of fungal infections and defects in the phagocytic or physical barriers of the innate immune system predispose patients to systemic fungal disease. It is intricate in that C. albicans has a complex and dynamic response to phagocytosis, with major changes in transcript profiles, morphology, and metabolism. The changes are intertwined, with gene expression changes supporting altered metabolism, and metabolic byproducts affecting morphology. We have described three carbon catabolic pathways that are activated in C. albicans when in the phagolysosome, utilizing amino acids, carboxylic acids, or N-acetylglucoasmine (GlcNAc), each of which C. albicans uses avidly in vitro. Beyond providing energy and biomass, catabolism of these compounds has profound effects on the host pathogen interaction. Carboxylic acids such as lactate induce alterations in cell wall architecture, drug resistance and recognition by phagocytes. GlcNAc stimulates hyphal morphogenesis. Though the routes of catabolism are independent, all three share a common feature: they allow C. albicans to neutralize initially acidic environments, including the macrophage phagolysosome. This promotes hyphal growth, fungal survival, and inflammasome-mediated pyroptosis in the phagocyte. Neutralization in the presence of amino acids or GlcNAc results from the excretion of ammonia from the fungal cell, derived from amine groups on these compounds while degradation of the carboxylic acids leads to neutralization. Mutants that cannot efficiently utilize any one of these compounds, such as stp2 (encoding a regulator of amino acid permeases), jen1jen2 (encoding carboxylic acid permeases), or hxk1 nag1 dac1 (“h-d“; GlcNAc catabolism) occupy more acidic phagolysosomes than control strains and are more readily killed by macrophages. While significant in vitro, phenotypes of these mutants are less notable in vivo. We hypothesized that C. albicans has evolved a redundancy that allows it to utilize multiple carbon sources simultaneously, in agreement with findings from Brown and colleagues. We took two approaches to address this, the first of which was to combine all three sets of mutations in a single strain. The stp2jen1jen2h-d combination was significantly more sensitive to killing by macropages and more attenuated in an IV model of disseminated infection in mice, confirming the metabolic flexibility of this species. In a second approach, we screened for mutants unable to utilize many different non-fermentable carbon sources. All of these are attenuated for virulence in macrophage models, mice, or both. In summary, the nutritional flexibility of C. albicans both generates energy and biomass and actively suppresses phagocyte function. This is a unique form of metabolic adaptation to the host environment.

S2.1b Adaptation to complex host niches by fungal pathogen C. albicans drives resistance against neutrophil attack C.F. Urban, J.P. Lopes, E. Backman, S. Holmberg, R. Claesson Umea˚ University, UMEA˚, Sweden Immune systems have developed to prevent harm inflicted by other organisms. As a consequence, successful colonizers have evolved traits to escape from immune attack. Candida albicans is a successful colonizer of humans and its virulence is connected to the ability to adapt to stress or nutrient scarcity within the host. This environment shapes the niche for C. albicans. The yeast has evolved to anticipate environmental clues by predicting and adapting to secondary stimuli, thereby improving the organism’s fitness. In this case the niche shapes the environment. Here, we describe one such event. Upon infection, neutrophils are rapidly infiltrating into the mucosal niche. Circulating neutrophils are effective phagocytes which serve as first line defense against fungal pathogens. High numbers of infiltrating cells coupled with the formation of microbial structures, such as biofilms, lead to induction of hypoxic and anoxic microniches. We have characterized the effect of anoxia on neutrophil responses encountering C. albicans both under the form of different planktonic morphotypes and under biofilm growth. We found that a persistent anoxic milieu did not affect neutrophil viability nor metabolism, however, hampered neutrophil responses towards C. albicans. PAMP sensing and subsequent responses (phagocytosis, degranulation, NET formation) against C. albicans were reduced under anoxic conditions allowing the yeast to escape from neutrophil attack. In addition, anoxia contributed to increased fungal metabolic activity as compared to normoxic conditions, a trait we found to be conserved in many Candida species. We therefore conclude that adaption to low oxygen is not only an evolutionary advantage but rather a pre-requisite for successful colonization and infection of the host.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

S2.1d Fungal Transformers: Tracking a Moving Target D.S. Childers1 , GM Avelar1 , J Bain1 , A Pradhan1 , D Larcome2 , M Netea3 , L Erwig4 , NAR Gow1 , AJP Brown1 1 MRC Centre for Medical Mycology at University of Aberdeen, ABERDEEN, United Kingdom, United Kingdom 3 Radboud University, NIJMEGEN, Netherlands 4 GlaxoSmithKline, STEVENAGE, United Kingdom

S2.2 Candida auris S2.2a Identification and antifungal susceptibility of Candida auris A. Chowdhary Vallabhbhai Patel Chest Institute, DELHI, India Candida auris a multidrug-resistant(MDR) yeast that exhibits resistance to fluconazole (FLU) and markedly variable susceptibility to other azoles, amphotericin B(AMB), and echinocandins has globally emerged as a nosocomial pathogen that can cause invasive infections. Candida auris was first described in 2009 by Satoh et al. as a novel Candida species, in the Candida haemulonii complex(Metchnikowiaceae), from a patient in Japan after its isolation from the external ear canal. Alarmingly, in less than a decade this yeast, which is difficult to treat, has become widespread across several countries causing a broad range of healthcare associated invasive infections that display clonal inter- and intra-hospital transmission. C. auris in routine microbiology laboratories remains an unnoticed pathogen as 90% of the isolates characterized by commercial biochemical identification systems such as API 20C, Vitek 2 (bioM´erieux), Phoenix (BD), and MicroScan (Beckman Coulter), misidentify as a range of other Candida species. Most commonly, these isolates have been misidentified as C. haemulonii, but also C. famata, C. sake, Rhodotorula glutinis, R. mucilaginosa, and Saccharomyces species. Rarely, C. auris has been misidentified as C. catenulate, C. lusitaniae, C. guilliermondii, or C. parapsilosis. MALDI-TOF MS is considered as a more rapid and robust diagnostic technique for C. auris identification. Mass spectra can be easily added to the MALDI-TOF MS database, leading to accurate identification of C. auris to the species level. The development of PCR assays specific for C. auris using cultured colonies for the rapid and accurate identification could prove useful in outbreak situations. Sequencing of genetic loci, including D1/D2, RPB1, RPB2, and internal transcribed spacer (ITS) domains of the rRNA, has proven useful in the identification of C. auris, but it is not routinely used in diagnostic microbiology laboratory. The published susceptibility data of C. auris to antifungals is limited and varied studies have used a variety of methods, including Clinical and Laboratory Standards Institute (CLSI) broth microdilution, EUCAST, Etest, and the Vitek 2 yeast susceptibility system. Yet, analysis of these susceptibility results is not straightforward and can be problematic since no antifungal breakpoints for C. auris have been defined by CLSI or EUCAST. As more isolates from around the world have been tested, the number of isolates with FLU minimal inhibitory concentration (MIC) values similar to those of C. glabrata (in the 2–8 mg/l range) has increased, and fluconazole resistance is now believed to be acquired. Regarding azole resistance, mutations in Erg11 gene associated with the development of FLU resistance in Candida albicans have been detected in C. auris isolates. ERG11 sequences of C. auris exhibited amino acid substitutions Y132 and K143 in FLU resistant whereas wild-type (WT) genotypes, i.e. without substitutions at these positions, were observed in isolates with low FLU MICs (1–2 mg/L) suggesting that these substitutions confer a phenotype of resistance to FLU similar to that described for C albicans. Mutations conferring reduced susceptibility to FLU are strongly associated with geographic clades. The concern about resistance to azoles and AMB has led to the recommendation for the use of echinocandins as first-line therapy pending susceptibility testing. However, C. auris isolates with a reduced susceptibility to one or more echinocandin class drugs (MIC ≥4 mg/l for anidulafungin and micafungin; MIC ≥2 mg/l for caspofungin) have been detected. Echinocandin resistance in C. auris was linked to a novel mutation S639F in FKS1 hot spot region I. Resistance caused by fks1 S639F in C. auris was further confirmed in vivo in the mouse model of invasive candidiasis. The fact that this yeast exhibit MDR clonal strains which are nosocomially transmitted is unusual in other Candida species warranting effective control strategies to limit its spread.

ABSTRACT

S5

S2.2d Skin and surface disinfection challenges for the emerging pathogen Candida auris

S2.4d Azole resistance in Aspergillus fumigatus: Screening in Cystic Fibrosis patients

R. Kean1 , B. Short1 , E. McKloud1 , L. Sherry1 , C. Williams2 , G. Ramage1 1 University of Glasgow, GLASGOW, United Kingdom 2 University of the West of Scotland, PAISLEY, United Kingdom

` 1 , G. Reboux1 , M.L. Dalphin2 , J.C. Dalphin2 , B. Thiriez Richaud2 , L. Millon1 S. Rocchi1 , B. Valot1 , E. Scherer2 , A. Laboissiere 1 Chrono-environnement UMR CNRS 6249, Bourgogne Franche-Comte´ University, BESANC¸ON, France 2 CHRU Jean Minjoz, BESANC¸ON, France

Objective: Since its emergence in 2009, the fungal pathogen Candida auris has received considerable attention due to its resistant phenotype and its ability to exist within the healthcare environment. The impact on transmission and infection control is substantial, so understanding the mechanisms of spread and survival within this setting is critical. It has been shown to persist for prolonged periods on a number of fomites, as well as being able to successfully colonise the skin resulting in patient to patient transmission. Methods: Four C. auris clinical isolates were used throughout this study, with C. albicans and C. glabrata used as comparators. Surface disinfection testing was performed using three different substrates: cellulose matrix, plastic and stainless steel. Following adhesion, cells were then treated with sodium hypochlorite (NaOCl) or peracetic acid (PA) for 5 min before neutralisation. Cell viability was quantified using CFU plating and re-growth analysis. The efficacy of skin disinfectants was also analysed using a complex, 3-D biofilm model. Following growth for 1.5 or 48 hours, biofilms were challenged with clinically relevant concentrations of 10% povidone iodine (PVP-I), chlorhexidine (2%, 0.05%) and 3% hydrogen peroxide (H2 O2 ) with viable cells quantified using miles and misra and qPCR. In addition, untreated and treated samples were viewed using scanning electron microscopy. Results: The cellulose matrix was shown to be the most susceptible surface, with complete eradication achieved with both NaOCl and PA. No viable cells were recovered from the plastic substrate following treatment with PA, standard NaOCl treatment was shown to reduce by 88% for azoles against Aspergillus spp., Fusarium spp., Scedosporium spp. and Mucorales whereas lower levels of agreement can be observed for amphotericin B. The essential agreement between the two methods for Mucorales species against isavuconazole was best when 24 h EUCAST readings were compared with 48 h CLSI readings. Spectrophotometric readings of MICs have been evaluated for EUCAST AFST of azoles against A. fumigatus with an essential and categorical agreement >92% compared to visual MICs. EUCAST MICs for A. fumigatus isolates with different cyp51A point mutations vary according to the underlying mechanism. Based on MIC distributions, resistance mechanisms, PK/PD data and clinical outcome, EUCAST has determined the following susceptibly breakpoints for A. fumigatus: ≤0.125 mg/l for posaconazole, ≤1 mg/L for itraconazole, voriconazole, isavuconazole and amphotericin B. A 4-well azole agar method has been developed by the EUCAST as a screening method for detection of clinically relevant azole-resistant A. fumigatus with >99% sensitivity and specificity in detecting CYP51A mutants. Similar efforts have been undertaken for EUCAST AFST of echinocandins using an agar dilution method and a colorimetric method utilizing the XTT dye. Reference methodologies can be used to detect mutants and isolates with reduced susceptibility to antifungal drugs whereas screening methods can facilitate the detection of those isolates in clinical microbiology laboratories.

S2.5b Absorbance, turbidity, diameter, Oh my! Harmonizing disparate yeast testing methodologies S.R. Lockhart Centers for Disease Control and Prevention, ATLANTA, USA Susceptibility testing of yeast, once hidden in the dark corners of a few reference laboratories, has now become mainstream and is performed in clinical laboratories all across the world. There are two standards committees that oversee the rules for this testing, the European Committee on Antimicrobial Susceptibility testing (EUCAST) and the Clinical and Laboratory Standards Institute (CLSI). Testing is performed primarily by broth microdilution, with EUCAST and CLSI each having their own methodology and interpretations. In addition, there is the YeastOne panel which doesn’t strictly follow either of the Standards but is often used as a proxy for the CLSI methodology, and disk diffusion, for which CLSI has both a standard and interpretations. While the methodologies are good and the interpretations that have been established seem to be working, the missing pieces are interpretations for all but a few Candida species. In this talk I will discuss where the field stands in terms of harmonizing the various methodologies, and where interpretation of this testing may be heading in the future.

S6

S2.5d EUCAST susceptibility testing of Trichophyton rubrum: chloramphenicol and cycleheximide supplemented growth medium improve assay performance M.C. Arendrup1 , J Guinea2 , J. Meletiadis3 , K.M Jørgensen4 1 Statens Serum Institut; Rigshospitalet and Copenhagen University, COPENHAGEN, Denmark 2 ´ MADRID, Spain Hospital General Universitario Gregorio Maran˜ on, 3 University Hospital Athens, ATHENS, Greece 4 Statens Serum Institut, KØBENHAVN S, Denmark Objective: Terbinafine resistance is increasingly reported in Trichophyton rubrum rendering susceptibility testing important in non-responding cases. However, due to the slow-growing nature of dermatophytes, resistance determination is challenged by contamination which complicates endpoint reading especially when affecting the positive controls or wells close to the MIC. Here, we evaluated EUCAST susceptibility testing of terbinafine S/I/R T. rubrum with and without addition of chloramphenicol and cycloheximide (C+C). The aim was to evaluate if the growth of T. rubrum in the microdilution trays and the MIC endpoints were affected by the presence of C+C and if bacterial contamination were avoided during the necessary 5 to 7 day incubation period. Methods: Nineteen clinical T. rubrum isolates (10 WT and 9 squalene epoxidase mutants) were included. The isolates were sampled as pure cultures from Sabouraud plates supplemented with C+C and stored at −80◦ C prior to the experiment. Susceptibility to terbinafine (8-0.008 mg/L), voriconazole (8-0.008 mg/L), fluconazole (32-0.03 mg/L) and itraconazole (32-0.03 mg/L) was determined following the EUCAST E.Def 9.3 method in duplicate with and without the addition of C+C to the inoculum (final concentration in the plate of 50 mg/L and 300 mg/L, respectively). Spectrophotometer growth curves and degree of growth in the drug free growth controls were compared and MICs determined visually (full inhibition) and spectrophotometrically (90% inhibition) after 5–7 days incubation at 25◦ C when the growth was sufficient. Results: Comparison of the drug free growth controls revealed a discrete reduction in mean growth (9.1%, range -30% to -3.1%) for control wells with C+C compared to those without. The overall shape of the growth curves were similar (Data not shown). Bacterial or mould contamination were not observed in wells containing C+C despite the long incubation period. The MICs were either identical MICs or within ±1 dilution step for all isolates except one, for which widespread bacterial contamination in the wells without C+C complicated MIC determination, leading to similar MIC50 and ranges (Table). For itraconazole, a combination of paradoxical growth in the wells with the highest drug concentration (32 and 16 mg/L) and partial inhibition of the T. rubrum isolate in the middle of the concentration range resulted in visually determined MICs to be up to four dilution steps higher than the spectrophotometrically determined MICs. Conclusion: The addition of C+C resulted in a discrete reduction of growth but did not affect the MICs obtained for the included antifungals. Although not reflected in the MIC values, addition of C+C resulted in less variation and a clearer distinction between inhibited and non-inhibited wells during visual MIC determination. Terbinafine MIC determinations correctly separated isolates with target gene mutations from isolates without whereas azole MICs were similar across WT and non-WT isolates. Thus, supplementation of the EUCAST growth medium for dermatophyte testing should be further investigated. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 425553 bdd2101d-224b-4e53-8d3d2d20dd8426a4.png Caption 1: Table: MIC50 and range (mg/L) following E.Def 9.3.1 (visual MICs) w/wo addition of C+C

S2.6 ISHAM Working Group: Medical Phycology S2.6a Microsporidiosis and pythiosis in Medical Field K. Makimura Teikyo University, TOKYO, Japan Similarly to Prototheca or Chlorella infection, there is mycosis like infection caused by fungi-mimicking microorganisms, e.g., pythiosis. Needless to say, these pathogens are not true fungi; Prototheca and Chlorella are Archaeplastida (Plant) and Pythium is Stramenopiles of Diaphoretickes, eukaryotes in modern classification. However, these diseases and pathogens have been handled in the field of Medical Mycology. In contrast, the protozoan pathogens of microsporidiosis have been re-classified as fungi. These microorganisms and infections tend to fall into the gap between the research fields and researchers’ interests as “orphan pathogens and their infections”. Clinically, orphan infections lean to be severe and intractable to treatment, therefore, the presence of enriched intellectual bases for basic biology and epidemiology to clinical management of orphan pathogens and infections is highly desired. Working group of Medical Phycology under the umbrella of ISHAM may act as an active center for the research and mangment regarding these diseases and pathogens. Current status and perspectives of “orphan pathogens and their infections” will be disucussed. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISHS/add 442634 0687f59f-a614-4c32-af91-3e28223bc dd3.jpg Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISHS/add 1 442634 0687f59f-a614-4c32-af91-3e28223bc dd3.jpg

S2.6c Prototheca infections in dogs and cats P. Danesi1 , C. Falcaro1 , D. Binanti2 , M. Krockenberger3 , R. Malik4 1 Istituto Zooprofilattico Sperimentale delle Venezie, LEGNARO, Italy, Italy 3 VPDS, B14, Faculty of Veterinary Science, The University of Sydney Syndey NSW,, SYNDEY NSW, Australia 4 Centre for Veterinary Education, B22, The University of Sydney, SYDNEY, NSW, Australia Protothecosis is an uncommon cutaneous or systemic disease caused by unicellular algae of various Prototheca spp. These algae lack chlorophyll, having a saprophytic lifestyle, with a worldwide distribution except Antarctica. They favour warm, humid climates where there is abundant organic matter with high water content. Prototheca species currently recognized include: P. zopfii, P. wickerhamii, P. blaschkeae, P. stagnora, P. ulmea and P. cutis. Only P. zopfii and P. wickerhamii act as pathogens of dogs and cats. Two genotypes of P. zopfii are recognized; genotype 1 is a weakly pathogenic variant isolated from a minority of protothecal mastitis cases in dairy cows. In contrast, genotype 2 is the most virulent Prototheca variant and causes the vast majority of bovine Prototheca mastitis cases worldwide and most systemic canine protothecosis. P. wickerhamii is often associated with cutaneous disease and has been isolated from all affected cats. Protothecosis is an uncommon and sporadic disease of dogs and is even rarer in cats. In dogs, protothecosis is usually a serious disseminated disease, but localized skin disease occurs occasionally. Most affected dogs do not have a history of immunosuppressive drug therapy or illness. Boxer dogs and collies are predisposed, possibly secondary to an underlying genetic immunodeficiency, although a variety of other small- and large-breed dogs can be affected also. Cats with protothecosis have single or multiple nodular skin lesions in sites subjected to penetrating injury; disseminated feline disease has not been reported. Affected cats are typically FIV and FeLV negative and otherwise in good health. Cutaneous disease probably occurs secondary to cutaneous inoculation of organisms, which may be followed by development of localized cutaneous nodules or dissemination through lymphatic or haematogenous spread. Systemic invasion by organisms probably occurs after ingestion of a large inoculum of organisms, possibly followed by colonization of the gut, and then invasion especially in the setting of concurrent ulcerative disease, e.g. granulomatous colitis of Boxer dogs. In dogs, Prototheca can disseminate from the primary site of infection (usually the colon) to a variety of tissues, but especially the eyes, brain and meninges, heart, kidneys and long bones. This results in clinical signs of inappetence and weight loss; acute or chronic large bowel diarrhea; blindness and neurologic signs (seizures, ataxia, cranial nerve palsies) and sometimes lameness due to osteomyelitis. Ocular lesions include granulomatous chorioretinitis, uveitis and panophthalmitis. Cutaneous lesions in dogs are nodular and may ulcerate. Lesions may be located on the head, footpads, and distal limbs and tail base and can resemble those caused by Cryptococcus or Sporothrix. Prototheca organisms may be seen using cytologic examination of rectal scrapings; fine-needle aspirates of lymph nodes or bone or skin lesions; CSF or vitreal or aqueous humor aspirates; and urine sediment (after centrifugation). The algae may be mistaken for fungi such as Candida, Blastomyces, Coccidioides or Cryptococcus spp. Specimens collected for cytological examination may be cultured on standard media (e.g. Sabouraud’s dextrose agar) and investigated with molecular tools or mass spectrometry (MALDItof) in order to differentiate between the P. zopfii genotypes. We also have developed an in house real-time PCR assays that detects and differentiate Prototheca species from formalin-fixed paraffin-embedded tissue in order to support a histological or cytological diagnosis of protothecosis in animals. Concerning treatment, surgical excision can be curative for localized cutaneous protothecosis and should be performed whenever possible. Medical treatment of protothecosis is challenging. Therapy of canine disseminated protothecosis with amphotericin B leads to remission in some cases, but relapse typically occurs when the drug is discontinued, or dogs fail to respond to treatment and ultimately die or are euthanized as a result of the disease. Azoles are also useful in therapy either alone or in concert with amphotericin B.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Medical Mycology, 2018, Vol. 56, No. S2

S2.6b Genetic and biological insights from whole-genome sequencing of the pathogenic microalga Prototheca wickerhamii T. Jagielski1 , Z. Bakula1 , A. Gromadka2 , J. Gawor2 , R. Gromadka2 , P. Siedlecki1 University of Warsaw, WARSAW, Poland Polish Academy of Sciences, WARSAW, Poland

1 2

Objective: Among an estimated number of 72,500 algal species and 400,000 plant species worldwide, Prototheca are the only known organisms potentially pathogenic for both humans and animals. Of the eight currently recognized Prototheca species, four have been implicated in human infections, namely P. wickerhamii, P. zopfii, P. cutis, and P. miyajii with the former being responsible for the bulk of cases. The Prototheca algae and protothecosis in general have been much neglected areas of research. Importantly, sequencing of the entire chromosomal DNA of any Prototheca species has never been attempted before. The aim of this study was to perform whole genome sequencing (WGS) of P. wickerhamii using Illumina (Illumina, USA) and PacBio (Pacific Biosciences, USA) technologies combined to provide a comprehensive picture of the genetic make-up, pathophysiology, and evolution of this species. Methods: The type strain of Prototheca wickerhamii (ATCC 16529) was used in the study. Genomic DNA was isolated by using a newly designed DNA extraction method, essentially described elsewhere (Jagielski et al., Plant Methods. 2017;13:77). WGS was performed with the Illumina MiSeq (Illumina, San Diego, USA) and PacBio (Pacific Biosciences, Menlo Park, USA) platforms. Genome completeness was assessed using QUAST, BUSCO, and CEGMA. Gene prediction and annotation was performed using the MAKER annotation pipeline. Repetitive elements were defined by RepeatMasker and RepBase. Sequence similarity was assessed using BLAST with E-value < 1e-10. RNA for transcriptome analysis was isolated using the A&A Biotechnology (Poland) Total RNA Mini Plus kit, while sequencing libraries were generated with the KAPA Stranded RNA Seq kit (KAPA-Roche, Switzerland). Genetic content of P. wickerhamii was analyzed along with the genomes, publicly accessible via NCBI, of two chlorellacean species, closely related to Prototheca, namely Auxenochlorella protothecoides (accession no. GCA 000733215.1) and Helicosporidium sp. (GCA 000690575.1). Results: The contigs were assembled into 79 scaffolds spanning 32 Mbp, with a separate scaffold for mitochondrial and plastid DNA, resulting in a genome larger than that of A. protothecoides (22.9 Mbp) and Helicosporidium sp. (12.4 Mbp). The P. wickerhamii genome had a GC-rich genomic composition (64.4%), higher than in both A. protothecoides (63.5%) and Helicosporidium sp. (61.7%). Over 9,300 protein-encoding genes were predicted in P. wickerhamii, a number significantly higher than in Helicosporidium sp. (7,016) and A. protothecoides (6,033). Interspersed repeats and low complexity DNA sequences were shown to comprise 2.8% of the P. wickerhamii genome, with simple repeats and low complexity regions accounting for 2.1% and 0.2% of the genome, respectively. Small RNA sequences were detected in 0.3% of the genome and the most abundant transposable elements were the long terminal repeats (LTRs) Gypsy and Copia.The P. wickerhamii genome was shown to encode more metalloproteases and protease inhibitors when compared with Auxenochlorella and Helicosporidium. A number of genes coding for proteins, originating from staphylococci, streptococci, Candida albicans, and Cryptococcus neoformans, plausibly involved in the pathogen–host interactions were disclosed. Conclusion: This study provides a first insight into the genome of P. wickerhamii. A precise determination of the gene/protein functions and delineation of metabolic pathways is still in progress.

S2.6d Characterization of CYP51 gene of pathogenic algae of Prototheca spp M. Masuda, Y. Shinozaki, K. Matsumura, A. Masubuchi, T. Watanabe, K. Nishimura Dokkyo Medical University School of Medicine, TOCHIGI, Japan Objective: Prototheca spp. are achlorophyllous algae ubiquitous in nature. So far, five species, P. wickerhamii, P. zopfii, P. blaschkeae, P. cutis and P. miyajii, have been reported to cause infection in humans or animals. Although protothecosis has been thought to be a rare disease, an increasing number of the cases are reported, making Prototheca spp. as clinically non-negligible pathogens. Since the cell membrane of Prototheca spp. was shown to contain ergosterol, antifungal drugs, such as polyenes and azoles, are often used for the treatment of protothecosis. However, efficacy of the antifungal drugs, especially azoles, against Prototheca is still controversial. While azoles are known to inhibit sterol 14α-demethylase (CYP51) involved in biosynthesis of ergosterol, structure of the Prototheca CYP51 gene or protein is unknown. In this study, structures of the CYP51 gene of various Prototheca strains were determined and compared in order to develop the effective therapeutic drugs against protothecosis. Methods: Based on the known DNA sequences of the CYP51 genes of chlorophyllous algal species phylogenetically close to Prototheca, degenerate PCR primers were designed. By using these primers, PCR was performed on the template genomic DNA extracted from two strains of P. wickerhamii and one strain each of P. cutis and P. miyajii, and nucleotide sequences of the amplified DNA were determined. The amino acid sequences of Prototheca CYP51 deduced from the obtained nucleotide sequences were used for phylogenetic analysis with MEGA7 and search for potential characteristics associated with azole resistance. Results: The exon sequences of the CYP51 gene of P. wickerhamii, P. cutis and P. miyajii were highly similar to each other. Positions and sizes of the CYP51 gene introns were similar between two strains of P wickerhamii, but different from those of P. cutis and P. miyajii. While the latter two species were shown to be closely related based on the rDNA sequences, their CYP51 gene intron structures were different from each other. In the phylogenetic tree, Prototheca CYP51 proteins were localized in the same branch as chlorophyllous algae and separate from the branch of fungal CYP51. It was also found that some of the amino acid residues associated with azole resistance in the context of C. albicans CYP51 are shared by all of the Prototheca strains examined. Conclusion: Comparison among Prototheca strains of genomic structures of the CYP51 gene revealed apparent species specificity, suggesting that CYP51 might be useful for elucidating the phylogeny and derivation of various Prototheca spp. The phylogenetic distance of Prototheca CYP51 from the fungal orthologs, as well as presence of the amino acid residues potentially associated with azole resistance, is compatible with the previous finding that treatment with the currently available antifungal azoles often showed limited efficacy against protothecosis. Further analysis of the structure of Prototheca CYP51 protein may provide useful insights into development of the specific inhibitors effective for the treatment of protothecosis.

S3.1 Evolutionary strategies of fungal pathogens S3.1a Genome Evolution in Candida albicans R.J. Bennett1 , I.V. Ene1 , M.Z. Anderson2 , J.M Wang1 , R.A. Farrer1 , M.P. Hirakawa1 , K. Agwamba1 , C.A. Cuomo1 1 Brown University, PROVIDENCE, USA Evolution occurs when selection acts on mutations that naturally arise within the genome. A number of studies have examined mutational processes in haploid or homozygous diploid species, yet considerably less is known about how these processes shape heterozygous diploid genomes. Candida albicans is a heterozygous diploid yeast that is both a natural commensal of the human gastrointestinal (GI) tract and a prevalent opportunistic pathogen. This species shows a largely clonal population structure, yet an elaborate parasexual cycle has been described under laboratory conditions. To better understand plasticity in the C. albicans genome, we performed a detailed analysis of genomic differences arising during microevolution in the laboratory. Microevolution experiments involved isolates passaged both in vitro and in animal models of infection. During these relatively short time-scales, genomic variation was primarily driven both by de novo base substitutions and by loss of heterozygosity (LOH) events, with the latter often involving short tracts that impacted only single heterozygous positions. Large-scale chromosomal changes were also observed, with trisomies of chromosome 7 repeatedly emerging during GI colonization. Both strain background and chromosomal features affected mutation patterns, with rates being greatly elevated in regions adjacent to emergent LOH tracts. Mutation rates were also elevated during infection where genomes showed evidence of purifying selection. To complement these studies, we performed a comparative genomic analysis of 21 C. albicans isolates recovered from the clinic. These isolates displayed similar mutational patterns to those occurring during microevolution, such as hotspots in repetitive regions of the genome and evidence for purifying selection. Both aneuploidies and long-tract LOH events were frequently present. In addition, some isolates showed striking signatures of sexual recombination both in their nuclear and mitochondrial genomes. Together, our results provide a comprehensive picture of the genetic events driving C. albicans evolution. They reveal that particular regions of the genome are relative hotspots for evolution, and that mutation rates are elevated during infection of the mammalian host compared to in vitro culture. We also demonstrate that both purifying selection and sexual recombination shape the genome, and thus evolution, of this opportunistic pathogen. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISHS/add 1 445298 06d6b6dd-49b0-46fc-ae27abec123aad62.png

ABSTRACT

S3.1b Sexual reproduction and the evolution of eukaryotic microbial pathogens J. Heitman Duke University Medical Center, DURHAM, USA

S7

S3.2d Talaromyces SPP., New emerging pathogen in Jakarta, Indonesia: Analysis of clinical and animal isolates S.S. Surja1 , R. Adawiyah2 , J. Houbraken3 , A. Rozaliyani4 , - Ridhawati4 , E. Yunihastuti1 , R. Wahyuningsih4 1 Universitas Katolik Indonesia Atma Jaya, JAKARTA, Indonesia Faculty of Medicine Universitas Indonesia, JAKARTA, Indonesia 3 Westerdijk Fungal Biodiversity Institute, UTRECHT, Netherlands 4 Universitas Indonesia, JAKARTA, Indonesia 2

Sexual reproduction and the evolution of eukaryotic microbial pathogens Joseph Heitman, MD, PhD, Department of Molecular Genetics and Microbiology, Duke University, [email protected] We study the evolution of sexual reproduction and its impact on microbial pathogens. Many fungi and parasites were thought to be asexual and clonal, and yet we now appreciate that the majority have extant but unusual sexual cycles. We study how sexual identity is specified by mating-type loci. In parallel we study how sexual reproduction occurs. We discovered an unusual sexual cycle involving only one mating-type, unisexual reproduction, which can provide adaptive benefits similar to bisexual reproduction. Unisexual reproduction can generate genetic diversity de novo, preserving well-adapted genomic configurations yet generating limited genetic diversity. Second, unisexual reproduction promotes the yeast to hyphal dimorphic transition to forage for nutrients and generate infectious spores. Third, unisexual reproduction can reverse Muller’s Ratchet, avoiding mutation accumulation that threatens asexual species. Other fungi and eukaryotic parasites have also been found to reproduce unisexually. Unisexual reproduction may have evolved to mitigate sex-associated costs and afford advantages associated with conventional sexual modes. Studies of fungal sex evolution illustrate general principles with implications for model and pathogenic microbes and multicellular eukaryotes, and provide insight into a hypothesized evolutionary epoche featuring sex before sexes.

S3.1d Genome sequencing reveals infection mechanisms for two amphibian-infecting chytrid species R.A. Farrer1 , A. Nash1 , A. Martel2 , E. Verbrugghe2 , A. Abouelleil3 , R. Ducatelle2 , J.E. Longcore4 , T.Y. James5 , F. Pasmans2 , M.C. Fisher6 , C.A. Cuomo3 1 University College London, LONDON, United Kingdom 2 Ghent University, GHENT, Belgium 3 Broad Institute of MIT and Harvard, CAMBRIDGE, USA 4 University of Maine, ORONO, USA 5 University of Michigan, ANN ARBOR, USA 6 Imperial College London, LONDON, United Kingdom Objective: Nearly half of all amphibian species are declining globally due to factors such as habitat loss and disease. Two related fungal pathogens (Batrachochytrium dendrobatidis; Bd and the recently identified B. salamandrivorans; Bsal) have been attributed to these global declines and extinctions. To understand the evolutionary pathways that lead to emerging infections of vertebrates, we explored and compared their genomic content with that of closely related free-living chytrid fungi. Methods: We sequenced and compared the genomes of two pathogenic and two free-living chytrid fungi. To more broadly characterize the host–pathogen interplay during infection, we also compared the in vivo transcriptomes of Bd and Bsal in a susceptible model host species (Tylototriton wenxianensis, Tw) at late stage of infection against transcription in vitro. Results: By comparing the genome content and gene expression during infection, we identified fundamental differences in the molecular basis of pathogenesis. Notably, we identified a new group of secreted genes in Bsal that have no sequence similarity to previously characterized genes, but are highly expressed in the host. Additionally, we identified a large expansion of metalloproteases in Bsal compared to Bd, genes which have been also been reported in a variety of dermatophytes. We found that both of these candidate pathogenicity factors were differentially expressed in the presence of the host, and that the host response is highly distinct to the two pathogens. Conclusion: These analyses demonstrate the divergent infection strategies and immune response to within this amphibiankilling genus.

S3.2 AIDS-related mycoses S3.2b AIDS-related histoplasmosis in Latin America A. A. Adenis Centre Hospitalier de Cayenne, CAYENNE, French Guiana Histoplasmosis is caused by Histoplasma capsulatum, a thermodimorphic fungus. The mold form is distributed worldwide in moist and enriched soils containing bird droppings or bat guano. Histoplasmosis is an airborne disease that can affect both immunocompromised and immunocompetent individuals with contrasted prognoses and different care and treatment strategies. Mostly asymptomatic and spontaneously self-limited, histoplasmosis causes low morbidity and mortality among immunocompetent individuals. Among immunocompromised patients, in the presence of an acquired or congenital cellular immunodeficiency, histoplasmosis is responsible for an important morbidity and mortality. At all ages, it is mostly fatal in the absence of appropriate treatment. Its extrapulmonary or disseminated form became an acquired immunodeficiency syndrome (AIDS)-defining condition in 1987. Autochthonous cases of HIV-associated histoplasmosis have been described on five continents, the Americas accounting for most cases, notably the central eastern USA and Latin America. Despite ART scale-up and progress in care and treatment across Latin American countries, HIV/AIDS care and treatment remains challenging. In many areas where HIV prevalence is high, a significant proportion of patients present to care with advanced HIV infection and with a low CD4 cell count (30-70% 1000 IU/mL; and, two of the following: (i) serum A. fumigatus-specific IgG >27 mgA/L; (ii) total eosinophil count >500 cells/μL; and, (iii) radiographic pulmonary opacities consistent with ABPA. The specificity of testing Aspergillus specific IgE may improve using Asp f 1 and f 2, specific allergen components from A. fumigatus. This nationwide survey in Japan, found late-onset, relatively lower serum IgE levels, and frequent recurrences/flares in their patients. The role of other fungi than A. fumigatus in causing the disease, is not clear, though several agents have been claimed to be associated with occasional cases. The treatment principles include the institution of glucocorticoids to control the immunological activity and antifungal azoles, primarily itraconazole to decrease the fungal burden in the tracheobronchial tree. Recent evidence suggest that lower doses of glucocorticoids are effective in the vast majority of the patients. Itraconazole is also effective in about 88% of patients with acutestage ABPA and can be used especially in those at risk for glucocorticoid-related adverse effects. The disorder is characterized by recurrent episodes of exacerbation. In patients experiencing recurrent exacerbation, long-term treatment with antifungal azoles, nebulized amphotericin, low-dose glucocorticoids or omalizumab may be required. Newer agents such as mepolizumab, reslizumab and benralizumab are also likely to be beneficial in ABPA. S6.2c Recent advances in allergic bronchopulmonary aspergillosis complicating cystic fibrosis

G. Butler University College Dublin, DUBLIN, Ireland

R.B. Moss Stanford University, PALO ALTO, USA

Candida albicans and close relatives translate the codon CUG as serine rather than leucine, associated with changes in the tRNACAG . The group containing these species is therefore often referred to as the “CTG clade” or more recently, as the “CTG-Ser” clade. Most asexual Candida species belong to the Candida/Lodderomyces clade, a sub-group of the CTG-Ser clade. We are exploring within-species diversity of some pathogenic members of the Lodderomyces clade using genome sequencing and phenotypic analysis. Sequencing 28 Candida orthopsilosis isolates revealed that most have highly heterozygous diploid genomes. C. orthopsilosis isolates arose from at least four hybridizations between related, but not identical, parents. We used population genomics data together with phenotypic assays to correlate genotypic and phenotypic variation in C. orthopsilosis. We identified 6773 variants with potential high-impact (deleterious effects). One variant correlated with sensitivity to nystatin, which we confirmed using CRISPR-Cas9 editing. We are also carrying out a similar analysis using genome sequencing of >70 strains of Candida tropicalis, isolated from clinical and environmental sources. The isolates fall into several clades, with little evidence of geographical separation. Phenotypic differences between these isolates have been assayed under >70 different conditions.

Although allergic bronchopulmonary aspergillosis was recognized as a distinct complication of asthma in 1952 and described in patients with CF in the 1960’s, more than half a century later diagnosis remains a difficult and imprecise process. ABPA has been reported to affect up to 20% of CF patients in some studies (average reported prevalence in CF is 9–10%). ABPA diagnostic criteria were formalized in 1977 from observations in patients with underlying asthma, and subsequently adapted from the context of asthma to that of cystic fibrosis via consensus conference in 2001, followed by an ISHAM working group update in 2013. CF presents particular issues in diagnosis and treatment of ABPA, due to similarity of several diagnostic features of ABPA with underlying CF, and CF-related complications (e.g. diabetes, osteoporosis) vulnerable to worsening by ABPA pharmacotherapies. Unlike in asthma, in CF it is recommended that ABPA is screened for with annual total blood IgE levels beginning around age 6 years. Additionally, elevations in IgE have been reported to be a useful independent single biomarker for steroid therapy leading to improved outcome in CF regardless of formal ABPA diagnosis. Recent efforts to improve ABPA diagnosis have addressed ambiguities in serologic cutoff values and lack of assay standardization. Refinements of Aspergillus-specific IgE and IgG antibody assays, including studies with recombinant A. fumigatus allergens, have improved diagnostic accuracy but utility of universal application remains uncertain. Measurement of serum cytokines or chemokines such as CCL17/TARC has not yielded a useful biomarker. We have developed a flow cytometric assay analyzing activation state of blood basophils–a critical innate and adaptive component of the Th2 immune response underlying ABPA pathophysiology–that offers the potential for a definitive diagnostic test and ex vivo monitor of response to treatment. Additionally, chest MR using T1- and T2-weighted images may offer a valuable alternative to CT scans, sparing patients radiation exposure. With regard to treatment, recent clinical trials (albeit primarily in asthmatics with ABPA) support use of several modalities widely used in CF-ABPA, including oral glucocorticosteroids, Aspergillus-active oral triazoles, and inhalational amphotericin. Omalizumab, a monoclonal anti-IgE antibody administered subcutaneously once or twice a month, has become a popular choice in CF-ABPA in relapsing or steroid-dependent stages given loss of alternative drug efficacy, toxicity or other problems. A recent placebo-controlled trial has demonstrated that conventional omalizumab dosing can be applied to ABPA despite often very high IgE levels. Intravenous monthly pulse glucocorticoids are also employed as an alternative to oral daily steroids. Future likely developments include potential use of multiple biological agents targeting specific ligands along the Th2 pathway, advances in safer and potentially more potent local lung delivery of antifungals such as inhalational azoles, further standardization and availability of diagnostic assays, and placebo-controlled trials of antifungals. Consortia focusing on fungal issues in CF including ABPA have been established in the EU and UK.

S6.1d Comparative genomics for understanding the development of multidrug resistance in Candida lusitaniae D. Sanglard1 , S. Asner2 , S. Kelly3 1 University of Lausanne and University Hospital, LAUSANNE, Switzerland 2 University of Lausanne and Universiry Hospital, LAUSANNE, Switzerland 3 Swansea University Medical School, SWANSEA, United Kingdom Objective: Antifungal resistance is an inevitable phenomenon when fungal pathogens get exposed to antifungal drugs. Multidrug resistance (MDR) has emerged in hospitals due to the use of several agents administered in combination or sequentially to the same individual. We investigated here MDR in Candida lusitaniae during therapy of a patient with amphotericin B, azoles and candins over a time lapse of 3 months and resolved MDR mechanisms using genome sequencing approaches. Methods: Different isolates were obtained during therapy and they were assigned to 5 different antifungal susceptibility profiles (P1-P5). The genomes of isolates P1 to P5 were subjected to whole genome sequencing using the PacBio technology in order to resolve mutations associated with antifungal resistance. The genomes were annotated with a combination of systematic blasts and use of RNAseq data and compared with each other. Results: P1 was the earliest isolate obtained from stools at initiation therapy and was susceptible to all antifungals. P2, P3, P4 and P5 were MDR isolates since they exhibited resistance to at least 2 drug classes. These isolates originated from the bloodstream indicating a systemic infection likely originating from P1 in the gastro-intestinal tract. P2 to P5 were related to P1 since they exhibited DNA profiles identical to P1. Assembly of P1 to P5 genomes could resolve 8 large contigs that corresponded to the 8 chromosomes reported in C. lusitaniae. P1 to P5 genomes did not undergo significant rearrangements but were different from a Genbank deposited C. lusitaniae genome structure (strain ATCC 42720). The PacBio assembled genomes were next compared to each other and with the initial isolate P1 in order to identify drug resistance mutations. From a total of 13 non-synonymous SNPs (NSS) in P1 to P5 comparisons, 6 were associated with MDR and included: i) 1 NSS in ClMRR1 (that encodes a putative transcriptional activator) identical in isolates P3 and P4. These two isolates are azole-resistant and exhibit upregulation of a major facilitator transporter (MFS7), which is consistent with involvement of an altered transcription factor. RNAseq data confirmed transcriptional changes in P3 and P4 as compared to P1 which was in agreement with a gain of function mutation in ClMRR1. ii) 3 separate NSS in FKS1 (glucan synthase) in P2, P3 and P5, which were all candin-resistant. These mutations were situated in a FKS1 region known to participate to candin resistance. iii) 2 NSS resulting in non-sense mutations in ERG4 and ERG3 (ergosterol biosynthesis) from P2 and P5 both being amBresistant but the later accumulating 2 NSS. Both P2 and P5 consistently exhibited sterol profiles consistent with ERG4 and ERG3 defects. Conclusion: Genome analysis could resolve the resistance profiles identified in this clinical case. MDR isolates P2 to P5 accumulated 6 different mutations conferring resistance to all known antifungal agents. This case study illustrates the capacity of C. lusitaniae to rapidly adapt to drug pressure within the host. Genome analysis helped to decipher the operating drug resistance mechanisms.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

S6.2d A new Aspergillus fumigatus Western Blot assay for IgE sensitization and Allergic Broncho Pulmonary Aspergillosis diagnosis R. P. Piarroux1 , S. Ranque2 , J. Vitte2 1 LDBIO Diagnostics, LYON, France 2 AP-HM, MARSEILLE, France Objective: Diagnosis of Allergic Broncho Pulmonary Aspergillosis (ABPA) is complex and based on a multi-criteria definition. The detection and quantitation of immunoglobin E (IgE) responses to Aspergillus fumigatus (Af) is one of the major criteria for its definition, but also reflect sensitization to Af. In addition to whole extract sensitization, a new approach assaying IgE responses to molecular antigens of Af has emerged in the past few years. Although this molecular diagnosis approach enhanced the discrimination between Af sensitization and ABPA, no available assay allows a clear-cut distinction between these two diseases. This may be due to the limited number of Af molecular antigens available for in vitro diagnostic assays. Western Blot (WB) allows the detection of the virtually complete spectrum of antigens recognized by immunoglobulins in a patient’s serum, yielding complex immune profiles in a single test. WB is therefore considered in many fields as a very sensitive and specific assay. Yet WB application to IgE response characterization remains scarce. This work aimed to test whether an Af IgE WB assay would efficiently detect and differentiate Af-sensitization and ABPA. Methods: 61 sera with known sIgE reactivity (10 ABPA, 39 Af-sensitized, 12 Af-IgE negative controls), previously assayed R to Af extract and molecular antigens were tested with the LDBIO Aspergillus WB and an anti-IgE conjugate. with ImmunoCap R as reference. We evaluated the ability of WB LDBIO to discriminate Performances of WB were evaluated using ImmunoCap between ABPA and Af sensitized patients. Results: 10/10 ABPA and 35/39 Af sensitizations sera were detected by WB, while 12/12 negative sera were found negative. R , two were of very weak IgE intensity (2 loci and were excluded from the analysis. The results showed a high genetic diversity revealing 46 distinct genotypes among 59 A. terreus isolates. All the nine markers used for STR typing of A. terreus species had highly polymorphic. Genetic Diversity Index or Simpson’s index (D) in this study was calculated 0.93. The results of susceptibility tests exhibited that amphotericin B had the highest MICs (MIC range, 0.125 to 4 μg/ml; MIC90 , 2 μg/ml), followed by terbinafine (MIC range, 0.002 to 1 μg/ml; MIC90 , 1 μg/ml). Only one isolate (1/81) showed amphotericin B MIC above the epidemiologic cutoff value (ECV). None of the isolates had a MIC of ≥ ECV for voriconazole, itraconazole and posaconazole. Conclusion: The reasons for the difference in amphotericin B susceptibility patterns between studies remain unknown. The genetic and species diversity, clinical, environmental and ecological factors in Terrei section on various amphotericin B susceptibility profiles in different countries should be considered more as the main reasons associated with these differences.

S6.3c Diversity among coelomycetous isolates from cutaneous and subcutaneous infections 2 ´ , K Sitbon1 , S Ahmed3 , P Moguelet2 , F Dromer1 , O Lortholary1 , F.M.S.G French Mycosis D. Garcia-Hermoso1 , S Guegan Study Group4 1 Institut Pasteur, PARIS, France 2 ˆ Hopital Tenon, PARIS, France 3 Westerdijk Fungal Biodiversity Institute, UTRECHT, Netherlands

Background: The infection caused by ubiquitous melanized fungi producing hyphae, pseudohyphae or yeast-like elements in tissue, is known as phaeohyphomycosis. Cutaneous and subcutaneous forms are the most common clinical entities. Several species have been reported responsible for disease mostly in the orders Chaetothyriales and Pleosporales. In the latter, coelomycetes, a heterogenous group of molds, produce fruit bodies in culture and are increasingly associated with this type of infection. Here we studied phaeohyphomycosis cases, due to coelomycetes retrospectively collected during 2005–2014. Methods: We analyzed cases of cutaneous and/or subcutaneous coelomycetous infections notified to the French National Reference Center for Invasive Mycoses and Antifungals (NRCMA) and characterized their corresponding isolates using a polyphasic approach. Results: Patients originated from tropical or subtropical regions and presented in a majority an underlying immunodepression. The type of lesions observed were nodules, abscesses or infiltrated plaques and their treatment consisted especially in surgical excision and administration of systemic antifungals. We identified of different genera belonging mainly to order Pleosporales: Medicopsis, Paraconiothyrium, Peyronellaea.

S6.3d Conidiobolomycosis: presentation of two cases in adult and infant A. Bonifaz1 , J. Araiza1 , L. Fierro-Arias1 , E. Guevara2 , P.D. Elizalde3 1 ´ Hospital General de Mexico Dr. Eduardo Liceaga, MEXICO, Mexico 2 ´ Hospital Lopez Mateos, ISSSTE, MEXICO, Mexico 3 ´ Hospital General Lopez Mateos, ISSSTE, MEXICO, Mexico Objective: Conidiobolomycosis is a mycosis caused by a primary pathogenic fungus, of the order Entomophtora, called: Conidiobolus coronatus, which usually involves nasal mucosa and subcutaneous tissue in the form of infiltrated masses. it is typical tropical disease of warm and humid climates; It has been registered in some African countries and in Latin America, in areas of tropical forests Objective: to present two cases in adult and infant, demonstrating their clinical characteristics, mycological and therapeutic response Methods: Case 1. Female patient of 21 years, with dermatosis of 2 years of evolution, from the coast of Oaxaca (Southeast of Mexico). Located to face and both eyelids, back of nose and naso-genianos grooves. It presented an increase in volume, erythematous-violaceous. Presumptive diagnosis: nasal tumor Case 2. Female patient of 5 months, with dermatosis of 3 months of evolution, of Coyuca Guerrero (South of Mexico), with no history of trauma. Located in the left eye with increased volume and secretion. Presumptive diagnosis: bacterial dacryocystitis. Results: In both cases, thick hyphae and cenocytic hyphae were observed in direct examination (KOH). To the culture, Conidiobulus coronatus was identified, formed by conidia with basal papilla, replication and superficial projections (like crown). Histopathology was granulomatous infiltrated with thick hyphae and surrounded by Splendore-Hoeppli phenomenon. Treatment: The first case was treated with oral itraconazole for 8 months. The second one with intravenous lipidic amphotericin B for 15 days and oral SMX / TMP for 8 months. In both cases clinical and mycological cure was achieved. Conclusion: Conidiobolomycosis usually affects the nasal mucosa, paranasal sinuses and pharynx; in chronic cases it invades the subcutaneous and muscular tissue; usually it is located in the centro-facial region. In an entity that progresses bilaterally and asymptomatically and that is usually confused with nasal tumors (lymphomas). Most cases are preset in adults and cases in children are exceptional. Its diagnosis is simple by culture and biopsy and the majority of cases respond well to itraconazole and SMX/TMP.

S6.4 Aspergillus terreus frontline S6.4c Amphotericin B Resistance: New insights ¨ C. Lass-Florl Medical University of Innsbruck, INNSBRUCK, Austria The polyene antifungal amphotericin B (AmB) exerts a powerful and broad activity against a vast array of fungi and in general displays a remarkably low rate of antimicrobial resistance. Aspergillus terreus holds an exceptional position among the Aspergilli due to its intrinsic AmB resistance, in vivo and in vitro. Until now, the underlying mechanisms of polyene resistance were not well understood. Novel data on the mode of action of AmB in A. terreus show that the stress response pathways covering the heat shock proteins (Hsp) 90/Hsp70 axis, as well as reactive oxygen species detoxifying enzymes play a major role in polyene resistance. Also, mitochondrial functions displayed striking differences in AmB-susceptible versus resistant isolates; A. terreus fungal mitochondria hold some unique features that impact the cellular redox status and hence influencing polyene susceptibility. These findings may provide new molecular targets for drug development.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

S6.5 Malassezia in humans and animals S6.5a Analysis of Malassezia microbiota in humans and animals: does it really help us to better understand and control Malassezia-related diseases? J. Guillot1 , A. Briand1 , O. Chosidow2 , C. Bernigaud2 1 ´ erinaire ´ Ecole nationale vet d’Alfort, MAISONS-ALFORT, France 2 ´ Faculty of Medicine, CRETEIL, France In the last decade, significant advances in next-generation sequencing methods allowed the characterization of the complex microbial communities occurring in several body sites, including the skin in humans and, to a lesser extent, in companion animals. Originally, studies mainly focused on prokaryotic inhabitants of the skin, but fungi, especially Malassezia yeasts, have recently received more attention. The first large-scale sequencing analysis, which took into account the fungal diversity on human skin, was performed by Findley et al. (2013) in 10 healthy adult volunteers in the USA. This first study clearly demonstrated that Malassezia yeasts are the most abundant fungal organisms on many human skin sites (14 sites swabbed, 78.6% of the population). In contrast to extensive bacterial diversity found at all human skin sites tested, the fungal communities structure seems to be more site-dependent. The back and head are the most stable sites with the lowest diversity, whereas the proximal arm sites display intermediate diversity. The foot sites are the more diverse, are not stable and changes occur over time. Eleven Malassezia species were identified with M. restricta being predominant in the external auditory canal, retroauricular crease and glabella, and M. globosa on back, occiput and inguinal crease. The remaining Malassezia species were detected across other body sites and with lower frequency. Reanalysis of these metagenomic datasets using a more complete set of Malassezia genomes demonstrated the presence of 12 species (out of 17 species currently described). A study investigating asymptomatic individuals in Japan indicated that Malassezia population differed by sex, body part, and season (Akaza et al. 2010). In another study conducted in patients with seborrheic dermatitis in Brazil, different Malassezia subtypes were detected in different proportions in samples (Soares et al. 2015). This may indicate that Malassezia communities can differ at intra-specific level, but can be similar at species level. To date, only a very few studies have been performed about the skin microbiota in companion animals. Cusco et al. (2017) described the structure of bacterial species on the skin of 9 healthy dogs. Their results suggested that the main force driving the variability in microbiota composition was the individual, rather than the breed, hair coat or the skin site. The objectives of the study from Meason-Smith et al. (2015) was to characterize the cutaneous mycobiota is dogs, and to determine whether body sites may influence the distribution of fungal organisms. For that purpose, several body sites, consisting of haired skin, mucosal surfaces and one mucocutaneous junction were sampled in 10 healthy dogs and 8 dogs with diagnosed skin allergies in the USA. This study revealed a much more diverse cutaneous mycobiota than what was previously described with culture-based techniques. The cutaneous mycobiota appeared to be influenced by various factors including environmental exposure, cohabitation with other pets and skin health status. Surprising, Malassezia yeasts were not the most abundant fungal organisms on dog healthy skin whereas sequences corresponding to filamentous contaminants from the environment (Alternaria, Cladosporium and Epicoccum spp.) were predominant. Furthermore, there was no significant difference in the relative abundance of Malassezia yeasts between healthy and allergic dogs. A similar metagenomic analysis was performed in healthy cats and cats diagnosed with one or more cutaneous lesions in the USA (Meason-Smith et al. 2017). The most abundant fungal sequences from the skin of all cats were identified as filamentous contaminants from the environment (Cladosporium and Alternaria spp.) and not Malassezia yeasts. More studies are needed to describe the mycobiome in the healthy skin and the dysbiosis occurring in skin diseases. Malassezia yeasts seem to be key players and their role needs to be better understood.

S6.5b The human skin microbiome: cause or effect? The role of Malassezia in human skin health and disease T. Dawson Agency for Science, Technology, and Research, SINGAPORE, Singapore While the human gut microbiome has realized virtual celebrity status, the skin microbiome remains unexplored, elusive, and poorly understood. Only recently have investigations begun to focus on the skin biome, and these have remained primarily focused on bacteria via 16S sequencing. Very few studies have been inclusive of metagenomic or ITS data sets which move beyond bacteria. Nearly a billion people worldwide are affected by fungal mediated disease, and multiple studies indicate a likely causative role for fungi in common skin disorders such as pityariasis versicolor and seborrheic dermatitis, and a role in exacerbation of many others including chronic wounds, atopic dermatitis, atopic eczema, and psoriasis. However, it remains unclear what role the microbiome would play in maintenance of skin health. We have spent more than 20 years defining the role of fungi in the common scalp disorder seborrheic dermatitis, including definition of the causal species, identification of multiple potential pathogenic mechanisms, and clinical proof of concept validating one specific pathway, lipase mediated induction of inflammation. Recent work in our labs indicates that the most common skin fungi, Malassezia, communicate with the host immune system through specific lipid mediators. Study of the skin microbiome should provide a window into interaction of commensal microbes with the immune system from a more easily accessed compartment (the skin surface) which is also more easily influenced (via topical treatment). However, future detailed work will be required to elucidate the role of and treatment for the skin microbiome in human health and disease. To further these necessary investigations, the Skin Research Institute of Singapore (SRIS) has launched a broad new program to define the relationship between the skin microbiome and skin health, and to develop microbiome-focused interventions in skin health, Acne, and healing of chronic wounds.

S16

Medical Mycology, 2018, Vol. 56, No. S2

S6.5c The overgrowth of Malassezia spp.in canine atopic dermatitis - the reason or the result of disease?

S6.6d Status and Surveillance of Azole Resistance in North America

B. Dworecka-Kaszak, I. Dabrowska, M.J Bieganska, A. Degorski, F.N. Toka WULS, WARSAW, Poland

E. L. Berkow Centers for Disease Control and Prevention, ATLANTA, USA

Objective: Yeasts of the genus Malassezia are well known as the members of normal skin mycobiome in animals or human and usually colonize the skin as in small population. Malassezia pachydermatis is a species for which dogs are a natural host. Both Staphylococcus pseudintermedius and Malassezia pachydermatis microorganisms may colonize a healthy skin if their population size is proper to maintain the skin equilibrium. In dogs with allergic skin disorders the number of M. pachydermatis usually increase dramatically. Atopic dermatitis (AD) is a chronic inflammatory skin disorder that results from interaction between genetic predisposition, host environment, chemical skin abnormalities, barrier and immunological defects. It is hypothesized, that in dogs the atopic dermatitis is a risk factor for M. pachydermatis infection, but in our opinion, on contrary, abundant colonization by these yeasts determine increased reactivity against members of the normal skin microbiota. Many factors which stimulate the atopic dermatitis stimulate also a proliferation of Malassezia and Staphylococcus. The growing bacteria and fungi release a lot of extracellular products which results in itchiness that makes the dog scratch, which further damages the skin, leading to a bigger area of infection. Also Malassezia cell wall components, as in other yeast may have immunomodulating potency and support an inflammation progress. The factors which have influence on skin fatty acid coat composition play also role as an inflammation starter and are correlated with Malassezia skin population. The objective of this work was to provide an update on recent advances in the explanation of the role of Malassezia in acute phase of AD lesions in dogs. Methods: experimentally studies, review data Results: Our studies have shown that administration of Malassezia pachydermatis cell walls increase proliferation of lymphocytes, enhances the respiratory burst and increases the killing potential of immunocompetent cells. The stimulatory effect on lymphocyte culture was comparable to Con A. We conclude that cell wall of M. pachydermatis may have immunomodulating properties, what should be consider in mechanisms of M. pachydermatis infection pathogenesis. The response of the host to the overgrowth of yeast includes non-specific defense mechanisms (phagocytosis by neutrophils) as well as cell-mediated specific defense mechanisms. Langerhans cells presents the antigen which activates T-cells. These T-cells multiply and produce lymphokines that stimulate phagocytosis and multiplication of epidermal basal cells. This leads to their mechanical removal yeast via scaling. Alterations of the cutaneous microclimate or host defense mechanisms allow Malassezia pachydermatis to multiply and realizing their stimulatory effect on immunocompetent cells. Conclusion: The changing of Canine Skin Microbiome in association with leucocytes responses, including the large spectrum of cytokine and non-cytokine factors that appear in Malassezia overgrowth are in our opinion a potential etiological agent of the development of canine AD. Supported by KNOW

With the emergence of drug resistant fungal pathogens comes a threat to the utility of the most commonly used antifungals, such as the triazole drug class. By and large, the most pressing current issues relating to azole resistance in North America involve two fungal pathogens – Aspergillus fumigatus and Candida auris. The environmentally derived TR34 /L98H and TR46 /Y121F/T289A mutations in the azole target gene of Aspergillus fumigatus have recently been identified in isolates from the US. Likewise, the emerging fungal pathogen, Candida auris, has been reported in the US, Canada, and Panama and is novel among Candida in terms of antifungal resistance. This presentation will address both of these organisms, detail the azole resistance for each, discuss existing surveillance efforts for each, and very briefly describe considerations for other relevant fungal species.

S6.5d Characterization of growth of lipid-dependent Malassezia yeast species, members of the skin mycobiome 1 ¨ H. De Cock1 , A. Celis2 , S. Triana2 , H. Wosten Utrecht University, UTRECHT, Netherlands ´ Colombia Universidad de Los Andes, BOGOTA,

1 2

Objective: Malassezia species are lipid-dependent due to the lack of cytosolic fatty acid synthase required for de novo synthesis of fatty acids (FAs) and these yeasts are part of the skin mycobiome. Pathogenicity of Malassezia has been related to several factors including the ability to produce enzymes such as esterases, lipases, lipoxygenases and proteases which enable growth on the host skin and lead to changes in sebum (skin fat) composition. The skin functions in the innate defense against pathogens due to its low water content, acidic pH, its microbiota, and antimicrobial compounds like free fatty acids. Understanding lipid dependency of Malassezia will help to understand how these yeasts establish themselves as part of the skin microbiota, which adaptation mechanisms are involved, and how, and whether, lipid metabolism impacts the shift to pathogenicity. The complex nutritional requirements of Malassezia have delayed the full comprehension of its lipid metabolism. Reconstruction of the lipid-synthesis pathways of Malassezia species in silico predicted amongst others a defect in the assimilation of palmitic acid in M. globosa, M. sympodialis, M. pachydermatis and an atypical isolate of M. furfur, but not in M. furfur. This prediction was validated by physiological characterization in chemically defined media (MM) using different lipid sources. Methods: Growth on FAs in liquid MM: Strains were first grown for 7 days at 33◦ C in lipid-rich mDixon medium. To prevent subsequent growth in MM due to the presence of residual lipids we performed a two-phase growth in MM. First, cells were diluted into MM containing specific lipids. After 3 days, these cells were diluted again in fresh MM with the same lipids. Growth was monitored for 7 days by determining OD600 nm and CFU by plating on mDixon plates. Results: M. furfur could assimilate palmitic acid or oleic acid as well as all Tween variants tested. The atypical M. fufur strain could assimilate only Tween 80, Tween 20, and oleic acid. M. pachydermatis, M. globosa, and M. sympodialis were able to grow in the first step in MM but not in the second step in MM with any of the lipid sources tested. Only M. furfur was able to maintain growth in MM with palmitic acid in the second growth step. Both M. pachydermatis and atypical M. furfur could sustain growth in MM with a mixture of palmitic acid and oleic acid. Conclusion: 1. A new culturing method for Malassezia spp. in chemically defined media was developed. 2. In silico predicted assimilation defects of palmitic acid for Malassezia spp. was confirmed. 3. Palmitic acid is fungicidal for a subset of Malassezia spp. but not for M. furfur. 4. FAs that induce lipid toxicity and do not affect the skin cells and microbiome harmony might have a therapeutic use.

S6.6 Surveillance azole resistance S6.6c First report of azole-resistant Aspergillus fumigatus harboring TR34/L98H and M220R in Brazil L. B Denardi1 , W. J. G. Melchers2 , J. Zoll2 , J. Buil3 , F. Hagen4 , J. F. G. Meis3 , S. H. Alves1 , P. E. Verweij2 1 Federal University of Santa Maria, SANTA MARIA, Brazil 2 Radboud University Medical Centre, NIJMEGEN, Netherlands 3 Radboud University Medical Centre/ Canisius-Wilhelmina Hospital, NIJMEGEN, Netherlands 4 Canisius-Wilhelmina Hospital, NIJMEGEN, Netherlands Objective: Despite the high use of triazole fungicides in Brazilian agriculture, azole-resistant Aspergillus fumigatus has not been documented in Brazil. The objective of this study was to characterize the Cyp51A-gene of two phenotypic resistant A. fumigatus isolates. Methods: One A. fumigatus isolate was cultured from a patient with chronic necrotizing pulmonary aspergillosis (CNPA), following tuberculosis. The patient was treated with itraconazole (ITZ) followed by voriconazole (VCZ) and finally, amphotericin B (AmB). The other resistant isolate was isolated from maize harvested from a crop in southern Brazil by the in-house plating method R Both strains were identified by macro and in surface with Dichloran Rose Bengal Chloramphenicol Medium (DRBC, Himedia). micro morphology, sequencing of ITS1-5.8s-ITS2 region and the ß-tubulin gene. In vitro susceptibility testing was performed using the EUCAST reference methods. To detect resistance mutations full sequencing of the Cyp51A gene and promoter region was performed. Results: R34 /L98H was found in the clinical A. fumigatus isolate and M220R in the environmental isolate. Both strains showed high MICs to ITZ (>16 mg / L); the clinical isolate was resistant to the other medical azoles, while the environmental strain was resistant only to isavuconazole and showed intermediate susceptibility to VCZ (Table 1). Conclusion: This is the first report of azole-resistant A. fumigatus isolates harbouring TR34 /L98H or M220R mutations in Brazil. Although the detection of resistance mechanisms in two strains of A. fumigatus does not represent great concern regarding the general context of azole resistance in Brazil, we believe that our finding underscores the need for resistance surveillance in clinical and environmental isolates to further determine the frequency of resistance. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 420288 98f02d45-7932-497a-bd0a-cc80a989 ecc3.png Caption 1: Table 1. Susceptibility of A. fumigatus isolates harboring azole-related mutations.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

S7.1 Fungal biofilms S7.1a Candida auris and non-albicans biofilms G. Ramage University of Glasgow, GLASGOW, United Kingdom The role of Candida biofilms in human disease has become increasingly recognized over the past 20 years. Much of this work has focused on Candida albicans, where the molecular basis of development and resistance is in an advanced state. However, clinically it is clear that non-albicans species such as C. glabrata, C. tropicalis and C. parapsilosis are capable of exhibiting biofilm characteristics, which also includes the emergent fungal pathogen Candida auris. This presentation will examine the contribution that these non-albicans species play in human disease, the basic and molecular characteristics that drives their biofilm formation, and therapeutic considerations for biofilm management. Our early understanding of C. auris biofilms will also be examined, and how this lifestyle may contribute its persistence in the healthcare environment.

S7.1b Insights into new antibiofilm molecules J. L Lopez-Ribot The University of Texas at San Antonio, SAN ANTONIO, USA Candida albicans is a common opportunistic pathogen and the most frequent causative agent of candidiasis, the main invasive fungal infection in immune- and medically-compromised patients. Candidiasis is often associated with the formation of biofilms, which contribute to virulence and further complicate treatment due to the high level of resistance to conventional antifungal agents. Clearly, new anti-biofilm strategies and therapeutics are urgently needed. Our group has taken a multipronged approach to tackle this problem. First, we have performed large-scale screening of over 50,000 small molecule compounds present in different commercial chemical libraries to identify inhibitors of C. albicans biofilm formation. This resulted in the identification of several leading series of anti-virulence compounds displaying potent in vitro and in vivo activity against C. albicans biofilms. They represent promising candidates for the development of novel antifungal agents, with new molecular structures, as well as new targets and modes of action. Second, unlike the tortuous and costly path of de novo drug discovery, drug repurposing (finding new uses to existing drugs) is gaining traction as an alternative path to accelerated drug development. Thus, we have also embarked in a “repurposing” campaign, in order to identify already existing drugs with activity against fungal biofilms. Third, we have determined the activity of different nanoparticle preparations against C. albicans biofilms, as well as against mixed fungal/bacterial biofilms that are particularly difficult to treat with conventional antimicrobial therapy. Lastly, our group has developed a novel technique consisting of nano-scale culture of microbial biofilms on a microarray platform. Using this technique, hundreds to thousands of microbial biofilms, each with a volume of approximately 30–50 nanolitres, can be simultaneously formed on a standard microscope slide. This new technology platform allows for the implementation of true throughput screening techniques that can speed up discovery of new drugs with anti-biofilm activity. Overall, successful development of these anti-biofilm strategies and therapeutics should have a profound impact on the management of patients suffering from these difficult to treat infections.

S7.1c Fungal-bacterial biofilms: consequences in an intra-abdominal infection model M.C. Noverr Louisiana State University Health Sciences Center, NEW ORLEANS, USA The pleiomorphic fungus Candida albicans (Ca) and the ubiquitous bacterial pathogen Staphylococcus aureus (Sa) are responsible for a myriad of biofilm-mediated human diseases, often co-infecting critically ill or immunocompromised patients. Although many Candida-bacterial interactions are antagonistic, the relationship between C. albicans and S. aureus is mutually beneficial, enabling them to act as co-pathogens. S. aureus preferentially adheres to C. albicans hyphae, and polymicrobial biofilms of both species display enhanced growth, antimicrobial drug resistance, and virulence. To study this polymicrobial interaction further, we established a murine model of intra-abdominal infection (IAI) where co-infection with both species results in 80– 100% mortality within 96 h post-inoculation compared to no mortality from infections with either Ca or Sa alone. Furthermore, co-infection led to formation of biofilm-like polymicrobial structures on the surface of target organs. The polymicrobial-specific host response is characterized by dramatic up-regulation of local and systemic pro-inflammatory cytokines, prostaglandins, and polymorphonuclear infiltrate, all hallmarks of lethal sepsis. We tested several other non-albicans Candida species (NAC) and found that co-infection with the closely related C. dubliniensis (Cd) resulted in 90% survival. The protective response is sustained long term (up to at least 60 days prior to re-challenge) and is broad-spectrum providing protection against similarly lethal C. tropicalis/Sa and C. krusei/Sa IAI. Surprisingly, the Cd-induced protection against lethal IAI is NOT mediated by adaptive immunity, but instead appears to be through a mechanism of trained innate immunity (non-specific memory mediated by innate cells). Preliminary data indicate that the Cd-mediated protective trained innate response is mediated by Gr-1+ myeloid derived suppressor cells (MDSC) that have been reported in human sepsis. These results suggest that low virulence Candida species can induce protection against lethal fungal/bacterial IAI with C. albicans and S. aureus that is mediated by MDSCs as a unique form of trained innate immunity. This provides a unique mechanistic pathway for protective immunity and potentially new avenues for vaccine strategies to protect against intra-abdominal polymicrobial infections resulting in lethal sepsis.

ABSTRACT

S17

S7.1d Deciphering the global transcriptomic profile of Candida glabrata during biofilm and planktonic growth phase

S7.2c Pneumocystis Activation of Innate Immune Responses by Lung Epithelial Cells

K. Raj1 , P. Dhiraj2 , D. Dhiraj2 , S. Yogesh2 , R. Praveen3 , S. Geeta3 1 PANJAB UNIVERSITY, CHANDIGARH, India 2 National Centre for Microbial Resource, PUNE, India 3 Panjab University Chandigarh, CHANDIGARH, India

A.H. Limper Mayo Clinic College of Medicine, ROCHESTER, MN, USA

Objective: Candida glabrata is an emerging threat in ICU settings of hospitals. Being an opportunist pathogen knowledge about its microbial virulence and exact molecular pathogenesis is still not known. Biofilm formation is considered to be a significant mechanism in its pathogenesis but how biofilm growth phase differentially transcribed the gene expression in comparison to planktonic phase is not elucidated. Analysis and evaluation of comparative transcriptomic profiles of C. glabrata in biofilm and planktonic growth phase conditions would be a stride towards the understanding its pathogenesis which may help in unrevealing the key genes responsible for biofilm development and its regulation. Next generation sequencing technologies have advanced the sequence-based research with the advantages of high-throughput, high-sensitivity and high-speed and specially RNA-Sequencing is now being widely used for uncovering multiple facets of transcriptome to facilitate the biological applications. In a present study we made an attempt to determine the whole transcriptomic profile of this pathogen by using RNA seq. Monitoring of biofilm formation and selection of best biofilm forming Candida glabrata isolate on the basis of its biofilm biomass and metabolic activity. Isolation of total RNA from biofilm and planktonic growth phase and its sequencing by Next Generation Sequencing.Mapping, annotation, detection of differentially expressed genes.Gene Ontology and pathways analysis of selected gene associated with biofilm formation.Validation of differentially expressed genes during biofilm and planktonic growth phase Methods: Biofilm formation was carried out in 96 well microtitre plate and subsequently biofilm biomass assay was performed with crystal violet assay. Further metabolic assay was carried out by XTT or tetrazolium salt reduction assay. Morphology and architecture of biofilm formation was assessed by Scanning electron microscopy (SEM), Confocal laser scanning microscopy (CLSM). RNA was extracted from planktonic as well as from biofilms using the Hi-PurA yeast RNA purification kit. Sequencing of RNA was outsourced from Sci-Genome pvt. ltd. Aligning, mapping and assembly of transcripts over reference transcriptome was carried out with the Tuxedo pipeline tool and differentially expressed genes (DEGs) were detected. Data visualization for DEGs was carried out by using R studio tools. Gene ontology and pathways analysis of selected gene associated with biofilm formation of RNA seq data was performed by using open source tool Fungi-Fun-2. Validation of few selected DEGs was carried out in wet lab by qPCR. Results: Clinical strain with NCCPF no 100037 showed best biofilm forming ability and was selected for RNA sequencing. Our bioinformatics analysis showed that 2554 genes differentially expressed during biofilm formation, 1318 genes down regulated and similarly 1236 genes up regulated when compared with planktonic growth phase. Overall analysis from regression curves, volcano curves, heat maps, and pathways analysis of DEGs showed that expression of genes responsible for cell wall formation and other synthetic processes of cell gets down regulated in C. glabrata and whole metabolic pathways gets altered in biofilm formation. Conclusion: The quest of searching the novel anti-fungal targets could be achieved for this inherent azole resistant pathogen by further studying the transcriptomic profile in larger picture.

S7.2 Fungal Interactions with Epithelium Trigger Innate Immune Activation S7.2a Epithelial activation by Candida species J. R. Naglik King’s College London, LONDON, United Kingdom Objective: Candida albicans causes mucosal and life threatening systemic infections that contribute to high morbidity and mortality. C. albicans hyphae damage host tissue by secreting Candidalysin, a peptide toxin that permeabilises epithelial membranes, triggers c-Fos/MKP-1 signalling pathways, and activates epithelial immunity. Analysis of Ece1p amino acid sequences from different Candida species has revealed that additional putative Candidalysin toxins are also present in C. dubliniensis, C. tropicalis and C. maltosa. We compared the different Candidalysins for their ability to cause damage, activate c-Fos/MKP-1 signalling and immune responses in epithelial cells in vitro. Furthermore, we assessed the importance of the C. albicans Candidalysin in mucosal and systemic murine models of infection. Methods: Activation of epithelial signalling pathways was investigated by Western blotting. Immune induction was determined by quantification of secreted cytokines by Luminex. Damage was quantified by lactate dehydrogenase assay. Pathogenicity of Candidalysin-expressing and non-expressing C. albicans strains was assessed in vivo using two mucosal models of oropharyngeal candidiasis and vaginitis, and a systemic intravenous model. Results: In vitro studies demonstrate that the Candidalysins from C. albicans, C. dubliniensis, C. tropicalis and C. maltosa are all capable of damaging epithelial cells, activating c-Fos/MKP-1 signalling pathways, and inducing pro-inflammatory cytokine responses, despite differences in amino acid sequence. In vivo, only Candidalysin-expressing C. albicans strains were able to damage the host or induce pro-inflammatory cytokines and recruitment of neutrophils to the site of infection. Non-expressing C. albicans strains were all attenuated in virulence. Conclusion: We identify the Candidalysins as a conserved family of fungal peptide toxins, provide mechanistic insights into Candidalysin function, and demonstrate a critical role for Candidalysin in mucosal and systemic C. albicans infections.

S7.2 Fungal Interactions with Epithelium Trigger Innate Immune Activation S7.2b The Immunopathogenesis of Candida Vaginitis P.L. Fidel Louisiana State University Health Sciences Center, NEW ORLEANS, USA Considerable attention has been given to understanding the pathogenesis of vulvovaginal candidiasis (VVC) and recurrent VVC (RVVC) over several decades through clinical studies and animal models. Results of numerous studies eventually led to the consensus that susceptibility to VVC/RVVC is not associated with any apparent deficiencies in adaptive immunity, although protective immune mechanisms and the role of innate immunity remained poorly understood. It was not until an innovative clinical live challenge design was conducted in women that a fuller understanding of the natural history of infection/disease was achieved that provided clues to the pathogenesis of VVC. These studies revealed that symptomatic infection is associated with aggressive inflammation concomitant with the recruitment of polymorphonuclear neutrophils (PMNs) into the vaginal lumen. Subsequent studies in the established mouse model demonstrated that infiltrating PMNs were incapable of reducing fungal burden despite an acute inflammatory state. This led to the hypothesis that VVC/RVVC was associated with immunopathology, involving both Candida and the host response as drivers of symptomatic disease. Further studies in mice revealed critical components of the immunopathogenic response, including a requirement for the morphological transition of C. albicans to hyphae, vaginal epithelial cell pattern recognition receptors (PRRs), and pro-inflammatory mediators. However, mechanistic details surrounding PMN dysfunction at the vaginal mucosa remained elusive. Ultimately, by testing mouse strains resistant or susceptible to experimental chronic VVC, it was determined that heparan sulfate (HS) in the vaginal environment is a competitive ligand for Mac-1 on PMNs, thereby prohibiting PMN binding to Candida to initiate killing. Hence, the outcome of symptomatic VVC/RVVC is postulated to be dependent on a Candida-vaginal epithelial cell trigger Hence, the outcome of symptomatic VVC/RVVC is postulated to be dependent on a Candida-vaginal epithelial cell trigger, and subsequent PMN-initiated immunopathogenic response involving HS-mediated PMN dysfunction, that effectively renders the neutrophils in a state of anergy.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Pneumocystis pneumonia (PCP) remains a common cause of morbidity and mortality in patients with immune compromise, particularly in those with AIDS. There are an estimated 400,000 cases of PCP worldwide each year, with mortality ranging from 15 to as high as 80% in resource poor settings. In the absence of effective CD4 cell immunity, the innate immune system assumes a more prominent role in mediating organism clearance as well as initiating inflammatory responses to Pneumocystis. Of interest, pro-inflammatory responses in the absence of effective Pc organism clearance, as frequently occurs in CD4 deficiency, strongly promote lung injury and respiratory failure during PCP. Prior studies of innate immunity have focused largely on the roles of alveolar macrophages and dendritic cells in mediating innate responses to Pneumocystis. Accumulating evidence supports strong activity of Pc cell wall beta-glucans (including beta-1,3 and beta-1.6 glucans) in potently initiating the release of proinflammatory cytokines including TNF-alpha, IL-6 and MIP-2 during infection. Our data further indicate that alveolar epithelial cells (AECs) provide substantial host recognition and innate inflammatory responses to this fungal organism. For instance, we have shown that AECs generate markedly greater MIP-2 chemokine responses compared to alveolar macrophages on a cell-by-cell basis. Hence, the AECs represent a significant innate immune sensing and response source in the lower respiratory tract during PCP. Additional studies demonstrate that the C-Lectin Receptor (CLR) Family of receptors particularly Decin-1 and Mincle working through the common signaling molecule CARD9 plays a central role in innate immune response to Pneumocystis. Specifically, CD4 depleted mice deficient in CARD9 demonstrated marked impairment of Pc clearance, but also exhibit a dramatic reduction in lung inflammation, indicating important roles for the CLR family in innate immune control of infection and in regulation of host inflammatory responses during infection. While resting AECs do not demonstrate significant Dectin-1 or Mincle, these CLRs are inducted during activation with Pneumocystis and Pc cell wall components. In addition, host cell surface lactosylceramide also participates in AEC interactions and activation in response to the Pneumocystis cell wall. Taken together, our studies indicate that interactions of alveolar epithelial cells with Pneumocystis cell wall components represents a significant mechanism of host innate immune response during Pneumocystis pneumonia.

S7.2d Differential gene expression of Aspergillus fumigatus and Aspergillus niger interacting with epithelial lung cells ¨ E.M. Keizer, N. Escobar, I.D. Valdes, S.R. Ordonez, R.A. Ohm, H.A.B. Wosten, H. Cock Utrecht University, UTRECHT, Netherlands Objective: Aspergillus fumigatus is the main causative agent of aspergillosis. Most infections occur in immunocompromised individuals, indicating an efficient clearance of conidia by the pulmonary defence system in immunocompetent individuals. Infections by other aspergilli like Aspergillus niger can occur, but to lesser extent. Previous studies showed that A. fumigatus and A. niger behave differently in the presence of type II alveolar A549 epithelial cells. A. fumigatus is more efficiently internalized by the A549 cells and shows a delay in germination, when compared to A. niger. The hyphae of A. fumigatus, that escaped the epithelial cells grow parallel to the epithelium, while the A. niger hyphae grow away from the epithelial cell layer. This study focusses on the gene expression of A. fumigatus and A. niger after co-cultivation with A549 cells. Our hypothesis is that the difference in lifestyle between the two aspergilli is also observed in the gene expression profiles. Methods: RNA of the co-cultivation of the A549 cells with A. fumigatus or A. niger was isolated and sequenced. The obtained RNA sequences were analysed with custom R and python scripts to obtain the differentially expressed genes and GO terms. Results: The obtained RNA sequences show big differences in the global gene expression of A. fumigatus and A. niger upon contact with A549 cells. A total of 545 and 473 genes for respectively A. fumigatus and A. niger were differently expressed when compared to growth in absence of A549 cells. Of these genes only 53 (∼10%) were shared between both species. The different response was also illustrated by the fact that only 4 GO terms were shared between the differentially expressed genes of both gene sets. Genes described in hypoxia regulation and heat shock were found up-regulated in A. fumigatus and their homologs in A. niger. The A. fumigatus thioredoxin reductase and allergen genes were found up-regulated in this fungus, but homologous genes were down-regulated in A. niger. After co-cultivation with A. fumigatus 62 genes were up and 47 genes were down-regulated in the A549 cells. Co-cultivation with A. niger resulted in 17 up and 34 down-regulated genes. GO term related with the immune response were down-regulated in the A549 cells upon exposure to A. fumigatus, but not in the case of A. niger. This is a strong indication that A. fumigatus reprograms the A549 cells to be immunologically less alert. Conclusion: Our dual transcriptome analysis supports earlier observations of a markedly difference in life style between A. fumigatus and A. niger when grown in presence of type II epithelial lung cells. These results show an important difference in gene expression, amongst others the downregulation of immune response genes in epithelial cells by A. fumigatus and not by A. niger.

S7.3 The Real Pathogens: Ajellomycetaceae S7.3a Emerging Emergomyces africanus in Africa N. P. Govender1 , T.G. Maphanga1 , I.S. Schwartz2 1 National Institute for Communicable Diseases, JOHANNESBURG, South Africa 2 San Antonio Center for Medical Mycology, UT Health San Antonio, SAN ANTONIO, USA Emergomycosis is caused by several fungal species within a newly-described genus, Emergomyces. Evidence of the earliest case of this mycosis (formerly disseminated emmonsiosis) dates back to at least 1992. The recent recognition of these fungi and the disease they cause is attributed to the contemporary use of molecular identification techniques in clinical and research laboratories rather than their sudden emergence as human pathogens. The genus Emergomyces is currently placed within the family Ajellomycetaceae alongside other thermally-dimorphic fungal pathogens such as Histoplasma, Blastomyces, and Paracoccidioides. The largest described burden of emergomycosis is among persons with advanced HIV disease in South Africa, where most cases are attributed to Es. africanus. In fact, emergomycosis is the most commonly-diagnosed endemic mycosis in South Africa. Cases have been diagnosed in six of nine South African provinces, which include (in decreasing frequency) Western Cape, Eastern Cape, Gauteng, Free State, Mpumalanga and KwaZulu-Natal provinces. Emergomycosis has also been reported in a patient from Lesotho. Molecular detection of Es. africanus was demonstrated in 30% of soils sampled from South Africa (mostly from the Western Cape), including from a wide range of soil habitats. However, attempts to culture Es. africanus from soil have thus far been unsuccessful. To date, animal infection with Emergomyces has not been demonstrated. Emergomycosis is typically a disseminated disease of immunocompromised hosts. The most common clinical manifestation – best described for disease caused by Es. africanus - is the appearance of widespread cutaneous lesions, which can include papules, plaques, or ulcerations. There are no commercially available serological or molecular assays developed specifically for emergomycosis. However, an antigen assay developed for Histoplasma capsulatum partially cross-reacts with Es. africanus. Diagnosis of emergomycosis is currently made by detection of the yeast phase from affected tissue during histopathology examination or by isolation of the fungus from appropriate specimens such as skin tissue, blood, bone marrow, respiratory tissue, liver tissue and lymph node tissue. Molecular tools can be used to detect Es. africanus in clinical and environmental samples and for the identification of clinical isolates to species level. While relatively rare, Es. africanus causes a potentially-fatal disseminated mycosis among immunocompromised persons in southern Africa, the only described endemic area for this fungus. Much work remains to be done to understand the full geographic range, ecology, epidemiology and immunopathogenesis of this fungal disease, to understand the full clinical spectrum of disease and to optimise clinical diagnostic and treatment pathways in areas of endemicity.

S18

S7.3b Migration of Coccidioides posadasii into South America BRIDGET M Barker1 , MARCUS M Teixeira1 , GEORGE Thompson2 1 Northern Arizona University, FLAGSTAFF, USA 2 University of California, Davis, DAVIS, USA Objectives: Coccidioides posadasii is a pathogenic fungus that causes coccidioidomycosis in the southwestern United States, Central and South Americas. Our previous work indicates that C. posadasii is comprised of at least three populations; ARIZONA, TEXAS/MEXICO/SOUTH AMERICA (TX/MX/SA) and GUATEMALA. The exact range of C. posadasii and its role on human and animal infections in Central and South America is undetermined: the disease in these countries is sub-notified to local health departments, and fewer than 1,000 total coccidioidomycosis cases across the region have been reported. The Caribbean region is bordered by the Caribbean Sea, and its surrounding continental landscapes and islands may play an important role in the dispersion of C. posadasii across South America through Southeastern Mexico, Honduras, Guatemala and Venezuela. Methods: To better define the genetic distribution and population dynamics of C. posadasii in Central and South America, we de novo sequenced the genomes of 6 Coccidioides sp. clinical isolates from Venezuela, 4 from Argentina, 2 from Mexico as well 1 from Texas and 1 from Florida (USA). We performed phylogenomic and population genomics analysis by incorporating 52 previous deposited genomes from C. posadasii (TX/MX/SA), ARIZONA and GUATEMALA populations to better understand dispersion of this species complex into Central and South America. Results: Comparative phylogenomic analyses of C. posadasii complex reveal that clinical strains from Guatemala and Venezuela are reciprocally genetically isolated from the well described populations ARIZONA and TX/MX/SA. Argentinian isolates form a monophyletic lineage within TX/MX/SA clade and clustered with a previously genotyped strain from Paraguay. Population genomics data indicates that limited gene flow exists between GUATEMALA and ARIZONA populations, whereas complete reproductive isolation from other C. posadasii lineages was observed in the VENEZUELA population. Based on these observations, a new pattern of dispersion of this pathogen complex through Central and South America is proposed. Conclusion: By using comparative genomics and population genetics tools we provide strong evidence that the South American continent was colonized by at least two ancestral populations: TX/MX/SA ancestral genotype, and the second by a GUATEMALA/VENEZUELA ancestral genotype. The isolates from Argentina and Paraguay cluster within the TX/MX/SA clade, whereas the Venezuelan clade shares a common ancestor with the Guatemalan isolates to form the "Caribbean clade." Thus, the data suggest that the Venezuela lineage was purified through migration through Central America to the semi-arid regions of Venezuela, especially in the coastal plains of the Paraguana´ peninsula and the depression valleys of Lara and Falcon states. Future work includes completing sequencing additional genomes from isolates of South American and Mexican origin.

S7.3d Molecular epidemiology of Colombian Histoplasma capsulatum (Hc) isolates showed their polyphyletic behavior and indicated chicken manure as one infection source ´ ´ ˜ 1 , M. Arango Arteaga1 , J.G. McEwen Ochoa1 , A. Zuluaga2 , C.A. Pelaez Jaramillo1 , J.M. Acevedo L. F. Gomez Londono 1 ´ ´ Alzate Ru´ız1 , M.L. Taylor3 , M.P. Jimenez 1 Universidad de Antioquia, MEDELL´IN, Colombia 2 ´ para las investigaciones Biologicas ´ Corporacion (CIB), MEDELL´IN, Colombia 3 Universidad Nacional Autonoma de Mexico, MEXICO DF, Mexico Objective: To establish the genetic characteristics of the Colombian isolates of Histoplasma capsulatum (Hc) from environmental and clinical origin by MultiLocus Sequence Typing (MLST). Methods: There were collected environmental samples from organic fertilizers, cave floors and bird droppings. Environmental samples were evaluating for Hc presence by Hc100 nested PCR. Positive environmental samples were cultivating in Mycosel to obtain the isolate. The MLST proposed by Kasuga (1999/2003), using arf, tub, antiH and ole, was selected to compare Hc The PCR protocols were standardized to our laboratory conditions. Three group of sequences were used for molecular issues: a) DNA were obtained from 3 environmental and 28 clinical Colombian isolates, then MLST was applied. The PCR products were sequenced, and compared with: b) treefile matrix #1063, and c) gene sequences from GenBank. Geneious was used for the sequences analyses: a) to obtain consensus sequences for Colombian isolates; b) to build a matrix using the 3 sources sequences and c) to concatenate the genes; d) The matrix was analyzed using IqTree to stablish the evolutionary model and the relations between isolates by Maximum Likelihood and Ultrabootstrap. The phylogenetic tree obtained was visualized using FigTree. Results: 393 environmental samples were collected from 2010 to 2017. A total of 39(9.9%) environmental samples were positive for Hc100 nested PCR. Microbiological Hc cultures were positive in 1 sample, corresponding to a not-composted chicken manure, from this, 3 colonies were isolated. The standardized conditions for the modified MLST PCR led us amplifying the four genes using a conventional PCR protocol. 212 isolates are represented in the molecular analyses: 31 are new Colombian isolates, 80 from treefile #1063 and 101 from GenBank. The length for each locus was: arf: 465 bp, antiH: 415 bp, tub: 263 bp and ole: 416 bp. The concatenated matrix length was 1559. The evolutionary model was stablishing as K2+G4. The phylogenetic species at the tree were marked with a bootstrap over 70%. There was identified 17 phylogenetic species similarly to the results reported by Kasuga, 2003 and Teixeira, 2016. The Colombian isolates are distributed among the tree in at least 3 clades LAm A, LAm B and Nam 2. Also, the 3 Colombian environmental isolates are grouped together and share the same group with Colombian clinical isolates. Conclusion: The conditions described for the MLST PCR according to Kasugas’s protocol were not reproducible in our laboratory that made necessary to change the conditions to obtain the amplification products. In all distributions obtained by the phylogenetic analysis, the environmental isolates were grouped with the clinical isolates, which showed a genetic homology and these results suggest that the environment, especially the non-composted chicken manure is a potential source of infection with Hc. Additionally, there was observed great genetic heterogeneity among Colombian isolates, which indicates that the Colombian Hc population are polyphyletic like had been suggested in previous studies. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 417876 0486a786-f901-4333-82bb-ccc56d44 cc2c.png Caption 1: Phylogenetic tree obtained from sequences analyses Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 417876 0486a786-f901-4333-82bb-ccc56d44 cc2c.jpg

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Medical Mycology, 2018, Vol. 56, No. S2

S7.4 Why do patients get aspergillosis? S7.4c Defective antifungal immunity in cystic fibrosis A. Warris University of Aberdeen, ABERDEEN, United Kingdom Cystic fibrosis (CF), caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) in epithelial cells is the most common inherited life-limiting disease in North European people and affecting 90,000 people worldwide. Progressive lung damage caused by recurrent infection and persistent inflammation is the major determinant of survival with a median age of death at 29 years. Approximately 50% of CF patients are infected with Aspergillus fumigatus, a ubiquitous environmental fungus, and its presence is associated with accelerated lung function decline. Half of the patients infected with Aspergillus are 75% of the strains analysed). In comparison, identifications provided by the partners were as follows: 100 isolates (64%) were correctly identified up to the species level, 27 were incorrectly identified while 29 could not be identified. In conclusion, MALDI-TOF MS is a powerful, accurate and cost effective method for fungal identification with applications beyond the routine clinical laboratory. References: https://www.ncbi.nlm.nih.gov/pubmed/?term=Cassagne%20C%5BAuthor%5D&cauthor=true&cauthor_uid=22194834. et al., https://www.ncbi.nlm.nih.gov/pubmed/?term = Cassagne+C+2011+Plos+one 2011; 6(12):e28425 https://www.ncbi.nlm.nih.gov/pubmed/?term = Lau%20AF%5BAuthor%5D&cauthor = true&cauthor_uid = 23269728. et al., https://www.ncbi.nlm.nih.gov/pubmed/?term = Lau+AF+clinically+2013 2013; 51(3):828-34. Becker PT. et al., Med Mycol. 2014; 52(8):826-34. https://www.ncbi.nlm.nih.gov/pubmed/?term = L’Ollivier%20C%5BAuthor%5D&cauthor = true&cauthor_uid = 23611419. et al., https://www.ncbi.nlm.nih.gov/pubmed/23611419 2013; 51(7):713-20. Packeu A. et al., J Clin Microbiol. 2014; 52(9):3440-3. Triest D. et al., J Clin Microbiol. 2015; 53(2):465-76. Becker P. et al., Mycoscience, doi 10.1016/j.myc.2014.08.002

S9.4d MALDI -TOF MS based identification of clinically important moulds is faster and reliable- an experience from India A.K. Ghosh, S. Paul, P. Singh, S.M Rudramurthy, A. Chakrabarti PGIMER,Chandigarh, CHANDIGARH, India Objective: Invasive fungal infections (IFI) due to moulds are serious life threatening infections and associated with high morbidity and mortality. Rapid and reliable identification of moulds play an important role in optimizing therapy. Identification of moulds by conventional techniques with several limitations including longer time and molecular DNA based techniques are expensive and labour-intensive. In recent years, matrix-assisted laser desorption ionization time of flight mass spectrometry (MALDI-TOF-MS) based identification has emerged as a rapid and accurate diagnostic technique. Although identification of bacteria and yeasts by MALDI-TOF-MS are routinely used, identification of moulds is still in the process of standardization and face the problem of protein extraction protocol and limited database. We standardized and compared the various protein extraction protocols and added new main spectrum profiles (MSPs) of some rare filamentous fungi including melanized of fungi to the Bruker Biotyper database for identification of clinically important moulds Methods: Four different sample preparation methods were evaluated: Protocol A- direct plate extraction method from solid media growth, B- liquid nitrogen crush to make powder from solid media growth followed by off plate extraction, C- off plate extraction from growth on liquid media and D- similar to protocol C, but adding acid washed glass beads were used with extended vortexing. New main spectrum profiles (MSPs) were added following Bruker protocol. A total of 153 hyaline moulds were used for validation of protein extraction methods and creation of in house database. Fifty nine melanized moulds including 26 different species were used to create an in house database using protein extraction protocol-D followed by validation on of 117 clinical black mould isolates. A comparison was made for MALDI TOF MS based technique vs PCR based technique for identification of melanized moulds to evaluate turnaround time (TAT) and accuracy Results: Among different extraction protocols evaluated, reliable identification with best log score (LS) was achieved through Protocol D, which was used for subsequent experiments. Of 153 hyaline moulds, 123 (80.3%) were accurately identified using existing database and remaining 30 (19.7%) were identified after improvement of database. Among 117 black mould isolates, only 6 (6.7%) were identified by existing Bruker database. However, all the isolates could be accurately identified by newly created in-house database. Compared to MALDI-TOF MS identification TAT of 2–4 days for hyaline and 5–7 days for melanized fungi and PCR based identification took 4–7 days for hyaline and 7–10 days for melanized fungi respectively Conclusion: MALDI-TOF MS can be used for routine identification of clinically important hyaline moulds and melanized fungi with modified Bruker extraction protocol with expansion of existing database. The turnaround time of MALDI-TOF MS is shorter than PCR method

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Humans exhale hundreds of gases, including inorganic compounds (ammonia, nitric oxide, hydrogen sulfide, etc.) and volatile organic compounds (VOCs) arising from their normal/ abnormal body metabolism, exposure to environment and from pathogens (e.g. bacteria, fungi) that live in or on the body. Since Hippocrates times some diseases were recognized by their associated odour. After 1971, the modern breath analysis connected these odours with a specific gas analyte (biomarker) or a profile of VOCs. These compounds are transported by blood around the body and when arrived in the alveoli many of them diffuse easily into to the lungs and hence are exhaled. Pathogens including bacteria, fungi and parasites have also their own metabolism that generates specific VOCs. It has been shown that the onset of disease results in changes in the concentrations of VOCs in exhaled breath, whilst pathogens can produce specific biomarkers that humans don’t. Therefore, direct detection of these exogenous pathogen metabolites in human breath is a novel, powerful and non-invasive tool for identification of the specific pathogen. This approach is particularly welcome in detection of fungal disease, e.g. caused by Aspergillus fumigatus present in the environment and acquired via inhalation by patients with cystic fibrosis (CF). Since polymicrobial infections are common, we assessed whether we could distinguish Pseudomonas aeruginosa and Aspergillus fumigatus mono- and co-cultures using their VOC emissions. Headspace samples of P. aeruginosa, A. fumigatus and co-cultures at 16, 24 and 48 hours after inoculation were collected and the VOCs were identified by thermal desorption combined with gas chromatography – mass spectrometry. Using multivariate analysis by Partial Least Squares Discriminant Analysis (PLS-DA) distinct VOC biomarker combinations for mono- and co-cultures at each sampling time point was found, showing that there is an interaction between the two pathogens, with P. aeruginosa dominating the co-culture at 48 h. The PLS score plots of VOCs in the headspace of P. aeruginosa, A. fumigatus and co-cultures at 16, 24 and 48 hours after inoculation are shown in the figure (points represent experimental samples). Furthermore, time-independent VOC biomarker combinations were also obtained to predict correct identification of P. aeruginosa and A. fumigatus in mono-and co-culture. The VOC combinations in P. aeruginosa and A. fumigatus co-microbial environment are different from those released by these pathogens in mono-culture. The pathogen specific biomarker combinations may help to detect mixed respiratory infections in exhaled breath of cystic fibrosis patients and/or treatment monitoring [1]. Reference: 1. Neerincx et. al., Identification of Pseudomonas aeruginosa and Aspergillus fumigatus mono- and co-cultures based on volatile biomarker combinations, J. Breath Res. (2016) 10: 016002. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISHS/add 1 442157 5afc1d8e-faeb-4ce2-a925-222aa3db6e bd.jpg

S9.5c Detection of Invasive Pulmonary Aspergillosis in Mice Using Lung Perfusion Single-Photon Emission Computed Tomography with 99mTc-MAA M. Tashiro1 , M. Yoshida1 , K. Nishi2 , M. Mishima1 , T. Takazono1 , T. Miyazaki1 , T. Kudo2 , K. Izumikawa1 1 Nagasaki University Graduate School of Biomedical Sciences, NAGASAKI, Japan 2 Atomic Bomb Disease Institute, Nagasaki University, NAGASAKI, Japan Invasive pulmonary aspergillosis (IPA) is an opportunistic fungal infection caused by Aspergillus species. Despite treatment with currently available antifungal agents, the mortality of invasive aspergillosis reportedly remains as high as 30%–100%. Therefore, there is an urgent need for development of better diagnostic strategies to improve the outcomes of this disease. Early and accurate diagnosis of IPA, which is critical for better outcomes, remains a challenge. IPA is an angioinvasive pulmonary infection with characteristics that are different from those of bacterial pneumonia. Recently, a potential role for CT pulmonary angiography has been reported in distinguishing between angioinvasive mold infection and other causes of pulmonary infiltrates, given its ability to detect angioinvasion. Those findings suggested that detection of angioinvasion would be an ideal way of identifying a focus of IPA in a patient’s lungs earlier than would be possible using other clinical indicators. Imaging modalities other than CT pulmonary angiography, such as single-photon emission computed tomography (SPECT), positron emission tomography (PET), and magnetic resonance imaging, can also be used for quantitative imaging of regional pulmonary perfusion. SPECT in particular has several significant advantages. The technique most widely used when measuring pulmonary perfusion by SPECT involves injection of technetium-99m-labeled macroaggregated albumin (99m Tc-MAA). These particles are 10–150 μm in size and become lodged in the pulmonary capillaries at a rate that is proportional to local blood flow. Identification of the number of pulmonary capillaries destroyed by microinvasion of Aspergillus hyphae is necessary to be able to detect IPA in its early stages. Lung perfusion SPECT may be better able to identify IPA in its early stages than other modalities. Further, lung perfusion SPECT is already well established in clinical practice, and is widely available and relatively inexpensive. We hypothesized that lung perfusion SPECT may be more sensitive and specific than chest CT in its ability to detect IPA. We investigated lung perfusion SPECT/CT images of IPA and bacterial pneumonia in a mouse model to confirm our hypothesis. Histopathologic analysis in the IPA mouse model showed a clear match between areas with a perfusion defect and the presence of mold. The sequential changes on perfusion SPECT images were also confirmed on CT images taken at the same times with the same positioning. The same lesions that showed infiltrates on CT images also showed perfusion defects on the SPECT images. These perfusion defects persisted at around day 14 despite disappearance of the infiltrate, indicating the possibility of residual Aspergillus, which would be consistent with the culture results showing some remaining Aspergillus at this time. In some mice, we found abnormal areas with perfusion defects but no infiltrates on the CT images. Some of these perfusion defects appeared on day 1 and infiltrates subsequently appeared on day 5 in the same area. These findings indicate that sites of IPA infection may be detected earlier on SPECT images than on CT images. We also assessed the ability of SPECT perfusion images to distinguish between bacterial pneumonia and IPA. Quantitative analysis confirmed that perfusion in the affected areas was significantly decreased in the IPA model but not in the bacterial pneumonia model. This difference indicates that perfusion SPECT can distinguish IPA from bacterial pneumonia, which show a variety of infiltrates on CT images.

ABSTRACT

S9.5d AsperGenius versus MycoGENIE: Comparison of two Commercial Realtime PCR Assays for detecting Aspergillus fumigatus in respiratory specimens D. H. Schmidt1 , J. Buer1 , P.-M. Rath1 , J. Steinmann2 1 University Hospital Essen, ESSEN, Germany 2 Paracelsus Medical University, NUREMBERG, Germany Objective: Invasive aspergillosis is still associated with a high mortality and morbidity. Early and accurate diagnosis is essential to improve patient outcome. In this study we analysed respiratory specimens obtained from intensive care unit patients (ICU) with two commercial realtime PCR assays (AsperGenius, PathoNostics, The Netherlands; MycoGENIE, ademtech, France) that both can also detect azole resistance markers. Results were compared with culture and sequence analysis of the Cyp51A gene. Methods: The AsperGenius assay (AG) is available in two separate qPCR modules. The first module detects the presents of Aspergillus fumgatus, Aspergillus terreus and Aspergillus spp. Positive samples can further be analysed with the second module that detects the azole resistance markers TR34, L98H and Y121F (runtime about 2.5 h each). The MycoGENIE assay (MG) detects A. fumigatus, TR34 and L98H in parallel in the same run (Runtime less than 2.5 h). Overall 132 respiratory specimens from 108 ICU patients (49% male, age between five months to 90 years, median: 59 years) were analysed. An aliquot of 300 μl of untreated specimen was used for DNA extraction. Extraction was performed on a Maxwell16 extraction platform (Promega, Germany). All PCR assays ran on a Rotor-Gene Q thermal cycler (Qiagen, Germany) in a final volume of 25 μl. Data were analysed according to the recommendations by the manufacturer in the latest versions of the assay manuals. For the AG assay and the MG assay cycle threshold values (ct values) below 38 and 40, respectively, were considered positive. Additionally, DNA isolated from seven azole resistant A. fumigatus isolates with known Cyp51A mutations were tested in both assays. Results: The AG PCR found in 12 samples Aspergillus fumigatus DNA. In contrast, the MG assay was positive in 36 specimens for A. fumigatus. In total, in six respiratory specimens A. fumigatus were detected by culture which is the entry criteria for putative invasive pulmonary aspergillosis in ICU patients according to Blot et al. At the ISHAM conference the PCR performances will be presented according to Blot or EORTC/MSG criteria. For the detection of resistance markers the agreement of each assay compared with sequence analysis from isolates was 100% (7/7). Additionally, both assays were able to detect azole resistance directly in patients´ specimens in two cases which could later be confirmed by sequence analysis of the Cyp51A gene from the corresponding isolate. Conclusion: Both assays were able to detect azole resistance markers with high accuracy. The performance of the PCR assays and the evaluation of the positive results (especially by the MG assay) will be defined at the conference.

S9.7 Cryptococcus-host interactions S9.7a The Hormonal Milieu and its Effects on Virulence of Cryptococcus neoformans T.E. Guess Middle Tennessee State University, MURFREESBORO, USA Objective: Cryptococcus neoformans (C. neoformans), the causal agent of cryptococcal meningitis, is responsible for an estimated quarter million new cases of the disease, resulting in more than 180,000 deaths of each year. Interestingly, the prevalence of this disease is skewed between males and females. Numerous studies show sex-specific differences in C. neoformans infection rates, with males having a higher incidence of disease and death (7:3, m:f). Differences in susceptibility to infections in males and females are not uncommon. However, research on the sexual dimorphism of infections is primarily focused on the different immune responses to these pathogens. Little is known about how the hormonal milieu affects pathogens directly, and up until this point, no research has been done studying C. neoformans and the effect sex hormones have on the pathogen itself and virulence factors that influence disease severity. The aim of this project is to begin to unravel the complexity of gender-specific, host-pathogen interactions by examining the effect of sex hormones on C. neoformans and its virulence factors. We hypothesize that males have an increased incidence of disease due, at least in part, to differences in virulence factors that are specifically expressed in a “male” environment vs. a “female” environment. Methods: There are two major components to this study. First, to establish whether sex hormones are penetrating C. neoformans, we incubated a fluorescently tagged 17β-estradiol with the common lab strain H99S and imaged the results on a confocal microscope. Second, to assess any changes in virulence factors in the presence of sex hormones, we grow C. neoformans clinical isolates in an environment designed to mimic the central nervous system (CNS) and are conducting a series of in vitro biochemical experiments that examine each of the virulence factors individually in the presence of sex hormones. Results: Fluorescent images show that, estrogen, at normal physiological levels seen in females, is taken up by C. neoformans. Further, the results of virulence factor testing indicate significant differences in some virulence factors in the presence of exogenous sex hormones in strains isolated from both males and females. In addition to the primary C. neoformans virulence factors, strains isolated from females exposed to exogenous levels of estrogen showed inhibited growth when also exposed to increased levels of H2 O2 , an osmotic stressor and a condition found inside macrophages. Conclusion: We are the first to show that estrogen has the ability to permeate the C. neoformans capsule and be taken up by the cell. Implications of this may be far-reaching. Additionally, the data from the virulence factor and cell stressor testing suggest that C. neoformans strains behave differently in the presence of male and female sex hormones. This is useful for two reasons: 1. It could aid researchers in understanding the gender gap we see in lethal C. neoformans infections, and 2. This project provides insight on the effect the hormonal environment of its host has on C. neoformans directly, a topic that has not previously been addressed by researchers.

S9.7b The effect of nutrient and temperature stress on the urease of the opportunistic pathogen Cryptococcus neoformans B. Lerm1 , I.S. Schwartz2 , C. Kenyon2 , T. Boekhout3 , A. Botha1 1 Stellenbosch University, CAPE TOWN, South Africa 2 University of Antwerp, ANTWERP, Belgium 3 Westerdijk Fungal Biodiversity Institute, UTRECHT, Netherlands Objective: Urease is a well-known virulence factor of pathogenic cryptococci and has been extensively studied over the past decades. The potential involvement of cryptococcal urease in the fungal cell’s response to stress conditions outside of the human body, however, is yet to be explored. The aim of this study was to determine the effect of nutrient and temperature stress on the enzymatic activity and gene expression of cryptococcal urease. Urease activity of Cryptococcus neoformans H99 and of a clinical strain, C. neoformans CAB 1055, was quantified under different nutrient conditions at 26 and 37◦ C. In addition, real-time quantitative PCR was used to study changes in urease gene expression of C. neoformans H99 as well as the expression of genes involved in cellular responses to nutrient and temperature stress, respectively. Methods: Cryptococcus neoformans H99 and C. neoformans CAB 1055 were cultured in brain-heart infusion broth for 16 h and transferred for 3 h to a nutrient-limited medium supplemented with and without either ammonium chloride or tryptone. Urease activity in crude protein extracts was spectrophotometrically quantified by measuring ammonia production using a phenolhypochlorite assay. To quantify gene expression under the same experimental conditions, SYBR Green real-time quantitative PCR was performed and relative fold differences were calculated based on the comparative Ct (2−Ct ) method. Results: Under all tested nutrient conditions, urease activity at 37◦ C was significantly higher than the corresponding activities at 26◦ C. In addition, relative to gene expression levels in the respective media at 26◦ C, there was a notable increase in the expression of the heat shock proteins, Hsp60 and Hsp70, at 37◦ C. A similar effect was observed under conditions of nutrient stress, where urease activity was found to increase in response to nutrient limitation at both 26 and 37◦ C. Tryptone supplementation significantly decreased urease activity and also resulted in reduced expression levels of the respective genes encoding urease, catalase and superoxide dismutase. Conclusion: In conclusion, decreased urease activity and gene expression in the presence of tryptone, but not ammonium chloride, suggests that cryptococcal urease is downregulated by the presence of more complex nitrogen sources, rather than ammonium, occurring in the environment. In addition, the notable levels of urease activity obtained at 37◦ C in a nutrient-limited medium without a nitrogen source, indicates that urease regulation is more complex than a mere response to the type of available nitrogen source. These findings, together with the enhanced expression of stress-related genes, provide evidence that the urease enzyme of C. neoformans may be associated with cellular responses to nutrient and temperature stress.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

S27

S9.7c Titan cell production reshapes Cryptococcus neoformans cell surface composition in order to modulate and/or evade the host immune system L. Mukaremera1 , K.K Lee2 , N.A.R. Gow3 , K. Nielsen1 University of Minnesota, MINNEAPOLIS, USA University of Aberdeen, Scotland (UK), ABERDEEN, USA 3 University of Aberdeen - Scotland, ABERDEEN, United Kingdom 1

2

Objective: Cryptococcus neoformans is a human fungal pathogen that often causes infections in immunocompromised individuals. Upon inhalation into the lungs C. neoformans differentiates into cells with altered size and morphology, including production of large titan cells. Previous studies revealed that titan cells possess thickened cell wall and dense, cross-linked capsule when compared to in vitro grown cells. However, the exact composition of either titan or typical cell wall and capsule composition is not known. The aims of this study were (a) to examine the cell wall and capsule carbohydrate composition of in vivo and in vitro C. neoformans cells, and (b) to analyze how changes in cell wall and capsule composition affect the host immune response to C. neoformans. Methods: Cell walls and capsule components were extracted from in vitro, in vivo titan and in vivo typical C. neoformans cells and analyzed by HPLC to determine their carbohydrate content. The immune response to C. neoformans was studied both in murine models and human ex vivo antigen stimulation assays. Results: The monomer composition of cell wall polysaccharides showed that in vivo C. neoformans cells contained more glucosamine, and less glucose than in vitro cells suggesting alteration in abundance of both chitin and glucans, respectively. Within the in vivo cell population, differences in the proportions of cell wall and capsule monomers between typical and titan cells were also observed. Morphology changes as well as cell surface changes were associated with differential cytokine responses to C. neoformans cells both in humans and a murine model of cryptococcosis. Conclusion: Our results demonstrate that C. neoformans reshapes its cell wall and capsule composition during infection. These cell wall and capsule alterations likely help C. neoformans escape recognition by, and allow modulation of, the host immune system.

S9.7d Macrophage immune modulation by Secreted Molecules from Cryptococcus neoformans during infection 1 ¨ , C.L.F Marina2 , R.C. May1 , A.L. Bocca2 , A.H. Tavares2 P. H. Burgel 1 University of Birmingham, BIRMINGHAM, United Kingdom 2 University of Brasilia, BRASILIA, Brazil

Objective: Cryptococcus neoformans is a pathogenic fungus responsible for causing cryptococcal meningitis, a lethal infection that affects mostly immunocompromised patients. This yeast expresses a wide range of virulence factors, which suppress the host immune response. Macrophages are considered an important cell in the initial response to infection, although they are susceptible to negative modulation by the fungus, creating a harmless intracellular environment for cryptococcal growth. Strategies utilized by macrophages to prevent this scenario includes pyroptosis (a rapid highly inflammatory cell death) and vomocytosis (the expulsion of the pathogen from the intracellular environment without lysis). In previous studies carried out by our group, it was reported that small molecules secreted freely by the fungal strain B3501 (CM35) possessed immunosuppressive properties, specifically inhibiting the inflammasome. Our main objective was to investigate how the suppression of an important pro-inflammatory pathway could impact the outcome of in vitro infections with C. neoformans. Methods: To evaluate the capacity of secreted molecules by C. neoformans to interfere in fungal clearance by macrophages in vitro, an assay utilizing transwell inserts was designed. In the lower chamber, macrophages were harvested and infected with the wild-type strain B3501, the acapsular mutant CAP67 or left uninfected. Meanwhile, macrophages were seeded in the upper chamber and left uninfected. After the initial infection, macrophages in the upper chamber were infected with the highly virulent strain H99. All the chambers passed through a wash process after 3 hours of infection, to remove extracellular yeasts. After, the macrophages in the upper chamber were lysed and the intracellular yeasts obtained were plated for CFU determination. To evaluate a possible interference of the secreted molecules in vomocytosis events, macrophages were infected with calcofluor white labelled H99 and treated or not with CM35. At four time points the supernatant and lysed fraction of the interaction were collected and the labelled yeast analysed through flow cytometry. Results: The results obtained in the transwell assay showed differences between the groups. While the ones containing uninfected macrophages, or macrophages infected with the mutant in the lower chamber, exhibited the same intracellular burden in the upper chamber, in comparison the group infected with the strain B3501 in the lower chamber showed a much higher intracellular burden in the upper chamber. This indicates that the products of the infection in the lower chamber (including secreted molecules by C. neoformans) in this group are capable of interfering with adjacent macrophages undergoing infection. The results from the flow cytometry showed that vomocytosis events are enhanced in the presence of CM35, particularly after 12 hours of infection. Conclusion: The results obtained corroborate our previous results, showing that CM35 is capable of inhibiting fungicidal functions in macrophages, contributing to fungal survival in vitro. This work shows that molecules secreted from C. neoformans have significant impact in the outcome of in vitro infection in macrophages, indicating an important role during cryptococcal infections in the host.

S9.7e The impact of extracellular vesicles on Cryptococcus neoformans transmigration across brain endothelial cells V. K.A. Silva1 , J. Rizzo2 , J. Rodrigues3 , D. Adesse4 , R.C. May5 , M.L. Rodrigues6 1 Resultados da pesquisa Institute of Microbiology and Infection - University of B, BIRMINGHAM, United Kingdom 2 Departamento de Bioqu´ımica, Instituto de Qu´ımica, Universidade Federal do Rio de, RIO DE JANEIRO, Brazil 3 ´ Instituto de Microbiologia Professor Paulo de Goes, Universidade Federal do Rio, RIO DE JANEIRO, Brazil 4 ´ Laboratorio de Biologia Estrutural, Instituto Oswaldo Cruz, FIOCRUZ, RIO DE JANEIRO, Brazil 5 Institute of Microbiology and Infection - University of B, BIRMINGHAM, United Kingdom 6 Instituto Carlos Chagas, FIOCRUZ, CURITIBA, Brazil Objective: The blood-brain barrier protects the central nervous system (CNS) by restricting the passage of molecules and microorganisms. However, Cryptococcus neoformans has mechanisms to invade the brain and causes meningitis. Once it reaches the CNS, cryptococcosis is highly lethal, killing more than 80% of the infected patients. Only a few mechanisms used by C. neoformans to invade the brain are known. Unconventional mechanisms of secretion and EV release are essential for the virulence of C. neoformans. However, the impact of unconventional secretion on blood-brain barrier transmigration is still very limited. We aimed to understand how molecules exported by this fungus can influence its transmigration through the blood-brain barrier and reach the brain. Thus, we investigated if the extracellular vesicles released by C. neoformans could impact on the fungus transmigration. Methods: To perform the transmigration assay in vitro, immortalized endothelial cells from mouse cerebral cortex (bEnd.3) were grown on transwell systems until confluent. The integrity of the cell monolayer was analysed by transendothelial electrical resistance (TEER). Extracellular vesicles (EVs) were purified after successive steps of centrifugation and filtration. The endothelial cell monolayers were infected with C. neoformans in the presence of EVs. Alternatively, the monolayers were pre-incubated with EVs for 1 h and then infected with C. neoformans cells. After 24 h of incubation, aliquots of the lower chamber (brain side) were inoculated on YPD agar plates for quantification of fungal loads. After 48 h of incubation, the number of colony-forming units was determined. The monolayer integrity was evaluated by its permeability to dextran (70 kDa), using cytochalasin D (inhibitor of polymerization of actin filaments as a positive control). Results: The transmigration of C. neoformans cells were significantly impaired when the EVs and fungal cells were simultaneously added to cellular monolayers. However, when the endothelial cells were pre-incubated with EVs, the transmigration of C. neoformans cells was significantly higher. In all systems tested, the permeability of the monolayer was not affected. Conclusion: Studies that address how yeast cells interact with cerebral microvascular endothelial cells and transpose the blood-brain barrier are essential for the development of strategies to prevent CNS infection. In this context, the fungal secretory system plays an important role in the virulence of C. neoformans, implying that vesicular secretion stages may be attractive targets for therapeutic intervention.

S28

S9.7f Pathogenesis of clinical and environmental isolates of Cryptococcus neoformans and Cryptococcus gattii in human brain microvascular endothelial cells:A comparative analysis S. Lahiri Mukhopadhyay1 , A. Banerjee2 , S. Bhutda2 , N. Chandrashekar1 , V. H. Bahubali1 1 National Institute of Mental Health & Neuro Sciences, BANGALORE, India 2 Indian Institute of Technology, MUMBAI, India Objective: Central nervous system infection by Cryptococcus neoformans/gattii sp complex is one of the deadliest opportunistic infections worldwide which results due to inhalation of the environmental yeast-propagules. This study aims to investigate the brain invasion and survival rate of cryptococcal isolates from both clinical and environmental sources to human brain microvascular endothelial cell (hBMEC) line. It concentrates on comparing the relative changes in the expression of most common virulent genes among the isolates while infecting hBMEC. Methods: HBMEC were grown in confluency on rat tail collagen-coated tissue culture plates in RPMI1640 medium supplemented with fetal bovine serum and Nu-Serum. For invasion and survival assay, 1 × 106 cells from 48 hrs grown cultures of six clinical, four environmental and four standard strains (VNI,VNII,VGI,VGIV) of cryptococci were infected to hBMEC monolayer. Invasion and survival were documented at 3, 12 and 24 hrs of time intervals by lysis of hBMEC and subsequent colony count of internalized cryptococci. In another experiment, using the same set of samples (except VGI isolates) post-infection RNA extraction was performed for the internalized yeast cells. Total RNA from 48 hrs grown cultures of the cryptococcal samples were used as controls representing 0 hrs of infection. RNA samples were converted to cDNA and quantitative Real-time PCR was performed for the genes encoding for virulence factors (CAP10, PLB1, ENA1, URE1, LAC1, MATα) of cryptococci. Relative quantification was calculated using Ct values for the two time-intervals (0-3 hrs and 3–12 hrs). Results were analyzed statistically. Results: Invasion and survival rate was significant and similar among C.neoformans clinical, environmental and standard strains. Although invasion rate was considerable, the C.gattii isolates exhibited diminished survival rate in hBMEC. The rate of survival was lowest among C.g VGI samples. Environmental isolates of C.g (VGIV) showed similar invasion and survival rate as clinical isolates. Statistically significant differences were observed among the clinical and environmental isolates in the expression of CAP10, ENA1, LAC1, MATα and URE1 at 0–3 hrs interval, whereas no difference was there for PLB1 by Kruskal Wallis Test. There were significant differences observed in the expression level of ENA1, LAC1 and PLB1 at 3–12 hrs, whereas absent for URE1, CAP10, and MATα. When the two time-points were considered, the P value obtained by Wilcoxon signed-rank test for the environmental isolates were insignificant (P = 0.063) for the expression fold-changes from 3–12hr, but significant (P = 0.043) for the clinical isolates. Conclusion: This study explains that the lesser frequency of C.gattii infection than C.neoformans is possibly due to its lower survival rate in hBMEC. Isolates from both the sources are capable to invade and survive in the blood-brain-barrier. There were certain differences in the expression levels of the virulent genes of the isolates. Clinical isolates exhibited higher expression in the majority of the virulent genes in 0–3 hrs than environmental isolates whereas the later express fold changes in expressing essential virulent genes in 3–12 hrs time interval. The results suggest, probably exposure to the host system leads to alterations in the clinical isolates, which help to evolve them as more virulent and potent in establishing infection in the brain. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 422358 33022edf-c564-42ee-95dc-62f9d03fe 8b2.jpg Caption 1: Human Brain Microvascular cells pre & post infection

S9.7g Mismatch repair of DNA replication errors contributes to microevolution and the emergence of resistance to antifungal drugs in Cryptococcus neoformans K. J. Boyce1 , Y. Wang2 , S. Verma3 , V. Shakya3 , C. Xue2 , A. Idnurm4 1 RMIT University, MELBOURNE, Australia 2 Rutgers University, NEWARK, USA 3 University of Utah, SALT LAKE CITY, USA 4 The Univeristy of Melbourne, MELBOURNE, Australia Objective: The evolutionary success of pathogenic microorganisms is determined by their ability to deal with environmental stress and rapidly adapt to the changing conditions experienced within the host. Adaptation occurs as a result of a mutation which generates a phenotypic trait which aids the organism in surviving within it’s environment. Subsequently, natural selection ensues the small proportion of cells possessing this mutation become predominant in the population in a short time frame in a process termed microevolution. The mutations on which selection can act arise from environmental damage or errors occurring during DNA replication. Mutations can be pre-existing in the microbe’s genome, or can be rapidly acquired in response to the host environment in a process termed adaptive evolution. Adaptive evolution is greatly enhanced by an increased mutation rate, which provides higher genetic diversity within a population on which selection can act. Strains which exhibit an elevated mutation rate, often 100-200-fold that of wildtype, are termed mutators. A mutator phenotype is advantageous in rapidly changing environmental or stressful conditions. The objective of this study was to ascertain if mutators existed within environmental and clinical populations of Cryptococcus neoformans and to investigate the role mutation rate plays in microevolution and the emergence of resistance to antifungal drugs. Methods: The mutation rates of a collection of environmental and clinical Cryptococcus neoformans isolates was determined. Whole genome analysis was performed on two clinical isolates exhibiting an increased mutation rate (i.e. a mutator phenotype). Gene deletion strains of mismatch repair pathway genes MSH2, MLH1 and PMS1 were generated and characterized to assess the role of mismatch DNA repair in microevolution. Results: Comparison of environmental versus clinical Cryptococcus neoformans isolates revealed a correlation between clinical origin and a mutator phenotype. Whole genome analysis of two mutator strains revealed mutations in MSH2 of the mismatch repair pathway which corrects errors arising during DNA replication. Gene deletion strains of mismatch repair pathway genes MSH2, MLH1 and PMS1 result in approximately 200-fold increase in mutation rate compared to wild type. An increased mutation rate enables rapid microevolution to occur in these strains, generating phenotypic variation in traits associated with the ability to grow in vivo, in addition to allowing the rapid generation of resistance to antifungal drugs. Conclusion: These findings provide support for the hypothesis that this pathogenic fungus can take advantage of a mutator phenotype in order to cause disease, but only in specific pathways that lead to such a trait without a significant trade off in fitness.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Medical Mycology, 2018, Vol. 56, No. S2

S9.7h Non-lytic exocytosis of Brazilian Cryptococcus neoformans clinical isolates from macrophages ˜ 1 , H. R Sousa1 , C. P Rosa2 , J. Lucas Junior3 , W. Freitas1 , G.P. Oliveira Junior1 , K.M. Gorgonha1 , A.F. da Silveira1 , S. Frazao A.F. Correia4 , L. Trilles5 , M. Lazera5 , M.S. Felipe2 , V.L. Pinto Jr3 , I. Silva-Pereira1 , P. Albuquerque6 , A.M. Nicola1 1 University of Brasilia, BRAS´ILIA, Brazil 2 ´ Universidade Catolica de Brasilia, BRAS´ILIA, Brazil 3 FIOCRUZ-DF, BRASILIA, Brazil 4 ´ Lacen-DF, BRASILIA, Brazil 5 FIOCRUZ-RJ, RIO DE JANEIRO, Brazil 6 ˆ University of Bras´ılia, Faculty of Ceilandia, BRAS´ILIA, Brazil Objective: Macrophages are the most important effector cells in immunity to Cryptococcus spp., but they are also a niche in which these facultative intracellular pathogens may live in the host. One of the most intriguing aspects of the macrophageCryptococcus interaction is non-lytic exocytosis, an event in which ingested fungal cells are expelled from macrophages without killing either the host cell or the fungi. There is some evidence that this process is to some extent controlled by the pathogen, but the molecular mechanism is not known. Our group is undertaking a large effort to quantify multiple virulence and host-pathogen interaction phenotypes in a set of Brazilian Cryptococcus spp. clinical isolates, including the rates of non-lytic exocytosis of each isolate from infected macrophages. The objective of the present work is to measure rates of non-lytic fungal expulsion to gain insight into the mechanism through which C. neoformans cells could influence non-lytic exocytosis. Methods: Non-lytic exocytosis was measured using time-lapse videomicroscopy. Briefly, J774 cells adhered to glass-bottom culture chambers were infected with each of seven clinical isolates individually; two laboratory strains (H99, C. neoformans serotype A and B3501, C. neoformans serotype D) were also used as controls. The chambers were then incubated in an inverted microscope in which temperature and CO2 were maintained at 37◦ C and 5%, respectively. Images were collected every four minutes for 24 hours, and the resulting images analyzed with the Zeiss ZEN software. One hundred macrophages with internalized C. neoformans cells were evaluated for each isolate/strain in order to quantify the outcomes of the interaction. Results: We observed both partial and complete non-lytic exocytosis events in macrophages infected with all of the nine isolates/strains. The percentage of macrophages that expelled fungi varied from 14% to 74%. The rates were higher for laboratory strains than for clinical isolates. For the two strains and a single clinical isolate, the non-lytic exocytosis events were homogeneously distributed through the entire 24 h observation period. All other isolates were expelled after a lag phase that lasted up to 12 h. Conclusion: These results show that the kinetics of non-lytic exocytosis varies widely between different fungi. Thorough studies into characteristics of each of these isolates could thus lead to the molecular mechanisms by which fungi modulate non-lytic exocytosis.

S10.1 The technical revolutions ahead of us NGS, proteomics, Crispr-cas S10.1a Genomic epidemiology of Candida auris within the United Kingdom, and the future of whole genome sequencing typing J. Rhodes1 , S. Argimon2 , N.A. Chow3 , K.A. Etienne3 , A.M. Borman4 , A.P. Litvintseva3 , S.P. Lockhart3 , C.A. Cuomo5 , E.M. Johnson4 , S Schelenz1 , D Armstrong-James1 , D.M. Aanensen1 , M.C. Fisher1 1 Imperial College London, LONDON, United Kingdom 2 Wellcome Trust Sanger Institute, CAMBRIDGE, United Kingdom 3 Centers for Disease Control, ATLANTA, USA 4 Public Health England, BRISTOL, United Kingdom 5 Broad Institute, BOSTON, USA Objective: To evaluate the genetic epidemiology of the recently emerged fungal pathogen Candida auris within the United Kingdom, and to assess the feasibility of a whole genome sequence typing (WGST) approach in outbreak scenarios. Methods: A total of 46 unique clinical C. auris isolates from 39 patients in six healthcare centres around the UK were obtained between 2013 and 2016, and subjected to whole genome sequencing (WGS); these sequences were investigated for known alterations conferring drug resistance in ERG11, FKS1 and FUR1. These data were also used to populate a WGST (‘fungalWGST’) scheme, a web-based molecular epidemiology surveillance tool to visualise genomic data in a spatially-scalable format and identify transmission events. Results: Of the 36 isolates subjected to antifungal susceptibility testing, all displayed reduced susceptibility to the frontline drug fluconazole. Phylodynamic analyses revealed 63% (n = 29) of isolates had an Indian or Pakistani geographical origin, with the remaining isolates originating from South Africa (n = 16) or Japan (n = 1). A web service for species and taxonomy prediction, ‘fungalWGST’, has been developed using these data to provide interactive visualisation of metadata. Conclusion: Phylodynamic analyses suggest multiple introductions of C. auris to the UK, and clonal expansion within healthcare centres, with isolates separated by 16 mg/L to 0.5 mg/L) but had no effect on posaconazole resistance (MIC >16 mg/L), indicating the presence of an additional resistance mechanism. Additionally, recreating 167∗ in an uncharacterized protein increased resistance to itraconazole (MIC 1 mg/L to 4 mg/L) and voriconazole (MIC 1 mg/L to 2 mg/L), but had no effect on posaconazole susceptibility (MIC 0.25 mg/L). Unexpectedly, this transformant possessed a 50% enhanced mycelial growth rate. Conclusion: Here we show a modified CRISPR/Cas9 method that can be used for creating SNPs in clinical A. fumigatus strains. Our findings provide further insight into the complex process of in-host adaptation.

S10.2 ISHAM Working Group: Fungal PCR Initiative S10.2a The FPCRI past, present and future R.A. Barnes Cardiff University School of Medicine, CARDIFF, United Kingdom The European Aspergillus PCR initiative (EAPCRI) was formed in 2006 with the aim of standardising Aspergillus PCR methodology in order to determine accurate analytical performance and clinical validity (http://www.eapcri.eu). The EAPCRI has made significant advances in standardising Aspergillus PCR testing of EDTA-whole blood, serum, plasma and bronchoalveolar lavage fluid. In doing so, it has permitted its incorporation into revised guidelines for defining invasive fungal disease (IFD). Work is ongoing to develop an International Standard for Aspergillus PCR and establish a system for quality assurance and control. Following the success of the EAPCRI, the ISHAM Working Group was rebranded as the “Fungal PCR Initiative” (FPCRI). This much expanded group is attempting to repeat the process for Candida, Pneumocystis, Mucor PCR in blood, and other specimens, as well as tissue PCR. As was done for Aspergillus, separate Laboratory Working Parties for each of these activities are developing testing panels to develop methodologies and protocols for setting the standard for each of the relevant PCR techniques. Meanwhile, the Clinical & Translational Working Party is focussing on meta-analyses and systematic reviews for the screening and diagnosis of Candida, Pneumocystis and Mucor and identifying the unmet research needs. The ultimate goal is to improve the diagnosis and subsequent management of patients at risk of IFD.

S10.2d QPCR detection of Mucorales DNA in bronchoalveolar lavage fluid for pulmonary mucormycosis diagnosis L. Millon1 , E. Scherer1 , X. Iriart2 , A.P. Bellanger2 , D. Dupont3 , J. Guitard4 , F. Gabriel1 , S. Cassaing1 , E. Charpentier5 , M. Cornet5 , F. Botterel6 , S. Rocchi1 , A. Berceanu1 1 Centre Hospitalier Universitaire, BESANC¸ON, France 2 Centre hospitalier universitaire, TOULOUSE, France 3 Hospices Civils de Lyon, LYON, France 4 ˆ AP-HP, Hopital Saint-Antoine, PARIS, France 5 Centre hospitalier Universitaire, TOULOUSE, France 6 CHU Henri Mondor, CRETEIL, France Objective: Early diagnosis and treatment are essential to improving the outcome of mucormycosis The aim of this retrospective study was to assess the contribution of quantitative PCR detection of Mucorales DNA in bronchoalveolar lavage fluids for early diagnosis of pulmonary mucormycosis. Methods: Bronchoalveolar lavage fluids (n = 450) from 374 patients with pneumonia and immunosuppressive conditions were analyzed using a combination of 3 quantitative PCR assays targeting the main genera involved in mucormycosis in France (Rhizomucor, Mucor/Rhizopus, Lichtheimia) as previously described (Millon, Clin Microbiol Infect, 2016).Demographics, underlying conditions, diagnostic tools, EORTC classification, first-line antifungal therapy and outcome at day 90 were recorded for all the patients with positive BAL MucPCR. Mucorales PCR was also performed using the same techniques on available sera sampled around the date of the first positive BAL MucPCR (between D-10 and D+10). Results: Among these 374 patients, 24 had at least one bronchoalveolar lavage with a positive PCR. 23/24 patients had radiological criteria for invasive fungal infections according to consensual criteria (10 patients with probable or proven mucormycosis, and 13 additional patients with other invasive fungal infections (4 probable aspergillosis, 1 proven fusariosis, and 8 possible invasive fungal infections). Only 2/24 patients with a positive PCR on bronchoalveolar lavage had a positive Mucorales culture. Aspergillus/Mucorales mixed infections were detected using qPCR in 6/24 patients (25%) D0 was the date of the first positive PCR on bronchoalveolar lavage. PCR was also positive on serum sampled between D-10 and D+10 in 17/24 patients. In most cases, PCR was first detected positive on sera (15/17). However, a positive PCR on bronchoalveolar lavage was the earliest and/or the only biological test revealing mucormycosis in 4 patients with a final diagnosis of probable or proven mucormycosis, 3 patients with probable aspergillosis and one patient with a possible invasive fungal infection. Conclusion: Mucorales PCR performed on bronchoalveolar lavage could provide additional arguments for early diagnosis of mucormycosis and early initiation of specific antifungal therapy; the earlier detection of mixed infections is also crucial to initiating specific antifungal therapy promptly. This tool should be included in the diagnostic approach of pulmonary IFI to improve the outcome of lung mucormycosis

S10.3 ISHAM-EFISG symposium: From non-responder to fungal breakthrough infections by opportunistic yeasts and molds S10.3b Current epidemiological trends: from prevalence to risk factors A. Alastruey-Izquierdo Instituto de Salud Carlos III, MAJADAHONDA, Spain Fungal infections have been rising in the last decades due to the increasing population at risk. Prevalence of different species varies across studies and regions. Epidemiological changes in fungal infections comes form both sides, the host that is more susceptible to some infections than others and the pathogen that is more frequent in some regions than in others. Thus, patients with lung cavities formed after TB can be colonized and infected by Aspergillus causing Chronic Pulmonary Aspergillosis, while Cryptococcus causes meningitis in HIV patients. On the other side epidemiological studies reveal clear regional differences, thus Candida glabrata is the second most frequent species of Candida in North America and northern Europe, while Candida parapsilosis is the second cause of candidemia in South America and Southern Europe and Candida tropicalis is the second leading Candida in Middle east and South East Asia. In addition breakthrough infections caused by resistant species or resistant isolates is also a matter of concern. Emerging pathogens such as Candida auris is recently changing the landscape of fungal infections as well as new therapeutic strategies like biological treatments that is producing new host prone to opportunistic infections

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

S29

S10.3d Breakthrough fungal infections in solid organ transplant (SOT) recipients receiving prophylaxis with isavuconazole and other antifungal agents M. H. Nguyen1 , R.M. Marini2 , R.M. Rivosecchi1 , L. Clarke1 , R.K. Shields2 , C.J. Clancy3 1 UPMC Presbyterian, PITTSBURGH, USA Presbyterian Hospital, PITTSBURGH, USA 3 VA of Pittsburgh, PITTSBURGH, USA 2

Objective: SOT recipients are at risk for invasive fungal infections (IFIs). Several antifungal agents are available for prophylaxis. However, the preferred agent is unclear. In 2015, a cluster of mucormycosis among SOT recipients at our center prompted a switch from voriconazole (VOR) or fluconazole (FLU) to isavuconazole (ISA) prophylaxis. Our objective was to describe rates of breakthrough fungal infections (BFIs) and adverse drug reactions (ADRs) in heart and liver transplant recipients (HTR, LTR) receiving prophylaxis. Methods: This was a retrospective study of high risk for IFI in HTR and LTR who received azole prophylaxis. LTR high risk was defined as receipt of renal replacement therapy (RRT), need for surgical re-exploration, fulminant hepatic failure as a cause of transplant, re-transplantation, or massive blood loss during transplant. HTR high risk was defined as receipt of RRT, need for surgical re-exploration or prolonged open chest. A positive culture for fungus was required for the case definition. Results: 38 HTR and 1139 LTR high risk for IFI received antifungal prophylaxis. Equal percentages (50%, 19/38) of HTR received ISA and VOR. BFI occurred in 5% (1) and 16% (3) of HRT receiving ISA and VOR, respectively. BFI on ISA was caused by Candida fermentati xxxx. BFIs on VOR were caused by MucoralesRhizomucor spp., C. glabrata and C. parapsilosis., C. xxx, C. xx, etc. 74% (14) of HTR receiving ISA and 42% (8) VOR completed the intended course of prophylaxis (P = 0.09); 16% (3) and 26% (5) discontinued due to ADRs, respectively. 33% (37/113) of LTR received ISA and 67% (76) VOR/FLU. BFI occurred in 3% (1) and 5% (4) of LTR, respectively. Give species for each regimen hereBFIs were caused by C. tropicalis in ISA group and by C. glabrata and C. albicans in VOR/FLU group. 84% (31) LTR receiving ISA and 66% (50) VOR/FLU completed the intended course of prophylaxis (P = 0.049); 3% (1) and 12% (9) discontinued due to ADR, respectively. Overall, azole resistance was not documented among tested Candida spp. causing BFIswer. Elevated liver enzymes and altered mental status were most common reasons for azole discontinuation. causing BFIs. Conclusion: ISA was as effective as VOR/FLU in preventing IFIs among HTR and LTR at our center. ISA was better tolerated than VOR/FLU in both groups, with fewer early discontinuations and ADRs. In general, ISA and VOR/FLU prophylaxis failures were not associated with resistance, suggesting that pharmacokinetic factors in patients or at tissue sites of infection may have contributed to BFIs. Studies are needed to validate these findings, and to determine BFI rates in other SOT populations.

S10.4 Ecology and outbreaks S10.4b Phylogenetic genome-level trees, population genetics and species delineation in dimorphic fungi: Does it help us understand infection? M.M. Teixeira, B.M. Barker Northern Arizona University, FLASGSTAFF, USA Objectives: Molecular epidemiology of mycosis focuses on the contribution of potential genetic and environmental risk factors, identified at the DNA level, to the etiology, dynamics, and determinants of fungal infection in human populations. Deep systemic mycosis caused by the dimorphic genus Histoplasma, Paracoccidioides and Coccidioides (HPC) provoke varied disease types ranging from mild-pulmonary to disseminated and fatal in both immunocompetent and immunocompromised people worldwide, especially in the American continents. With the advances in molecular biology, problems in taxonomy and diagnostics of shared or too few morphological characters, non-corresponding characters among asexual and sexual fungal taxa and convergent morphologies were overcome with DNA sequencing. In the last decade, high-throughput sequencing technologies have dramatically dropped the sequencing cost per-base. Thus, coupled with high genetic resolution, we can deeply investigate genetic variation of fungal pathogens at a population level, as well as provide powerful tools for molecular epidemiology and diagnostic methods. By using high-throughput genome sequencing we investigate the molecular taxonomy, population structure and eco-epidemiological dynamics of HPC. Methods: Hundreds of genomes from HPC isolates were sequenced on Illumina platforms. Assembled genomes from HPC were used as reference to map reads from each individual isolates and phylogenetic analysis were carried out individually in each genus using Maximum Likelihood (ML) methods. Both nuclear and mitochondrial DNA (mtDNA) were analyzed using ultrafast bootstraps coupled with Shimodaira-Hasegawa-like approximate likelihood ratio test (SH-aLRT) for branch testing. Population genetics of HPC was performed based on Principal Components Analysis (PCA), Variational Bayesian inference (faststructure) and graphic plots of ancestral populations implemented in Treemix software. Species reconciliation in HPC was tested using Bayesian concordance methods implemented in the Bucky software under coalescent models. Results: Phylogenomic clades resolved within the HPC genus are in most cases congruent with the population structure resolution. Bayesian concordance analysis indicates that clades/populations deduced based on phylogenomic methods are truly species since harbor high level of concordance along its genomes. Admixture were detected in all HPC suggesting that hybridization or Incomplete Lineage Sorting (ILS) may play a role in the intra-species diversification and may contribute for phenotypical plasticity in dimorphic fungi. Additionally, admixture in the mtDNA is evident in Coccidioides and Paracoccidioides species suggesting that this molecule do not follow the species tree evolution and may lead erroneous conclusions in species diagnostics. Conclusions: Random mutation, sexual/parasexual recombination and species hybridization are mechanisms involved in fungal evolution that contributes to select virulent genotypes or more pathogenic populations. Species identification based on mtDNA should be avoided in HPC dues highly incongruence observed compared to species trees. Gene flow between well-defined populations in HPC indicates that sexual/parasexual recombination acts as driven force for phenotypical plasticity but also hybridization between homozygous lineages is observed. Hybrids must be considered in dimorphic pathogens and phylogenomic analysis must complemented by population genomic data. Species diagnostic based on molecular methods targeting duplicated regions must be aware about admixture and must be avoided. Next steps involve the correlation of clinical relevant traits and compare to species complex within HPC species. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISHS/add 1 443615 24ca5464-48ad-4a66-88ed-447e2ec6 c31c.png

S30

Medical Mycology, 2018, Vol. 56, No. S2

S10.4d Epidemiological investigation for grouped cases of Trichosporon asahii using whole genome sequencing

S10.5c Isothermal amplification techniques, a tool for molecular diagnosis of eumycetoma

M. Desnos-Ollivier1 , C. Maufrais1 , M. Pihet1 , C. Aznar2 , L. Laboratoire de Parasitologie3 1 Institut Pasteur, PARIS, France 2 CHU Angers, ANGERS, France 3 CH Cayenne, FRANS-GUYANA, France

SARAH Ahmed University of Khartoum; Westerdijk Institute, KHARTOUM, Sudan

Objective: Trichosporon asahii is a basidiomycetous yeast-like responsible of human trichosporonosis worldwide. As part of the French epidemiological surveillance system, the National Reference Center for Invasive Mycoses & Antifungals (NRCMA) received clinical isolates involved in human Invasive Fungal Infections. In 2014, several grouped cases of bloodstream and urine infections due to T. asahii, involving 8 patients in two remote hospitals, were notified to the NRCMA. The aim of our study was to analyze genomic diversity of T. asahii clinical isolates, based on whole genome sequencing (WGS), in comparison with IGS1 haplotypes sequencing frequently used as genotyping method and to assess the link between isolates in these local outbreaks. Methods: Thirty two clinical isolates, recovered between 2003 and 2016, from 29 patients in 17 different French hospitals, were analyzed. They were mainly isolated from blood (n = 17). All isolates are identified by phenotypic methods, mass-spectrometry, and DNA sequencing of ITS, D1-D2 and IGS1 regions. Whole genomes of the 32 clinical isolates and the type strain (CBS 2479) were sequenced by Illumina. Genomes were mapped to the genome of the type strain distributed in 342 contigs (ALBS00000000) by using the Burrows-Wheeler Alignment tool, BWA version 0.7.7. All SNPs and indels identified with a MQ>20 were extracted with freebayes and vcftools. Multiple alignment of concatenated sequences of SNPs was performed using Clustal Omega multiple sequence alignment tool and the unrooted tree was constructed with the Neighbor Joining tool of the Phylip package. Results: Based on IGS1 sequencing, the 32 isolates correspond to 6 different haplotypes of which 2 were unknown. Haplotype 1 was the most frequent (n = 17) as already reported including isolates involved in 3 grouped-cases, suggesting a common source of contamination. Based on WGS, 99% of the type strain genome mapped that available on Genbank. For the clinical isolates, between 93 and 97% of the genomes mapped to the reference genome, confirming the species identification and the sequencing quality. They harbored between 148294 and 175236 SNPs and between 57451 and 67919 indels. Neighbor Joining Tree constructed with concatenation of SNPs (length of 297725) showed that isolates with same haplotypes were usually grouped in a same cluster. However, it also revealed genomic diversity within the same cluster and between isolates with a same haplotype. Conclusion: Based on SNPs and indels counting we can conclude that genomes of the 32 isolates of T. asahii have 1.2% of difference among themselves and with the type strain. For two patients infected with multiple isolates recovered over one month, isolates can be considered to be clonal (99% of SNPs positions are similar). Within the same IGS1 haplotype, isolates exhibited genomic differences, especially when they were recovered from different geographic origins or at different times showing that isolates of the same IGS1 haplotype cannot be considered as clonal. These results confirm that one patient is infected with a unique isolate but suggest that IGS1 sequencing is not discriminant enough for epidemiological investigation.

Eumycetoma is a neglected implantation mycoses that is characterised by tissue destruction, morbidity and disability. The disease is endemic in tropical and subtropical regions and affects people in rural arid areas with resource-poor settings. In the endemic regions, mycetoma is considered a leading cause of disability as 25% of the patients undergo amputation or extensive surgery. Medical treatment depends on the type of the causative microorganism; hence the diagnostic gold standard method for mycetoma is the isolation and identification of the causative pathogen. However, this presents a challenge because of the large number of species that are capable of causing the disease which lack differential characters. Phenotypic methods are proven to be of a limited value for identification of eumycetoma agents and the only way to ascertain the species identity is the use molecular based assays. DNA barcoding with short sequence from the species genome or protein finger prints have facilitated accurate identification in the well-established laboratories. However, these methods are difficult to deliver to the remote areas endemic with eumycetoma. The PCR-based amplifications require high-precision instruments, cumbersome, and ill-suited for point of care diagnosis. Isothermal amplification of nucleic acids has emerged as a promising tool that can efficiently amplify the DNA at a constant temperature without the need for a thermocycler. In contrast to the PCR-based technologies, isothermal amplification assays can be performed within a shortened time, are simple, cost-effective, and have high throughput. Therefore, they offer the opportunity of performing molecular diagnostic in resource-limited settings, beyond the centralized laboratories. So far, three methods have been established for eumycetoma including Loop-mediated isothermal Amplification (LAMP), Recombinase Polymerase Amplification (RPA), and Rolling Circle Amplification (RCA) assays. The LAMP and RPA have been evaluated for direct detection of the prevalent agent of the disease, M. mycetomatis from clinical samples. Both methods have shown high specificity and sufficient sensitivity, and are reliable for detection of the fungus directly from patient biopsies as well as from cultures. Given the accuracy, simplicity, and ease to perform in the absence of sophisticated infrastructure, there is no doubt that RPA and LAMP are powerful methods for eumycetoma diagnosis. The assays can be modified to a multiplex platform that allows multiple species detection. In addition, simple hand-held devices can be developed for real-time detection of eumycetoma agents to enable on-site field-based diagnosis.

S10.5d Development of Madurella mycetomatis Short Tandem Repeat (MmySTR) assay for studying the genetic variance between different isolates B. Nyuykonge1 , K. Eadie1 , A.H. Fahal2 , W.W.J. Van de Sande1 , C. H. W Klaassen1 1 ErasmusMC, ROTTERDAM, Netherlands Mycetoma Research Center, KHARTOUM, Sudan

2

S10.5 Closing the mycetoma knowledge gap S10.5b Treatment of Mycetoma E.E. Zijlstra Drugs for Neglected Diseases initiative, GENEVA, Switzerland The treatment landscape of Mycetoma The treatment of mycetoma firstly depends on the causative organism. There are few well controlled studies and most information comes from case series. Current landscape Actinomycetoma is caused by bacteria of which Nocardia spp are most common. Smaller lesions may be treated with trimethoprim-sulfamethoxazole to which dapsone may be added. For larger lesions the recommended regimen is a combination of two antibiotics (amikacin and trimethoprim-sulfamethoxazole) that is used in 5- week cycles, with cure rates >90% and a reasonable safety profile. Co-amoxiclavulanic acid may be used as an alternative. In resistant cases carbapenems may be considered. Determination of antibiotic susceptibility of the pathogen involved is recommended. Surgery is rarely needed. In eumycetoma antifungals are the first line treatment, often in combination with surgery. Nevertheless, primary surgical removal of the lesion is still commonly practised in smaller lesions, for lack of access to medical treatment and efficacious, safe and accessible medical drug therapy. The optimal regimen for smaller, intermediate or larger lesions, respectively, has not been identified and may be compounded by bone involvement. Only azoles seem effective, of which ketoconazole has been mostly used. After its ban by the FDA and EMA because of liver an adrenal toxicity, itraconazole is the only available drug in most endemic countries, with limited efficacy (often 0.5 ODI). BDG and GM levels showed a significant correlation (P = 0.004). Patients with an elevated BDG were more frequently Aspergillus-positive (40.7 versus 14.3%, P = 0.004) and had a significantly lower forced expiratory volume in one second (FEV1) than patients with a normal BDG (61.6 versus 77.1%, P = 0.007). In the multivariate analysis, BDG but not GM or the growth of A. fumigatus, proved to be an independent predictor for the FEV1. An increase of the BDG concentration of 10 pg/ml was associated with an average loss in FEV1 of 1%. Conclusion: In the present study, we performed for the first time a detailed correlative analysis of BDG and GM antigenemia, colonization/infection with A. fumigatus and pulmonary function in CF patients. Our results show that CF patients with persistent Aspergillus detection have elevated BDG and GM levels which are located between healthy and invasively infected patients. In the multivariate analysis serum BDG has proved to be superior to GM and fungal culture in predicting an impaired lung function associated with A. fumigatus in CF patients. Our data further suggests the existence of two subgroups within the Aspergillus-positive patients. One subgroup consists of patients with mere A. fumigatus colonization (exhibiting normal biomarker levels) and the other of patients with true A. fumigatus infection (exhibiting elevated biomarker levels). This could offer an explanation why previous studies reported inconsistent results concerning the correlation between Aspergillus detection by culture or PCR and lung function decline in patients with CF.

S10.7a Candida auris: report of the first case of infection from Australia C.H. Heath, DJ Gardam, T.M. Pryce, S. Pang, C.H. Heath Royal Perth Hospital & Fiona Stanley Hospital, PERTH, Australia Objective: Candida auris, an emerging multi-drug resistant nosocomial fungal pathogen, is now recognised as a serious global public health concern. Herein, we describe the first Australian case of Candida auris infection. Methods: Identification was confirmed by both phenotypic and non-phenotypic methods. Polyphasic phenotypic tests included examination of microscopic morphology, thermo-tolerance studies and culture on CHROMagarTM Candida medium (Difco, Becton Dickinson, Australia). Matrix-assisted laser desorption/ionization time-of-flight MALDI-TOF MS (Biotyper database v3.1; Bruker Daltoniks, Germany) was used for identification. We also performed sequencing of both the Internal Transcribed Region (ITS) and the D1-D2 region (28S) rDNA genes to confirm the species identification. DNA sequences were edited, and consensus sequences assembled using SeqScape Software; sequence alignments were performed using GenBank BLAST search. MEGA 7 software was used R for phylogenetic analyses of the ITS- and D1-D2-nucleotide sequences. Susceptibility testing was performed using the Sensititre R YO10 system (Trek Diagnostics, Cleveland, OH, USA) panel. YeastOne Results: A 65-year-old Kenyan man presented with chronic sternal osteomyelitis in 2015; whilst visiting family in Perth, Western Australia (WA). Co-morbidities included: ischaemic heart disease, severe hypercapnoeic chronic obstructive pulmonary disease with pulmonary hypertension requiring home oxygen and chronic kidney impairment. Operative debrid´ement showed chronic destructive osteomyelitis of his distal sternum and anterior ribs bilaterally. His infection was thought to be from local bony trauma following cardiac resuscitation performed in a Kenyan hospital following cardiac arrest in 2012. Sternal tissue cultures yielded pale pink-purple colonies on CHROMagarTM of a budding yeast that did not produce pseudo-hyphae or germ tubes. The isolate grew at both 40◦ C and 42◦ C, but not at 45◦ C. MALDI-TOF MS testing yielded a score of >2.1 for C. auris. Sequencing of the ITS rDNA- and the D1-D2 regions of the 28S rDNA-genes confirmed the identification as C. auris. The ITS regions matched 100% with the C. auris reference strain CNRMA7.797 (ISHAM-ITS ID MITS484) deposited in Genbank (KP131674.1). The isolate was aligned and matched 100% to D1/D2 sequences of C. auris of the following strains deposited in GenBank: JQ219332, JQ219331, KU321688, KM000830 and KM000828. Based upon tentative breakpoints, susceptibility testing showed resistance to fluconazole (>256 mg/L), and reduced susceptibility to voriconazole (2 mg/L). The posaconazole MIC was 0.06 mg/L, and for pragmatic reasons, oral posaconazole was given as adjunctive medical therapy. He was treated successfully with 3 months of oral posaconazole; however, after 3 months therapy he was palliated and died from complications of his underlying co-morbidities. Phylogenetic studies applying MEGA 7 using both ITS- and D1-D2-rDNA sequences was unable to discriminate between the African and Indian clades of C. auris. Whole genome sequencing is therefore planned to clarify the specific phylogenetic lineage of this Australian isolate of Candida auris. No secondary cases of C. auris disease or colonization have been detected within Perth, WA; or elsewhere in Australia, since 2015. Conclusion: We describe the first Australian case of Candida auris disease. This case illustrates prolonged human carriage of C. auris, and also strongly suggests trans-continental spread of this emerging multi-drug resistant fungal human pathogen.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

S31

S10.7 Auris S10.7b Internal validation of GPSTM CanAur dtec-qPCR Test following the UNE/EN ISO/IEC 17025:2005 for detection of emergent nosocomial Candida auris A. Navarro1 , F. Hagen2 , J. Meis3 , A. Mart´ınez-Murcia1 1 ´ University Miguel Hernandez, ALICANTE, Spain 2 Westerdijk Fungal Biodiversity Institute, UTRECHT, Netherlands 3 Canisius Wilhelmina Hospital, NIJMEGEN, Netherlands Objective: Candida auris is a multidrug resistant pathogenic fungus that causes candidaemia with high mortality rates and it is emerging with the ability to persist and spread within the hospital environment. Since its first description in Japan 2009, reports of nosocomial outbreaks of C. auris have been reported globally. In continental Europe, the first incidence of C. auris infections occurred at Hospital Universitario y Polit´ecnico La Fe in Valencia (Spain) among four patients diagnosed in the intensive care unit during spring of 2016. C. auris is phylogenetically closely related to Candida haemulonii and is frequently misidentified by commercial identification techniques in clinical laboratories (i.e, Vitek Yeast ID Panel, Microscan Walkaway, BD Phoenix, etc.). Furthermore, without updating the database, the correct identification of C. auris seems impossible by using the two currently used MALDI-TOF MS systems. Candida auris is a multidrug resistant pathogenic fungus that causes candidaemia with high mortality rates and it is emerging with the ability to persist and spread within the hospital environment. Since its first description in Japan 2009, reports of nosocomial outbreaks of C. auris have been reported globally. In continental Europe, the first incidence of C. auris infections occurred at Hospital Universitario y Polit´ecnico La Fe in Valencia (Spain) among four patients diagnosed in the intensive care unit during spring of 2016. C. auris is phylogenetically closely related to Candida haemulonii and is frequently misidentified by commercial identification techniques in clinical laboratories (i.e, Vitek Yeast ID Panel, Microscan Walkaway, BD Phoenix, etc.). Furthermore, without updating the database, the correct identification of C. auris seems impossible by using the two currently used MALDI-TOF MS systems. Methods: In the present study, the MONODOSE GPSTM dtec-qPCR kit for the detection of C. auris have undergone validation following the guidelines of the UNE/EN ISO/IEC 17025:2005 and French Standard NF T90-471:2010 by using developed fast-cycling protocols. Validation terms included in vitro specificity (inclusivity/exclusivity), the quantitative phase analysis using the standard curve calibration (10-106 standard DNA copies), reliability (repeatability/reproducibility) and sensitivity (detection/quantification limits). GPSTM dtec-qPCR kits passed validation with strict acceptance criteria of correct results for a minimum of 10 repetitions. In addition to the specificity in silico of the primers and probes for C. auris proved by the designer (GPSTM ), experimental inclusiveness was achieved in two independent laboratories by testing the type strain JCM15448 and 117 clinical C. auris isolates received from India, Oman, South Africa, Spain, United Kingdom and from Venezuela. Results: Exclusiveness was tested using 25 strains of C. duobushaemulonii, C. haemulonii, C. lusitaniae and C. pseudohaemulonii. The use of MONODOSE format (target-specific, dried single-dose PCR tubes, ready to add the extracted DNA) made the preparation of PCR reactions a simple and quick task, allowed the transport at room temperature, and minimized the risk of contamination and deterioration, allowing C. auris detection may be accurately achieved in a few hours. Conclusion: Part of this research has received funding from the European Union Seventh Framework Programme [FP7/20072011] under Grant agreement no: 311846

S10.7c Genetic Diversity, Phenotypic Variability and Drug Resistance in the Emerging Fungal Pathogen Candida auris A.Lorenz, G. Bravo Ruiz, Z. Ross, S. Stoichkova, N.A.R. Gow University of Aberdeen, ABERDEEN, United Kingdom Objective: Only rarely does a completely new pathogenic microbe emerge in the spotlight of global health care. Candida auris is such an example, having been identified as a medically relevant fungus only in 2009. It is the most drug-resistant yeast known to date and its emergence and population structure are unusual in many respects (according to current research four distinct geographical clades can be discerned). Because of its recent emergence, we are largely ignorant about the general biology and life cycle of C. auris. Due to the evolutionary distance to the best-studied Candida species C. albicans, inferences from research on C. albicans are not always transferable to C. auris. Indeed, research by us and other laboratories indicate that these two species behave obviously different in terms of their cell biology. Methods: To provide a better understanding of the life cycle of C. auris – which, ultimately, will enable the Medical Mycology community to progress research into novel diagnostics and therapies – our laboratory studied the karyotype variability of 25 C. auris strains representing the four main geographical clades to understand its genome organization and evolution on a species-wide level. Results: Genome size measurements and electrophoretic karyotyping revealed C. auris to be a haploid species with a plastic karyotype containing 5–7 chromosomes. Substantial chromosome number and size variation between C. auris isolates, both within and between geographical clades, was observed. This plasticity of karyotypes within a clade was somewhat unexpected considering the uniformity of C. auris on a DNA sequence level belonging to the same geographical clade. This indicates that genome rearrangement on a chromosomal level potentially is a mechanism C. auris employs to generate genetic diversity during adaptation to environmental challenges. Conclusion: We are interested in how this genetic diversity is generated and how it affects fundamental features, including growth and stress response, and clinically relevant traits, such as virulence and drug resistance. Recent experiments on C. auris genetic diversity between clinical isolates and its influence on cell morphology and drug resistance will be discussed.

S32

Medical Mycology, 2018, Vol. 56, No. S2

S10.7d Applicability of MALDI-TOF MS for rapid detection of resistant C. auris strains to caspofungin

S10.7g Case-case comparison of Candida auris vs. other Candida species bloodstream infections in Colombia

M. Vatanshenassan1 , K. Sparbier2 , J.F. Meis3 , A. Chowdhary4 , R. Ben-Amid5 , J. Bermane6 , M. Kostrzewa1 1 Bruker Daltonik GmbH, BREMEN, Germany 2 Bruker Daltonik GmbH,, BREMEN, Germany 3 Radboudumc, NIJMEGEN, Netherlands 4 V. P. Chest Institute, University of Delhi, DELHI, India 5 Tel Aviv Sourasky Medical Center, TEL AVIV, Israel 6 George S. Wise Faculty of Life Sciences, TEL AVIV, Israel

S. Rivera1 , D.H. Caceres2 , P. Escandon1 , P.A. Armstrong2 , N.A. Chow2 , M. Ovalle1 , J. Diaz1 , G. Derado2 , S. Salcedo3 , I. 6 ´ ˜ 6 , N. Villalobos7 , J.M. , A. Marino Berrio4 , A. Espinosa-Bode2 , C. Varon5 , A. Guzman5 , M. Stuckey2 , J.E. Perez-Franco Correa7 , A.P. Litvintseva2 , T.M. Chiller2 , S. Vallabhaneni2 , B.R. Jackson2 , O. Pacheco1 1 Instituto Nacional de Salud (INS), BOGOTA, Colombia 2 Centers for Disease Control and Prevention (CDC), ATLANTA, USA 3 Cl´ınica General del Norte, BARRANQUILLA, Colombia 4 ´ para Investigaciones Biologicas ´ Corporacion (CIB), MEDELLIN, Colombia 5 ˜ Pilar, CARTAGENA, Colombia Hospital Dona 6 Hospital Militar Central, BOGOTA, Colombia 7 Cl´ınica los Nogales, BOGOTA, Colombia

Objective: Candida auris (C. auris) is a new emerging yeast which has been rapidly spreading across the globe and becoming a serious threat of human health. This nosocomial transmitted yeast is inherently a multidrug-resistant microorganism and often leads to invasive fungal infections. Using conventional methods, C. auris is often mis-identified. Thus, a rapid and accurate diagnostic tool which could concurrently identify C. auris and detect strains resistant to different antifungals, is essential for successful patient management. Accordingly, the purpose of this study is to demonstrate the applicability of MALDI Biotyper antibiotic susceptibility test rapid assay (MBT-ASTRA) as a novel method to detect C. auris strains resistant to caspofungin (CAS) within six hours. Methods: A total of 27 clinical C. auris strains collected from three different sites were analyzed. In vitro AFST was performed by twofold serial dilutions of the caspofungin (0.125 – 4 μg/ml) according to the current CLSI guideline (M27-S4/2012). MBTASTRA with Caspofungin was set up according to EUCAST guideline E.DEF 7.3 including minor modifications. Incubation was performed for 6 h. Subsequently, the cells were lysed and spotted in duplicate. Dried spots were overlaid with the MALDI matrix containing an internal standard. Spectra were acquired in the mass range between 2 and 20 kDa and analyzed by MS-ASTRA prototype software. The results were compared to microdilution results according CLSI. Results: The MICs determined by microdilution were considered as a gold standard. So far, breakpoints were not finally defined by standard methods and considered as S ≤1 mg/ml and R >1 mg/ml based on recent research studies (1,2). Applying these breakpoints, 22 susceptible and 5 resistant strains C. auris isolates were identified by microdilution. MBT-ASTRA correctly detected all 5 resistant strains. Seventeen susceptible strains were accurately detected, too. Six susceptible strains were detected as resistant by MBT-ASTRA but breakpoints of these strains ranged between 0.5 and 1 mg/ml and might have to be considered as intermediates. Conclusion: MBT-ASTRA has been shown to be a promising tool to facilitate and accelerate the detection of multi-drug resistant C. auris strains in order to improve patient management. Additional strains obtained from different regions and different antifungals will have to be investigated to confirm these results. Keywords: Candida auris, Antifungal Susceptibility Test, MALDI-TOF MS References: 1. David Sears, Brian S. Schwartz. Candida auris: An emerging multidrug-resistant pathogen. International Journal of Infectious Diseases 63 (2017) 95–98. 2. Shawn R. Lockhart, Kizee A. Etienne, and et al. Simultaneous Emergence of Multidrug-Resistant Candida auris on 3 Continents Confirmed by Whole-Genome Sequencing and Epidemiological Analyses. Clinical Infectious Diseases 2017;64(2): 134–40.

S10.7e Azole and echinocandin antifungal drug resistance determinants of Candida auris

Objective: Candida auris is an emerging multidrug-resistant fungus that causes healthcare-associated outbreaks of invasive infections. In 2016, clinicians and public health officials first identified cases of C. auris in Colombian healthcare facilities. To evaluate risk factors and outcomes for these infections, we investigated epidemiologic and clinical features of patients with C. auris and other Candida species bloodstream infections (BSI). Methods: As part of the C. auris outbreak investigation, we conducted a retrospective case-case study in four acute care hospitals in Colombia. A case was defined as isolation of Candida spp from blood during January 2015–September 2016. Species were determined by automated and matrix-assisted laser desorption/ionization time of flight (MALDI-TOF) methodologies. C. auris cases were compared with other Candida species cases. We abstracted clinical and laboratory data using a standardized case-report form. Odds ratios (OR) and corresponding 95% confidence intervals (CI) were calculates using logistic regression. Results: We analyzed data from 96 patients, including 40 with C. auris and 56 with other Candida species. All had been admitted to the intensive care unit (ICU). Fifty-four (56%) patients were male; median age was 31 years (interquartile range [IQR]: 61 years). No significant demographic differences existed between the two groups. After adjusting for age, C. auris case status was significantly associated with: having diabetes mellitus (OR 5.34, CI 1.19-23.9), inpatient hemodialysis (OR 3.97, CI 1.42-11.1), severe sepsis (OR 3.56, CI 1.32-9.58), and higher number of ICU days before Candida culture (OR 1.02, CI 1.00-1.05). C. auris case-patients had greater odds (OR 5.68, CI 2.27-14.2) of >15 day ICU stay than those with other Candida BSIs. In a multivariable model, diabetes (OR: 6.11, CI 1.09-34.0), ≥15 days of pre-infection ICU stay (OR: 5.66, CI 2.09-15.3), and evidence of severe sepsis (OR: 3.61, CI 1.18-11.0) remained significantly associated with C. auris vs. other Candida species. Thirty-day mortality was 43% among patients with C. auris and 38% in patients with other Candida species BSIs (OR: 1.40, CI 0.59-3.31). Conclusion: Patients with C. auris BSI had longer lengths of ICU stay than those with other candidemias, consistent with acquisition of infection during hospitalization, in contrast to other Candida infections, which are usually thought to result from autoinfection with host flora. The findings of higher odds of C. auris for patients with diabetes and severe sepsis warrants further investigation but may be related to longer ICU stays or differences in immunosuppression associated with infection.

S10.7h Candida auris in Germany - report of the first clinical cases of an emerging nosocomial pathogen A. G. Hamprecht1 , R. Martin2 , S. C. Mellinghoff3 , G. Walther4 , O.A. Cornely3 , O. Kurzai2 University of Cologne, COLOGNE, Germany ¨ ¨ University of Wurzburg, WURZBURG, Germany 3 University Hospital of Cologne, COLOGNE, Germany 4 ¨ Invasive Pilzinfektionen NRZMyk, JENA, Germany Nationales Referenzzentrum fur 1

1 ´ , A. Singh2 , A. Lee1 , S. Park1 , I. Berrio3 , A. Chowdhary2 , Y. Zhao1 , D.S. M. Kordalewska1 , K. Healey1 , C. Jimenez-Ortigosa Perlin1 1 Rutgers Biomedical and Health Sciences, NEWARK, USA 2 University of Delhi, DELHI, India 3 ´ Hospital General de Medell´ın Luz Castro de Gutierrez ESE, MEDELL´IN, Colombia

Objective: Candida auris is a novel Candida species that was first isolated from the external ear canal discharge in 2009. Subsequently, various types of infections have been reported from many countries located on five continents. One of the challenges in the treatment of C. auris infections is variable antifungal susceptibility profiles among clinical isolates and the development of resistance to single or multiple classes of available antifungal drugs. A thorough understanding of the molecular insights of this organism is crucial for improved management. Therefore, our aim was to perform a comprehensive analysis of the determinants of the C. auris resistance to azole and echinocandin antifungal drugs. Methods: A total of 106 C. auris isolates (Colombia, India, FDA-CDC AR Isolate Bank) were investigated in this study. Antifungal susceptibility testing (AFST) with azoles (fluconazole - FLC, isavuconazole - IVC, voriconazole - VRC) and echinocandins (anidulafungin - ANF, caspofungin - CSF, micafungin - MCF) was performed in accordance with CLSI document M27”A3. ERG11 and FKS1 genes, encoding targets for azole and echinocandin class antifungal drugs, respectively, were amplified and sequenced. The most commonly identified ERG11 alleles were cloned onto a low-copy vector (pRS416) and expressed within a haploid strain of S. cerevisiae (BY4741). Azole susceptibilities were then determined for the transformed strains of S. cerevisiae. Glucose-induced efflux of rhodamine 6 G was measured to estimate ABC-type drug transporter activity. In vivo drug response to CSF was assessed in a murine model of invasive candidiasis. Results: Only four Indian isolates from a total of 106 isolates (3.8%) exhibited highly elevated MICs ≥4 mg/l at 24 h and were considered presumptively resistant to all tested echinocandins. These isolates were found to harbor a S639F amino acid substitution in Fks1. The remaining 102 echinocandin-sensitive isolates presented wild-type (WT) genotype. MCF was the most potent echinocandin (MIC50 = 0.125 mg/l). CSF AFST results analysis was difficult, since all FKS1 WT isolates exhibited a paradoxical growth effect (PGE). However, in a murine model, mice infected with FKS1 WT C. auris isolates, irrespective of PGE observed in vitro, had a significant (P < 0.05) ∼1 log10 CFU/g kidney burden reduction upon CSF treatment relative to vehicle controls. Contradictory, mice challenged with fks1 S639F mutants failed to respond to the drug and no significant differences in kidney burdens were detected between CSF treated and untreated groups. Azole resistance levels were 56%, 33%, 33% for FLC, IVC and VRC, respectively. Erg11 amino acid substitutions Y132F, K143R, and K177R/N335S/E343D were detected with the highest frequency. Expression of pCauErg11-Y132F or pCauErg11K143R, but not pCauErg11-WT or pCauErg11-K177R/N335S/E343D resulted in induction of triazole resistance in S. cerevisiae. Moreover, increased ABC-type drug transporter activity was found in isolates with elevated azoles MICs. Conclusion: Without established breakpoints for C. auris, AFST results interpretation and conclusions regarding resistance should be made with caution. We have discovered that molecular determinants contributing to the resistance are FKS1 genotype for echinocandins, and Erg11 amino acid substitutions and increased drug transporter activity for azoles.

S10.7f Comparison of Candida auris candidemia with non-C. auris candidemia: risk factors and outcome experience from Pakistan J.Q. Farooqi, M. A. Sayeed, K. Jabeen, S. Awan, S.F. Mahmood Aga Khan University, Karachi, KARACHI, Pakistan Objective: Candida auris is an emerging yeast with decreased susceptibility to antifungal agents and a propensity to cause nosocomial outbreaks. Given its recent spread, information regarding its risk factors and outcomes is limited. We therefore investigated/compared the clinical spectrum and outcomes of C. auris candidemia with non-auris in an ongoing outbreak at our institute. Methods: A case-control study was conducted comparing 38 cases of C. auris candidemia with 101 controls of candidemia caused by other species of Candida including C. albicans, C.tropicalis and C. parapsilosis at Aga Khan University Hospital (Karachi, Pakistan) from September 2014 to March 2017. Patients 16 years or older, with at least one blood culture positive for Candida spp., who received primary treatment at our hospital were included. We collected data on the demographic characteristics, clinical history, comorbidities, specimen details, management, site of infection, length of hospital stay and outcomes. SPSS 22.0 was used for analysis. Results: One hundred and thirty-nine patients of candidemia were enrolled. Patients with C.auris candidemia were more likely to have comorbidities (89.5% vs. 64.4%, P 0.003), indwelling lines (97.4% vs. 82.2%, P 0.02), previous antibiotic and antifungal exposure (100% vs. 88.1%, P 0.03) and (36.8% vs. 1.0%, P < 0.001) respectively and had isolated other multidrug resistant organisms before isolating C. auris (55.3% vs. 11%, P < 0.001). Half of the cases isolated C. auris after 2 weeks of hospital stay (50% vs. 14%, P < P < 0.001), and central line being the most common site of infection (89.5% vs. 46.5%, P < 0.001). They had a prolonged hospital stay (mean stay 36.3 days vs. 14.8, P < 0.001) with all- cause and 14- day mortality same as that of other candida species (60.5% vs. 52.4%, P 0.44) and (44.7% vs. 46.5%, P 0.37) respectively. Conclusion: C.auris fungemia is more often secondary to central line related infections late in the hospital admission, likely due to its nosocomial transmission. Despite being drug resistant, C. auris shares the same mortality rate as that of the other Candida species.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

2

Objective: Since its first description in 2009, Candida auris has disseminated worldwide. Because of the unprecedented spread, a clinical alert has been issued by both the CDC and the ECDC. C. auris causes nosocomial infections, which are difficult to diagnose, as this species is still not identified by most phenotypical methods (e.g. biochemistry). Treatment options in severe infections are limited, as most isolates are resistant to fluconazole and some even to other azoles and echinocandins. Here we present data on the first cases of C. auris in Germany. Methods: C. auris isolates were collected at the National Reference Centre for Fungal Infections Jena (NRZMyk) and the University Hospital Cologne. For identification, different methods were used and compared: two MALDI-TOF mass spectrometry systems (VitekMS, bioM´erieux, Nurtingen, Germany and Biotyper, Bruker Daltonics, Bremen, Germany), biochemical identification ¨ (Vitek2) and Api (bioMerieux). Sequencing of the internal transcribed spacer (ITS) of rDNA served as the gold standard method. Susceptibility testing was performed by EUCAST broth microdilution method. Additionally, clinical characteristics from patients with C. auris were analyzed. Results: Until 1/2018, seven cases of C. auris infections were reported to the NRZMyk, including two blood stream infections and three urinary tract infections. Most patients with C. auris had a history of medical treatment abroad. Correct identification was achieved by Biotyper (6/6 isolates), but not by VitekMS (using the Vitek MS database) or Vitek2, which misidentified all isolates. Minimal inhibitory concentrations (MICs) were high in all isolates for fluconazole (32- >128 mg/L), with varying MICs for voriconazole (0.125-0.5 mg/L), amphotericin B (1-2 mg/L) and anidulafungin (0.03-0.12 mg/L). Conclusion: Until now, C. auris has been detected in isolated cases in Germany, mostly from patients with medical treatment in high prevalence countries. Up to now, C. auris has not disseminated as in other countries, e.g. the UK, Spain, USA or India or caused local outbreaks. However, given its difficult identification with commercial systems, the true prevalence of C. auris infections is likely underestimated.

Poster Pitch session Session 1: Sunday 1 July 12:15 hrs. – 13:15 hrs PP1.001 Azole-resistance in Aspergillus terreus and closely related species, an overseen problem? ¨ 1, 3 M. Lackner1 , T Zoran1 , B Sartori1 , JOS Houbraken2 , B Risslegger1 , C Lass-Florl Division of Hygiene and Medical Microbiology, INNSBRUCK, Austria Westerdijk Fungal Biodiversity Institute, UTRECHT, Netherlands

1 2

Objective: Invasive aspergillosis (IA) is significant cause of mortality in immunocompromised patients. The most frequent representatives of IA are members of Aspergillus section Fumigati, followed by section Terrei species. We aimed to study the frequency of A. terreus sensu stricto (s.s.) and related (cryptic) species in clinical specimens and the frequency of azole-resistance in these species. Methods: A global set (n = 498) of section Terrei isolates was molecularly identified (beta-tubulin), tested for antifungal R and EUCAST: posaconazole, voriconazole, and itraconazole), and resistant phenotypes were correlated with susceptibility (Etest point mutations in the cyp51A gene. Results: The majority of isolates were identified as Aspergillus terreus s.s. (86.8%), followed by the (cryptic) species A. citrinoterreus (8.4%), A. hortai (2.6%), A. alabamensis (1.6%), A. neoafricanus (0.2%), and A. floccosus (0.2%). According to EUCAST clinical breakpoints azole resistance was detected in 5.4% of all tested isolates, 6.2% of A. terreus s.s. were posaconazoleresistant. Posaconazole resistance in section Terrei isolates differed geographically and reached up to 13.7% in Germany. In contrast, azole resistance among cryptic species was rare (0.2%) and was observed only in one A. citrinoterreus isolate. The most affected amino acid position of the Cyp51A correlating with the posaconazole resistant phenotype was M217, which was found in the variation M217T and M217V. Conclusion: A. terreus s.s. was most prevalent, followed by A. citrinoterreus. Posaconazole was the most effective drug against all species of the section Terrei, but 5.4% of A. terreus s.s. isolates showed resistance against posaconazole. In Austria, Germany, and the United Kingdom posaconazole-resistance was higher than 10% among A. terreus s.s. isolates. Resistance against itraconazole was absent and rare for voriconazole.

ABSTRACT

S33

PP1.002 Predominance of non-fumigatus Aspergillus species among patients suspected to pulmonary aspergillosis in a tropical and subtropical region

PP1.005 Gene co-expression analysis identifies gene clusters associated with isotropic and polarized growth in Aspergillus fumigatus conidia

H. Zarrinfar1 , E. Zanganeh2 , F. Rezaeetalab1 , A. Fata1 , M. Tohidi1 , M. Najafzadeh1 , A. Naseri1 , M. Alizadeh3 , A. Jannati1 , M. Ghanbari1 1 Mashhad University of Medical Sciences, MASHHAD, Iran 2 Islamic Azad University of Damghan, DAMGHAN, Iran 3 Faculty of Medicine, Mashhad University of Medical Sciences, MASHHAD, Iran

T.J.H. Baltussen, J.P.M. Coolen, J. Zoll, P.E. Verweij, W.J.G. Melchers Radboud Institute for Molecular Life Sciences, NIJMEGEN, Netherlands

Objective: The rate of infections caused by Aspergillus in patients with immune deficiency has increased during the past decade. Pulmonary aspergillosis (PA) is one of the main causes of mortality in such patients. Non-fumigatus Aspergillus species are the leading cause of PA in countries located in tropical and subtropical climate zones. Bronchoalveolar lavage (BAL) specimen is one of the useful specimens for diagnosis of PA. In this study, Aspergillus isolated from BAL specimens of patients with suspected PA were identified by a molecular method. Methods: In a prospective study between 2015 and 2016, a total of 150 BAL specimens was collected from patients with pulmonary disorders and underlying immunodeficiencies in Northeastern Iran in the Middle East. The originating Aspergillus strains were phylogenetically identified at the species level by analyzing partial β-tubulin gene sequences. Results: Of the patients, 18 (12%) had a probable IPA with 13 (8.7%) positive direct examination and 20 (13.3%) positive culture for Aspergillus. Overall, Aspergillus species were isolated from 10 (50%) patients with cancer, 5 (25%) patients receiving corticosteroid therapy, 3 (15%) organ transplant recipients and 2 (10%) patients admitted to intensive care unit (ICU). A. flavus complex was the predominant 15 (75%) cause of probable invasive pulmonary aspergillosis (IPA), followed by A. tubingensis 3 (15%), and 2 (10%) A. fumigates complex. Conclusion: The distribution of Aspergillus species in patients with PA in the tropical region of northeastern Iran in the Middle East shows a predominance of the more non-fumigatus Aspergillus spp. In addition, the cancer patients, particularly with hematological malignancies showed a relatively high incidence of IPA.

Objective: Aspergillus fumigatus is a saprophytic fungus that extensively produces conidia. These microscopic asexually reproductive structures are small enough to reach the lungs. Germination of conidia followed by hyphal growth inside human lungs is a key step in the establishment of infection in immunocompromised patients. Until now, transcriptome and proteome studies in A. fumigatus were only performed on breaking of dormancy and early germination. In this study, we are the first to use RNA-Seq and focus on the later stages of germination in A. fumigatus. These stages are characterized by two distinct morphological phases as observed in A. niger. The first morphological change is swelling of the cell, referred to as isotropic growth. The second, polarized growth is characterized by the formation of a germ tube. These morphological changes are probably induced by a selective set of genes. Methods: Therefore, we constructed a co-expression network, identifying genes with similar expression patterns. These expression patterns may be associated to the distinctive morphological phases seen in conidial germination. Additionally, the constructed co-expression network was used to detect highly connected genes in the module. Results: Construction of a gene co-expression network revealed four gene clusters (modules) correlated with a growth phase (dormant, isotropic growth, polarized growth). Transcripts levels of genes encoding for secondary metabolites were high in dormant conidia. During isotropic growth, transcript levels of genes involved in cell wall modifications increased. Two modules encoding for growth, cell cycle and DNA processing were associated with polarized growth. In addition the co-expression network was used to identify highly connected intermodular hub genes. These genes may have a pivotal role in the respective module and could therefore be compelling therapeutic targets. Conclusion: Generally, cell wall remodeling is an important process during isotropic and polarized growth, characterized by an increase of transcripts coding for hyphal growth, cell cycle and DNA processing when polarized growth is initiated.

PP1.003 Aspergillosis of the paranasal sinuses Report of 7 cases treated by Endoscopic Sinus Surgery (ESS)

PP1.006 Molecular epidemiology and antifungal susceptibility profiles of Aspergillus terreus complex

B. Sadeghi-Nejad1 , S. Nikakglagh2 Abadan School of Medical Sciences, Abadan, Iran, AHVAZ, Iran Emam Khomeiny Hospital, Ahvaz Jundishapur University of Medical Sciences, Iran, AHVAZ, Iran

1 2

Objective: Nowadays, due to the increasing number of immunocompromised patients, the occurrence of mycoses infections have been increased and fungal sinusitis usually is observed in weakened immune system individuals but may be appear in healthy people. Aspergillosis of the paranasal sinuses has classified in two original groups, non-invasive “aspergilloma” form and invasive form that usually seen in the immunosuppressed patienst. Methods: In this study 34 sinusitis patients attending to department of ENT, Emam Khomeiny Hospital, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran were evaluated. Fungal sinusitis was diagnosed based on clinical findings, functional endoscopic sinuses surgery (FESS) of nasal and paranasal sinuses, CTscan and MRI, Mycological and histopathological examinations. Results: In histopathological and mycological examinations of tissue specimens endoscopic sinuses of nasal and paranasal, in 7 cases out of 34 cases was observed hyaline, branching septate hyphae with conidiophores and conidia in crusted fungus ball samples. In cultured, Aspergillus flavus and Aspergillus niger were isolated. Microscopically, stained smears from colonies with lactophenol anillin blue showed conidiophores and the conidia of As. flavus and As. niger. In this study fungal sinusitis was reported in individuals which were diabetic and immunosuppress such as kidney transplantation, leukemia and record of nasal polyp surgery and allergic chronic sinusitis. All cases were successfully treated with surgical debridement involved tissue and systemic Amphotricin B. Conclusion: We confirmed the importance of early clinical diagnosis and treatment with surgical debridement of infected tissue in nasal cavity and paranasal sinuses combined with Amphotricin B in special patients such as diabetic individuals as soon as possible. Key words: Fungal sinusitis, Aspergillosis, paranasal sinuse

PP1.004 Preliminary evaluation of a new immunochromatographic test for anti-Aspergillus antibodies detection R. P. Piarroux1 , T. Romain2 , A. Martin2 , L. Lachaud3 , F. Gabriel4 , J. Vitte2 , S. Ranque2 1 LDBIO Diagnostics, LYON, France 2 AP-HM, MARSEILLE, France 3 CHRU Montpellier, MONTPELLIER, France 4 CHU Bordeaux, BORDEAUX, France Objective: Aspergillus related diseases burden millions of people in both high and low-income countries. Their diagnosis rely on various criteria, including serology. Numerous tests are available for the detection of IgG directed against Aspergillus, but none comply with the WHO ASSURED (Affordable, Sensitive, Specific, User-friendly, Rapid, Robust, Equipment-free, Delivered) criteria, being either too expensive or requiring sophisticated automates incompatible with resource-poor laboratory settings. Here, we present the preliminary results of a new immunochromatographic test (ICT) that detects anti-Aspergillus antibodies in sera in less than 30 minutes and requires minimal laboratory equipment. Methods: Two studies were conducted: A 4 months single-center prospective study; A multicenter retrospective study where four French expert hospital laboratories provided sera of patient diagnosed with an Aspergillus In both studies the gold standard was the final multi-criteria diagnosis of Aspergillus diseases, categorized as: chronic colonization by Aspergillus in cystic fibrosis (CF) patients, allergic broncho-pulmonary aspergillosis (ABPA), CPA (including aspergilloma, fibrosing CPA and cavitary CPA), sub-acute invasive aspergillosis (SAIA) and rarer forms such as Aspergillus sinusitis, severe asthma with fungal sensitivity or Aspergillus abscess. Results: Prospective study: From July to October 2017, of 263 adult patients tested for anti-Aspergillus antibodies, 44 were diagnosed as Aspergillus disease cases and 219 had no-Aspergillus disease. In this prospective study the ICT showed 91% (40/44) sensitivity and 96% (211/219) specificity. Its positive and negative predictive values were 83.3% [71.6 to 90.9] and 98.1% [95.4 to 99.26], respectively. Retrospective study: By mid-January 2018, 123 cases and 82 controls had been included. Of the 123 cases, 114 were positive with ICT (sensitivity = 92.7% [86.6 to 96.6]). Of the 82 negative controls, 80 were negative in ICT (specificity = 97.6% [91.5 to 99.7]). Combined analysis: 167 Aspergillus diseases cases were included. ICT was positive 154 times (sensitivity = 92.2% [87.1 to 95.8]). ICT sensitivity was 93%, 100%, 94%, and 72% for the diagnosis of ABPA, APC, colonization, and all others forms pooled together, respectively. The lowest sensitivity (67%, n = 12) was for the diagnosis of SAIA. ICT was negative in 297/301 controls (specificity = 98.7% [96.6 to 99.6]). Conclusion: This new ICT is showing promising preliminary results with adequate sensitivity and specificity for the diagnosis of Aspergillus diseases. It also comply with the ASSURED criteria, which indicates that this test could be used in middle- and low-income countries.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

A. Vaezi1 , H. Badali1 , J.F. Meis2 , H. Fakhim3 , F. Hagen2 , E. Dannaoui4 School of Medicine, Mazandaran University of Medical Sciences, SARI, Iran Canisius-Wilhelmina Hospital (CWZ), NIJMEGEN, Netherlands 3 Faculty of Medicine, Urmia University of Medical Sciences, URMIA, Iran 4 ´ Faculte´ de Medecine, APHP, Universite´ Paris-Descartes, PARIS, France 1

2

Objective: Aspergillus terreus is emerging as an etiologic agent of invasive aspergillosis in immunocompromised individuals. Infections caused by A. terreus are difficult to treat because of the intrinsic resistance to amphotericin B, and higher mortality compared to infections due to other Aspergillus species. The aim of the present study was to determine the in vitro antifungal activity of amphotericin B and 11 comparators against clinical and environmental A. terreus isolates and the genetic diversity and population structure of these isolates in Iran. Methods: A panel of 81 A. terreus isolates from clinical (n = 36) and environmental (n = 45) sources were collected in five different cities. The population structure of A. terreus isolates was determined using microsatellite based typing (STR) technique. Additionally, in vitro antifungal susceptibility was performed using the CLSI M38-A2 procedure. Results: Molecular identification showed that 66 and 15 isolates were A. terreus sensu stricto and A. citrinoterreus, respectively. The β-tubulin gene phylogenetic tree yielded 4 distinct clades and clade 1 represented 69.1% of A. terreus isolates. All of 81 A. terreus isolates were subjected to microsatellite typing using a panel of nine short tandem repeats to evaluate the genetic relatedness between the isolates. Twenty two isolates revealing no amplification at >2 loci and were excluded from the analysis. The results showed a high genetic diversity revealing 46 distinct genotypes among 59 A. terreus isolates. All the nine markers used for STR typing of A. terreus species had highly polymorphic. Genetic Diversity Index or Simpson’s index (D) in this study was calculated 0.93. The results of susceptibility tests exhibited that amphotericin B had the highest MICs (MIC range, 0.125 to 4 μg/ml; MIC90 , 2 μg/ml), followed by terbinafine (MIC range, 0.002 to 1 μg/ml; MIC90 , 1 μg/ml). Only one isolate (1/81) showed amphotericin B MIC above the epidemiologic cutoff value (ECV). None of the isolates had a MIC of ≥ECV for voriconazole, itraconazole and posaconazole. Conclusion: The reasons for the difference in amphotericin B susceptibility patterns between studies remain unknown. The genetic and species diversity, clinical, environmental and ecological factors in Terrei section on various amphotericin B susceptibility profiles in different countries should be considered more as the main reasons associated with these differences.

PP1.007 Identification and characterization of novel Aspergillus fumigatus mycoviruses J. Zoll, P.E. Verweij, W.J.G. Melchers Radboud University Medical Centre, NIJMEGEN, Netherlands Objective: In recent years, Increasing numbers of viruses infecting fungi have been identified. In this study, we used an in silico approach for the analysis of deep RNA sequencing results in order to identify and characterize putative genomic ssRNA or dsRNA molecules of mycoviruses in Aspergillus fumigatus. Methods: RNA sequencing reads from transcriptome analysis of itraconazole treated Aspergillus fumigatus strains were mapped against the Af293 reference genome of A. fumigatus using CLC Genomic Workbench. Unmapped reads were collected and used for de novo assembly. Contigs were analyzed by Blastx comparison with a mycovirus protein database using standalone NCBI Blast. Assembled viral genomes were used as template for remapping of RNA sequencing reads. Results: In total, deep RNA sequencing results from 11 Aspergillus fumigatus strains were analyzed for the presence of mycoviral genomic RNAs. In 9 out of 11 strains, putative mycovirus RNA genomes were identified. Three strains were infected with two different mycovirus species. Two strains were infected with Aspergillus fumigatus tetramycovirus type 1 (AfuTMV-1). Four strains contained genomic RNA of an unknown narna-like virus which showed 38% amino acid sequence identity to Beihai narna-like virus 21. Three strains contained genomic RNA of an unknown narna-like virus which showed 47% amino acid sequence identity to Fusarium poae narnavirus 2. Two strains contained genomic RNAs of an unknown partitivirus which showed 50% amino acid sequence identity to Alternaria alternata partitivirus 1. Finally, one strain contained genomic RNA of an unknown mitovirus which showed 34% amino acid sequence identity to Sclerotina sclerotiorum mitovirus. Conclusion: In silico analysis of deep RNA sequencing results showed that a majority of the Aspergillus fumigatus strains used in this study, were infected with mycoviruses. Four novel Aspergillus fumigatus RNA mycoviruses could be identified: Two different A. fumigatus narna-like viruses, one A. fumigatus partitivirus, and one A. fumigatus mitovirus. Further molecular and virological characterization is ongoing.

S34

Medical Mycology, 2018, Vol. 56, No. S2

PP1.008 Molecular epidemiology and antifungal susceptibility of Aspergillus species isolated from asthma patients

PP1.042 Galactomannan antigen as a diagnostic and prognostic marker in ICU subpopulation suspected of Invasive Aspergillosis

M. T. Hedayati1 , M. Vakili1 , V. Mortezaei1 , S.A. Mahdaviani2 , M.S. Mirenayat2 , M. Pourabdollah2 , J. Heshmatnia2 , A. Fakharian2 , G. Pourdolat2 , S. Sharifynia2 , M. Alialy1 , M. Abastabar1 , J. Yazdani Charati1 1 Mazandaran University of Medical Sciences, SARI, Iran 2 Shahid Beheshti University of Medical Sciences, TEHRAN, Iran

Y. Dabas, A Mohan, I Xess All India Institute of Medical Sciences, NEW DELHI, India

Objective: Asthma is a chronic lung disease characterized by inflammation, obstruction and hyper-responsiveness of airway, which can cause difficulty in breathing. Many of these patients have to use locally or systematically corticosteroid agents across their life. This condition predispose the airways to non-invasive colonization by thermo-tolerant filamentous fungi, in particular Aspergillus species. Airways colonization by Aspergilli can lead the host to life- threatening conditions including allergic bronchopulmonary aspergillosis (ABPA), severe asthma with fungal sensitization (SAFS) and even invasive aspergillosis. In this study we evaluated the molecular epidemiology and antifungal susceptibility of Aspergillus species isolated from asthma patients. Methods: During one year, 216 patients (82 male and 134 female) with mild (13.9%), moderate (62.5%) and severe (23.6%) asthma as well as 30 healthy volunteers were included in the study. At a single stable visit, subjects underwent spirometry, sputum fungal culture and a sputum cell differential count. Aspergillus species were identified by microscopic and macroscopic morphology and confirmed by sequencing. In vitro antifungal susceptibility testing was performed against luliconazole (LUL), itraconazole (ITC), voriconazole (VRC), posaconazole (POS), ravuconazole (RAV), amphotericin B (AMB), caspofungin (CAS), micafungin (MFG) and anidulafungin (AFG) using the CLSI-M38-A2 protocol. The minimum inhibitory concentration (MIC) and minimum effect concentration (MEC) values were evaluated according to CLSI M38-A2 guidelines. Results: Out of 216 patients with asthma, 117 (54.2%) were positive for Aspergillus species growth in sputum samples. The samples obtained from control group were negative for Aspergillus growth however Candida species (30.0%) and Cladosporium spp. (3.3%) were isolated. Patients with severe asthma had the most positive samples (78.4%) for Aspergillus. The range of grown Aspergillus colonies was 1–10 (average = 3.0) in positive samples. Patients with severe asthma had the most average of grown Aspergillus colonies (4.0). In general, 137 species of Aspergillus were identified from obtained samples which of A. flavus (29.2%) was the most common prevalent species followed by A. fumigatus (27.7%), A. niger (11.7%) and A. tubingensis. AFG had the highest in vitro activity against all strains; their MICs ranged from 0.001-0.016 μg/mL) with at least GM MIC (0.001418 μg/mL) among different isolated species. The MIC ranges of other agents were the following: AMB (MIC range, 0.031–4 μg/mL), ITR (MIC range, 0.031– >16 μg/mL), and VOR (MIC range, 0031-1 μg/mL), VOR (MIC range, 0/031–1 μg/mL), VRC (MIC range, 0/031-1 μg/mL), POS (MIC range, 0.002–4 μg/mL), RAV (MIC range, 0.002→16 μg/mL), LUL (MIC range, 0.001–0.5 μg/mL), CAS (MIC range, 0.001–0.031 μg/mL) and MFG (MIC range, 0.001–0.016 μg/mL) respectively. MFG, AFG, CAS and LUL had the lowest MIC90 (0.008 μg/mL). Among 117 isolates of Aspergillus, the resistance against tested antifungals was only observed in Aspergillus tubingensis. Of 16 A. tubingensis isolates, 2 (12.5%) were resistance against both ITR and POS. Conclusion: Our study have shown that Asthma patients are prone to colonization with Aspergillus species. The severity of asthma significantly influence on the pulmonary colonization with Aspergillus. In the present study, the observation of Aspergillus resistant isolates against main antifungals for aspergillosis treatment can be considered as a serious community health awareness.

PP1.041 Allergic bronchopulmonary aspergillosis presenting with lung mass-Report of six cases MUHAMMAD Irfan, KAUSER Jabeen, NOUSHEEN Iqbal, JOVERIA Farooqi, JAVAID A Khan Aga Khan University, KARACHI, Pakistan Objective: Allergic bronchopulmonary aspergillosis (ABPA) is a disorder caused by hypersensitivity to Aspergillus antigens. The estimated prevalence of ABPA is about 1% to 2% in patients with bronchial asthma and 2% to 15% in patients with cystic fibrosis. Patients with ABPA can have diverse radiological manifestations; however ABPA presenting as a lung masses is a rare presentation. So far, to our knowledge only 10 cases have been reported in literature. Here we report 6 patients of ABPA who presented with lung mass leading to lung cancer as a differential diagnosis. To study the clinical, radiological characteristics and outcome of patients of ABPA presented with a lung mass mimicking lung cancer. Methods: Medical records of 6 patients of ABPA presenting with lung mass at Aga Khan University hospital (AKUH), KarachiPakistan were reviewed. Diagnosis of ABPA in all cases was made using the Rosenberg criteria. Complete resolution of mass after steroid therapy was also used as an adjunct to diagnosis. Results: Of the six patients, five were males with ages of 23, 26, 30, 46 and 48 years and one female of 32 years. Four patients had a history of mild asthma while 2 patients had a history of only mild allergic rhinitis. The major symptoms at presentation were cough and pleuritic chest pain for 1–2 weeks duration. On chest X-ray four patients had mass like lesion in right upper lobe while in 2 patients the lesions were in left upper lobe. Two patients underwent bronchoscopy and one had CT guided biopsy with non-conclusive results. The diagnosis of ABPA was made on the Rosenberg criteria for the diagnosis of ABPA. In all patients’ serum IgE level was > 2000 IU/ml and 4 had peripheral eosinophilia. In all patients the lung masses completely resolved with steroids therapy (fig 1 and 1A of patient 1). Before ABPA diagnosis, one patient had already undergone right upper lobectomy on suspicion of malignancy. Conclusion: ABPA can present as pulmonary mass lesions and must be considered in the differential diagnosis of mass like lesions in lung, particularly in a patient with a history of asthma. Good clinical history, peripheral eosinophilia and raised IgE levels can help in narrowing the differential diagnosis. Treatment with glucocorticoids is associated with excellent outcomes. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 420009 a9975d2a-5f68-497a-816d-d988feec05 c3.png Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 420009 a9975d2a-5f68-497a-816d-d988feec05 c3.png Caption 2: CXR of patient 1, before (fig1) and after (fig 1A) steroid treatment

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Objective: To understand the diagnostic and prognostic usefulness of galactomannan (GM) assay in our medicine ICU patients suspected of invasive aspergillosis (IA). Methods: From the cohort of 235 patients only one had proven IA. Based on AspICU algorithm, 21 had putative IA (8.9%), 12 were colonised (5.1%). Applying an extrapolated EORTC/MSG criteria where non-specific radiological findings and colonisation cases were included, 107 were probable IA (45.5%), 24 were possible IA (10.2%) and 12 were colonised (5.1%). Serial serum and BAL samples (if available) were collected on day 0 and 7 for GM testing for all patients (n = 235). For the simplicity of analysis; proven cases were merged with putative and probable IA in the AspICU algorithm and EORTC/MSG criteria classifications, respectively. For determination of the best predictive cut-offs for IA diagnosis, receiver operating characteristics (ROC) curves were constructed for GM. ROC-curves were used to evaluate the two diagnostic criteria and serum GM as markers for predictors of IA diagnosis. All statistical analysis were done using STATA version 9 (StataCorp. 2005. Stata Statistical Software: Release 9. College Station, TX: StataCorp LP). Results: Following the GM kit cut-off ≥0.5, 177/235 (∼75%) tested positive. Radiological imaging was done for 165/235, 70.21% patients and the non-specific but clinically correlated findings were seen in 132/165 (80%) patients. The positive GM was seen for 102/132 (77%) of the patients with non-specific radiological findings. No statistical correlation was seen between piperacillin/tazobactam therapy and GM positivity (P > 0.1). According to AspICU criteria the significant GM cut-off was calculated to be ≥1.24 with 77.27 sensitivity, 77.46 specificity, 97.06 negative predictive value and 26.15 positive predictive value. The area under the receiver operating curve was 0.843. Figure 1 represents the best predictor of disease (IA) among the tests and diagnostic criteria employed. Patients who received antifungal treatment (194/235, 82.5%), the most common drugs were voriconazole (78/194, 40.20%) and amphotericin B (69/194, 35.56%). The median decrease duration in GM OD with voriconazole was 5 days and with amphotericin B was 7 days. On analysis of variance, cases of no versus any antifungal administered were statistically significant (P < 0.001). Table 1 highlights GM OD w.r.t. antifungal treatment in ICU patients. (where, Delta GM OD is, GMday 0 - GMday 7 ) Conclusion: Application of diagnostic criteria in ICUs may differ as per the local patient inflow. However, the use of local GM cut-offs calculated for diagnosis and then monitored for prognosis may help the intensivists for prompt initiation or change of therapy for the better outcome of patients. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 420594 397b90f9-487f-4a7b-9b5f-ae4b6f4e9 e2d.jpg Caption 1: Best predictor of disease (IA) among the tests and diagnostic criteria

PP1.043 Invasive Aspergillosis: Performance of New and Established Diagnostic Approaches with Same-Day Blood and Bronchoalveolar Lavage – a Prospective Cohort Study 1 1 ¨ ¨ , A. Wolfler , T. Niedrist1 , S. Heldt1 , J. Prattes1 , S. Eigl1 , B. Spiess2 , H. Flick1 , J. Rabensteiner1 , G. Johnson3 , F. Pruller T. Boch2 , P. Neumeister1 , H. Strohmaier4 , R. Krause1 , D. Buchheidt2 , M. Hoenigl1 1 University Hospital Graz, Medical University of Graz, GRAZ, Austria 2 Mannheim University Hospital, Heidelberg University, MANNHEIM, Germany 3 OLM Diagnostics, NEWCASTLE-UPON-TYNE, United Kingdom 4 Center for Medical Research, Medical University of Graz, GRAZ, Austria

Objective: Aspergillus spp. and other molds have been shown to induce elevated levels of several cytokines. It remains unknown whether these cytokines hold value for clinical routine and enhance diagnostic performances of established and novel biomarkers/molecular tests for invasive aspergillosis (IA) and other invasive moldinfections (IMI). The objective of this prospective cohort study was to determine the diagnostic potential of a bundle of cytokines as well as established and emerging tests for IA and IMI, in patients with underlying hematological malignancies in a setting that frequently uses mold-active prophylaxis. Methods: This cohort study included prospectively enrolled cases (n = 106, adults; 04/2014-08/2017; Medical University of Graz, Austria) with underlying hematological malignancies and suspected pulmonary infections who underwent bronchoscopy. Serum samples were collected within 24 hours of bronchoalveolar lavage fluid (BALF) sampling. Both, serum and BALF samples, were used to evaluate diagnostic performances of the Aspergillus-specific lateral-flow device test (LFD; OLM Diagnostics), an Aspergillus-specific PCR (conducted at the University Hospital of Mannheim, Heidelberg University, Germany), galactomannan (GM), β-D-glucan (BDG), and a bundle of cytokines previously associated with IA. Cytokines included interleukin (IL)-4/-6/-8/-10/15/-17A/-22, soluble IL-2 receptor, tumor necrosis factor α, interferon-γ and C-C motif chemokine ligand 5 (CCL5); concentrations were retrospectively tested using a custom made ProcartaPlex 11plex immunoassay (eBioscience, Vienna, Austria). IA and IMI were classified according to the 2008 revised EORTC/MSG criteria. Results: Among the 106 cases, 11 had probable IA, 32 possible IA (of which 7 had probable IMI), and 63 no evidence for IMI. Underlying diseases in probable IMI cases (including probable IA) were acute myeloid leukemia/myelodysplastic syndrome (n = 11), acute lymphoblastic leukemia (n = 3), Non-Hodgkin lymphoma (n = 3) and multiple myeloma (n = 1). Neutropenia 10 days before BALF sampling were seen in 28/106 cases (including 5/11 of those with probable IA). Overall 85/106 cases (including 10/11 of those with probable IA) had received ≥2 defined daily doses of mold-active antifungal prophylaxis or treatment at the time of sample collection. Combinations of serum IL-8 with either BALF Aspergillus LFD (sensitivity 100%, specificity 94%) or BALF Aspergillus PCR (sensitivity 91%, specificity 97%) were highly sensitive and specific for differentiating probable IA from no IA (figure 1). In Receiver Operating Characteristics (ROC) curve analysis, serum IL-8 (P = 0.004) and serum IL-6 (P = 0.008) were significantly associated with probable IA, while other cytokines and also serum BDG (P = 0.271) were not associated (figure 2). ROC curve analysis also showed potential for serum IL-8 (P = 0.014) for differentiating possible and probable IMI from no IMI, followed by serum CCL5 (P = 0.038), and marginally also serum IL-10 (P = 0.045 when extrapolated low levels were included; P = 0.089 after extrapolated levels were excluded) (figure 2). In contrast, the other serum and BALF cytokines, serum GM, serum BDG and BALF GM were not discriminative. Conclusion: Our study indicates that serum IL-8 testing may be a valuable addition to clinical routine for diagnosing IA and IMI in high risk patients who have a suspected pulmonary infection with an unknown microbiologic entity while receiving mold-active antifungals. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 416505 2e53c93e-a002-41be-862e-c22e26872 fb4.jpg Caption 1: Figure 1 Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 416505 2e53c93e-a002-41be-862e-c22e26872 fb4.jpg Caption 2: Figure 2

ABSTRACT

S35

PP1.044 Clinical features and outcome of Chronic Pulmonary Aspergillosis: experience from a high tuberculosis burden country

PP1.048 The presence of Candida albicans promotes Proteus mirabilis damage to enterocytes

NOUSHEEN Iqbal, MUHAMMAD Irfan, KAUSAR Jabeen, JOVERIA Farooqi Aga Khan University, KARACHI, Pakistan

I.D. Jacobsen, M.J. Niemiec, M. Kapitan Leibniz Institute for Natural Product Research and Infection Biology, JENA, Germany

Objective: The incidence of chronic pulmonary aspergillosis (CPA) is getting high especially in high tuberculosis (TB) burden countries. However there is limited data available on CPA as a post-TB sequel and in structural lung diseases. The aim of the study is to determine the clinical characteristics and outcomes of patients with CPA in a tertiary care hospital. Methods: This is a retrospective study in patients admitted with pulmonary Aspergillosis at the Aga Khan University Hospital (AKUH), Karachi, Pakistan from January 2012 to December 2016. All adult patients (>18 years) admitted with a diagnosis of Aspergillosis using International Classification of Disease, Ninth Revision codes (ICD-9 1173) were identified. Data on demographics, comorbid conditions, underlying lung condition, radiographic and microbiological findings, requirement of invasive and non-invasive mechanical ventilation (NIMV), respiratory complications and in hospital mortality was collected on a predesigned form. CPA was defined as one or more cavities with or without a fungal ball or nodules on thoracic imaging, direct evidence of Aspergillus infection (microscopy or culture from biopsy) and exclusion of alternative diagnoses, all present for at least 3 months Results: A total of 47 patients were included, who met the inclusion criteria. Majorities were male 36(76.59%) and diabetic 14(29.78%).Mean age was 45 ± 15.7 years. The Commonest form of CPA was Simple Aspergilloma 23(48.93%) followed by Chronic cavitory pulmonary aspergillosis (CCPA) 20(42.55%),Chronic progressive pulmonary fibrosis (CPFA) 2(4.2%) and nodule 2(4.2%). The commonest underlying cause was post tuberculosis 33(70.21%) followed by bronchiectasis 14(29.78%), asthma with allergic bronchopulmonary aspergillosis (ABPA) and cardiothoracic surgery in 5(10.63%) each. Sputum culture was positive in 22(46.8%) and the commonest Aspergillus species identified was Aspergillus fumigatus 7(31.8%), flavus 7(31.8%) followed by niger 6(27.2%) and terrus 3(13.6%).Surgical excision was done in 23(48.93%) while itraconzole received by 31(65.95%) patients. Out of 47, three patients died due to chronic respiratory failure. Conclusion: Currently the burden of CPA is raising especially in high TB burden countries like Pakistan. We found Aspergilloma and CCPA as the commonest form of CPA. Further large prospective studies using Aspergillus specific IgG antibodies testing are required for better understanding of prevalence of CPA.

Objective: The human gut is a relevant source for disseminated infections. While the role of host factors for the risk of microbial translocation is well established, the impact of microbial interactions on translocation and the development of infections is less studied. We thus investigated if fungal-bacterial interactions affect virulence. Methods: We used an enterocyte cell culture model and determined damage after infection with either bacteria, Candida or a combination thereof. Furthermore, microscopical analysis and determination of cfu was performed. To study fungal-bacterial interactions in the absence of host cells, in vitro co-culture using different media and a static biofilm model were employed. Results: The damage upon co-infection with Proteus (P.) mirabilis and C. albicans was significantly higher compared to summed-up single-species damage. This synergistic effect was observed with several primary P. mirabilis clinical isolates from urine and blood cultures, independent of the site of isolation, the ability to swarm on agar plates, the damage potential of the P. mirabilis strain alone, and oxygen levels. It did however dependent on the presence of P. mirabilis hemolysin HpmA. In contrast, C. albicans filamentation and candidalysin-mediated cell damage were dispensable for synergistic interactions. Interestingly, less virulent and avirulent yeasts, e.g. Saccharomyces cerevisiae, did also promote synergistic host cell damage with P. mirabilis, but the effect was not observed with all Candida species tested. Both fungal and bacterial numbers during co-infection were comparable to single-strain infections. In the absence of host cells, fungal numbers were reduced during long-term coincubation with P. mirabilis while bacterial survival was prolonged, suggesting antagonistic interactions favoring P. mirabilis. Similarly, Candida survival was reduced in mixed biofilms in human urine. Conclusion: Our results indicate synergistic interactions between C. albicans and P. mirabilis on enterocytes, resulting in increased host cell damage. This is not caused by enhanced growth of either pathogen but appears to be due to enhanced cytotoxicity of P. mirabilis. As synergistic damage depended on the presence of the P. mirabilis hemolysin HpmA, we currently test the hypothesis that hemolysin production is upregulated in the presence C. albicans. Of note, synergism was only observed in the presence of host cells, implicating that the type of microbial interactions are influences by the environmental context. Therefore, we are currently conducting further experiments in nematodes and mice to determine if synergistic virulence also occurs in vivo.

PP1.045 In vivo analysis of A. fumigatus sulphur-related transcriptome during infection using a NanoString nCounter Plattform M. Sueiro-Olivares, J. Scott, E. Bignell, J. Amich University of Manchester, MANCHESTER, United Kingdom Objective: The regulation of sulphur assimilation has been demonstrated to be essential for A. fumigatus virulence (1). Therefore, sulphur metabolism is a promising pathway to identify relevant virulence traits which can be exploited as targets for fighting fungal infection. To identify gene products which are relevant for infection one approach is to analyse the in vivo transcriptome. However, detection and analysis of the fungal transcriptome during infection is a persistent challenge, as fungal RNA usually represents between 0.05 and 0.5% of the total RNA isolated from infected organs (2). The aim of this work is to determine specific sulphur metabolic related genes which are relevant for infection of mammalian hosts using the NanoString nCounter Platform. NanoString nCounter is a novel probe based technology with an excellent reproducibility, sensitivity, and specificity when compared to other transcriptomic methods such as microarray or RT-qPCR. Its high sensitivity, being capable of detecting as little as 0.5 fM of mRNA, makes this technology ideal to detect fungal RNA during infection. Furthermore, its incomparable specificity is fundamental to prevent any crosstalk with the much more abundant mammalian RNA. Methods: Fungal RNA has been isolated from in vitro samples grown on different concentrations and sources of sulphur and from lungs of leukopenic infected mice. RNA has then been hybridised to a cartridge containing probes for the detection of 72 genes of interest (including 4 housekeeping genes) and run on a NanoString nCounter System. We have further investigated the efficiency of linear amplification of RNA samples using a Multiplex Target Enrichment (MTE) protocol. Results: The in vitro samples have generated clear and characteristic profiles which can be clustered to show the similarity among different concentrations and sources tested. Comparison and hierarchical clustering with the in vivo samples suggests that the murine lung constitutes a sulphur limiting environment, with some differential characteristics. Analysis of the expression of single genes allow identification of those that are upregulated in the murine lung compared to all tested conditions (i.e. are likely relevant for infection). Importantly, some genes which can be considered controls (as hapX) have been detected in this manner. Furthermore, analysis of the expression pattern of sulphur-related genes in the murine lungs suggests that the exploited S-sources are organic. Direct comparison between the fold change of MTE amplified and non-amplified in vitro and in vivo samples have demonstrated that MTE amplification is linear and maintain the rates. This will become relevant for the analysis of samples in which the expected amount of RNA is below the detection limit. Conclusion: Our results demonstrate that NanoString Technology is a promising approach to analyse the transcription levels during fungal infection. Data obtained so far suggest that the murine lung constitutes a sulphur limiting environment and have identified promising genes which will be investigated further. We now plan to investigate sulphur-related gene expressions at different infection times, in different murine immunosuppression models and in patient samples. 1) Amich et al., 2013 PLoS Pathog 2) Xu et al., 2016 Methods Mol Biol PP1.046 Ultrastructural changes of Trichophyton rubrum in tinea unguium after itraconazole therapy in vivo observed using scanning electron microscopy X. Yue1 , A. Wang2 Beijing Tian Tan Hospital, Capital Medical University, BEIJING, China 2 Peking University First Hospital., BEIJING, China

1

Objective: Using Scanning electron microscopy (SEM) to observe in vivo ultrastructural changes of tinea unguium caused by Trichophyton rubrum (T. rubrum) before and after itraconazole (ICZ) therapy, and explore the in vivo antifungal effect of ICZ. Methods: Ten outpatients diagnosed with tinea unguium caused by T. rubrum after mycology and SEM were recruited. They received ICZ pulse therapy (200 mg twice/day for 1 week, stop for 3 weeks, repeated for 3–4 months). Clinical change, mycology and SEM results were obtained after therapy. Results: After ICZ therapy, three cases was positive by both mycology and SEM, which showed completely dry, curved, shrivelled and folded hyphae with a relatively smooth surface or local destruction. Several hyphae remained intact with only several local bumps or crimps. The other cases were negative by SEM, but two were positive by mycology. Conclusion: In vivo ultrastructural changes of hyphae of T. rubrum in tinea unguium after ICZ treatment were first observed using SEM, demonstrating that SEM is a good tool for evaluating the effectiveness of ICZ in vivo and that ICZ fungistasis was effective. Moreover, this study is the first to prove that ICZ permeated the affected nail plate via the nail bed capillaries using SEM. PP1.047 Pleurotus sajor-caju can be used to synthesize silver nanoparticles with anti-fungal activity against Candida albicans D. Sandai1 , Y. Tabana2 , F. Musa1 Universiti Sains Malaysia, PENANG, Malaysia 2 University of Alberta Canada, EDMONTON, Canada 1

Objective: Green synthesis of silver nanoparticles (AgNPs) has become widely practiced worldwide. In this study, AgNPs were synthesized using a hot-water extract of the edible mushroom, Pleurotus sajor-caju. Methods: The product, PSC-AgNPs, was characterized by using UV-Vis spectra, DLS analysis, TEM, XRD and FTIR spectrometry. To assess its antifungal activity against C. albicans, gene transcription and protein expression analyses were conducted for CaICL1 and its product, ICL using RT-qPCR and western blot, respectively. Results: PSC-AgNPs with an average particle size of 11.68 nm inhibited the growth of the pathogenic yeast C. albicans. MIC and MFC values were 250 mg/L and 500 mg/L, respectively. TEM images revealed that the average particle size of PSC-AgNPs was 16.8 nm, with the values for zeta potential and the polydispersity index being -8.54 mV and 0.137, respectively. XRD and FTIR spectra showed PSC-AgNPs to have a face-centered cubic (FCC) crystalline structure. The polysaccharides and amino acid residues present in P. sajor-caju extract were found to be involved in reducing Ag+ to AgNP. Both CaICL1 transcription and ICL protein expression were found to be suppressed in the cells treated with PSC-AgNPs as compared with the control. Conclusion: Our PSC-AgNPs preparation makes for a promising antifungal agent that can downregulate isocitrate lyase.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

PP1.081 Therapeutic effects of an antibody-derived peptide and its alanine scanning derivatives in a Galleria mellonella model of systemic candidiasis E. Borghi1 , E. Ottaviano1 , L. Giovati2 , M. Falleni1 , D. Tosi1 , W. Magliani2 , G. Morace1 , L. Polonelli2 , S. Conti2 , T. Ciociola2 Universita` degli Studi di Milano, MILAN, Italy University of Parma, PARMA, Italy

1 2

Objective: The synthetic peptide T11F, with sequence identical to a fragment of the constant region of human IgM, and most of its substituted alanine derivatives proved to possess a significant in vitro candidacidal activity (EC50 values in the micromolar range). In this study, the therapeutic efficacy of T11F and two selected derivatives, D5A, the most active in vitro, and F11A, characterized by a different conformation, was investigated in a Galleria mellonella infection model by Candida albicans. Methods: Last instar G. mellonella larvae (16 larvae/group) were used for this study. For toxicity experiments, larvae were inoculated directly into the hemocoel, via the last left pro-leg, with the selected peptides (15 μmol/kg). Control groups consisted of larvae untouched or inoculated with saline. Potential therapeutic activity of selected peptides was then evaluated by inoculating C. albicans SC5314 suspension (5 × 105 cells/larva); 30 min after Candida challenge, larvae were injected via the last right pro-leg with the selected peptides (10 μmol/kg) or saline (control). Larvae were then transferred into clean Petri dishes, incubated at 37◦ C in the dark for 9 days, and scored daily for survival. Survival curves of peptide-treated and control animals were compared by the Mantel-Cox log-rank test. A value of P < 0.05 was considered significant. Peptide modulation of host immunity to C. albicans infection was determined using hemocyte analysis, by hemocytometer count and cytospin, and larval histology. Results: All the tested peptides showed lack of toxicity in this experimental model, with survival curves similar to control group (saline-injected). A single injection of F11A derivative, but not D5A and T11F, in larvae infected with C. albicans SC5314, led to a significant increase in survival, in comparison with infected animals treated with saline. Hemocytes analyses and histology highlighted a different immune stimulation by the studied peptides. In particular, F11A was the most active in eliciting nodule formation and melanization and in fat body activation, leading to a better control of yeast growth. Indeed, F11A-treated larvae showed stronger hemocytes recruitment at tissue level and no yeast hyphal forms were noticed compared with D5A- and T11F-treated groups. Conclusion: Overall, the different therapeutic effects observed in vivo against C. albicans systemic infection allow for hypothesizing a critical role in immune system activation. Although all peptides displayed similar activity in vitro, only F11A was efficient in increasing larvae survival, by promoting a protective immune response characterized mainly by granulocytes and plasmatocytes. Our data suggest for F11A a double role, targeting simultaneously the fungus and the immune system, which results in pathogen clearance. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 420033 36848294-efdb-4621-8fab-d5c 9892256e9.jpg Caption 1: Figure legend- Cytospin analysis performed at 24 h

PP1.082 Understanding the role of biofilms in recurrent vulvovaginal candidiasis (RVVC) and their impact on therapy R. Kean1 , L Sherry1 , E McKloud1 , R Metcalfe2 , R Thomas2 , G Ramage1 1 University of Glasgow, GLASGOW, United Kingdom 2 NHS Greater Glasgow and Clyde, GLASGOW, United Kingdom Objective: Vulvovaginal candidiasis (VVC) is a global health problem, affecting up to 75% of healthy women at least once during their lifetime. Although the majority of cases are treated effectively, ∼10% of patients encounter treatment failure and complain of more than 4 episodes of VVC per year, defined clinically as recurrent VVC (RVVC). It has been hypothesised that RVVC proves difficult to treat due to the presence of biofilms within the vaginal mucosa, however definitive evidence for this is lacking. Therefore, the role of biofilms in RVVC needs to be evaluated to aid the management of this infection. Methods: An anonymised series of high vaginal swabs (HVS, n = 300) were obtained from woman reporting VVC, for at least the second time. The causative organism was identified using MALDI-TOF and biofilm formation assessed using crystal violet and metabolic dyes. Antifungal sensitivity testing was performed on planktonic cells and mature (24 h) biofilms, using antifungals currently used clinically (fluconazole, miconazole and clotrimazole) as well as the alternative natural agent carbohydrate-derived fulvic acid (CHD-FA). Results: Only 71% of isolates were identified as C. albicans, with the remaining isolates including C. glabrata, C. dubliniensis, and C. parapsilosis. Biofilm assessment showed vaginal isolates were able to form differential biofilms regardless of species; with C. albicans isolates eliciting the greatest variation in biomass. Fluconazole, the first line antifungal used to treat VVC, was ineffective against most isolates, with planktonic MIC’s ranging from 1–32 mg/mL however when this agent was tested against sessile populations the MIC’s ranged from 16→32 mg/mL. In contrast, the natural agent CHD-FA was shown to be equally effective against both planktonic and sessile cells with an MIC of 0.25%. Conclusion: Biofilm heterogeneity may contribute to the management of VVC infections, as these communities are known to be notoriously recalcitrant to antifungal therapy, and has been shown to correlate with in vitro antifungal therapy. Furthermore, the effectiveness of the natural agent CHD-FA, highlights its potential role to be used in the clinical management of these infections. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 423576 168f28a7-2067-4809-8464-5453c9205 d9b.png Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 423576 168f28a7-2067-4809-8464-5453c9205 d9b.png

S36

PP1.083 Major transcriptional modulations in S. aureus induced by the C. albicans secreted quorum sensing molecule farnesol T. Vila, E. Kong, M.A. Jabra-Rizk University of Maryland Baltimore, BALTIMORE, USA

Medical Mycology, 2018, Vol. 56, No. S2

PP1.087 Comparative genomics of Aspergillus fumigatus and the role of agricultural azoles on the emergence of resistance A. E. Barber1 , J. Born2 , I. Schliebner2 , A. Lange1 , H. Deising2 , O. Kurzai3 1 Leibniz Institute of Natural Product Research and Infection Biology - HKI, JENA, Germany Martin Luther University Haale-Wittenberg, HAALE (SAALE), Germany 3 University of Wuerzburg, WUERZBURG, Germany 2

Objective: In polymicrobial infections the presence of one microorganism may augment the pathogenesis of another. Candida albicans and the bacterial pathogen Staphylococcus aureus are the most frequent combination of organisms isolated from the human host. Our preliminary studies had elucidated complex and dynamic interactions between these two pathogens with important clinical and therapeutic implications. In this study, we aimed to expand our investigations to explore and characterize mechanisms orchestrating inter-species interactions with pathogenic implications, namely those mediated by quorum sensing molecules. Specifically, we investigated the impact of the C. albicans secreted quorum sensing molecule farnesol on S. aureus phenotypically, and on a molecular level. Methods: A S. aureus farnesol-sensitized phenotype was generated through sequential growth in media supplemented with exogenous farnesol. At various time points, cells were recovered and assessed for antimicrobial resistance against vancomycin. RNA was simultaneously extracted from these cells at each time point for gene expression studies targeting a family of drug efflux genes most notably involved in development of drug resistance in S. aureus. Based on the generated initial findings, comprehensive transcriptional analysis was subsequently performed on the farnesol-sensitized cells using RNA sequencing followed by functional categorization of the differentially expressed genes. Results: Findings from these studies demonstrated that farnesol exposure resulted in a S. aureus phenotype highly resistant to antimicrobials, mediated by over expression of drug efflux pumps. Comparative transcriptional analysis demonstrated major transcriptome alterations in S. aureus induced by farnesol involving key regulatory pathways impacting various aspects of S. aureus pathogenesis. Conclusion: Combined, these novel findings support the hypothesis that farnesol-induced transcriptional modulations of key regulatory networks and pathways may impact S. aureus fitness, antimicrobial tolerance and virulence, and in turn, the pathogenesis of mixed C. albicans-S. aureus infections. We expect these findings to provide valuable mechanistic insights into the dynamics of inter-species signaling and resistance of polymicrobial infections, which may aid in identifying novel targeted therapeutic strategies. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 424551 728a19e5-920b-40ce-9440-b31da5355 81b.png Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 424551 728a19e5-920b-40ce-9440-b31da5355 81b.png

PP1.084 Distribution, Characterization and Antifungal susceptibility pattern of Candida Species in various Clinical samples at a Multispecialty Hospital - Indian scenario Swati Salila Indira Gandhi Inst. of Medical Sciences, PATNA, India Objective: To determine the predominant Candida species in various clinical samples, its phenotypic identification and to evaluate the antifungal susceptibility of these isolates. Methods: A hospital based observational cross-sectional study was conducted from December 2016 to June 2017 in the Department of Microbiology, Indira Gandhi Institute of Medical Sciences, Patna, a tertiary care hospital of Bihar. One hundred and six isolates of Candida spp. were cultured on Sabouraud dextrose agar (SDA). Candida spp. were identified by four standard methods, germ tube test, CHROMagar Candida, cornmeal agar and carbohydrate utilization test (KB006 HICandida Identification Kit). Detection of antifungal susceptibility testing was done by Vitek-2 Fungal Susceptibility Card (AST YS01) kits (Biomerieux). Results: A total 106 samples were collected which mostly comprised of urine (57%) followed by blood (18%), HVS (10%), sputum (8%), pus (4%), oral swab (2%) and stool (1%). There were 64 males and 42 females. It showed dominance of non-albicans Candida spp. (71%) over Candida albicans (29%). Strains of C.albicans were 100% sensitive to Fluconazole and Caspofungin. Few strains showed resistance against Voriconazole (6.45%), Micafungin (3.22%), Amphotericin-B (12.90%) and Flucytosine (3.22%). Resistance pattern among the non-albicans Candida spp. were as follows: Fluconazole (16.0%), Voriconazole (13.33%), Amphotericin-B (6.66%) and Flucytosine (2.66). Otherwise non-albicans strains were 100% sensitive to Caspofungin, Micafungin. Conclusion: The changing epidemiology of Candida infection highlights the need for close monitoring of Candida species distribution and susceptibility to optimize treatment and outcome. Invasive fungal infections seriously threaten the health of hospitalized patients, causing substantial morbidity, mortality, and increases in hospital costs. Therefore, early and accurate diagnosis of Candida infection is essential since each species varies significantly in susceptibility to the currently used antifungal drugs.

PP1.085 Protein kinase A governs growth and virulence in Candida tropicalis CJ Lin, CY Wu, SJ Yu, YL Chen National Taiwan University, TAIPEI, Taiwan Objective: Candida tropicalis is one of the most important human fungal pathogens causing superficial infections in locations such as the oral mucosa and genital tract, as well as systemic infections with high mortality. In its sister species Candida albicans, the cyclic AMP/protein kinase A (cAMP/PKA) pathway regulates fungal adhesion and dimorphism, both of which correlate closely with virulence. CaTpk1 and CaTpk2, the catalytic subunits of PKA, not only share redundant functions in hyphal growth, adhesion, and biofilm formation, but also have distinct roles in stress responses and pathogenesis, respectively. However, studies on PKA in the emerging fungal pathogen C. tropicalis are limited. Methods: In this study, we disrupted the catalytic subunits of PKA (Tpk1 and Tpk2) in C. tropicalis and used phenotype assays, adherence assays and murine model of systemic infection to characterize the roles of PKA in growth and virulence in C. tropicalis. Results: Our results suggest that Tpk1 is involved in cell wall integrity and drug tolerance. The tpk2/tpk2 mutants, which have no protein kinase A activity, have reduced hyphal growth and adhesion. In addition, the tpk1/tpk1 tpk2/tpk2 double deletion mutant demonstrated delayed growth and impaired hyphal formation. In a murine model of systemic infection, both TPK1 and TPK2 were required for full virulence. We further found that EFG1 and HWP1 expression is regulated by PKA, while BCR1, FLO8, GAL4, and RIM101 are upregulated in the tpk1/tpk1 tpk2/tpk2 mutant. Conclusion: This study demonstrates that Tpk1 is involved in drug tolerance and cell wall integrity, while Tpk2 serves as a key regulator in dimorphism and adhesion. Both Tpk1 and Tpk2 are required for growth and full virulence in C. tropicalis.

PP1.086 Evolution of fluconazole-resistant Candida albicans strains by drug-induced sexual recombination ¨ JOACHIM Morschhauser, CHRISTINA Popp ¨ ¨ Germany University of Wurzburg, WURZBURG, Objective: Candida albicans can develop resistance to the widely used antifungal agent fluconazole, which inhibits ergosterol biosynthesis. Resistance is commonly caused by mutations in the target enzyme Erg11 or by gain-of-function mutations in the transcription factors Mrr1, Tac1, and Upc2, which result in overexpression of multidrug efflux pumps and ergosterol biosynthesis genes. Many fluconazole-resistant isolates are homozygous for the mutated genes and exhibit multiple resistance mechanisms. The loss of heterozygosity is frequently accompanied by MTL homozygosity, which enables the cells to switch to the mating-competent opaque cell form. We therefore investigated if sexual recombination may be involved in the evolution of highly drug-resistant strains. Methods: We propagated a set of isogenic strains that were heterozygous for ERG11, MRR1, TAC1 and UPC2 alleles with resistance mutations in the presence of fluconazole. Results: This resulted in the emergence of derivatives with increased resistance that had become homozygous for the mutated allele and the mating type locus. When mixing MTLa/a and MTLα/α cells of these strains in all possible combinations, we could isolate mating products containing the genetic material from both parents. The initial mating products did not exhibit higher drug resistance than their parental strains, but further propagation under selective pressure resulted in the loss of the wild-type alleles and increased fluconazole resistance. Conclusion: Our results demonstrate that fluconazole treatment not only selects for resistance mutations but also promotes genomic alterations that confer mating competence. This allows cells in an originally clonal population to exchange individually acquired resistance mechanisms by sexual recombination and generate highly drug-resistant progeny.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Objective: Aspergillus fumigatus is a ubiquitous, opportunistic fungus capable of causing life-threatening invasive infections and allergic bronchopulmonary disease. Over the last decade there has been a rapid and global emergence of azole resistance in A. fumigatus and the dominant resistance mechanism is of environmental origin, suggesting that resistance is emerging through a selective pressure applied by the widespread usage of azole antifungals in agriculture. However, the influence of these fungicides on the ecology of A. fumigatus in the environment and the emergence of resistance remain largely unknown and will be addressed in this study through the functional and genomic comparison of A. fumigatus isolated from conventional agricultural sites in Germany utilizing azoles and from organic agriculture withholding these compounds. Methods: Soil samples were collected from farms in Saxony, Saxony-Anhalt, and Thuringia. A. fumigatus was isolated from soil using temperature selective incubation and confirmed by morphological and molecular characteristics. Strains were examined for resistance to medical and agricultural azoles, as well as submitted for whole-genome sequencing (WGS). Results: Using the EUCAST-validated VIP Check assay, 11% of strains tested display resistance to one or more medical azoles. Cross resistance to commonly-applied agricultural azoles is currently being assessed. With the recent submission of 300 strains for WGS, we seek to address questions such as: are there discrete genomic differences in strains isolated from conventional agriculture compared to those originating from organic agriculture? What sorts of population shifts occur after a growing season and the application of azoles? How much genomic diversity is present in A. fumigatus strains isolated from a single agricultural site and between different sites? Finally, through the large-scale comparison of environmentally-isolated A. fumigatus with clinical isolates, can we identify fungal determinants critical for human infection? Conclusion: Our observed azole resistance rate of 11% among environmental A. fumigatus isolates highlights the problem of antifungal resistance and we hope that the increased understanding of the ecology and epidemiology of A. fumigatus obtained in this study can be applied towards improving management of aspergillosis in the era of increasing antimicrobial resistance.

PP1.088 In vitro antifungal susceptibility testing of Candida isolates from women with recurrent vulvovaginal candidiasis Stavroula Antonopoulou1 , DROSOS KARAGEORGOPOULOS2 , JOSEPH MELETIADIS3 , FLAVIA De BERNARDIS4 1 Faculty of Biology.University of Athens, ATHENS, Greece Hygeia Hospital, ATHENS, Greece 3 Attikon University Hospital, ATHENS, Greece 4 Istituto Superiore di Sanita, ROME, Italy 2

Objective: Vulvovaginal canididiasis (VVC) is a common infection among premenstrual women. Around 10–20% of women will have recurrent VVC (RVVC) (four or more episodes per year). This is often due to non-albicans Candida spp., which have reduced susceptibility to antifungal agents. Due to the lack of clinical breakpoints for topical antifungals, epidemiological cut-off values may be used to detect non-wild type isolates. We aimed to determine the ECOFFs of RVVC isolates to different antifungal agents and identify the best indicator drugs to be used for routine screening for resistant isolates. Methods: More than 500 Candida spp. isolates have been collected over the past 10 years from women with RVVC at MycoLab outpatient microbiology laboratory, Athens, Greece and were stored at -70◦ C. They were revived by subculturing at 35◦ C on Chromagar plates. Species identification was performed with Auxacolor (Biorad) and additional techniques, as required. Inocula were prepared and adjusted to 0.5 McFarland standard. The following antifungal agents were used for susceptibilty testing according to the EUCAST E.Def. 7.3 protocol: clotrimazole, econazole, fluconazole, itraconazole, ketoconazole, miconazole, and boric acid. Two-fold serial dilutions of the drugs were prepared in 96-well microplates. The final drug concentrations ranged from 0.016 to 16 mg/l. The final inoculum was in the 1–5 × 105 CFU/ml range. Microplates were incubated at 35◦ C for 24 h and the optical density OD of each well was measured at 530 nm. The MIC was determine as the lowest drug concentration producing >50% growth inhibition. The median MICs, MIC90 and the MIC range was determined for each drug and Candida spp combination. The epidemiological cut-off values (ECOFFs) were determined with the ECOFFinder calculator. The % of isolates with an MIChigher than the ECOFF reflecting non wild-type isolates was determined. The differences in the MICs among different drugs were analyzed with AVONA followed by multiple comparison test after log2 transformation. In order to assess cross-resistance, the log2 MICs of each drug was correlated with the log2 MICs of the other drugs using Pearson analysis. Results: The current study will help to determine the epidemiology and in vitro susceptibility of Candida isolates from women with RVVC. The in vitro susceptibility to different drugs used to treat RVVC will be compared. Furthermore, epidemiological cutoff values will be determined for each Candida species. The ECOFF values will help to detect non-wild type isolates with reduced susceptibility and possible poor clinical outcome. Drugs indicators of in vitro susceptibility will be identified in order to facilitate clinical labs to screen fast with minimal requirements Candida RVVC isolates. Finally, the findings of this study will be communicated to the EUCAST subcommittee for antifungal susceptibility testing in order to formulate guidelines for isolates involved in RVVC. Conclusion: C. albicans and non-albicans isolates from RVVC have reduced in vitro susceptibility to antifungal drugs used for the treatment of RVVC (2, 3). However, the in vitro susceptibility is not similar of all isolates of the same species and therefore in vitro antifungal susceptibility testing is necessary for therapeutic and epidemiological purposes.

ABSTRACT

PP1.121 Validation of diagnostic criteria for chronic pulmonary aspergillosis (CPA) ID Page1 , R Byanyima2 , S Hosmane3 , C Opira4 , J Opwonya5 , M Richardson1 , R Sawyer6 , A Sharman6 , DW Denning1 1 The University of Manchester, MANCHESTER, United Kingdom 2 Kampala Imaging Centre, KAMPALA, Uganda 3 Manchester University Hospitals NHS Foundation Trust, UK, MANCHESTER, United Kingdom 4 St. Mary’s Hospital, Lacor, GULU, Uganda 5 Gulu District Health Office, GULU, Uganda 6 Manchester University Hospitals NHS Foundation Trust, MANCHESTER, United Kingdom Objective: Chronic pulmonary aspergillosis (CPA) is a serious condition estimated to afflict millions of people worldwide. Denning et al initially proposed the case definition upon which all subsequent studies have been based in 2003, with guidelines later published by ESCMID in 2016. These definitions are arbitrary in nature. In 2015 we completed the first survey of CPA prevalence. We have now analysed the results of that study to see which clinical and radiological features are associated with raised Aspergillus-specific IgG and CPA diagnosis to validate the case definition used and inform future case definitions. Methods: 400 adults with treated tuberculosis were recruited between October 2012 and February 2013. 285 were resurveyed between October 2014 and January 2015. Aspergillus-specific IgG was measured by Siemens Immulite 2000 with results above 20 mg/L reported as positive. Clinical assessment and chest X-ray were performed on both occasions. CT thorax was performed in those with suspicion of fungal ball on chest X-ray or raised Aspergillus-specific IgG. CPA was diagnosed in patients with all of; 1 - cough or haemoptysis for 3 1 month, 2 – Either paracavitary fibrosis or fungal ball on CT thorax or progressive cavitation on serial chest X-rays, 3 – Raised Aspergillus-specific IgG, 4 - Absence of positive GeneXpert test for M. tuberculosis. Results: CPA was diagnosed in 14 (4.9%) of patients with a statistically non-significant trend towards decreased CPA frequency in those with HIV co-infection (3% vs. 6.7%, P = 0.177). Case definition features cough, haemoptysis, fungal ball and paracavitary fibrosis (on CT thorax) were all associated with CPA. Each was also associated with raised Aspergillus-specific IgG. Chest pain was also significantly more common in those with CPA (50% vs. 25%, P = 0.043). Chest X-ray cavitation, fungal ball, paracavitary fibrosis and pleural thickening were all significantly more common in those with raised Aspergillus-specific IgG. Cavitation, pleural thickening and destroyed lung on CT thorax were all significantly more common in those with raised Aspergillus-specific IgG and CPA. Bronchiectasis and nodules were not associated with raised Aspergillus-specific IgG. Conclusion: This study provides the first validation of the arbitrary case definitions used in CPA research and clinical practice. The association with raised Aspergillus-specific IgG levels provides validation for the established use of cough, haemoptysis, fungal ball and paracavitary fibrosis in the case definition. While chest pain and pleural thickening are recognized features of CPA, they do not normally form part of the case definition used in studies. It may now be appropriate to include them in future case definitions. It has been postulated that raised Aspergillus-specific IgG might simply be due to colonization of bronchiectatic airways, rather than CPA. The absence of any association between bronchiectasis and raised Aspergillus-specific IgG in this treated tuberculosis cohort suggests this is not the case. PP1.122 Cutaneotrichosporon (Cryptococcus) cyanovorans, a basidiomycetous yeast, described for the first time from the airways of cystic fibrosis patients T. Van der Bruggen1 , A. Kolecka2 , B. Theelen2 , J.M. Kwakkel-van Erp1 , H.G.M. Arets1 , T. Boekhout2 1 University Medical Center Utrecht, UTRECHT, Netherlands 2 Westerdijk Fungal Biodiversity Institute, UTRECHT, Netherlands Objective: Cystic fibrosis (CF) patients are colonized by a multitude of bacteria and fungi. In our institute, respiratory specimen from a large part of the Dutch CF population is frequently cultured. Occasionally, micro-organisms are isolated that are difficult to identify, like a yeast we cultured from two CF patients. The objective was to identify this yeast correctly. Methods: Identification methods consisted of matrix assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) using the MALDI biotyper (Bruker, Germany) and internal transcribed spacer (ITS) and ribosomal large subunit (LSU) sequencing. Results: From respiratory specimen obtained from two CF patients (37 and 20 years old), a difficult to identify yeast was repeatedly isolated over a period of about 4 years. Identification by MALDI-TOF-MS was inconclusive. The yeasts of both patients were eventually identified by ITS and LSU sequencing as Cutaneotrichosporon (Cryptococcus) cyanovorans. The MALDI-TOF-MS database does not currently contain spectra of C. cyanovorans, explaining the inability of identification by MALDI-TOF-MS. So far, C. cyanovorans has not been described before in CF patients. This basidiomycetous yeast was originally isolated from cyanide contaminated soil in South Africa. Phylogenetic analysis showed that the clinical isolates are closely related to the South African strains. However, both patients have never been in South Africa. Intriguingly, C. cyanovorans can grow in the presence of cyanide in vitro. In general, cyanide can be measured in the lungs of many CF patients, suggesting the possibility of an advantageous pulmonary environment in CF for C. cyanovorans. However, we were not able to perform a measurement of cyanide levels in our patients. Currently, it is not possible to discriminate between colonization and infection. Conclusion: The presence of C. cyanovorans in respiratory specimen of CF patients is a novel finding. Further study is needed to determine whether or not more positive CF patients can be identified. If so, a possible relation with cyanide in the CF lung and the clinical significance can be investigated. PP1.123 Prevalence, identification and antifungal susceptibility pattern of Candida species isolated from Iranian HIV patients with oropharyngeal candidiasis M. Roudbary1 , S. Khedri1 , A.L.S. Dos santos2 , R. Hadighi1 , M. Falahati1 , S. Farahyar1 , M. Khoshmirsafa1 1 Iran University of Medical Sciences, TEHRAN, Iran 2 Federal University of Rio de Janeiro, RIO DE JANEIRO, Brazil Objective: Candidiasis is an important opportunistic fungal infection in hospitalized patients as well as in immunocompromised individuals especially in cancer-treated patients, organ transplant recipients and HIV-infected persons. Oropharyngeal candidiasis (OPC) is a common mucocutaneous infection in more than 90% of the HIV-infected patients, particularly in the early and advanced stages of AIDS. In this study we identified the Candida species isolated from oral cavity of Iranian HIV/AIDS patients by conventional and molecular methods, as well as antifungal susceptibility test for Candida strains against five antifungal agents examined. Methods: Herein, Specimens were obtained by sterile cotton swab from the tongue and buccal mucosa lesions from 150 HIVpositive patients admitted at the HIV Health Centers in Tehran,Iran during 6 months .At first,direct examination using KOH 10% was carried out.Then,the samples cultured on Sabouraud-dextrose agar (SDA)and identified by conventional methods(CHROM agar candida,Corn meal agar), PCR amplification and Sequencing of ITS region. Minimum inhibitory concentration (MIC50,MIC90 and geometric mean (GM) of MIC) of 102 Candida spp. was performed against itraconazole, fluconazole, voriconazole, caspofungin, and amphotericin B, using the broth microdilution assay according to the Clinical and Laboratory Standard Institute (CLSI; protocol M27-S3). Breakpoint for fluconazole, voriconazole, caspofungin provided by CLSI M27-S4 recommendation. Results: Eighty nine patients (59.3%) had positive culture for Candida and presented clinical signals of classical oral candidiasis. In this group, 102 morphologically distinct colonies were recovered and subsequently identified by polymerase chain reaction (PCR) and sequencing assay, presenting the following frequency: 54 C. albicans (52.9%), 16 C. dubliniensis (15.7%), 12 C. tropicalis (11.8%), 9 C. glabrata (8.8%), 7 C. kefyr (6.9%) and 4 C. africana (3.9%). Additionally, multiple Candida species were co-isolated from 13.5% (12/89) patients. Regarding the antifungal susceptibility test, all Candida isolates were susceptible to amphotericin B and caspofungin, while some of them were resistant to fluconazole (17.6%; 16 C. albicans, 1 C. dubliniensis and 1 C. glabrata), itraconazole (16.7%; 15 C. albicans, 1 C. dubliniensis and 1 C. tropicalis) and voriconazole (5.9%; 5 C. albicans and 1 C. tropicalis). Conclusion: Taken together, our finding displayed that HIV/AIDS patients are susceptible to oral candidiasis-related to host factors. Early and accurate detection of OPC could result in better outcome in infected patients. Even with the prophylaxis and treatment with antifungal agents, the increasing of resistance to common antifungal drugs in HIV-infected individuals has been noticed as well as the increase frequency of non-albicans Candida species.Finding reinforce the urgent necessity to address alternative therapeutic agents or combination therapy for treating oral candidiasis in HIV-positive patients to overcome the high incidence of azole-resistant C. albicans strains and.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

S37

PP1.124 The prevalence and diversity of fungi in respiratory samples of cystic fibrosis patients - a Dutch, nationwide, prospective, multicentre study T. G.P. Engel1 , L. Slabbers1 , C. De Jong1 , W.J.G. Melchers1 , F. Hagen2 , P.E. Verweij1 , P.J.F.M. Merkus1 , J.F. Meis2 1 Radboud University Medical Centre, NIJMEGEN, Netherlands Canisius Wilhelmina Ziekenhuis (CWZ), NIJMEGEN, Netherlands

2

Objective: Cystic fibrosis (CF) is a congenital disorder that leads to multiorgan disease, with progressive lung injury contributing most to the morbidity and mortality of patients. Thickened mucus and recurring infections with bacteria leads to chronic colonization and loss of mucociliary clearance. Fungal colonization is obtained from the environment and locally performed epidemiology studies are necessary for patient management. Our objective was to investigate the prevalence and diversity of fungi in Dutch CF patients. Additionally we assessed azole resistance in Aspergillus fumigatus. Methods: Over a 3-year period, all fungal isolates cultured from respiratory specimens of CF patients from 5 CF centers, were collected. Samples were inoculated onto Sabouraud dextrose agar (SDA) and Medium B+. Molecular identifications were performed in one centre, using Amplification Fragment Length Polymorphism (AFLP) and sequence based identification using the loci ITS, calmodulin and/or β-tubulin. Azole resistance was assessed for all A. fumigatus using a qPCR assay followed by phenotypic confirmation. Results: In 699 patients fungi were recovered from at least one respiratory sample, corresponding with 3,787 cultured fungal species. A. fumigatus was cultured most often with a prevalence of 31.7%, followed by Penicillium spp. (12.6%), other Aspergillus spp. (5.6%), Scedosporium/Lomentospora complex spp. (4.5%) and Exophiala (Wangiella) dermatitidis and Cladosporium spp. (1.1% each). In total 115 different fungal species were identified, with 40 Penicillium spp. and 15 Aspergillus spp. Azole resistance frequency was 7.1%, with TR34 /L98H being the dominant genotype. Conclusion: This is the first Dutch multicentre study analyzing the diversity and prevalence of fungi in respiratory samples of CF patients. A vast diversity of filamentous fungi was demonstrated, dominated by Aspergillus and Penicilium species. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 420000 41370871-3415-42ef-b109-249284c 3dbca.jpg

PP1.125 Identification of encapsulated viable Cryptococcus neoformans in bronchoalveolar lavage of the patient with active pulmonary Tuberculosis and relapsing pneumonia S. Amani Ghayoum1 , N. Davoodian2 1 Hormozgan University of Medical Siences, BANDAR ABBAS, Iran 2 Hormozgan University of Medical Siences, BANDARABAS, Iran Objective: Cryptococcus neoformans is an opportunistic fungal pathogen which produces a virulent polysaccharide capsule. It can impress respiratory tract and causing fatal infections, especially in AIDS and immunosuppressed patients. There is no report of concomitant occurrence of cryptococcal pneumonia plus pulmonary Tuberculosis in healthy patients. Substantially during active tuberculosis, innate and Th1-type immunity are impaired due to induction of immune suppressive mediators, which probable related to elevated regulatory T cells. This strategy allows opportunistic organisms to evade host immunity and dissemination. Our exceedingly rare report show dual infection that make challenge in Epidemiological trends and stimulate public health concerns in clinical mycology Methods: An exceptionally rare case of concurrent pulmonary infection with Cryptococcus neoformans and Mycobacterium tuberculosis in Iranian 48 year- old man who had exposed to pigeon droppings, is described. Significant clinical symptoms were fever, chest pain and cough. Suspected BAL fluid collected and smear prepared from fluid sediment. Then sample cultured and modified Ziehl-Neelsen staining technique carried on smears. By chance microscopic examination of Giemsa stain report several encapsulated yeasts in budding forms. DNA extraction and PCR technique performed to amplify polysaccharide capsule associated gene (CAP10) using CAP10 F, CAP10 R specific primers Results: TB characteristic Acid-fast bacilli were identified in studied smear and several clear encapsulated Blastoconidia observed in direct cytology examination. The amplification of CAP 10 gene revealed the distinct PCR product (∼ 474 bp) for tested broncho alveolar lavage sample. This evidences confirmed rare pulmonary Cryptococcosis. Radiographic features show multiple clustered nodular and course reticular interstitial pattern Conclusion: This episode of very infrequent dual infections should accentuate the need to maintain a raised clinical suspicion for opportunistic fungal infections, even without a certain immunodeficiency Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 414174 529a43bf-f147-49b3-a430-45dd5ac 91421.1.jpg Caption 1: Fig1.Giemsa stained cytology smears showing budding forms of Cryptococcus Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 414174 529a43bf-f147-49b3-a430-45dd5ac 91421.3.jpg Caption 2: Fig3. Banding pattern of amplified Cryptococcus Capsule gene CAP10

PP1.126 Meta-analysis of published molecular epidemiology data of the Cryptococcus neoformans and C. gattii species complexes using the ISHAM MLST consensus L. Trilles1 , C. Firacative2 , M. Cogliati3 , W. Meyer4 , CN. CG. The ISHAM working group5 1 Oswaldo Cruz Foundation/FIOCRUZ, RIO DE JANEIRO, Brazil 2 Universidad del Rosario, BOGOTA, Colombia 3 Universita` degli Studi di Milano, MILAN, Italy 4 The University of Sydney, Westmead Institute for Medical Research, SYDNEY, Australia 5 The ISHAM working group on ,,Genotyping of Cryptococcus neoformans/C. gattii,,, RIO DE JANEIRO, Brazil Objective: Cryptococcosis is a life-threatening systemic mycosis affecting humans and animals. A standardized MLST scheme has been established by the ISHAM working group on “Genotyping of Cryptococcus neoformans/C. gattii “, which is used globally for typing the agents of cryptococcosis. This scheme includes seven unlinked genetic loci, the genes CAP59, GPD1, LAC1, PLB1, SOD1, URA5, and the IGS1 region. The allele and sequence types are recorded in the MLST database: http://mlst.mycologylab.org/. We present a meta-analysis to discuss the worldwide molecular epidemiology of the C. neoformans/C. gattii species complexes based on the currently published data. Methods: At least 47 papers have puclished data using the ISHAM MLST consensus scheme and/or the MLST database until 2017. From those, only 23 papers included the list of strains, accounting for 1849 C. neoformans and 1141 C. gattii species complex strains from 51 countries. Results: Most of the strains analyzed by MLST are reported to be VNI (51%) followed by VGII (25%), VGI (8%), VGIII (6%), VNIV (5%), VNII (3%), VNB and VNIV (1% each). A total of 465 sequence types (STs), 241 for C. neoformans species complex and 224 for C. gattii species complex, were identified. Haplotype (Hd) and nucleotide (Pi) diversity of the concatenated seven loci varied according to the major molecular type and the continent of origin of the strains. The most genetically diverse population was found among VNB strains in Africa. VNIV in Europe, VGII in South America and VGIII in North America also showed high genetic diversity. Minimum spanning tree analysis shows that VNI population includes two main clusters, one containing predominantly STs from Asia and the other containing STs from Europe. Some STs are exclusive of a specific continent and others are present worldwide, but predominating in different regions, e.g. for C. neoformans STs 4, 5, 6 and 31 are more prevalent in Asia; STs 1, 71, 77 and 93 predominate in South America; STs 32 and 69 in Africa; and STs 23, 59, and 63 in Europe. VNB is almost exclusively from Africa and VNIV from Europe, but they are also occasionally reported in other continents. Similar regional patterns are observed among C. gattii species complex subtypes, ST156 is exclusive to Europe, ST6 to North America, but STs 51 and 7 are found in several continents. The majority of C. neoformans species complex strains (51%) had risk factor data, with the presence of risk factors to acquire cryptococcosis varying greatly, from 100% (for all VNB STs) to 9% (for VNIV, ST324). Only 7.7% of C. gattii cases have risk factor data, and the numbers per ST are too small to make any association. Statistical analysis demonstrates that populations with a higher genetic diversity are associated with a higher rate of mating type a strains, suggesting sexual reproduction as the main way of recombination within the C. neoformans and C. gattii species complexes. Conclusion: This work highlights the significant progress that has been made worldwide towards the typification of cryptococcal isolates, which contribute to understand the population structure of these medically important yeasts.

S38

PP1.127 Antifungal susceptibility of Cryptococcus neoformans/gattii spp complex; Comparison between clinical and environmental isolates Nagarathn Siddaiah, S.Lahiri Mukyopadhay, Veena.H Bahubali, Netravath Manjunath, Sayani Maji Nimhans, BENGALURU, India Objective: To determine if substantial differences in susceptibility profiles to common antifungal agents exist among clinical and environmental isolates of C. Neoformans/c gattii complex from our geographical location in south India. To isolate the CnAFR1 gene responsible for resistant to Fluconazole. Amplification and was sequencing of the CnAFR1 gene. To compare clinical and environmental isolates of Cryptococci with respect to CnAFR1 gene sequence. Methods: The study was conducted in the department of Neuromicrobiology NIMHANS,Bangalore.In total eighty clinical isolates obtained from cerebrospinal fluid (CSF) of cases suffering from cryptococcal meningits and eighteen environmental isolates of cryptococci obtained from soil,bark of tree etc collected from the residences from corresponding cases of cryptococcal meningitis formed the study material. Antifungal Susceptibility testing was carried out using VITEK 2Compact system for AmphotericinB (AMB), Fluconazole(FLC), 5 Flucytocine, Voriconazole (VOR). MIC values were compared with epidemiological cut-off values MIC values obtained for clinical and environmental sources were compared and Analysis of variance (ANOVA) test was performed in Graphpad Prism software. P values ≤0.05 was considered as statistically significant Genomic DNA of the resistant isolates were extracted using Qiagen DNeasy Plant mini kit. CnAFR1 gene responsible for FLC resistance was demonstated by polymerase chain reaction (PCR) The CnAFR1 amplified gene product was identified at 340 bp as described by Posteraro et al. Amplified gene products were sequenced in Applied Biosystems Genetic Analyzer 3500. Amplified sequences were analysed in Bio Edit Sequence Alignment Editor software and phylogenetic tree was constructed using Neighbour joining methods. Results: Out of 80 clinical isolates 1(1.2%),8(10%), were resistant to AMB,FLC respectively. Among the18 environmental isolates 3(16.6%),6(33.3%) were resistant to AMB,FLC respectively. MIC values were significantly (P < 0.05) different for the isolates from two sources. CnAFR1 gene was present among the FLU resistant isolates. Analysis of the sequences of CnAFR1 gene established the phylogenetic relationship among the isolates. Conclusion: There is statistically significant difference in antifungal susceptibility profile of clinical isolates when compared to environmental isolates of Cryptococci. The gene CnAFR1 was present among all the FLU resistant isolates. The phylogenetic analysis showed relatedness between Cryptococci isolated from the two sources based on CnAFR1 sequences.

Medical Mycology, 2018, Vol. 56, No. S2

PP1.162 Paracoccidioides antiadhesive peptide shows potential as a broad-spectrum agent against different fungi H. C. De Oliveira1 , L. Scorzoni1 , A.C.A. De Paula e Silva1 , C.M. Marcos1 , P.A. Assato1 , J.L. Singulani1 , R.M. Silva1 , A.M. Fusco-Almeida1 , O. Zaragoza2 , M.J.S. Mendes-Giannini1 1 ˆ ˆ Faculdade de Ciencias Farmaceuticas - FCFar UNESP, ARARAQUARA, Brazil 2 National Centre for Microbiology, ISCIII, MADRID, Spain Objective: The search for agents that may innovate the mechanism of action or enhanced the capacity of action of the available antifungals is of outmost importance for the treatment of systemic mycoses. Using Paracoccidioides spp., we screened a peptide phage display library and found four peptides that could act as antiadhesive agent. These peptides bind to Paracoccidioides spp., inhibiting up to 64% of the adhesion of P. brasiliensis and P. lutzii to pneumocytes. Our goal is to characterize these peptides and explore their capacity to prevent and treat paracoccidioidomycosis and also to explore their capacity to be employed in the treatment of other important mycoses. Methods: To investigate the activity of these peptides, we work with different models, such as cell cultures (pneumocytes A549 and macrophages RAW264.7), to study their toxicity and to investigate the immune system modulation; and alternative animal models, such as Galleria mellonella and Caenorhabditis elegans, to investigate the efficiency of these peptides against infection and to understand some immunological aspects elicited by them. Thanks to the information obtained with these models, we performed more accurate murine models to better characterize their efficacy during Paracoccidiodes infection. Results: Using G. mellonella, we verified that the treatment with the different peptides lead to an increase in the survivor up to 64% when infected with P. brasiliensis and up to 60% when infected with P. lutzii. Within the four peptides, P4 (VVAGSV) was the most active and therefore it was selected to be better characterized. P4 showed no fungicidal activity against Paracoccidioides nor against Cryptococcus. However, it showed growth inhibition at concentrations of 400 and 200ug/mL up to 60 and 20% respectively for Candida albicans. For these species, we also verified if the peptide can act in synergism with amphotericin B. We tested different combinations of the peptide with sub inhibitory concentrations of amphotericin B and we observed a synergic effect, being the combination effective even for C. neoformans where the peptide by itself showed no fungicidal activity. Using chromatography followed by mass spectrometry, we identified that P4 binds to the Paracoccidioides hsp70 protein, that is involved in different morphological changes which play important roles in the virulence of C. neoformans and C. albicans. P4 also modulates G. mellonella and C. elegans immune system by increasing the production of haemocytes in the first and stimulating the expression of distinct antimicrobial peptides in the second. It also stimulates the immune response of macrophages in vitro. Finally, in a murine model we could observe that p4 can protect mice when infected with Paracoccidiodes by reducing significantly the CFU showing similar results to mice treated with itraconazole. Conclusion: P4, first investigated as an antiadhesive agent in combat paracoccidioidomycosis now shows great potential as a broad-spectrum agent with multiple mechanisms of action capable to face distinct mycosis. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 422190 a2c73a3a-2ae9-48f8-bdce-fb5b880 f037f.png

PP1.128 Interaction of Brazilian Clinical strains of Cryptococcus spp with macrophages ˜ 1 , E.M Garcez1 , C. P. Rosa2 , H.R. Sousa1 , L. Trilles3 , M.S. Lazera3 , M.S FELIPE2 , I J. S. Folha1 , T.S. Santos1 , S.O. Frazao Silva-Pereira1 , P. Albuquerque4 , A.M. NICOLA1 1 University of Brasilia, BRASILIA, Brazil 2 ´ Universidade Catolica de Brasilia, BRAS´ILIA, Brazil 3 FIOCRUZ-RJ, RIO DE JANEIRO, Brazil 4 ˆ University of Bras´ılia, Faculty of Ceilandia, BRAS´ILIA, Brazil Objective: Our group is part of the Brazilian Cryptococcosis Research Network which aims to study the epidemiological and clinical evolution of primary and opportunistic cases of cryptococcosis in Brazil, identifying risk factors associated with clinical outcomes. Among other approaches, we are working on the phenotypic characterization of clinical isolates of Cryptococcus regarding their ability to produce different virulence factors and interact with different host models. In this work more specifically, our aim was to analyze the interaction of Brazilian clinical isolates of Cryptococcus spp with primary murine macrophages (BMMs). Methods: Macrophages (BMM - M1-like) derived from the bone marrow of Balb/c mice were obtained by the method described by Lutz et al. (1999). BMMs were co-incubated with different Brazilian isolates of C. neoformans VNI for 2 h or 24 h and the laboratory strains H99 and B3501. After the interaction we analyzed the percentage/phagocytic index of phagocytosis of each isolated by macrophages, the fungal survival after the interaction and the production of cytokines by macrophages. These results were correlated with previous results obtained from our group regarding the in vitro expression of virulence factors by these isolates or interaction with other hosts, such as capsule production, melanization, mean survival of infected Galleria mellonella larvae, among others. Results: The percentages of fungal phagocytosis and the fungal viability post interaction showed a significant variation among the clinical strains studied. Additionally, all the strains were able to induce production of inflammatory cytokines such as TNF-α, IL-1β, IL-6 and MCP-1 by macrophages. We observed a significant correlation between fungal survival after the interaction and the percentage of phagocytosis. We also observed a correlation between the percentage of phagocytosis and the median survival of G. mellonella larvae infected with the different fungal isolates. We were also able to identify a significant correlation of production of all the detected cytokines with the percentage of phagocytosis of the clinical isolated. Conclusion: These results demonstrated the phenotypic variability of Brazilian clinical isolates of Cryptococcus spp. Further characterization of these fungal isolates, and the correlation of this features to their clinical profiles may help in the development of s more efficient strategies for the treatment of cryptococcosis in Brazil.

PP1.161 A singular case of eumycetoma of right leg due to exophiala jeanselmi HENRY Harak1 , S. Ahmed2 , PEI-LUN Sun3 , ANNE Van Diepeningen2 1 Presidio Ospedaliero di Sesto San Giovanni - Italy, SESTO SAN GIOVANNI, Italy 2 CBS Utrecht, UTRECHT, Netherlands 3 Chang Gung Memorial Hospital, TAIWAN, Taiwan Objective: Study of the pathology of a 25 years old immunocompetent female from El Salvador but living in Italy. 3 years before she was diagnosed as having an asymptomatic panniculitis of the right leg. She underwent 2 consecutive surgeries but without benefit and precise diagnosis. Later she complained of a strong pulsatile pain and purulent discharge from the site. There was past history of injury with bamboo splinter 17 years ago. Methods: Mycological cultures and molecolar identification. Results: Mycological cultures of the discharge yielded Exophiala jeanselmei confirmed by sequencing both ITS and LSU. After 1 year of treatment partial recovery was achieved. Conclusion:Different treatment were tried: - local hyperthermia; - criotherapy; - witfield ointment; - systemic treatment with oral terbinafine and itraconazol. Lack of complete recovery should be ascribed to the bad tollerance of the generic drugs (itraconazol, terbinafine). It is necessary continuosly follow up the patient until full recovery and painstaking searching for the more efficacious treatment. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 422112 2e21ae16-1735-4a06-9f53-c7a76 ffebb90.JPG Caption 1: detail Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 422112 2e21ae16-1735-4a06-9f53-c7a76 ffebb90.JPG Caption 2: general view

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

PP1.163 Phenotyfipication and Genotypification of Colombian clinical isolates of Sporothrix spp from the medical mycology laboratory, universidad de Antioquia, medellin, Colombia L. C. Alvarez-Acevedo, M.C Zuleta-Gonzalez, O.M Gomez, D.Y Molina, I Saavedra-Porras, M.E Uran-Jimenez, MYRTHA ´ Arango-Arteaga, J. G. McEwen-Ochoa, A. Rua-Giraldo, M.D.P. Jimenez-Alzate Universidad de Antioquia, MEDELLIN, Colombia Objective: General goal: To do the phenotypication and genotyping of clinical isolates of Sporothrix spp complex obtained from patients on the Medical Mycology Laboratory, Universidad de Antioquia, from 2004 to 2017. Specific Goals: To determine in the Sporothrix spp clinical isolates the phenotypic characteristics as: growth rate, pigment, texture and carbohydrate assimilation. To identify the different species in the Sporothrix spp clinical isolates, by the calmoduline gene sequencing. To correlate the phenotypic, genotypic and clinical findings for each one of the Colombian Sporothrix spp clinical isolates. Methods: A-Phenotypification of the 41 clinical isolates at days: 7, 14, 21, 28 and 40 of culture. A1-Macroscopic morphology: Growth: The diameter was measured at the different time points culturing them on potate dextrose agar (PDA) and cornmeal agar (CMA) at 25◦ C. Pigment and texture were evaluated culturing the isolates on PDA at 25◦ C. The inoculum of each isolate to evaluate growth, pigment and texture was 5 × 105 conidia/ml. Transition from the mold to yeast phase was determined in two media culture: 1) brain heart infusion (BHI) supplemented with 2% glucose and 5% CO2 (BHI-1); 2) BHI supplemented with 2% glucose, 5% human blood, 0.1% L-cysteine and 5% CO2 (BHI-2). R Marcy-l´Etoile-France). The reading Carbohydrate assimilation was determined using the kit api 20 C AUX (Biomerieux; was done after 8 days of incubation at 30◦ C. A2-Microscopic morphology: Microcultures in PDA at 25◦ C were made for all isolates; the morphology, diameter and type of sporulation were evaluated using the Micrometrics SE Premium 4 software. B-Genotypication: DNA was extracted from the yeast phase for all isolates using the Fungi/Yeast Genomic DNA isolation kit (Norgen Biotek Corporation). The calmoduline gene was amplified by PCR with the primers described by O‘Donnell 2000. The amplification products were sequenced by Macrogen (Korea) and the sequences analysis was done with Genious Software. Results: A1: The range of growth at the mycelial phase of all isolates was similar in both media. The pigment varied from beige to black; the pigment distribution was: homogeneous, spotted heterogeneous, central heterogeneous, sectorized heterogeneous and dotted. The isolates texture was varied between them: velvety, central vellus, cerebriform and membranous. The transition from mold to yeast was 100% using the BHI-2 and 90% with the medium BHI-1. There were differences on the carbohydrate assimilation specifically of sucrose, raffinose and adonitol between all isolates. A2: All isolates produced oval conidia without pigment; some had elongated oval conidia, other globoses with botrios sympodial sporulation, however not all isolates produced pigmented conidia and some of them were triangular with sesil sporulation. B-The genetic analysis suggests that the species population of Sporothrix complex in Colombia is polyphyletic. Conclusion: The Sporothrix spp isolates studied were obtained from patients with different clinical forms of sporotrichosis. We found phenotypic differences between Colombian Sporothrix spp isolates, however it is neccesary to correlate these findings with their genotypic characterization. The differences found on this study are key to seek for the diversity of Sporothrix species in Colombia.

ABSTRACT

PP1.164 Comparative study of lipid composition of the mycelial cell wall from environmental and clinical isolates of Histoplasma capsulatum 2 ´ ´ Jaramillo2 , M.J Mar´ıa del Pilar Jimenez ´ P. A Pedronel Araque Mar´ın1 , C.P Carlos A. Pelaez Alzate 1 Universidad EIA, ENVIGADO, Colombia 2 Universidad de Antioquia, MEDELL´IN, Colombia

Objective: Compare the lipid composition of the mycelial cell wall from environmental and clinical isolates of Histoplasma capsulatum Methods: Clinical isolates 1402065 was obtained by means of a biopsy of a patient that was analyzed in the Grupo de Micolog´ıa M´edica and environmental isolates 316-1 was obtained by samples of organic amendments in the Grupo Interdisciplinario de Estudios Moleculares of the Universidad de Antioquia. These isolates remained in mycelial phase in the Mycosel environment at 23◦ C. The strains used in this study was store in hexane solvent for 6 months at 23◦ C and monitored monthly to guarantee inactivity of the extract. The lyophilized cultures were subjected to Soxhlet extraction whit four solvents consecutively, hexane, chloroform isopropanol and methanol. The different extracts were treated with sodium hydroxide in methanol at 90◦ C under a reflux system for 7 min. Thereafter, 5 ml of 20% boron trifluoride in methanol was added and maintained under a reflux system. Then the samples were mixed with 4 mL of n-heptane and allowed to reflux for one additional min. The organic phases were then collected into Eppendorf tubes with anhydrous sodium sulfate to dry the samples and centrifuged at 13.000 rpm for 7 min.Two microliters of a solution containing the internal standards mixture of FAMEs, followed by the different extracts that were run independently in the Agilent 6890 N gas chromatograph with flame ionization detector. Results: In all extract five fatty acids could be detected. Myristic, palmitic, stearic, oleic, and linoleic acids, except in the hexane extract the linolenic acid could be detected. In the hexane extract the most abundant fatty acids were palmitic, oleic and linoleic acids, with an unsaturation index of 2.2 (environmental) and 2.1 (clinical). In the chloroform extract the most abundant fatty acids were palmitic, stearic, oleic and linoleic acids, with an unsaturation index of 1.8 (environmental) and 1.3 (clinical). In isopropanol extract of the environment isolate the most abundant fatty acids were palmitic, stearic, oleic and linoleic acids, with an unsaturation index of 1.6. unlike clinical isolation, the most abundant fatty acids were palmitic, oleic and linoleic acids with an unsaturation index of 2.6. In the methanol extract the most abundant fatty acids were myristic, palmitic, stearic and oleic acids, with an unsaturation index of 0.6 (environmental) and 0.7 (clinical). Conclusion: The proportion of unsaturated fatty acids in the environment decreases continuously as the polarity of the solvent increases, except in the clinical isolates, where there is a large decrease in stearic acid in the extract with isopropanol, presenting significant differences in the index of unsaturation 2.6. These differences indicate that H. capsulatum primary isolation changes its relationship between the saturated and unsaturated fatty acids of the cellular cell to be able to adapt to the body temperature of the host. The lipid difference between the isolates contribute significantly for understanding of lipid metabolism in pathogenic fungi can help the development of more efficient antifungal therapeutic strategies.

S39

PP1.167 Imaging mass spectrometry and microbial metabolomics on track of infectious diseases V. Havlicek1 , M. Petrik2 , A. Skriba1 , T. Pluhacek1 , D. Luptakova1 , A. Palyzova1 , O. Benada1 , K. Lemr1 , G. Mitulovic3 , J. Novak1 1 Institute of Microbiology, PRAGUE 4, Czech Republic 2 Institute of Molecular and Translational Medicine, OLOMOUC, Czech Republic 3 Medical University, VIENNA, Austria Objective: Mixed infections represent a diagnostic challenge for any microbiology laboratory. In this work high mass resolution spectrometry is introduced as extremely sensitive tool for early detecting Aspergillus and Pseudomonas infections in rat models. Microbial siderophores were used as specific disease biomarkers and detected in urine, serum and tissues of infected animals. Methods: Using a model of experimental aspergillosis in Lewis rats, the fungal siderophores ferricrocin (FC) and triacetylfusarinine C (TAFC) were identified as markers of Aspergillus fumigatus infection. Analogously, bacterial pyoverdine E (PyE) was quantified in urine, serum and lung tissues in rats infected with Pseudomonas aeruginosa. Molecular biomarkers were analyzed by matrix-assisted laser desorption ionization (MALDI) or electrospray ionization (ESI) using a 12T SolariX Fourier transform ion cyclotron resonance (FTICR) mass spectrometer (MS). Non-invasive diagnoses were performed with animal urine. MS imaging (MSI) experiments on tissues and liquid chromatography (LC)-ESI analyses of rat sera represented the invasive armories. Results: In experimental aspergillosis, the mean concentrations of TAFC and FC in the infected rat urine were 0.37 and 0.63 μg/mL, respectively. The limits of detection of the ferri-forms of TAFC and FC in the rat urine were 0.02 and 0.03 ng/mL, respectively. As an example, the initial FC signal in urine reflecting the infection appeared two days post-infection. The MALDI FTICR MSI illustrated the actual microbial ferricrocin distribution in the lung tissue and resolved the false-positive results obtained by the light microscopy and histological staining. In an analogous experiment with Pseudomonas aeruginosa, PyE was quantified in rat urine by LC-FTICR approach by application of PyE non-isobaric analogues. Separation of desferri and ferriforms of siderophores was achieved on biphenyl LC column. In parallel, PyE was visualized by MALDI-MSI in infected lung and muscle tissues. Lateral distribution of PyE correlated with bacterial bodies visualized by scanning electron microscopy. Conclusion: Ferricrocin, triacetylfusarinine C and pyoverdine E detection in urine represents an innovative non-invasive indication of Aspergillus and Pseudomonas infections in a host. Proper alignment of various images (mass spectrometric, microscopic) was accomplished by our in-house software called CycloBranch, which can be downloaded for free from http://ms.biomed.cas.cz/cyclobranch. Acknowledgement: Ministry of Education, Youth and Sports of the Czech Republic (NPU LO1509) and Czech Science Foundation (16-20229S). Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 411393 9be35c84-88bc-4846-83d4-9954d6a8 c2c9.png Caption 1: Scanning electron microscopy image of a rat lung tissue infected with Pseudomonas aeruginosa. Squares indicate the area irradiated with laser in MSI.

PP1.165 Outbreak of zoonotic sporotrichosis in Southern Brazil V. R. Poester1 , T.M. Brandolt1 , I. M. Madrid2 , A. S. Mattei3 , K. O. Sanchotene1 , R. P. Basso1 , G.B. Klafke1 , P. Portella Della Terra4 , A. Messias Rodrigues4 , M.O. Xavier1 1 Mycology Lab, Faculty of Medicine, RIO GRANDE, Brazil 2 Zoonosis control, PELOTAS, Brazil 3 University of Caxias do Sul, CAXIAS DO SUL, Brazil 4 ˜ Paulo, Sao ˜ Paulo, Brazil Federal University of Sao Objective: Given the geographic expansion of sporotrichosis in Brazil in the last decades and it zoonotic importance in public health, this study aimed to describe an outbreak of the disease in humans associated with the increase in feline sporotrichosis cases in the last five years. Methods: A retrospective study was performed including all human and feline sporotrichosis cases diagnosed at the Mycology Lab from Federal University of Rio Grande (FURG), and/or notified to the Zoonosis Control Center (ZCC) of Municipal Health Secretary (MHS) of Pelotas (RS, Brazil), between October 2012 and October 2017. Only proved cases, defined as those that had Sporothrix spp. growth in mycological culture of clinical samples were included. Clinic-epidemiological data of the patients were collected accessing the databases of the Mycology Lab (FaMed-FURG) and of the ZCC-SMS Pelotas, as well as by checking the Medical Records Service (SAME) of HU-FURG. Results: Across the five-years studied, a total of 101 human sporotrichosis cases were diagnosed in the South region of RS, Brazil, corresponding to an average of 20 cases per year. The number of cases reported each year was not the same, ranging from eight to 27 cases. Patients were mostly women (62.4%) and adults (81.5%) with a mean age of 40 years (ranging between 2 and 83 years). Fixed and lymphocutaneous lesions were predominant (73.3%), with impairment of hands and/or arms in 73% of the cases (n = 54), followed by face (n = 11) and legs (n = 09). Data concerning the source of infection was available in 91 patients (90.1%), being the zoonotic transmission responsible for 93.4%, with patient narrative of scratch, bite and/or contact with sick cats. In fact, 78.8% (26/33) of these Sporothrix sp. humans isolates submitted to PCR were identified as S. brasiliensis. Regarding feline sporotrichosis, 375 cases were diagnosed in the same period in south region of RS, corresponding to about 75 cases/year. An increase of 120% in numbers of cases occurred when comparing the first with the last year studied. Almost a half of felines (56%) evaluated showed the disseminated form of the disease, and considering 153 animals in which data concerning outcome was available, 35% of them died. Regarding epidemiological data 75% of the felines were males, 63% not castrated and 95% had access to the streets, highlighting their high potential on the disease transmission and dissemination. Conclusion: The increase in feline sporotrichosis cases, associated with the human sporotrichosis outbreak described, majority of them with zoonotic transmission, shows that the epidemiological situation of the disease in South region of RS, Brazil, is extreme worrying to public health, which may take severe proportions in future years.

PP1.168 Unravelling the mechanistic basis of methionine synthase essentiality J. Scott1 , M Sueiro-Olivares1 , E Bignell2 , J Amich1 1 University of Manchester, MANCHESTER, United Kingdom 2 University of Mancheter, MANCHESTER, United Kingdom Objective: Methionine synthase is an essential protein in at least three of the more prominent fungal pathogens: Aspergillus fumigatus, Candida albicans and Cryptococcus neoformans. Consequently, it constitutes a promising candidate for the development of novel broad spectrum antifungals. The mechanistic basis of its essentiality is unknown, but much-needed in order to fully explore the therapeutic potential of this enzyme as a drug target. Therefore, our aim is to unravel the underlying reason for A. fumigatus methionine synthase essentiality in order to verify its suitability for drug development. Methods: We have constructed a conditional-expressing methionine synthase (MetH) strain. In this background we are introducing single-point mutated versions of metH, which are expressed ectopically (from the innocuous Ku70 locus) under the control of its native promoter. These versions of the protein have been designed based on in silico motif analyses and published data on enzyme structure and activity. We are also introducing a 3x-HA tagged protein to co-immunoprecipitate potential interactors which may be acing in complex. Furthermore, we are performing metabolome analyses to identify deleterious shifts in the metabolism which may help to explain the essentiality of this protein. Results: Aspartic acid 614 has been reported to be required for a conformational rearrangement that is required for methionine synthase enzymatic activity in C. albicans. At the time of the submission of this abstract we have already observed that in A. fumigatus a version of the protein with a D616A amino acid change does not restore growth in the presence of methionine, suggesting that methionine synthase enzymatic activity is required for viability. Other version of the protein with a Y662A amino acid change did significantly restore growth in minimal medium without methionine, indicating that, in contrast to C. albicans, this amino acid residue is not indispensable for enzymatic function in A. fumigatus. Intriguingly, overexpression of the cystathionine-β-synthase encoding gene in restrictive conditions restores growth on methionine to almost wild-type conditions, suggesting that toxic accumulation of homocysteine is key to explain loss of viability. To better understand the mechanism of essentiality, we are currently constructing two versions of the protein which should not be able to bind the substrate homocysteine or THF. We are also constructing strains to overexpress the S-adenosylhomocysteinase and the A.nidulans homocysteine thiolactone hydrolase encoding genes to determine what the toxic effect of homocysteine accumulation is. Conclusion: We have designed a strategy to determine the mechanistic reason for methionine synthase essentiality in Aspergillus fumigatus. By these means we have already demonstrated that enzymatic activity is required for viability. We are now in the process of unravelling the enzymatic action that is required and the exact mechanism of homocysteine toxicity. Ascertainment of the underlying grounds for methionine synthase essentiality in pathogenic fungi will set the basis for the rational design of novel drugs to treat fungal infections.

PP1.166 Macrophage activation by IFN-? triggers restriction of phagosomal copper from intracellular pathogens Q. Shen, M.J. Beucler, S.C. Ray, C.A. Rappleye The Ohio State University, COLUMBUS, USA Objective: This study investigates how macrophages alter copper availability to control intracellular pathogens and the mechanisms by which Histoplasma capsulatum combats host copper restriction. Methods: A forward genetic screen of H. capsulatum mutant yeasts was conducted to identify loci required for proliferation within macrophages. Quantitative RT-PCR (qRT-PCR) was used to measure the transcriptional response of Histoplasma yeasts to high or low copper. To estimate intraphagosomal copper concentrations in macrophages, a gfp transcriptional reporter was used to measure the activity of the copper-responsive CTR3 promoter. Histoplasma yeasts lacking Ctr3 were tested for virulence using a murine model of pulmonary histoplasmosis. Results: The loss of the ability of Histoplasma yeast to replicate in macrophages was linked to disruption of the CTR3 locus, which encodes a fungal copper transporter. This suggests copper is limiting within the macrophage phagosome. Loss of Ctr3 function impairs yeast growth in limiting copper but does not affect growth in limiting iron or high copper consistent with Ctr3 functioning as a copper-specific importer. Transcription of the CTR3 gene is induced both by differentiation of H. capsulatum into pathogenic yeasts and by low available copper. Using a transcriptional fusion to the CTR3 promoter, and infection of macrophages demonstrated that phagosomes of non-activated macrophages have moderate copper levels that are not antimicrobial to H. capsulatum. However, IFNγ activation of phagocytes causes phagosomal copper restriction both in culture and in vivo. Accordingly, in a respiratory model of histoplasmosis, Ctr3-deficient yeasts are fully virulent during innate immunity but are attenuated after the onset of adaptive immunity. Conclusion: Activation of macrophages as part of cell-mediated immunity, switches the phagosome from a copper-replete to a copper-depleted environment forcing H. capsulatum reliance on Ctr3 for copper acquisition.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Poster Pitch session 2 Sunday 1 July 18 :00 hrs. – 19 :00 hrs PP1.201 Prevalence of endobacterial symbiosis in Rhizopus microsporus (Tempe fungus) S. Dolatabadi1 , M.J. Najafzadeh2 , G.S. De Hoog3 Sabzevar university of new technology, SABZEVAR, Iran Mashhad University of Medical Sciences, MASHHAD, Iran 3 CBS-KNAW Fungal Biodiversity Centre, UTRECHT, Netherlands 1

2

Objective: Mucorales have been used for production of fermented food in Asia and Africa since time immemorial. Particularly Rhizopus species which occur naturally during the first stages of soybean fermentation. Two biosafety issues have been raised in recent literature: (1) pathogenicity, Rhizopus species being prevalent opportunists causing erosive infections in severely compromised patients, and (2) toxicity, strains harboring endosymbiotic Burkholderia producing toxic secondary metabolites. At the molecular level, based on different gene markers, species identity was found between strains used for food processing and clinical strains. Thus we aimed to search for the prevalence of such a symbiosis in Rhizopus species. Methods: In this study, we screened for bacterial symbionts in 64 Rhizopus (R. microsporus and R. arrhizus) strains by light microscopy, 16S rRNA sequencing, and HPLC. Results: None of the R.arrhizus strains contained any bacterial symbiont. Seven strains (11%) of R. microsporus carried bacteria identified as Burkholderia rhizoxinica and B. endofungorum, and an unknown Burkholderia species. The Burkholderia isolates proved to be able to produce toxic rhizoxins. Strains with endosymbionts originated from food, soil, and a clinical source, and thus their presence could not be linked to particular habitats. Conclusion: The presence of Burkholderia in Rhizopus producing toxins could not be excluded as a potential risk for human health. In contrast, given the type of diseases caused by Rhizopus species, we regard the practical risk of infection via the food industry as neglectable.

S40

PP1.202 Development of the first commercial real-time PCR assay for the detection of Mucorales species T. Kampermann, D Van Tegelen, G Gaajetaan, G Dingemans PathoNostics, MAASTRICHT, Netherlands

Medical Mycology, 2018, Vol. 56, No. S2

PP1.205 Lichtheimia corymbifera: elucidating the mechanisms for iron acquisition and transport during infection F. A Stanford1 , V. Schwartze2 , K. Voigt1 Leibniz Institute for Natural Product Research & Infection Biology, HKI, JENA, Germany Friedrich-Schiller University of Jena, JENA, Germany

1 2

Objective: Mucormycosis is a rare invasive fungal infection causes by Mucorales species and generally affects severely immunocompromised individuals. Mucormycosis is associated with a high mortality rate and prevalence is underestimated due to the limited diagnostic options. Correct and fast identification of mucorales infection is essential to start appropriate antifungal therapy. Due to this limitation in current diagnostics, PathoNostics developed a real-time PCR for the detection of the clinical most relevant Mucorales species. Several parameters were determined including the analytical specificity, inclusivity and limit of detection (LoD). The clinical sensitivity was examined on a ring trial and a set of clinical samples. Methods: The real-time PCR assay (MucorGenius, PathoNostics) is designed to detect the 28S multi-copy gene in the most prevalent etiological agents of Mucormycosis including Rhizopus spp., Mucor spp., Rhizomucor spp., Lichtheimia spp. and Cunninghamella spp. The real-time PCR assay consists of a set op primers and probes enabling detection of Mucorales species together with an internal control. The analytical specificity and inclusivity was determined by testing several Mucorales strains, other fungi, yeast and bacteria strains which may be present in the respiratory tract. In addition, the LoD was determined for all Mucorales species by testing dilution series of genomic DNA. Quantification was enabled by droplet digital PCR (ddPCR). Clinical sensitivity was determined using eleven Mucormycosis-suspected BAL samples which were tested by culture and in-house PCR. Finally the MucorGenius was also evaluated on the Mucorales panel (6 samples) obtained from the Fungal PCR Initiative (FPCRI). Results: The MucoGenius PCR was able to detect Rhizopus oryzae, Mucor racemosus, Rhizomucor pusillis, Lichtheimia corymbifera and Cunninghamella bertholletiae with a LoD in the range of 2–4 for all strains. No cross-reactivity was observed with other fungi, yeast or bacterial respiratory strains. From the eleven BAL samples, eight were positive for Mucorales species with the MucoGenius PCR whereas culture and the in-house PCR assay only resulted in 5 positive samples. Out of six FPCRI samples, 5 were correctly identified as Mucorales species with the MucorGenius PCR. This was in agreement with the FPCRI data. Conclusion: The MucorGenius real-time PCR from PathoNostics can detect the most clinically relevant Mucorales species. According to the initial clinical evaluation, the new MucorGenius PCR showed good performance on a small set of clinical samples and had a 100% score on the FPCRI panel.

PP1.203 The role of surface proteins in the virulence of Lichthemia corymbifera with alveolar macrophages ¨ ´ O Kniemeyer, R Konig, ¨ M. Abdelwahab Hassan, H. R. Park, V. U Schwartze, H.M Dahse, T Kruger, Z Cseresnyes, M. T. Figge, A. A. Brakhage, K. Voigt Leibniz-Institute for Natural Product Research and Infection Biology, JENA, Germany Objective: Exploration of spore surfaces proteins of Lichtheimia corymbifera by surface proteomics. Analysis of receptors involved in the recognition of Lichtheimia spores on the surface of alveolar macrophages (MH-S). Methods: Proteomics analysis by Liquid chromatography–mass spectrometry (LC-MS) followed by biotinylation of the surface after MH-Streptavidin enrichment, heterologous protein overexpression, fluorescence-activated cell sorting (FACS)-based binding assay, Generation of polyclonal and monoclonal antibodies, endocytosis assay, specificity test for antibodies by western blotting, apoptosis measurement, confocal laser scanning microscopy (CLSM)-based measurement of phagolysosomal fusion, protein localization via immune fluorescence. Results: Out of a total of 113 proteins identified, 30 were predicted to be on the surface based on genomic analysis of L. corymbifera and the presence of signal peptides. Of these proteins, 14 proteins were annotated at least based on functional domains. Among those, the hydrophobic binding protein HsbA was detected to be predominant on the surface of spores, but not on the surface of hyphae. The protein was found to stimulate the phagocytic processes during the interaction with murine alveolar macrophages (cell line MH-S) via toll like receptors (TLRs). Furthermore, L. corymbifera inhibits apoptosis and phagolysosomal maturation. From the host side, we identified receptors that may contribute to the recognition on the macrophage surface. Preliminary proteomics data and antibody-mediated blocking assays revealed that the heat shock protein orthologue HSP70 on the surface of MH-S may play a pivotal role as a putative receptor in binding and recognition of Lichtheimia spores. Conclusion: Spore surface proteins play a crucial role in the pathogenesis of the mucoralean fungus L. corymbifera. HsbA and HSP70 were recognized to be involved in the interaction between L. corymbifera as the fungal pathogen and the host, respectively.

PP1.204 Mucormycete virulence and efficiency of posaconazole prophylaxis depends on the underlying disease ¨ 2 , C. Speth2 Rambach1 , V. Fleischer2 , M. Hagleitner2 , C. Lass-Florl Division of Hygiene and Medical Microbiology, INNSBRUCK, Austria Medical University of Innsbruck, INNSBRUCK, Austria

1 2

Objective: Mucormycosis, induced e.g. by Lichtheimia corymbifera or Rhizopus arrhizus, represents a severe disease for immunocompromised patients with considerable morbidity and lethality. The precise role of the underlying disease for the pathogenesis and for the efficiency of prophylaxis is as yet insufficiently documented. For that reason we studied inhalative infection under immunosuppressive treatment regimens, neutropenia, and diabetes in a murine model. Methods: Mice with diabetes or immunosuppressed by either cyclophosphamide (to mimic chemotherapy), cortisone acetate (to mimic transplantation or autoimmune diseases), or specific depletion of neutrophils, were inhalatively infected with Lichtheimia corymbifera or Rhizopus arrhizus. Survival and clinical status were monitored over 14 days. Blood was taken at defined time points and analysed for immunological and inflammation parameters and for blood cell count. Results: Inhalative infection with both mucormycetes did not result in significant morbidity or any lethality in immunocompetent mice. In contrast, mice immunosuppressed by cyclophosphamide or cortisone acetate treatment mostly died within one week after infection. L. corymbifera proved to be slightly more virulent than R. arrhizus. Interestingly, selective depletion of neutrophilic granulocytes using a specific antibody did not predispose the mice to severe mucormycoses. Diabetes was a less substantial risk factor with only single mice dying from mucormycete infection. Prophylaxis and treatment of the mice by posaconazole significantly delayed the onset of disease in cyclophosphamide or cortisone acetate treated mice, but could not completely prevent the infection and lethality. The posaconazole-induced delay of infection could also be shown by analysing clinical parameters such as body weight, development of fever and blood cell count. Conclusion: Our studies of intranasal infection by Lichtheimia corymbifera and Rhizopus arrhizus clearly show that the status of the immune system significantly influences the sensitivity against fungal infections and the course of the illness. Therapies against cancer and autoimmune diseases impair multiple elements of immunity and are associated with high morbidity and rapid progression of disease. In contrast, a neutropenic status alone does not predispose to development of mucormycosis by these fungal pathogens. Diabetes as underlying disease seems to be a rather low risk factor for inhalative infection. Although posaconazole prophylaxis clearly delayed the course of disease, it could not prevent the breakthrough of the infection.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Objective: To date, our knowledge remains limited regarding iron metabolism in Lichtheimia corymbifera during infection. Since iron uptake is a key factor during infection; the aims of our current research are to determine the spectrum of iron sources our fungi can utilise in the environment and identify which host iron containing proteins L. corymbifera sequesters iron from. We also intend to identify which transcription factors are involved and gain new insights into how these pathways are regulated. Methods: These will be accomplished by applying both molecular and physiological studies including heterologous gene expression, complementation assays, transcriptome analysis and comparative genomics. Results: Comparative genomics of L. corymbifera has highlighted conserved genes involved in the three characterised pathways. This is particularly evident in the siderophore transporter genes which are highly conserved and cluster closely with siderophore transporter genes from other fungal pathogens such as Aspergillus species. There are also unique features in several genes involved in iron acquisition which differ when compared with other pathogenic fungi. An example of which is the high copy number of genes belonging to the reductive iron uptake pathway. RNA sequencing data has indicated that these genes may have different functions and our work will focus on determining the functionality of these duplicated genes. Initial gene expression studies have highlighted an iron responsive transcription factor which shows sequence similarities to GATA-transcription factors which are known to be involved in iron regulation in other fungal pathogens. Conclusion: Answering these key questions will aid our understanding of how these adaptive traits contribute to survival and virulence in the host. Collectively, our findings have the potential to aid research into the future development of therapeutics.

PP1.206 Multi-center study of Mucorales and other mould contamination of freshly-laundered linens arriving at U.S. healthcare facilities M. HONG Nguyen1 , CORNELIUS Clancy1 , WILLIAM Pasculle1 , MERIN Varghese2 , BECKY Smith3 , JOHN Perfect3 , KIRK Huslage3 , L. Abbo4 , KIERAN Marr5 , SEEMA Mehta5 , JOSE Vazquez2 , STEPHEN Pergam6 , GEORGE R Thompson7 , PETER Pappas8 , JOHN Wingard9 , MICHELLE Morris4 , ALLISON Galdys10 , KIMBERLY Hanson11 , JEANMARIE Mayer11 , SANKAR Swaminathan11 , ESTELLA Whimbey6 , DAVID Andes12 , PRANATHAR Chandrasekar13 , SANJAY Revankar13 , M. HONG Nguyen1 1 University of Pittsburgh, PITTSBURGH, USA 2 Augusta University, AUGUSTA, USA 3 Duke University, DURHAM, USA 4 University of Miami, MIAMI, USA 5 Johns Hopkins University, BALTIMORE, USA 6 University of Washington, SEATTLE, USA 7 UC-Davis, DAVIS, USA 8 UAB, BIRMINGHAM, USA 9 University of Florida, GAINESVILLE, USA 10 University of Minnesota, MINNEAPOLIS, USA 11 University of Utah, SALT LAKE CITY, USA 12 University of Wisconsin, MADISON, USA 13 Wayne State University, DETROIT, USA Objective: Several mucormycosis outbreaks have been linked to hospital linens. Linen facilities servicing U.S. hospitals can attain voluntary certification from the Healthcare Laundry Association Council (HLAC) and/or Textile Rental Service Association (TRSA), which includes some biologic testing. However, there are no U.S. governmental regulations for biologic surveillance of linen facilities, or accepted definitions of “hygienically clean” linens. Our objective was to determine culture-positivity rates for Mucorales and other moulds on linens arriving at U.S. hospitals. Methods: A dedicated team performed RODAC (25cm2 ) cultures on linens immediately upon arrival at 11 U.S. hospitals that care for transplant recipients. The benchmark for defining linens as hygienically clean was pathogenic mould culture-positivity in 80% (25% Mucorales) to 3% (0% Mucorales) of items. Conclusion: Linens were significantly contaminated with pathogenic moulds upon arrival at most participating U.S. transplant centers, often with Aspergillus or Mucorales. HLAC and TRSA certification is inadequate for assuring that linens are hygienically clean of moulds. Regulations for biologic surveillance and targets for acceptable culture-negativity of moulds are needed for hospital linens in the U.S. It is possible to reduce mould contamination of hospital linens by targeted remedation in laundering facilities.

ABSTRACT

S41

PP1.207 Heterogeneity and within-host adaption observed in clinical isolates of Aspergillus fumigatus

PP2.010 Occurrence of pathogenic Aspergillus species in drinking water from restaurants in Kathmandu, Nepal

1 ¨ I. D. Valdes1 , H.A.B. Wosten , H. De Cock1 , NATALIA Escobar1 , JORIS Van Den Berg1 , ANNIKA Haagsman1 , JACQUES F Meis2 , FERRY Hagen3 , JOS Houbraken3 , PIETER J Haas4 1 Utrecht University, UTRECHT, Netherlands 2 Canisius-Wilhemina Hospital, NIJMEGEN, Netherlands 3 Westerdijk Institute, UTRECHT, Netherlands 4 University Medical Center Utrecht, UTRECHT, Netherlands

U. Shrestha Khwakhali1 , J.F. Meis2 , P.E. Verweij3 1 Department of Microbiology, Amrit Campus, Tribhuvan University, KATHMANDU, Nepal 2 Department of Medical Microbiology and Infectious Diseases, CWZ, NIJMEGEN, Netherlands 3 Department of Medical Microbiology, Radboudumc, NIJMEGEN, Netherlands

Objective: We explored the phenotypical and genetic variability among isolates of the ubiquitous and saprophytic fungus Aspergillus fumigatus which has the remarkable ability to adapt and grow in many different niches. Due to this ability it can also cause invasive and non-invasive infections in humans and animals, for example invasive pulmonary aspergillosis (IPA) in humans and sinonasal aspergillosis (SNA) in dogs. Our main objective is to understand how this fungus adapts to different niches and to find the factors and genetic traits that influences host adaptation and development in the context of fungal infections. To address this question we have compared a set of clinical and environmental isolates at a genetic and phenotypic level. Isolates were derived from sputum or bronchoalveolar lavage from human patients at the intensive care unit who were suspected to developed IPA. In addition we cultured isolates from fungal plaques isolated from the sinus of dogs suffering with SNA using endoscopy or trephination. Methods: We have compared a set of isolates of A. fumigatus from A) humans (29 isolates from a preselected set of 9 patients),B) dogs with SNA (27 isolates form 9 patients) C) environmental isolates (27 isolates) with reference strains. Azole resistance was determined by microdilution assay antifungal susceptibility testing and tandem repeats in the promotor region of the cyp51A gene. Sequencing of calmodulin (CaM), beta-tubulin(benA) and mating type genes (MAT1-1 and 1–2) and microsatellite (STRAf) analysis were performed to detect genetic differences between isolates. Plating on different media was performed to observe differences in macro and micromorphology Results: Genotyping of the different isolates showed that each human patient carried multiple fungal genotypes. In contrast, each dog suffering from SNA appeared to be infected by only one single genotype. Remarkably, different isolates from each dogs, and having the same genotype, showed a large phenotypic variability. In particular “white isolates” with apparent reduced sporulation were frequently isolated (13 out of 27 isolates) from dogs but not in human patients or in environmental isolates. In terms of azole resistance only human isolates and one of the indoor and outdoor environmental isolates were found to be resistant. Principal component analysis using colony diameter as a proxy for growth speed suggests that canine isolates might represent a subgroup of A. fumigatus that are responsible for SNA. Conclusion: Our observations shows thatfumigatus from dogs with SNA are phenotypically very diverse in contrast to their environmental and human counterparts. Phenotypic variability seems to be generated during the chronic infection process in the sinus of the dogs. The basis of this heterogeneity might be due to genomic differences and/or epigenetic variations. We expect that appearance of the phenotypic “white isolates” in dogs is a result of within-host adaption and is triggered by environmental factors in the sinus which we address in ongoing research.

PP1.208 Simple, low-cost micro-culture method for rapid diagnosis of mucormycosis in murine model H. Badali, A. Vaezi, F. Faeli, F. Ahangarkani, M. Fakhar, S.H. Khojasteh Mazandaran University of Medical Sciences, SARI, Iran Objective: Mucormycosis is a life threatening invasive fungal infection caused by mucoralean fungi and delay in diagnosis and treatment usually results to high mortality rates. This study aimed to describe a simple, low cost micro-culture method for rapid diagnosis of mucormycosis in murine model. Methods: Infection by reference strain (Rhizopus oryzae), isolated from cerebral mucormycosis was induced in three groups which consist of five immunocompetent mice with three different inoculums (1 × 104 , 1 × 105 and 1 × 106 cfu/ml) in a volume of 0.2 ml into the lateral tail vein. Animals were euthanized daily, at day 3 to 7 post infection. Homogenized tissues (brain and kidney) and blood samples were cultured on SDA and diphasic blood-culture bottle and incubated at 35◦ C. Subsequently, histopathology and molecular assay have performed for confirmation. Micro-culture sampling was adjusted by non-heparinized glass capillary tube with 50–70 μl of RPMI 1640 medium (Sigma). Homogenized tissue and blood samples (75 capillary tubes for 15 mice) were ◦ inoculated into capillary tubes and sealed with paraffin wax and incubated at 35 C. After 24 hr direct examination were performed using invert microscope. Results: 21 out of 75 (28%) blood samples and 14 of 15 (93.3%) brain and kidney of each samples showed positive microculture results. From 25 micro-culture blood samples for each group, 5, 9 and 7 were positive with the inoculum sizes of 1 × 104 , 1 × 105 and 1 × 106 cfu/ mouse, respectively. Neither positive blood culture, nor PCR were observed. However, PCR and tissue culture were positive for 25 of 30 (83.3%) and 27 of 30 (90%), respectively. Conclusion: Use of micro-culture as a simple, rapid, and reliable method has the potential role to become a valuable surrogate assay for early diagnosis of mucormycosis. Further validation is required to confirm the clinical utility of this method.

PP2.009 Study the effect of honey ingestion on recognition of Aspergillus fumigatus conidia by peritoneal macrophages D. Nikaein, A.R. Khosravi, A. Sharifzadeh University of Tehran, TEHRAN, Iran Objective: Invasive aspergillosis (IA) is one of the most severe systemic fungal diseases caused by the opportunistic fungus Aspergillus. It is the main reason of fungal related mortality in high risk patients. The most important predisposing factor known is quantitative and/or qualitative defect in neutrophils; however the increase in the number of IA in non-neutropenic immunocompromised patients highlights the importance of non-neutrophil defense-related factors. These mechanisms may include the recognition of the microorganism, recruitment of leucocytes other than neutrophils and effector mechanisms of recruited or resident cells. In this study we examined the effect of three Iranian honeys including Thyme, Pennyroyal and Astragalus Honeys on TLR2 and TLR4 gene expressions in mice involving with Invasive Aspergillosis. Methods: BALB/c mice weighing between 20–30gr were divided into 10 groups (honey alone, honey and infection, negative and positive controls) each containing 10. Mice were treated with honey (1.5 g/kg BW/orally) for 10 days. At day 6, mice in infection group were infected with Aspergillus fumigatus conidia (5 × 105/ml) intravenously. Animals were sacrificed at day 11 and their peritoneal macrophages were cultured. The mRNA from macrophages was extracted and TLR2 and TLR4 gene expression was determined by semi-quantitative RT-PCR. Results: The results showed that TLR2 expression by peritoneal macrophages had decreased in all honey treated mice in comparison to control group, however this decrease was not significant except in mice receiving Thyme honey (P > 0.05). Among infection groups, only infected mice treated with Pennyroyal had significantly higher TLR2 expression; while TLR2 expression had increase in all honey treated groups comparing to normal saline treated mice. TLR4 expression showed that infected groups had higher TLR4 expression comparing to non-infected groups and this increase was significant among mice treated with Pennyroyal and Astragalus honeys (P < 0.05). All honey treated infected groups had lower TLR4 expression than saline treated infection group (P < 0.05). Conclusion: It can be concluded that honey could increase Aspergillus recognition by peritoneal macrophages, however in order to illuminate the exact mechanism of action of honey on innate immune responses during invasive aspergillosis, more studies are necessary in the future.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Objective: Aspergillus is a ubiquitously distributed opportunistic fungus that causes a wide range of infections in both immunocompetent and immunocompromised hosts. Aspergillus fumigatus is the global leading cause of invasive aspergillosis associated with high morbidity and mortality. A. flavus also causes invasive aspergillosis and is known to produce aflatoxins. Aspergillus species and other fungi are accounted as a significant cause of water contamination due to their ability to survive after filtration in distribution networks and during storage even when they have been treated with chlorine. The presence of Aspergillus in drinking water can lead to invasive infections, allergy and toxic responses, particularly in immunocompromised patients. In this study, we investigated the occurrence of pathogenic Aspergillus species in drinking water from restaurants in Kathmandu, Nepal. Methods: A total of 120 drinking water samples were collected between March to June 2017 from restaurants in the centre of Kathmandu and processed using a membrane filter (MF) technique according to standard methods of American Public Health Association (2005). A volume of 100 mL water was filtered through a sterile membrane filter with 0.45 μm pore size and 47 mm diameter. The membranes were placed on Sabouraud dextrose agar plates with chloramphenicol (50 mg/L) and incubated at 37◦ C for up to 7 days and examined daily for any visible growth of pathogenic fungi. Pathogenic Aspergillus species as well as different types of other fungi were enumerated and identified to species complex level by macroscopic and microscopic morphology. Gram stain, germ-tube test and biochemical tests were also performed for identification of yeasts. Results: All treated drinking water samples were positive for the growth of pathogenic fungi. Aspergillus species were recovered from 63% of water samples from restaurants but yeasts (83.7%) were more predominant than filamentous fungi (16.3%). Total count of Aspergillus species ranged from 1 to 38 colony forming units (cfu)/100 mL, with an average of 5 cfu/100 mL. The most abundant genera of filamentous fungi identified were Aspergillus (10.2%) but Fusarium (1.0%), Penicillium (0.8%), Rhizopus(0.4%), Mucor (0.4%), Curvularia (0.3%) and Trichoderma (0.2%) were also isolated. The genera Rhodotorula (35.1%) and Candida (25.5%) were detected in a high frequency. Among Aspergillus isolates, A. fumigatus (5.3%), A. flavus (15.8%) and A. niger (78.9%) were recovered from drinking water samples. Conclusion: Pathogenic Aspergillus species were the most frequently isolated filamentous fungi in treated drinking water sources in Kathmandu. The occurrence of opportunistic fungal pathogens in drinking water is a potential threat to human health and indicated increased risk of Aspergillus infections. Awareness of drinking water quality and water safety and the availability of improved drinking water treatment systems should be emphasized to maintain microbial drinking water safety.

PP2.011 Transcriptomic analysis of non -invasive infections by Aspergillus fumigatus: the case of sino-nasal aspergillosis (SNA) in dogs ¨ I. D. Valdes, H.A.B. Wosten, H. De Cock Utrecht University, UTRECHT, Netherlands Objective: The form of human fungal sinusitis that most closely approximates the disease occurring in the dog is chronic erosive non-invasive fungal sinusitis. This disease is characterized by final destruction of bone in the absence of tissue invasion by the fungus and requires both removal of fungal plaques, necrotic tissue and medical therapy with antifungals. Remarkably, these fungal plaques are white indicated that asexual development does not proceed in the patients. Immune response in SNA infections has been studied via biopsy and cytokine profiling as well as transcriptomic analysis of the host tissue. However, a transcriptomic study of this fungal pathogen growing in patients causing a non-invasive infection has never being performed. We obtained fungal plaques directly from canine patients suffering from SNA and characterize the transcriptome of the causative fungus A. fumigatus in order understand gene expression in the context of the host and particularly in the field of in-host adaptation Methods: Four different fungal plaques were isolated from dogs suffering from SNA. After surgical removal using endoscope or trephination part of fungal plaques were immediately frozen in liquid nitrogen and stored at -80◦ C for RNA isolation and sequencing. R from Qiagen and sequencing was performed by ServiceXS (Leiden, The RNA isolation was performed using RNeasy Mini Kit Netherlands). RNA-seq analysis involved quality check with fastQC. Cleaning and trimming of reads with Fastx-toolkit.Kallisto was used for transcript quantification(TPM) with A.fumigatus Af293 (AspGD) as reference. For functional characterization of the transcriptome, highly variable expressed genes between samples were removed, and 3 subjective levels of expression were established: low (1 to 39.8 TPM), median (39.8 to 1584.8 TPM) and high (1584.8 to 79432.8 TPM), for each group an enrichment analysis was performed. Additionally a more targeted categorization of the transcriptome was done using published lists of genes involved in stress, reproduction and virulence. Results: According to the used criteria 17% of the expressed genes presented a stable expression across all 4 fungal plaques. Careful examination of this group of genes showed genes previously reported to be involved in SskA-Hog/SakA signalling pathway with some of them (bck1 and hdaA) also involved in the regulation of secondary metabolism. Interestingly, central regulators of asexual reproduction like BrlA,WetA and AbaA showed variable or null expression. A similar pattern was observed for catalases and superoxide dismutases. Finally comparison with published biofilm expression data showed that 18% of the stable expressed genes were also differentially expressed in A. fumigatus biofilm, of which approximately half of them were described to be differentially expressed in an “mature” biofilm (48 h). Conclusion: 1-To our knowledge this is the first transcriptomic study of A. fumigatus in the context of a natural non-invasive infection in dogs suffering from SNA. 2-Variability in gene expression in SNA fungal plaques could be caused by several factors like time of infection, host response, and genomic differences. 3-SNA fungal plaques resemble a non-sporulation mature biofilm, explained partially by low expression of central regulators of sporulation and the expression of some genes related to previously reported biofilm formation.

S42

PP2.012 In vitro combination of voriconazole with micafungin against azole-resistant clinical isolates of Aspergillus fumigatus from different geographical regions H. Fakhim1 , A. Vaezi2 , E. Dannaoui3 , C. Sharma4 , B. Mousavi5 , E. Nasri6 , A. Chowdhary4 , J.F. Meis7 , H. Badali8 1 Department of Medical Parasitology and Mycology, Faculty of Medicine, Urmia Univ, URMIA, Iran 2 Department of Medical Mycology and Parasitology, School of Medicine, Mazandaran, SARI, Iran 3 ´ ˆ ´ Universite´ Paris-Descartes, Faculte´ de Medecine, APHP, Hopital Europeen Georges, PARIS, France 4 Department of Medical Mycology, Vallabhbhai Patel Chest Institute, University of, DELHI, India 5 ´ Dynamyc Research Group (EA 7380), Paris Est Creteil University, Ecole nationale, PARIS, France 6 Department of Infectious Diseases, Shahid Beheshti University of Medical Science, TEHRAN, Iran 7 Department of Medical Microbiology and Infectious Diseases, Canisius-Wilhelmina, NIJMEGEN, Netherlands 8 Pharmaceutical Sciences Research Center, Mazandaran University of Medical Scienc, SARI, Iran Objective: Azole-resistant Aspergillus fumigatus isolates have emerged as a major source of life threatening aspergillosis in hospitalized patients and these infections have been associated with significant morbidity and mortality even when properly diagnosed and treated. Due to the small number of antifungal agents available, their potential side effects and development of drug resistance, novel strategies are needed to improve outcome of invasive aspergillosis. The aim of this study was to determine the in vitro interaction of voriconazole with micafungin, against azole-resistant A. fumigatus clinical isolates harboring various resistance mechanisms and originating from different geographical regions. Methods: A panel of 33 well-characterized clinical A. fumigatus strains, comprising azole-resistant [i.e., TR34 /L98H (n = 10), TR46 /Y121F/T289A (n = 6), G54E (n = 8), M220 (n = 3), resistant isolates with no mutations in cyp51A gene (n = 4)] and azole-susceptible (wild type; n = 2) strains was tested. These isolates originated from the Netherlands, Romania, Tanzania, India and Iran. The in vitro interaction between voriconazole and micafungin was tested by using a checkerboard method based on the microdilution broth reference technique (M38-A2) of the Clinical and Laboratory Standards Institute. Both a complete and partial inhibition endpoint (50% inhibition) was used. The fractional inhibitory concentration index (FICI) was calculated and the interaction was interpreted as synergistic for FICI ≤ 0.5, indifferent for FICI 0.5–4, and antagonistic for FICI > 4. Results: The range of voriconazole MICs and micafungin MECs when tested alone were 0.125 - >16 μg/ml and 0.002– 0.031 μg/ml, respectively. The widest MIC range of voriconazole was 0.125 - >16 μg/ml for resistant A. fumigatus isolates with and without Cyp51A mutations. By using a complete inhibition endpoint, FICI for TR34 / L98H, TR46 /Y121F/T289A, G54E, M220, and no mutations ranged from 0.37 to 2.06, 0.75 to 1.5, 0.62 to 2.5, 0.5 to 1.5 and 0.62 to 1.25, respectively. The interaction between voriconazole and micafungin was indifferent for 31 of 33 (93.9%) isolates. The combination was synergistic for only one isolate with TR34 / L98H mutation and antagonistic for one azole-resistant isolates with G54E mutation. Although, these drugs in combination showed a more potent activity than voriconazole alone, there was no significant difference for voriconazole and micafungin against these isolates (P > 0.05). Conclusion: In vitro interaction of voriconazole and micafungin was not synergistic but exhibited indifferent activity against 93.9% of azole resistant A. fumigatus isolates. An increased likelihood that the resistant A. fumigatus will be susceptible to at least one of the components makes them a suitable option as an empiric combination regimen. More in vitro and in vivo studies are necessary to address questions regarding azole and echinocandin combination therapy.

PP2.013 Synergistic combinations of glabridin and voriconazole to battle against Aspergillus fumigatus M. Nabili1 , M Moazeni2 , M.T Hedayati2 , T Shokohi2 , N Aslani3 1 Young Researchers and Elite Club, Sari Branch, Islamic Azad University, SARI, Iran 2 Invasive fungi research center, Mazandaran university of medical sciences, SARI, Iran 3 Invasive fungi research center, Mazandaran university of medical sciences, Sari, SARI, Iran Objective: Voriconazole (VRC) is widely recommended to be the agent of first-line therapy for IA. However, surveillance studies have been demonstrated that there is an increase in the frequency of azole resistance in A. fumigatus. In recent years, studies on natural agents which have effective synergisms with antifungal drugs have been increased. Glabridin (Gla) is an isoflavonoid, the main ingredient of the root extract of glycyrrhiza glabra (Licorice) plant. In the present study, synergistic antifungal effect of Gla and VRC against resistant and susceptible clinical and environmental A. fumigatus isolates and the possible mechanisms were investigated. Methods: Antifungal susceptibility testing against Gla and VRC alone and especially in combination with VRC was performed on 50 A. fumigatus strains according to Clinical and Laboratory Standards Institute (CLSI) M38-A2 document. The interactions of Gla and VRC were investigated by using a microdilution checkerboard method based on the CLSI reference technique with 96-well microtiter plates. To assess the interaction of combinations of drugs, the fractional inhibitory concentration index (FICI) was calculated based on the Loewe additivity theory. The interaction was defined as synergistic if the FICI was ≤0.5, indifferent if >0.5 – ≤4.0, and antagonistic if >4. Results: According to in vitro antifungal susceptibility tests and the minimal inhibitory concentration (MIC) values of the clinical cut-off points, VRC susceptible (n = 45) and VRC resistant (n = 5) A. fumigatus strains were detected. The MIC indicated that Gla alone possessed a broad spectrum antifungal activity at relatively high concentrations (MIC50 , 16 mg/mL). Our results demonstrated that synergistic interactions between Gla and VRC with FICI range values of 0.15 to 0.5 against VRC susceptible and VRC resistant A. fumigatus strains. Conclusion: This study suggests that Gla possessed a synergistic effect with VRC and considered a safe agent to fight against A. fumigatus strains. Also, Gla and VRC might be considered as a novel naturally which providing new information for developing novel antifungal agents.

PP2.014 Molecular characterizations and in vitro susceptibility patterns of Aspergillus fumigatus in a tertiary care hospital, 1999–2016 EI Liu, YABIN Zhou, QIAN Wang, RUOYU Li Peking University First Hospital, BEIJING, China Objective: To investigate molecular characterizations and in vitro susceptibility patterns of Aspergillus fumigatus in a tertiary care hospital from China Methods: A total of 397 clinical A. fumigatus were collected and tested antifungal susceptibility to itraconazole, voriconazole, posaconazole, caspofungin, micafungin, and amphotericin B. The complete protein coding regions together with the promoter regions of the cyp51A gene in all azole non-wild type isolates were amplified by PCR and subsequent sequenced. For all isolates, the CSP typing, mating typing, and microsatellite typing were determined. Results: Fifteen isolates of azole-resistant A. fumigatus were detected, despite that non-wild type/resistant isolate to caspofungin, micafungin, and amphotericin B was not detected. Among these azole-resistant isolates, 5 isolates harbored G54W mutation, 3 isolates harbored G54R mutation, 3 isolates TR34/L98H/S297T/F495I mutation, 2 isolates harbored TR46/Y121F/T289A mutation, 1 isolate harbored M220I mutation and 1 isolate harbored TR34/L98H mutation. There were 20 CSP types in 397 clinical isolates, with t04A, t01 and t03 as the three most common CSP types. Two CSP types firstly identified in this study were defined as t28 and t29, respectively. There were 196 (49.6%) MAT1-1 and 201 (50.4%) MAT1-2 isolates among 397 isolates. All M220I, G54R, G54W, TR34/L98H and TR46/Y121F/T289A mutation isolates in this study was MAT1-1, while 2 of the 3 isolates with TR34/L98H/S297T/F495I mutation was MAT1-2, and the remaining one was MAT1-1. And 15 azole-resistant isolates were divided into 14 different microsatellite STR types. Two TR46/Y121F/T289A mutation isolates shared the same STR type. Phylogenetic analysis of the 15 azole-resistant isolates and 382 azole-susceptible isolates showed that all M220I, G54R and G54W isolates belonged to a same clade, three TR34/L98H/S297T/F495I mutation isolates belonged to three separate clades, the TR34/L98H isolate belong to a same clade with one TR34/L98H/S297T/F495I mutation isolate (BMU04835), while the TR46/Y121F/T289A mutation isolates belonged to another clade. The TR34/L98H mutation isolate in this study was highly related with the isolates harboring the same cyp51A mutation from the Netherlands. Similar phenomenon was also observed in TR34/L98H/S297T/F495I and TR46/Y121F/T289A mutation isolates. However, one TR34/L98H /S297T/F495I isolate presented a distinct genetic background from other azole-resistant isolates with same mutation. Interestingly, this isolate shared a same CSP type but opposite MAT type with a TR34/L98H mutation isolate, indicating sexual reproduction in the evolution of azole-resistance. Conclusion: Azole-resistance of A. fumigatus in China is resulted from mutation in cyp51A gene. MAT1-1 isolates of A. fumigatus might be prone to develop azole-resistance. One TR34/L98H /S297T/F495I mutation isolate in this study might be originated from a different evolutionary trajectory. And 2 new CSP types of A. fumigatus were defined.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Medical Mycology, 2018, Vol. 56, No. S2

PP2.015 Mucormycosis in Iran: a six-year retrospective experience S. Dolatabadi1 , B. Ahmadi2 , A. Rezaei-Matehkolaei3 , H. Zarrinfar4 1 Sabzevar university of new technology, SABZEVAR, Iran 2 Bushehr University of Medical Sciences, BUSHEHR, Iran 3 Ahvaz Jundishapur University of Medical Sciences, AHVAZ, Iran 4 Mashhad University of Medical Sciences, MASHHAD, Iran Objective: Mucormycosis is a devastating infection caused by Mucoralean fungi. Data concerning the global epidemiology of mucormycosis are scarce and little is known about the characteristics of mucormycosis in Iran. In this study, we aimed to understand the distribution of this infection in Iran retrospectively and to ascertain whether the patterns of infection are associated with specific host factors or not. Methods: A total of 208 cases were included in this study occurring during 2008–2014 and were validated according to (EORTC/MSG) criteria. Cases were collected from 16 provinces. Isolates were examined morphologically and molecularly using internal transcribed spacer (ITS) region; ITS1 / ITS4 primers as barcoding markers. Results: A rising trend as significant increase from 9.7% in 2008 to 23.7% in 2014 was observed. The majority of patients were female (51.4%) with median age of 50, and the infections were seen mostly in autumn season (39.4%). Diabetes mellitus (75.4%) was the most common underlying condition, and sinus involvement (86%) was the mostly affected site of infection. Amphotericin B (AmB) was the drug of choice for the majority of cases. Sixty four isolates didn’t show any growth in the lab and Rhizopus arrhizus var. arrhizus was the dominant species. Conclusion: Considering the high mortality rate of mucormycosis, early and accurate diagnosis, with the aid of molecular methods may provide accurate treatments and improve the survival rate. Therefore, increased monitoring and awareness of this life-threatening disease is critical.

PP2.016 Volatile sulphur compounds produced by Pseudomonas aeruginosa synergize with Aspergillus fumigatus in vivo enhancing the pathobiology of co-infection J. Scott1 , M Sueiro-Olivares1 , C Heddergott2 , J.P. Latge2 , E Bignell3 , J Amich1 1 University of Manchester, MANCHESTER, United Kingdom 2 Institut Pasteur, PARIS, France 3 University of Mancheter, MANCHESTER, United Kingdom Objective: Co-infection with Pseudomonas aeruginosa and Aspergillus fumigatus is associated with a more rapid decline in Cystic Fibrosis pulmonary function, more frequent hospitalisations and more respiratory infections, all leading to worse prognosis. Recently it was reported that P. aeruginosa produced dimethyl sulphide (DMS), a volatile sulphur compound (VSC), promotes A. fumigatus growth in vitro. The aim of this study was to investigate the role of VSCs for A. fumigatus growth and the relevance of P. aeruginosa derived VSCs in the pathogen-pathogen interaction during co-infection. Methods: Gas chromatography mass spectrometry was used to identify the major VSCs derived from methionine catabolism that can be exploited as S-source. Production and assimilation of these VSCs was then characterised using an in vitro volatile setup. A leukopenic murine model of pulmonary aspergillosis was used to investigate the sulphur sources utilised by A. fumigatus during infection of the mammalian lung. The alternative mini-host model of Galleria mellonella allowed investigating the influence of P. aeruginosa volatiles on A. fumigatus during co-infection in vivo. Results: Here we show that A. fumigatus produces a number of VSCs during methionine catabolism which can be exploited as sole sulphur source. These VSCs are assimilated into metabolism as H2 S, as proved by the inability of a cysBcysD strain to utilise them. Major VSCs released are DMS and DMDS, which were previously reported to be produced by P. aeruginosa and to promote A. fumigatus growth in vitro. We demonstrate that pure and Pseudomonas derived DMS and DMDS are exploited as S-source by A. fumigatus and promote growth on low concentration of organic S-source. The cysBcysD strain cannot utilise any inorganic S-source, including DMS and DMDS, but is completely virulent in both a leukopenic model of pulmonary aspergillosis and the Galleria model. This strongly suggests that A. fumigatus exploits organic S-sources during growth in the tissues. In the Galleria model, co-infection with P. aeruginosa and A. fumigatus results in increased mortality. Interestingly, co-infection with wild-type A. fumigatus enhances mortality to a much higher degree than co-infection with the cysBcysD strain. This suggests that P. aeruginosa is producing DMS in vivo and this can be exploited as an additional sulphur source by A. fumigatus wild-type, but not the mutant strain, promoting its growth and in turn increasing mortality. Further investigations are ongoing to investigate this hypothesis Conclusion: Aspergillus fumigatus exploits organic sulphur sources during in vivo growth. Increased mortality caused by A. fumigatus – P. aeruginosa co-infection can partially be attributed to the positive effect of P. aeruginosa derived VSCs on A. fumigatus growth due to its utilization as an additional S-source.

PP2.049 Involvement of iron metabolism in fluconazole susceptibility in Saccharomyces cerevisiae and Candida species L. Demuyser1 , E. Swinnen1 , A. Fiori2 , B. Herrera-Malaver1 , K. Verstrepen1 , P. Van Dijck1 KULeuven/VIB, LEUVEN, Belgium AgroSafve, GHENT, Belgium

1 2

Objective: The limited arsenal of antifungal therapies that is available and the increasing occurrence of resistance against these drugs hamper efficient eradication of fungal infections. The consequences for the patient as well as the economy are substantial. A promising strategy in the search for new therapies is the potentiation of commonly-used, yet not fully effective antifungal drugs, such as fluconazole, by combination therapy. To achieve this, it is essential to understand which mechanisms regulate susceptibility to these drugs. Methods: By screening overexpression and deletion strain collections of the model yeast Saccharomyces cerevisiae for altered susceptibility to fluconazole, we identified a number of interactors involved in the regulation of this process. Results: ScMGE1 encodes a yeast chaperone involved in Fe-S cluster metabolism and protein import into the mitochondria. In this study, we identified ScMGE1 as a multicopy suppressor of susceptibility to fluconazole in S. cerevisiae. We demonstrate that this phenomenon is not, exclusively, dependent on the integrity of the mitochondrial DNA, nor on the presence of the drug efflux pump ScPdr5. Instead, we show that the increased dosage of ScMge1 rather plays a protective role by retaining increased amounts of ergosterol upon fluconazole treatment. By overexpressing ScMGE1, the flux towards ergosterol synthesis increases while the flux leading to the production of a toxic sterol diminishes. Iron metabolism and, more particular, Fe-S cluster formation are involved in regulating this process, since the responsible Hsp70 chaperone, ScSsq1, is required. Additionally, we show the necessity, but by itself insufficiency, of activating the iron regulon in establishing the ScMge1-related effect on drug susceptibility. Finally, we confirm a similar role for Mge1 in fluconazole susceptibility in the pathogenic fungi Candida glabrata and Candida albicans. Conclusion: We can conclude that iron metabolism plays a central role in regulating fungal susceptibility to fluconazole. Fe-S cluster formation as well as activation of the iron regulon leads to protection of the cell from fluconazole by retaining higher amounts of ergosterol. By understanding how S. cerevisiae and pathogenic fungi react to and cope with the presence of clinically-used drugs, we can learn how to potentiate these drugs and, as such, increase the effectiveness of treatment. Demuyser L, Swinnen E, Fiori A, Herrera-Malaver B, Verstrepen K, Van Dijck P. 2017. Mitochondrial cochaperone Mge1 is involved in regulating susceptibility to fluconazole in Saccharomyces cerevisiae and Candida. mBio 8:e00201-17.

ABSTRACT

S43

PP2.050 Cellular apoptosis: an alternative mechanism of action of caspofungin in Candida glabrata

PP2.053 Candida glabrata epithelial cell damage

M. Moazeni1 , P. Aryamloo1 , H. Asgarian-Omran1 , T. Shokohi2 , H. Badali1 , H. Hossein-Nataj1 , N Aslani3 , M Nabili4 , A. Abdollahi Gohar1 1 Mazandaran University of Medical Sciences, SARI, Iran 2 Mazandaran University Medical Sciences, School of Medicine, SARI, Iran 3 Invasive fungi research center, Mazandaran university of medical sciences, Sari, SARI, Iran 4 Young Researchers and Elite Club, Sari Branch, Islamic Azad University, SARI, Iran

M. Pekmezovic, S. Mogavero, B. Hube Leibniz Institute for Natural Product Research and Infection Biology - HKI, JENA, Germany

Objective: Although the mechanism of activity for echinocandins is known, the physiological mechanisms by which these antifungal agents cause cell death via the classical apoptotic pathways are not well-defined yet. Regarding this, the present study aimed to evaluate the mechanisms of caspofungin-induced Candida glabrata cell death. Methods: For the purpose of the study, the minimum inhibitory concentration (MIC) of caspofungin against C. glabrata (ATCC 90030) was determined using the broth microdilution reference method (CLSI M27-A2 and M27-S4). The annexin V and propidium iodide staining was performed to determine the way through which caspofungin exerts activity against C. glabrata (i.e., through the induction of apoptosis and/or necrosis). Additionally, the possible effect of caspofungin on inducing the expression of two apoptotic genes, namely MCA1 and NUC, was studied using the real-time polymerase chain reaction assay. Results: According to the obtained MIC (0.5 μg/mL), C. glabrata, exposed to 0.25, 0.5, and 1 μg/mL of caspofungin, exhibited the features of late apoptosis/necrosis after 18 h of incubation. Furthermore, the use of 0.25, 0.5, and 1 μg/ml caspofungin induced apoptosis (early/late) in 14.67%, 17.04%, and 15.89% of the cells, respectively. There was a significant difference between the percentages of early-apoptotic cells at the three concentrations (P < 0.05). The rate of necrosis was significantly greater in response to caspofungin. Accordingly, necrosis occurred in 71.26%, 71.26%, and 61.26% of the cells at the caspofungin concentrations of 0.25, 0.5, and 1 μg/mL, respectively (P < 0.05). The analysis of the data in REST software demonstrated that the expression of MCA1 and NUC1 genes had a significant increase (P < 0.05). Conclusion: As the findings of the present study demonstrated, caspofungin promoted both necrosis and apoptosis of C. glabrata cells at concentrations higher or equal to the MIC. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 412821 b5f117fa-4dfc-4389-ad3a-45c8dfea 70e2.png Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 412821 b5f117fa-4dfc-4389-ad3a-45c8dfea 70e2.png

PP2.051 The Newly Characterization of a Candida albicans Isolate from a recurrent Cervical Lymphadenitis Patient and its Clinic Indication C. Zhang1 , H. Sang2 , J. Chen3 1 Jinling Hospital / Nanjing University, NANJING, China 2 Jinling Hospital,, NANJING, China 3 Chinese Academy of Sciences, SHANGHAI, China Objective: Candida albicans is one of the most commonly isolated opportunistic fungal human pathogens and causes superficial and systemic candidiasis. Candida albicans may be considered normal flora in humans. Patients with chronic Candida infections are often plagued by illness, although chronic superficial infections are usually non-lethal. However, little research has focused on the mechanism of chronic or recurrent clinical superficial fungal infections. In this study, we isolated and identified a clinical C. albicans strain (JL01) from an unusual cervical lymphadenitis patient. The disease recurred several times over a 13-year period and had a severe impact on the patient’s quality of life. We compared this strain with the reference strain SC5314 to evaluate the characterization, sensitivity to different reagents, virulence in a mouse model of systemic infection, ability to escape the host immune response and growth rate. Our study may reveal the connection between the characterizations of clinical C. albicans strains and chronic fungal infections. Methods: The clinical strain was isolated from a 21-year-old male patient with cervical lymphadenitis caused by Candida albicans named JL01. We confirmed the strain by DNA sequencing of internal transcribed spacer (ITS) regions and identified the JL01 as Candida albicans. Cells were spotted onto YPD plates with various agents and cultured at room temperature (25◦ C) for 3 days to analyze the resistance to different stress conditions. To assess the phenotypic differences between the JL01 and standard reference strain (SC5314), we analysed these two strains under various hypha-inducing conditions. To analyse filamentous growth under the embedded conditions, we examined the phenotype of the JL01 strain at 37◦ C and 25◦ C in YPS agar. We examined the virulence of the JL01 strain in a systemic infection model. We further analysed the fungal growth and inflammation in the kidney in PAS-stained histological sections from ICR mice infected with both strains. We further analysed the fungal growth and inflammation in the kidney in PAS-stained histological sections from ICR mice infected with both strains. To reveal the global regulatory genes of clinical strain, we performed comparative transcriptomic analyses of the SC5314 and JL01 and analyzed the expression pattern of genes related to evasion or tolerance of host immune response, response to stresses and hyphae growth which may explain the phenotype of the clinical strain JL01. Results: The JL01 strain is resistant to azole anti-fungal drugs, but sensitive to other anti-fungal drugs including caspofungin and amphotericin. The strain has also an ability to adapt to oxidative and osmotic stresses. Morphological analysis and virulence assay showed that the JL01 strain is defective in filamentous and invasive growth, and attenuated virulence during systemic infection. RNA-seq analysis revealed that the JL01 strain has a distinct gene expression profiling from a standard C. albicans strain SC5314, hundreds of transcripts were significantly dysregulated, including those related to stress response, morphogenesis and pathogenesis. Conclusion: Our study uncovered multiple faces of the JL01 strain in cell growth, stress response, morphogenesis and pathogenesis, may reveal the possible connection between the characterizations of clinical C. albicans strains and chronic fungal infections.

PP2.052 Epitope unmasking in vulvovaginal candidiasis is associated with hyphal growth and neutrophilic infiltration E. Pericolini1 , S. Perito2 , A. Castagnoli1 , E. Gabrielli2 , A. Mencacci2 , E. Blasi1 , A. Vecchiarelli2 , R.T. Wheeler3 1 University of Modena and Reggio Emilia, MODENA, Italy 2 University of Perugia, PERUGIA, Italy 3 University of Maine, ORONO, ME, USA Objective: Vaginal candidiasis is a common disorder in women of childbearing age. Since Candida albicans is a normal commensal of the vaginal mucosa, a long-standing question is how the fungus switches from being a harmless commensal to a virulent pathogen. Work with human subjects and in mouse disease models suggests that host inflammatory processes drive the onset of symptomatic infection. The expression of Candida virulence traits, especially those related to hyphal growth, can induce a powerful inflammatory response in the vaginal mucosa that includes strong neutrophil recruitment. Fungal cell wall molecules can also induce inflammation through activation of epithelial and immune receptors that trigger pro-inflammatory cytokines and chemokines, but pathogenic fungi can evade recognition by masking these molecules. Knowledge about which cell wall epitopes are available for immune recognition during human infection could implicate specific ligands and receptors in the symptoms of vaginal candidiasis. Methods: To address this important gap, we have directly probed the surface of fungi present in fresh vaginal samples obtained both from women with symptomatic Candida vaginitis and from women that are colonized but asymptomatic. Results: We find that the pro-inflammatory cell wall polysaccharide β-glucan is largely masked from immune recognition, especially on yeast. It is only exposed on a small percentage of hyphal cells that also tend to have enhanced levels of chitin. Enhanced β-glucan availability is only found in symptomatic patients with strong neutrophil infiltration, implicating neutrophils as the driver of these cell wall changes. Conclusion: This is especially interesting because neutrophils were recently shown to be necessary and sufficient to provoke enhanced β-glucan exposure in C. albicans, which is associated with elevated immune responses, both in vitro and in mice. Taken together, our data suggest that the architecture of C. albicans cell wall is finely regulated during vaginal candidiasis and therefore could be a target for innovative therapies.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Objective: Candida glabrata is the second most common pathogenic Candida species of humans. It is normally found among the resident microbiota of healthy individuals’ mucosae, but can cause disease when host barriers or immunity are impaired. Disease states range from superficial skin and mucosal infections to systemic infections. The transition from commensalism to pathogenicity is well described in C. albicans and it occurs in three major steps: adhesion, invasion and damage of the host cells. The same cannot be said about C. glabrata, where the same transition is still poorly elucidated. Since C. glabrata is phylogenetically very different from C. albicans and lacks some of the major C. albicans virulence attributes, such as its ability to form hyphae, it is unlikely that the steps leading to epithelial damage have common mechanisms between these two very different fungi. Methods: In this study, we aim to investigate the adhesion, invasion and damage potential of C. glabrata during infection of vaginal human epithelial cells (ECs) in vitro and gain more insight into its pathogenicity mechanisms. Results: C. glabrata adhered to ECs similar to C. albicans, but no invasion was observed. Although C. glabrata did not cause epithelial damage 24 h post infection (p.i.), significant epithelial damage was recorded 48 h p.i. To identify genes required for epithelial damage, a large-scale C. glabrata deletion library (619 strains) was screened. Sixteen mutants lacking genes associated with cell wall organization and cell adhesion showed reduced damage potential. Conclusion: These data suggest a hyphal independent damage mechanism of C. glabrata, which requires adhesion, but not invasion. In further studies, we aim at characterizing the role of damage associated genes and elucidating the processes leading to damage.

PP2.054 Novel formulated nanocomposite containing Indolicidin and Graphene Oxide against Candida albicans: in vitro and in vivo study M. Roudbary1 , A. Farzanegan1 , M. Falahati1 , M. Khoobi2 , E. Gholibegloo3 , P. Karimi1 , M. Khanmohammadi1 Iran University of Medical Sciences, TEHRAN, Iran Tehran University of Medical Sciences, TEHRAN, Iran 3 University of Zanjan, ZANJAN, Iran 1

2

Objective: Candidiasis is one of the most important opportunistic fungal infections in immunocompromised patients. The emergence of multidrug-resistant Candida species necessitates the development of novel antifungal agents. Seeking to the discovery of natural antifungal agents, this study aimed to synthesize a novel formulated nanocomposite containing Indolicidin (IN), antimicrobial peptide, and Graphene Oxide (GO), kind of nanomaterial, against Candida growth using in vitro and in vivo experiments for the first time. Methods: The IN peptide was conjugated with the GO. The formulated nanocomposite (GO-IN) was characterized using Scanning electron microscopy, equipped with an energy dispersive X-ray accessory, X-ray power diffraction, and Fourier transform infrared method analysis. The in vitro antifungal activity of fluconazole (FLU), GO, IN, and GO-IN was determined against Candida albicans (C. albicans) Compared to control groups. Cell cytotoxicity assay against intestinal epithelial cells (IEP) and hemolytic activities of GO-IN were performed. Moreover, in vivo experiments of nanocomposite efficacy were assessed in BALB/c mice infected with disseminated candidiasis. Results: Our results showed that nanocomposite had the highest inhibitory effect against C. albicans (MIC 3.12 μg/mL) compared with Flu (MIC 4 μg/mL), IN (MIC 12.5 μg/mL), and GO (MIC 6.25 μg/mL). The formulated nanocomposite had a low cytotoxic effect at the tested concentration (P < 0.05). The hemolytic activity of nanocomposite considered as 2.73%. For in vivo experiments, infected mice were successfully treated with GO-IN once a day within 7 days. GO-IN treated group eliminated the Candida infection in the spleen and liver of BALB/c mice (P = 0.001) similar to fluconazole. Although there was no significant difference in histological manifestations between Flu and GO-IN groups, these manifestations were greater in GO-IN group than Flu group. Conclusion: Altogether, our finding suggests that synergistic combination of GO and IN provide a new option, representing a potential therapeutic efficiency against disseminated candidiasis in an animal model as well as might be used as adjunct therapy in the management of candidiasis.However, further investigation is needed to evaluate the efficacy of the nanocomposite.

PP2.055 Transmission-frequency of Aspergillus fumigatus in cystic fibrosis patients through coughing T.G.P. Engel, E. Erren, K.S.J. Vanden Driessche, M.H. Reijers, W.J.G. Melchers, P.J.F.M. Merkus, P.E. Verweij Radboud University Medical Centre, NIJMEGEN, Netherlands Objective: Cystic fibrosis (CF) patients are often colonized with a variety of fungi. It is thought that acquisition through air is the main route of infection and there is hardly any evidence of patient-to-patient transmission. However, the often high fungal loads in colonized CF patients may suggest transmission of fungi through cough-secretion. We investigated the microbial spread of Aspergillus fumigatus, relative to typical bacterial CF pathogens, during coughing maneuvers in chronically colonized CF patients. Methods: During two, routine quarterly visits, adult CF patients colonized with A. fumigatus (>50% of sputum samples positive in the last 2 years) were asked to cough twice on 2 different “cough plates”. Cough plates contained Sabouraud dextrose agar (SDA) or Columbia blood agar (CBA). Simultaneously a sputum sample was collected conform CF guidelines. Identification of bacterial pathogens and fungi was performed. If A. fumigatus was isolated on both the cough plate and sputum sample, ShortTandem-Repeat (STR) genotyping of all colony-forming-units (CFU) on all media was performed. Identical STR genotypes were deemed as proof of secretion. Additionally, STR genotyping of all A. fumigatus cultured in the last 6 sputum samples was performed for all patients. The transmission frequencies of bacterial pathogens were assessed on the CBA cough plate as a growth control, using the sputum samples as the gold standard. Results: Twenty cough-plate assessments were performed from 15 patients. A. fumigatus was cultured in 11 sputum samples (9 patients). Two out of 11 (18%) assessments with a positive sputum culture also showed growth of A. fumigatus on the cough plate. In one patient the STR genotype of the secreted fungus was identical to all A. fumigatus cultured in the current and previous sputum samples. The other patient showed four unique A. fumigatus in the sputum culture of which none was identical to the STR genotype of the fungus cultured on the cough plate. All CBA cough plates showed bacterial growth. The transmission frequencies of bacterial pathogens was: Pseudomonas aeruginosa, 60%; Staphylococcus aureus, 8.3%; Stenotrofomonas maltophilia, 0%. Conclusion: This is the first study that shows secretion of A. fumigatus in a CF patient during coughing. Whether secretion actually causes transmission and cross-contamination between patients remains an important issue for further studies, as it may require additional control measures. In our future studies we will assess this issue and evaluate factors influencing secretion.

S44

PP2.056 Emergence of virulent non- albicans Candida species: An upcoming threat for population of Karachi S. A. Naz1 , G. Jabeen1 , S. Nazeer1 , S. Sharafat2 , S. Baig2 , M. Shafique1 , N. Jabeen1 1 Federal Urdu University of Arts, Science and Technology, KARACHI, Pakistan 2 Dow University of Health Sciences, KARACHI, Pakistan

Medical Mycology, 2018, Vol. 56, No. S2

Financial support: FAPESP, CNPq, CAPES PP2.090 Inhibitory Effects of Lactobacillus Culture Supernatants on Candida albicans YUKO Matsuda1 , OTOMI Cho1 , DAIKI Ogishima2 , TAKASHI Sugita1 1 Meiji Pharmaceutical University, TOKYO, Japan Juntendo University Nerima Hospital, TOKYO, Japan

2

Objective: Candida species are the major cause of opportunistic fungal infections that lead to a considerable rate of morbidity and mortality all over the world. These infections may range from mild skin or mucosal infection to serious systemic infections with high mortality rate. Although Candida albicans is the leading cause of these infections but recently non- albicans Candida (NAC) species are emerging as more pathogenic strains and are also responsible for causing drug resistant candidiasis. But these NAC are usually neglected in laboratory diagnosis in spite of the fact that they are more resistant to antifungal treatment and may pose great problems for human life in terms of health risk and economic burden. The following study has been designed to evaluate the prevalence of Candidiasis particularly caused by NAC species in the population of Karachi city. Moreover, the pathogenic potentials of these species were also evaluated by determining some of their enzymatic virulence factors. Methods: A total of 515 clinical isolates of Candida species were collected from Dow University of Health Science (DUHS) during the period of one year (October 2016- September 2017). All the isolates were identified by conventional methods (microscopy, germ tube test, morphology on CHROM agar and Corn meal agar and biochemical characteristics such as sugar assimilation and fermentation). RapID yeast plus kit (Remel, USA) was also used to identify rare species. The isolates were also screened for the production of some virulence factors. In this connection, production of phospholipase enzyme as virulence factor was detected by using Phospholipase egg yolk media, while Skim milk agar and Hemolysin media were used for the detection of proteinases and hemolysins activity respectively. Results: During the study, the candida species were predominantly isolated from females (73.7%) suffering from urogenital infections as compared to other clinical conditions. Among these strains, 58.3% were identified as C.albicans while remaining 41.7% were NAC species. C. galbrata is the predominant specie isolated among NAC followed by C. tropicalis. While other NAC species were isolated as C parapsilosis, C. krusei, C. lipolytica, C kefyr, C. guillormondii, C. lusitanei, C. zeylanoides etc. The virulence of these NAC were also found almost parallel to C.albicans in case of phospholipases and hemolysin production, however proteinase production was shown markedly by C. albicans. Conclusion: The increasing rates of emergence of non-albicans Candida species having almost similar traits of virulence as C albicans may pose upcoming threats in health care settings. Therefore there is a need of prompt management and accurate identification of these ignored species to suggest empirical antifungal therapy.

Objective: Vulvovaginal candidiasis (VVC) is a common superficial infection of the vaginal mucous membranes caused by Candida albicans. C. albicans exists as a yeast and/or hyphal form, and forms a biofilm on the vaginal epithelium. The healthy vaginal microbiome comprises predominantly Lactobacillus species, which inhibit pathogen invasion. We reported previously, using a pyrosequencing approach, that Lactobacillus gasseri and L. crispatus are representative vaginal microbial species in Japanese women. In this study, we assessed the mechanisms underlying the inhibitory effects of L. gasseri and L. crispatus culture supernatants on C. albicans budded-to-hyphal form transition (BHT), biofilm formation, and adhesion to HeLa cells. Methods: C. albicans cells were cultured with L. gasseri or L. crispatus culture supernatants under BHT- and biofilm formationinducing conditions. Inhibitory effects on biofilm formation were determined by 2,3-bis(2-methoxy-4-nitro-5-sulfophenyl)-5[(phenyl-amino)carbonyl]-2H-tetrazolium hydroxide (XTT) reduction assay. The expression levels of BHT- and biofilm formationassociated genes (HWP1, ECE1, ALS3, BCR1, EFG1, TEC1, and CPH1) were determined by reverse transcription-quantitative polymerase chain reaction. Inhibition of C. albicans adhesion to HeLa cells by the culture supernatants was evaluated by enumerating viable C. albicans cells. Results: Lactobacillus culture supernatants inhibited C. albicans hyphae and biofilm formation. The expression of BHT- and biofilm formation-associated genes was downregulated, and C. albicans adhesion to HeLa cells was inhibited, in the presence of the Lactobacillus culture supernatants. Conclusion: Culture supernatants of L. gasseri and L. crispatus, which are frequently present in the vaginas of healthy Japanese women, inhibit C. albicans BHT and biofilm formation by downregulating the expression of BHT- and biofilm formation-related genes, as well as adhesion of C. albicans to HeLa cells. These findings support the notion that Lactobacillus metabolites may be useful alternatives to antifungal drugs for the management of VVC.

PP2.091 SCY-078: A first-in-class, orally-bioavailable, glucan synthase inhibitor has broad spectrum activity against Candida, Aspergillus and Pneumocystis spp. STEPHEN Barat1 , KATYNA Borroto-Esoda1 , DAVID Angulo2 SCYNEXIS, Inc., JERSEY CITY, USA SCYNEXIS, Inc, JERSEY CITY, USA

1

PP2.089 Farnesol, tyrosol, and oxidative stress modulate the extracellular vesicle proteome and transcriptome in Candida albicans ˜ Jr.1 , M.G. Amorim2 , A. Melo1 , R.A. Mortara1 , R. Sinigaglia-Coimbra1 , A.K. Tashima1 , D. ROSANA Puccia1 , N. Leitao Nunes2 , I.T. Silva2 , R. Valieris2 , E. Dias-Neto3 1 ˜ PAULO, Brazil EPM-UNIFESP, SAO 2 ˜ PAULO, Brazil A. C. Camargo Cancer Center, SAO 3 ˜ PAULO, Brazil A. C. Camargo Cancer Institute, SAO Objective: We aimed to characterize the extracellular vesicles (EVs) produced by Candida albicans stimulated by farnesol, tyrosol and oxidative stress. EVs are closed structures, surrounded by a lipid bilayer membrane, which transport cellular components to the outside environment in all kinds of prokaryotic and eukaryotic organisms. The molecules already described in fungal EVs vary from protein, lipid, polysaccharide, melanin, mRNA, and s(small)RNA. EVs are involved in cell signaling and immune modulation. Methods: We used concentration and differential centrifugation steps to isolate EVs from culture supernatants of C. albicans cultivated for one day under shaking at 37◦ C in Ham’s F12 defined medium (pH 6.3) + 1, 5% glucose (controls), in the presence of farnesol (50 μM), tyrosol (20 μM) or 25 mM H2 O2 . The stimuli conditions were optimized to evoke a stressful environment without viability loss or change in cell morphology. EVs were analyzed by nanoparticle-tracking for number and size, by microscopy for interaction with C. albicans and macrophages, and by liquid chromatography coupled with in-tandem mass spectrometry for quantitative proteomics. We used Bioanalyzer and RNA-seq (Proton platform, Ion Torrent) for characterization of the mRNA and sRNA content in both EVs and C. albicans cells for each condition in biological triplicates. Results: Farnesol evoked about 8-fold increase in the C. albicans EV yields and a decrease in the mean EV size when compared with controls. Tyrosol and oxidative stress had the opposite effect. We observed a total of 202 proteins in control EVs versus 203 (oxidative stress), 252 (tyrosol), and 248 (farnesol), with 61% found in all samples. Most sequences were associated with catalytic activities. The most abundant proteins were associated with cell surface and morphology. In general, the proteins were comparatively more abundant in tyrosol-derived EVs. We observed that our stimulation conditions also modulated the EV mRNA population. We identified 842 differentially represented mRNA sequences among EV and C. albicans samples. The EV sequences, although in lower number than C. albicans sequences, showed higher proportion of modulation and exclusive mRNAs. Most importantly, comparison between EV and total C. albicans transcriptome suggested that the EV population does not reflect the cell mRNA population. Differential sRNA analysis is ongoing. Uptake assays with PKH26-labelled fungal EVs showed that they were either bound to or internalized by 10% of cultured C. albicans cells. On the other hand, when C. albicans was previously incubated with fungal EVs from both control and stressed cultures, the association of fungal cells with RAW 264.7 was inhibited by 15–20% in 2-to-4-h co-cultures. EVs isolated from tyrosol-stimulated cultures accelerated C. albicans filamentation under specific co-culture conditions. Conclusion: Extracellular vesicles from C. albicans can apparently signal both fungal cells and macrophages. Quorum sense molecules and oxidative stress can modulate the EV size, number, proteome, and transcriptome, thus suggesting that EVs might have a fundamental role in the fungal biology and virulence.

2

Objective: SCY-078 is a novel, oral and intravenous (IV), triterpenoid glucan synthase inhibitor with broadspectrumactivity against Candida, Aspergillus and Pneumocystis spp. currently in clinical development for use in the treatment of various fungal infections. The objective wasto establishthe activity of SCY-078 against pathogenicfungi to determine the utilityof SCY-078 as a future treatment of fungal diseases. Methods: SCY-078 was evaluated against multiple strains of Candida, Aspergillus and Pneumocystis spp. to ascertain the microbiological profile. Multiple in vitro andin vivo studies were conducted to yield the current understanding of the activity of SCY-078. Results: Experience to date with more than 1500 isolates of Candida spp. worldwide shows that SCY-078 has consistent fungicidal activity against Candida spp. including drug-resistant and difficult to treat strains, including C. auris. The activity of SCY-078 against echinocandin-resistant strains of Candida has been subject of investigation. In vitro studies using transmission and scanning electron microscopy have revealed morphological differences between treatment with SCY-078 and caspofungin. Despite sharing the same basic pharmacologic target (glucan synthase) as the echinocandins, the discernible morphological effects following treatment indicate that SCY-078 is differentiated from the echinocandins, which may, in part, be attributed to differences in target engagement. Utility against Aspergillus spp., including azole-resistant strains, has been demonstrated in vitro in nearly 500 isolates and in vivo in murine and rabbit models of aspergillosis. SCY-078 demonstrated fungistatic activity in vitro against Aspergillus spp. with microbiological outcome presenting as a stumpy phenotype attributed to the blocking of hyphal growth in the filamentous organisms. Studies with SCY-078 in combination with an azole antifungal (isavuconazole) have shown appreciable synergistic activity against Aspergillus spp. in both in vitro and in vivo models. The activity of SCY-078 against Pneumocystis spp. has been established in murine prophylaxis and treatment models where SCY-078 was shown to improve survival and reduce nuclei and asci burdens, with a level of activity in the model comparable to the current standard of care (trimethoprim/sulfamethoxazole). In addition to the activity against Candida, Aspergillus and Pneumocystis spp., SCY-078 has also been shown to be active against some rare moulds, with potent activity against Paecilomyces variotii and modest activity against Scedosporium prolificans. The extensive microbiological profile of activity of SCY-078 is complemented by a favorable PK/PD profile, as the systemic exposures necessary for activity across the various in vivo models of infection, and the respective MICs (and MECs) reported in vitro across various pathogenic fungi represent exposures that are achievable in humans. Further evidence in animal models shows that SCY-078 has extensive tissue permeability, readily distributing into tissues and achieving tissue to blood ratios ranging from 15-fold to more than 50-fold, thereby indicating that another key characteristic of SCY-078, in addition to the broad spectrum of microbiological activity, is the ability to distribute into various sites of potential infection at meaningful concentrations. Conclusion: Collectively, the existing in vitro and in vivo preclinical data indicates the utility of SCY-078 as an emerging treatment for difficult to treat and drug resistant fungal infections.

PP2.092 Upregulation Gene Expression Levels of SAP 1–3 Vaginal Discharge Candida albicans in Comparison to Culture of Candida albicans Isolates SEDIGHEH Hosseini1 , MOHAMMAD Yadegari2 , MASOUMEH Rajabibazl3 , EZZAT ALL Ghaemi1 Golestan university of Medical sciences, GORGAN, Iran Tarbiat Modares University, TEHRAN, Iran 3 Shahid Beheshti University of Medical Sciences, TEHRAN, Iran 1

2

Objective: Secreted Aspartyl Proteinase (SAP) is one of the main virulent factors in the pathogenesis of Candida. This enzyme is encoded by a family of at least 10 genes; among which, the role of SAP1-3 in mucosal infections is evident. This study aimed to investigate the of SAP1-3 genes expression of vaginal discharge Candida albicans, in comparison with to culture of Candida albicans isolates. Methods: Vaginal samples of 68 women with suspected vaginitis were obtained and cultured. 20 species of Candida albicans were identified using phenotypic and genotyping methods. Real-time PCR was used to determine the gene expression of SAP1-3, and their vaginal discharge Candida albicans and media of Candida albicans isolate in comparison with the control. Results: Candida albicans was found in the abundant species (47.8%). Increasing the relative expression of SAP1 genes in the level of vaginal discharge was observed to be 2.1-fold higher than that of media Candida albicans isolates. The SAP2 gene was also raised by about 3.2-fold in vaginal discharge relative to culture. The gene expression of the SAP3 was also increased by about 1.6-fold in vaginal discharge isolates relative to culture. In general, it can be concluded that SAP1-3 genes in vaginal discharge are more than culture isolated. Conclusion: The gene expression of SAP1-3 for the pathogenicity of Candida albicans was important during vaginal infections, the SAP2 gene was more than SAP1 and SAP3 genes. Therefore, it can be said that the gene SAP2 is a dominant gene in vaginal discharge and culture Candida albicans isolates.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

ABSTRACT

PP2.093 Virulence factors and susceptibility pattern of Candida albicans, Candida tropicalis and Candida glabrata from clinical specimens, Mwanza-Tanzania MARTHA F. Mushi1 , OLIVER Bader2 , CHRISTINE Bii3 , UWE Groβ 2 , STEPHEN E Mshana1 1 Catholic University of Health and Allied Sciences, MWANZA, Tanzania 2 Institute of Medical Microbiology, University Medical Center Goettingen, Germ, GOTTINGEN, Germany 3 Kenya Medical Research Institute, Center for Microbiology Research, NAIROBI, Kenya Objective: To determine virulence factors and the antifungal susceptibility pattern of Candida albicans, Candida glabrata and Candida tropicalis collected from human clinical samples in Mwanza, Tanzania. Methods: This was a cross-sectional study conducted between March and December 2017. Candida spp. isolated from blood, esophageal brushes, high vaginal swab, urine, sputum and oral swab of patients attending the Bugando Medical Centre during the study period were collected and characterized. Species identification was done by matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry. The antifungal susceptibility testing for fluconazole, voriconazole, posaconazole, micafungin, caspofungin and 5-fluorocytosine was done following the guidelines laid down by the European Committee on Antimicrobial Susceptibility Testing with MIC50 (μg/ml) recorded. Virulence –associated phenotypes (Phospholipase, proteinase, hemolytic, and coagulase activity) were determined for all Candida spp. Data analysis was done using STATA version 13. Results: A total of 376 Candida spp., (high vaginal swab: 146 (38.8%), oral swab: 99 (26.3%), urine: 68(18.1%), sputum: 47(12.5%), esophageal brushes: 11(2.9%) and blood: 5(1.3%)) were obtained during the study period. Of 376 studied Candida spp., 278(73.9%), 51(13.6%) and 47(12.5%) were C. albicans, C. tropicalis and C. glabrata, respectively. Phospholipase activity was the most frequently virulence factor detected in C. albicans 193/268 (72.0%) while for C. glabrata and C. tropicalis most frequently virulence factors detected were proteinase activity 32/51(62.8%) and coagulation 25/47(53.2%), respectively. Proteinase and phospholipase activity were frequently detected virulence factors from C. albicans isolated from blood (5/5(100%) and 4/5(80%)) and esophageal brushes (8/10(80%) and 5/11(45.5)) respectively. C. glabrata was sensitive (100%) to all antifungal agents tested with the mode (epidemiological cut off value μg/ml (ECV)) of 4(8), 0.063(4), 0.25(0.5), 0.25(0.5), 0.031(0.5) and 0.031(0.125), for fluconazole, voriconazole, posaconazole, caspofungin, micafungin and 5-fluorocytosine, respectively. The mode MIC50 (ECV) μg/ml for fluconazole, voriconazole, posaconazole, micafungin, caspofungin and 5-fluorocytosine of C. albicans was 0.25(1), 0.031(0.125), 0.016(0.063), 0.25(1), 0.063(0.5) and 0.063(0.5), respectively while the mode MIC50 (ECV) μg/ml for fluconazole, voriconazole, posaconazole, micafungin, caspofungin and 5fluorocytosine of C. tropicalis was 0.25(1), 0.031(0.125), 0.063(0.063), 0.125(0.25), 0.125(0.25) and 0.063(0.25), respectively. C. glabrata had the lowest mode for micafungin. C. albicans was 100% sensitive to caspofungin and C. tropicalis was 100% sensitive to fluconazole, caspofungin, micafungin and 5-fluorocytosine. Conclusion: Phospholipase and proteinase production is high among C. albicans from invasive specimens (blood and esophageal brush). More than 95% of C. albicans, C. tropicalis and C. glabrata from Tanzania are sensitive to fluconazole, posaconazole, micafungin, caspofungin and 5-Fluorocytosine. There is a need of starting active surveillance of fungi infections in developing countries in order to monitor the emergence of antifungal resistant strains.

PP2.094 Stress-contingent changes in Candida albicans SAPK pathway architecture and regulation. A. M. Day1 , D. A. Smith1 , C. M. Herrero-de-Dios2 , A. J. P. Brown2 , J. Quinn1 1 Newcastle University, NEWCASTLE UPON TYNE, United Kingdom 2 University of Aberdeen, ABERDEEN, United Kingdom Objective: The Hog1 stress-activated protein kinase (SAPK) in Candida albicans is activated in response to divergent stresses and is essential for virulence. Hog1 activation is dependent on the upstream Pbs2 MAPKK and the Ssk2 MAPKKK, but little is known about how different stress signals are sensed and relayed to the Hog1 module. Based on studies in model yeast, a twocomponent related signalling pathway (comprising of three stress sensing histidine kinases, the Ypd1 phosphorelay protein, and the Ssk1 response regulator) is predicted to regulate C. albicans Hog1. The objective of this work was to dissect both two-component dependent and independent mechanisms of signal transduction to Hog1 to aid our long term goal in identifying compounds that prevent Hog1 activation and C. albicans virulence. Methods: Panels of gene deletion and tagged C. albicans strains were generated to allow a dissection of protein-protein interactions within the Hog1 module, and an investigation of the impact of different stresses on the activation and cellular localisation of pathway components. Results: We find that the Ssk1 response regulator plays a global two-component independent role in Hog1 regulation. Specifically, Ssk1 functions as a scaffolding protein promoting interactions between Pbs2 and Ssk2 within the Hog1 module. Osmotic stress triggers the phosphorylation of Pbs2 which promotes dissociation from the scaffold and the nuclear accumulation of this MAPKK. Strikingly, other stresses such as oxidative stress, fail to induce Pbs2 phosphorylation. Instead we present evidence that oxidative stress-mediated Hog1 activation is due to the inhibition of specific downstream negative regulators of Hog1. Conclusion: Our studies have shown for the first time that the architecture of the Hog1 SAPK module is altered in a stressspecific manner, and also challenge the paradigm that SAPK activation is dependent on the activation of upstream regulators. Moreover, our identification of key protein-protein interactions within the Hog1 module involving the Ssk1 response regulator opens up new strategies to identify compounds that inhibit Hog1 signalling in an important fungal pathogen of humans.

PP2.095 Differential response of the bronchial epithelium and macrophages to Aspergillus fumigatus allergens JC Soto-Debran1 , M Monod2 , DW Denning3 , P Bowyer1 , S Gago1 1 University of Manchester, MANCHESTER, United Kingdom 2 Lausanne University Hospital, LAUSANNE, Switzerland 3 National Aspergillosis Centre, MANCHESTER, United Kingdom Objective: Sensitization to fungi can lead to the exacerbation and complication of respiratory conditions such as asthma in predisposed patients. Extracellular proteases and toxins from Aspergillus fumigatus are involved in host cells activation leading to cell cytotoxicity, generation of cytokines and facilitation of allergic sensitization. However, little is known about the normal response to epithelial cells and macrophages to purified fungal allergens. The aim of this study was to describe which specific A. fumigatus allergens are able to induce inflammatory responses in epithelial cells and macrophages. Methods: 16HBE bronchial epithelial cells and monocyte-derived macrophages (THP-1) were exposed to A. fumigatus conidia, crude protein extracts and the recombinant purified allergens Asp f 1, Asp f 5, DppV and AfuS28 for 24 hours. Cell damage measured by lactate dehydrogenase release (LDH) and epithelial cells desquamation were determined. Cell response was evaluated by measurement of pro-inflammatory cytokines (IL-6, IL-8, IL1b and TNFa) in cell culture supernatants. GraphPad Prism was used to interpret data and P values were calculated through One-way ANOVA test. Results: Aspergillus fumigatus hyphae and the purified allergens Asp f 1 and Asp f 5 significantly induced cell damage in bronchial epithelial cells and macrophages measured respectively by epithelial cells desquamation and LDH release (P < 0.01). Asp f 5 caused a higher percentage of epithelial detachment (70, 3%) compared to Asp f 1 (17, 63%) and A. fumigatus hyphae (19.6%). No differences between fungal protease-derived cytotoxicity in macrophages were observed. THP-1 macrophages secreted up to 4-fold more IL1b, TNFa and IL-6 than unchallenged controls in response A. fumigatus spores, Asp f 1 and Asp f 5 (P < 0.01). 16HBE bronchial epithelial cells released 2-fold more IL-6 and IL-8 in response to the purified A. fumigatus allergens DppV and Asp f 5 than unchallenged controls (P < 0.001). The fungal allergen AfuS28 was unable to induce inflammatory responses bronchial epithelial cells and macrophages in our model. Conclusion: (i) The mechanisms of epithelial cell and macrophage activation by fungal allergens are protein-dependant. (ii) Asp f 5 can activate both epithelial cells and macrophages while Asp f 1 predominantly activates macrophages and DppV epithelial cells. (iii) Further research is needed to investigate the role of these fungal allergens in modulating the response of the bronchial epithelium and macrophages in patients with fungal allergy.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

S45

PP2.096 Essential requirements for Candida albicans mediated damage of epithelial cells 1 1 ¨ ¨ S. Mogavero1 , S. Allert1 , A. Konig , L. Kasper1 , J.P. Richardson2 , T. Kruger , J. Naglik2 , B. Hube1 1 ¨ Institute, JENA, Germany Hans Knoll King’s College London - Dental Institute, LONDON, United Kingdom

2

Objective: Candida albicans, an important opportunistic fungal pathogen of men, is able to transition from the yeast morphology, usually associated with the commensal life style in the gut, to a filamentous hyphal state. This filamentous morphology has long been associated with the invasive and destructive stage of C. albicans, and is accompanied by the expression of several hyphae-associated genes. Among these, ECE1 is one of the most highly transcribed during hyphal growth. The role of ECE1 during mucosal infection has been elucidated: it encodes a polyprotein that is processed by Golgi-associated Kex proteases into several peptides, which are then secreted in the extracellular space. One of these is a peptide toxin, Candidalysin, which is able to damage human host cells. Of all Ece1 peptides, Candidalysin seems to be the first to be secreted and the most abundant in supernatants. Here we set to elucidate the dynamics of expression, processing and secretion of the Ece1 peptides, as important steps preceding delivery of Candidalysin to induce pore-forming mediated damage of epithelial cells. Methods: To understand the dynamics of expression, processing and secretion, we performed a systematic screening of several mutants defective in damage potential and/or hyphal formation and/or that are linked to Ece1 processing. The mutants were screened for the following features: quantification of ECE1 transcripts by RT-qPCR, ability to cause damage of oral epithelial cells using cytotoxicity assays, ability to form hyphae by measuring hyphal length, and composition of the secretome by LC-MS analysis. Results: We identified mutants with reduced or no ECE1 expression, with lower or no ability to form hyphae, secreting less or no Ece1-derived peptides and with reduced or no damaging potential. Low damage, compared to the wild-type, correlated with low ECE1 expression and/or shorter hyphae and/or mutated ECE1 sequences, especially around the Candidalysin sequence. Of note, mutants, where specific KR cleavage sites recognized by Kex2 had been modified to KA, lost their ability to properly release Candidalysin and to damage host cells. Conclusion: C. albicans uses its hyphal morphology to cause damage to host cells, and this is mediated by the Candidalysin peptide toxin. It is clear that, whenever at least one of the two requirements fails, or does not reach a specific threshold, the fungus is handicapped and unable to cause damage. This goes both ways, that is, whenever a mutant is unable to cause damage, the reason will likely be an indirect effect of reduced ECE1 expression or reduced delivery of Candidalysin to the host cells, either because hyphae are shorter, or because the processing or secretion is somehow impaired. In agreement with this conclusion, an optimal ratio of hyphal invasion, hyphal length and Candidalysin secretion is required for full damage.

PP2.129 Natural habitats of Cryptococcus neoformans and C gattii in the Caribbean H. Gugnani Retired Professor from VPCI, University of Delhi, NEW DELHI, India Objective: Cryptococcosis has been reported in immunocompetent and immunocompromised patients in several Caribbean countries. There is lack of information on the ecology of Cryptococcus neoformans and C. gattii in this region. This presentation gives an update on the natural habitats of Cryptococcus neoformans and C gattii in the Caribbean. Methods: All published papers on cryttococcosis in Caribbean countries were accessed by extensive and thorough search of literature using PubMed, MEDLINE, Biomed Lib, Med Facts, and different sets of key words, viz. crytpococcosis, Crytptococcus neoformans, C. gattii, occurrence in pigeon excreta, on trees etc. The relevant data were extracted for review. Results: In Cuba, C. neoformans (var. grubii) was recovered from 68 samples of pigeon excreta in widely distributed locations between 1998 and 2007. In Puerto Rico, Almond (Terminalia cattapa), mango (Mangifera indica) trees and cacti (Cephalocereus royis.) were found to be natural hosts to C. gattii. C gatti has been recovered from several samples of woody debris, collected from inside trunk hollows of living divi-divi tree (Caesalpinia coriaria) in Bonaire (Dutch Caribbean). Recently C. neoformans has also been recovered from three out of 40 samples of old pigeon excreta examined in Bonaire. These findings indicate the possible presence of human cases of crytococcosis in Bonaire. Several species of Candida spp, viz. C. albicans, C. famata, C. parapslosis were also recovered from samples of pigeon excreta in Bonaire. Sampling of pigeon excreta, and woody debris from inside trunk hollows of many species of living trees in several locations in Anguilla did not yield any isolation od C. neoformans or C. gattii, though many other yeast species were recovered. There is no record of environmental occurrence of C. neofromans or C. gattii from most countries in the Caribbean. Conclusion: A comprehensive study of natural habitats of Cryptococcus species in various Caribbean countries would contribute to our knowledge of epidemiology of crytptococcosis in the region.

PP2.130 Clinico-microbiological profile of Cryptococcal infections in non-HIV infected patients. K.R. Borde, R.S.K. Marak, A Kaul, A.K. Dixit, T.N. Dhole Sanjay gandhi post-graduate institute of medical sciences, LUCKNOW, India Objective: Cryptococcus species causes a wide range of infections in immunosuppressed individuals. Most of the cases occur in patients of retroviral disease. However, recently there is an increase in cases reported from non-HIV-infected individuals such as solid-organ transplant recipients. Seemingly immunocompetent individuals (non-HIV, non-transplant) can also get Cryptococcal disease. Here, we present clinical and microbiological evaluation of cases of Cryptococcal infections encountered during one-year period at our institute in Northern India. All the cases occurred in non-HIV infected individuals. Methods: All the cases suspected of having Cryptococcus infections were evaluated and detailed history was obtained. Samples were collected from appropriate sites (CSF for meningitis, blood for septic shock and pus from abscess). Microscopy was performed with KOH-wet mount, Gram staining and India ink preparation. Latex agglutination test (CALAS) was performed on CSF and serum samples. Cultures were performed on Sabouraud’s dextrose agar. Phenotypic confirmation of species was done by caffeic acid agar, creatinine-glycine-bromothymol blue agar, EDTA-urease inhibition test and MALDI-TOF MS. Antifungal susceptibility testing was performed using E-strips. Results: Total 12 cases of Cryptococcal infections were diagnosed during one year. 7 (58%) cases were confirmed by growth in cultures. 5 (41%) cases were culture negative but were positive in latex agglutination test in significant titers. Microscopic examination was positive in only 3 (25%) cases. Male-to-female ratio was 3:1 (n = 9, 3). Age of patients ranged from 19 to 57 years. Average age of males was 37.6 and that of females was 25.3 years. All the females had Systemic Lupus Erythematosus. 3 patients had chronic kidney or liver disease, 3 had immunological disorder, 3 were post-renal transplant and 3 patients had no seeming immunosuppressive risk factors. All the patients had fever, 9 (75%) had CNS symptoms, 1 (8%) had septic shock and 1 (8%) presented with iliac abscess. Antifungal susceptibility revealed flucytosine resistance in 5 (83%) out of 6 isolates tested. MICs for fluconazole ranged from 0.016 to 2 μg/ml. MICs for amphotericin B ranged from 0.002 to 0.032 μg/ml. Voriconazole MICs were between 0.002 to 0.008 μg/ml. All the patients received amphotericin B and flucytosine or fluconazole combination therapy. 4 (33%) died despite the treatment, two of these were post-transplant, one had chronic alcoholic liver disease and one had no apparent immunosuppression. One patient was lost to follow-up. 7 (58%) patients improved on antifungal treatment and remained asymptomatic till date and are on regular follow up. Conclusion: Cryptococcal infections are serious conditions not only in immunosuppressed but also in immunocompetent individuals. With increase in organ transplantation and geriatric population with chronic diseases, incidence of Cryptococcal infections is also increasing in non-HIV populations. A high degree of clinical suspicion and proper diagnostic tests are needed for timely diagnosis and treatment.

S46

PP2.131 The Effect of Novel Heterocyclic Compounds on Cryptococcal Biofilm M. Korem1 , S. Kagan2 , I. Polacheck1 1 Hadassah Medical Center, JERUSALEM, Israel 2 The Hebrew University of Jerusalem, JERUSALEM, Israel

Medical Mycology, 2018, Vol. 56, No. S2

PP2.134 Immunomodulatory effects of a scorpion-venom derived antimicrobial peptide during the interaction of Cryptococcus neoformans with murine macrophages and dendritic cells C. M. De-Souza-Silva1 , F. Guilhelmelli2 , P.S. Silva2 , B.L. Chagas2 , F.V. Barbalho2 , P. Albuquerque3 , I. Silva-Pereira2 1 University of Brasilia (UnB), BRASILIA, Brazil University of Brasilia, BRASILIA, Brazil 3 ˆ University of Bras´ılia, Faculty of Ceilandia, BRAS´ILIA, Brazil 2

Objective: Biofilm formation by microorganisms depends on their communication by quorum sensing, which is mediated by small diffusible signaling molecules that accumulate in the extracellular environment. During human infection, the pathogenic yeast Cryptococcus neoformans can form biofilm on medical devices, which protects the organism and increases its resistance to antifungal agents. The aim of this study was to test two novel heterocyclic compounds, S-8 (thiazolidinedione derivative, TZD) and NA-8 (succinimide derivative, SI), for their anti-biofilm activity against strains of Cryptococcus neoformans and Cryptococcus gattii. Methods: Biofilms were formed in a defined medium in 96-well polystyrene plates and 8-well micro-slides. The effect of sub-inhibitory concentrations of S-8 and NA-8 on biofilm formation was measured after 48 h by a metabolic reduction assay and by confocal laser microscopy analysis using fluorescent staining. Results: The formation and development of cryptococcal biofilms was inhibited significantly by these compounds in concentrations below the minimum inhibitory concentration (MIC) values. Conclusion: These compounds may have a potential role in preventing fungal biofilm development on indwelling medical devices or even as a therapeutic measure after the establishment of biofilm. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 414189 1ec07e3a-1402-4d22-890d-40802b77 f1d5.gif

PP2.132 Inflammasome modulation by Cryptococcus neoformans extracelular vesicles produced in different conditions 1 ¨ , D.P. Agustinho2 , D.Z. Miranda2 , A.H.F.P Tavares1 , J.D. Nosanchuk, M.D.2 , A.L. Bocca1 C. L.F Marina1 , P.H.M. Burgel 1 Institute of Biology, University of Bras´ılia, BRAS´ILIA, Brazil 2 Albert Einstein College of Medicine, NEW YORK, USA

Objective: Cryptococcus neoformans is a human pathogenic fungus that infects mainly immunocompromised individuals causing cryptococcosis. Among others, one of its strategies of virulence is the secretion of extracellular vesicles (EVs) containing important polysaccharides with immunomodulatory characteristics and biomolecule constituents of the capsule assembly. It’s known that different serotype of C. neoformans produce different inflammatory responses when incubated with macrophages and, depending on the growth condition, these fungi differentially release metabolites and virulence factors. In our current project, we show that the culture medium composition significantly impacts the production and biological activity of C. neoformans EVs. Methods: We evaluated the characteristics of EVs produced by capsular and acapsular serotypes of C. neoformans (B3501 and Cap67, respectively) with three different concentrations of Sabouraud Dextrose Broth (10%, 50% and 100%) as well as in a nutrient restricted medium (Minimum Medium). EVs were obtained by a multi-step protocol based on centrifugation, filteration, concentration and ultracentrifugations, as described (Rodrigues et al. 2007). EV morphology was characterized by Dynamic Light Scattering (DLS) and Electronic Microscopy, and they were quantified by Amplex Red essay for ergosterol quantification and Micro BCA assay for protein quantification. In order to assess for alterations in biological activity, we assessed the ability of the different EVs to activate the host inflammasome. EVs were incubated with bone marrow-derived macrophages (BMDMs) and dendritic cells (BMDCs) from C57BL/6 mice and the concentration of IL-1β in the supernatant was quantified by ELISA assay. Furthermore, in vivo experiments are currently being conducted to analyze the activation of inflammasome genes during infection with C. neoformans after treatment with the EVs. Results: The results show that the growth medium significantly modulates C. neoformans production of EVs as determined by their hydrodynamics sizes. Moreover, the EVs varied in their capacity to modulate the inflammasome as demonstrated by different levels of IL-1 β production. EVs obtained from a Minimum Medium showed higher hydrodynamic diameters, had increased amounts of virulence factors (i.e. laccase and urease) and contained more GXM (Glucuronoxylomannan, the principal constituent of the Cryptococcus neoformans capsule) than EVs obtained from the different concentrations of Sabouraud medium. Conclusion: Therefore, we can conclude that the culture medium composition significantly modulates the characteristics of the extracellular vesicles produced by the yeasts. Furthermore, the fact that they present higher amounts of conventional virulence factors, more protein and increase in size when obtained from a poor medium corroborate the hypothesis that these vesicles are virulence factors and are different under nutritional stress situations. Hence, these findings are consistent with the loading and release of EVs playing an important role in the fungal stress response, and further link EVs to pathogenesis.

PP2.133 Antifungal activity of scorpions’ venom-derived antimicrobial peptides against clinical isolates of Cryptococcus neoformans. ˜ 1 , L. Trilles2 , M.S. Lazera2 , A.M. Nicola3 , P. Albuquerque4 , I. F. Guilhelmelli1 , C. De-Souza-Silva1 , B.L. Chagas1 , S. Frazao Silva-Pereira1 1 University of Bras´ılia, Institute of Biological Sciences, BRAS´ILIA, Brazil 2 ˜ Oswaldo Cruz, RIO DE JANEIRO, Brazil Fundac¸ao 3 University of Bras´ılia, Faculty of Medicine, BRAS´ILIA, Brazil 4 ˆ University of Bras´ılia, Faculty of Ceilandia, BRAS´ILIA, Brazil Objective: Antimicrobial peptides (AMPs) are a potential class of antimicrobial drugs consisting of evolutionarily conserved multifunctional molecules of the innate immune response of diverse organisms with both microbicidal and immunomodulatory properties. Our group has previously described several scorpion’s venom AMPs with promising antifungal activity against Cryptococcus neoformans and Candida spp. The main objective of this work is to evaluate the antifungal activity of two antimicrobial peptides, ToAP1 and ToAP2 on C. neoformans isolates obtained from Brazilian patients. Methods: Cryptococcus neoformans VNI isolates from the Collection of Pathogenic Fungi (CFP-FIOCRUZ) were grown in the presence of different concentrations of ToAP1 and ToAP2, according to M27-A3 guidelines with some modifications. Amphotericin B and fluconazole were used as positives controls and fungal cells growth only in RPMI-1640 medium were used as growth control. Cryptococcus neoformans H99 was used as a reference strain. After 48 hours of incubation at 37◦ C, the fungal growth was evaluated by OD measurement at 630 nm. The minimum inhibitory concentration was determined as the minimum concentration that completely inhibited the fungal growth. Results: Both peptides exhibited similar minimum inhibitory concentrations to the reference strain for most of the clinical isolates, regardless of their susceptibility to fluconazole and amphotericin B. Conclusion: Antimicrobial peptides are promising molecules for the development of new antifungal drugs. The isolates showed different patterns of susceptibility against fluconazole, however, MIC values for ToAP1 and ToAP2 were very similar amongst the clinical isolates. This result indicates that the mechanism underlying resistance and susceptibility to fluconazole are different for those peptides. Additional tests are being performed in order to determine the MIC50 and minimum fungicidal concentration.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Objective: Our aims were to analyze the immunomodulatory effects of a scorpion-venom derived antimicrobial peptide (AMP) ToAP2 on bone marrow-derived murine dendritic cells (BMDCs) and macrophages(BMM) as well as during the interaction of these cells with Cryptococcus neoformans. Methods: Dendritic cells (BMDCs) and Macrophages (BMM - M1-like) derived from the bone marrow of C57Bl/6 mice using GM-CSF (Lutz et al., 1999). We evaluated the potential cytotoxicity of the scorpion-derived antimicrobial peptide ToAP2 to BMDCs and BMM cells using the LDH Assay. After that, BMDCs and BMM were incubated with the peptide, and the cultures supernatant were collected for cytokine production evaluation. The production of cytokines produced after the treatment of both cell types with two different concentrations of ToAP2 was evaluated by a multiplex assay that measured 14 different cytokines (TNF-a,INFg, IL1a, IL1b, Il4, Il6, IL10, 12(p70), IL13)/chemokines (IP-10, MCP-1, MIP-1a, MIP-1b, MIP-2). Additionally, we assessed the potential effects of ToAP2 during the interaction of both cell types with C. neoformans H99. More specifically, we evaluated the phagocytosis of C. neoformans by BMDCs and BMM in the presence of ToAP2, and their cultures supernatant were collected for further analysis. Results: ToAP2 presented BMDCs and BMM cytotoxicity in concentrations above 2.5 μM in both cells. The cytokine/chemokine analysis of BMDCs and BMM stimulated with this peptide revealed a pro-inflammatory effect with increased production of the cytokines TNF-a, IL1a, Il6, and chemokines IP-10, MCP-1, MIP-1a, MIP-1b, MIP-2. The peptide also produced a decreased expression of IP-10, MCP-1, MIP-2 by BMM cells, especially at the lower concentration. Pre-incubation of BMDCs and BMM with TOAP 2 also seems to increase the number of internalized C. neoformans in comparison with the control group for both cell types and to increase the percentage of phagocytosis in BMDCs cells. Conclusion: AMPs can be used in anti-fungal therapy acting not only as fungicidal/fungistatic molecules but also by helping the immune system to deal with fungal infections. Further characterization of ToAP immunomodulatory activity will help to better evaluate the full potential of AMPs in antifungal therapy.

PP2.135 Inducing pathogenicity of naive environmental C. neoformans var. grubii isolates TH Phan Oxford University Clinical Research Unit, HO CHI MINH, Vietnam Objective: To induce pathogenicity of naive environmental C. neoformans var. grubii isolates. Methods: Stationary-phase culture filtrate of clinical isolates of C. neoformans var. grubii (MLST sequence type 5) was used to induce pathogenicity of naive environmental isolates with matched MLST profile .The naive isolates, induced isolates and clinical isolates were injected into larvae of Galleria mellonella, incubated at 37 ◦ C and observed for survival for ten days. All inocula were blinded prior to injection. Fungal burden and morphology of the pathogens were examined 48 hours post infection. Activity and stability of culture filtrate were tested by treating it with heat, freeze, protease, and nucleases. I also analysed transcriptome profiles of these isolates using RNAseq. Results: Survival rate of larvae infected with induced isolates were significantly lower than those infected with naive isolates. Moreover, the induction effect was stable and inheritable through generations. Culture filtrate of induced isolates can induce pathogenicity of original naive isolates. Interestingly, fungal burden in larvae infected with induced isolates were significantly higher than naive isolates. Also, pseudohyphae cells were detected in the population of induced isolates extracted from larval hemolymph. Signaling peptides in the culture filtrate of clinical isolates were proposed to be responsible for induction. Signature transcriptome profiles of the induced isolates were identified. Set of genes associated with virulence factors were significantly upregulated in the induced isolates. Conclusion: Environmental isolates are significantly less pathogenic than clinical isolates in the Galleria mellonella infection model. Naive environmental isolates can be induced by clinical isolates. This finding gives insight into pathogenesis of environmental C. neoformans var grubii and identifies potential drug targets. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 419700 a97935be-e948-43d2-8cd6-1cddef076 faa.png Caption 1: Survival curves Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 419700 a97935be-e948-43d2-8cd6-1cddef076 faa.png Caption 2: Transcriptome analysis

PP2.136 Phylogenetic analyses and B-cell epitope mapping of virulence factors of C. neoformans and C. gattii: An in-silico insight KARUNA SINGH, GUNJAN UTTAM Banaras Hindu University, VARANASI, India Objective: Virulence factors ensure survival of the pathogen in its host. They modulate host’s immune system and play significant role in pathobiology of the disease. Cryptococcosis is a life threatening fungal infection caused by Cryptococcus species in humans and animals. Here we outline recent advances in our understanding of virulence factors of C. neoformans neoformans, C. neoformans grubii and C. gattii. An in-silico approach has been employed to phylogenetically analyse relationship between virulence factors of Cryptococcus sps. and to map their B-cell epitopes. Methods: The amino acid sequences of virulence factors (glucuronoxylomannan, superoxide dismutase, mannoprotein, urease, CAP, galactoxylomannan, phospholipase B and laccase) of C. n. neoformans, C. n. grubii and C. gattii were retrieved from NCBI. Web servers ABCpred, BCPred, BepiPred 1.0b, BcePred were used for the prediction of linear B-cell epitopes. The PDB structures were submitted to ElliPro, Disco Tope 2.0 Server, SEPPA and EPSVR web servers for mapping of conformational epitopes. On the basis of different physiochemical properties epitopic and non-epitopic regions were compared. Phylogenetic analysis was performed by PHYML server while JMP 13.1 software was used for clustering orthologs of virulence factors. Results: Hierarchical clustering grouped glucuronoxylomannan, mannoprotein, urease, superoxide dismutase, CAP, galactoxylomannan, phospholipase B and laccase into eight clusters; however, superoxide dismutase (SOD) was found to diverge separately. The lowest value of gamma shape parameter of SOD suggests that variation of substitution rates among sites is highest in SOD. It was also observed that majority of the predicted B-cell epitopes are hydrophilic. Amongst all virulence factors, the epitopes of SOD showed lowest antigenicity. Conclusion: It is suggested that virulence factors of C. n. neoformans, C. n. grubii and C. gatti might be governed by pressures of natural selection. Among all the virulence factors, SOD was found to be highly variable and may possibly become a critical virulence factor of Cryptococcus in future. Moreover, the identification and mapping of B-cell epitopes could be useful for the designing of potential drug candidates against cryptococcosis.

ABSTRACT

PP2.169 Cell wall robustness maintained under antibiotic stress by balanced synthesis of glucan and chitin J. Abel-moneim Abdelaziz, NEIL Gow University of Aberdeen, ABERDDEN, United Kingdom Objective: For a fungus, the breaching of the cell wall is a cataclysmic and irrecoverable event that inevitably results in cell death. Consequently fungi have evolved sophisticated mechanisms to ensure that the cell wall is protected under duress. Nearly all fungi have a conserved inner cell wall layer composed of two robust polysaccharides - chitin and β-1,3 glucan. In C. albicans this forms the scaffold to an outer layer of highly mannosylated fibrillar proteins is attached. These mannoprotein fibrils play key roles in pathogenicity and immune interactions. The aim of the present study was to analyse ultrastructure changes in the C. albicans cell wall associated with treatment with β-1,3 glucan and chitin synthase inhibitors, caspofungin and nikkomycin Z respectively, when added individually and in combination. We show a reciprocal upregulation of the synthesis of these polysaccharides under antibiotic stress with concomitant cell wall remodelling which affects both cell viability and the architecture of the fibrillar outer cell wall layer. Methods: Plate dilution sensitivity tests were performed to assess the susceptibility of chitin synthase mutants to caspofungin and nikkomycin Z, singly and in combination. To visualise the changes in the cell wall architecture, TEM analysis was performed. Fluorescence-activated cell sorting (FACS) was used to study changes in the composition of the cell wall of the tested stains. Q Exactive LC-MS was employed to analyse the cell wall proteins before and after the tested antifungal treatments. Results: Our data demonstrates cell wall remodelling under cell wall stress due to both genetic mutation and antifungal stress. Deficiency in Chs3 resulted in a compensatory increase in β-1,3 glucan and mannan. Inhibition of class I chitin synthase enzymes (CHS), using nikkomycin Z, resulted in shorter outer fibrillar layer, which was also phenocopied by genetic disruption of the class I CHS enzymes. Cell wall proteomic analysis indicated that twenty seven GPI-anchored proteins were increased in abundance under the effect the tested antifungal drugs. Five proteins were detected specifically in caspofungin treated cells whereas eight proteins were specifically increased under the effect of the combined treatment of caspofungin and nikkomycin Z. Fourteen additional proteins were increased in abundance after treatment with both antifungal agents alone and in combination. Conclusion: For the first time, our data illustrates the key role of CHS class I enzymes in triggering the protective compensatory mechanism which results in remodelling of the inner and outer layers of the cell wall. This gives an insight into the potential importance of these class I enzymes in C. albicans pathogenicity. Moreover, selective up-regulation of cell wall proteins was detected in response to the treatment with antifungal cell wall inhibitors. This highlights the role of different mannoproteins in cell wall remodeling under the stress of tested cell wall inhibitors.

PP2.170 Fruits are Vehicles of Drug Resistant Pathogenic Yeasts H. J. Lo1 , Z.L. Zhou2 , S.H. Tsai2 , W.L Chu1 , Y.Z. Chen1 , H.F. Chen3 , C.F. Lee3 , C.C. Lin1 , C.L. Huang4 , S.C. Wang5 , Y.L. Yang2 National Health Research Institutes, MIAOLI, Taiwan National Chiao Tung University, HSINCHU, Taiwan 3 National Tsing Hua University, HSINCHU, Taiwan 4 China Medical University, TAICHUNG, Taiwan 5 National Chung Hsing University, TAICHUNG, Taiwan 1

2

Objective: To investigate whether drug-resistant pathogenic yeasts exist on the surface of fruits Methods: Various fruits were purchased from supermarkets. Each type of fruits was washed with peptone water. After centrifugation, the supernatant was discarded and the pellet was re-suspended with remaining solution. A total of 200 μl cell suspension was transferred onto CHROMagar candida medium and incubated at 25 degree Celsius for 2 days. The species was identified by rDNA sequence. Results: First of all, 184 isolates, comprised of 55 species, from 22 different types of fruits in markets in Taiwan were recovered and characterized. Among them, 86 isolates, of 29 species, are reported to cause diseases in humans. They included Candida famata, Candida fermentati, Candida guilliermondii, Candida krusei, Candida orthopsilosis, Candida parapsilosis, Candida pelliculosa, Candida tropicalis, Trichosporon asahii, and 20 others. In addition to C. krusei, intrinsically resistant to fluconazole, all Rhodotorula and Rhodosporidium species were resistant to fluconazole. The two C. tropicalis isolates are, of respectively, of diploid sequence type (DST)149 and DST225, genotypes also detected in isolates from humans. Furthermore, the DST225 isolate was less susceptible to azole drugs. We further determined how many times we should wash the fruits to eliminate the yeasts. We purchased, lemon, mangos, melons, oranges, pears, and wax apple. We washed each type of fruits with peptone water for six times. We found that it is not enough to wash off microbes from fruits by buffer only. Moreover, yeasts on fruits with smooth surface, like mango, lemon or wax apple, were easier to be washed off than those on the fruits with rough surface. Conclusion: It is important to be aware of the existence of pathogenic yeasts, especially drug resistant ones, on the fruit surfaces, a potential route for pathogenic yeasts to be transmitted to humans. Most importantly, we should be cautious when providing fruits and/or juice to severely immunocompromised patients.

S47

PP2.171 Diagnosis of invasive fungal infections through detection of a circulating pan fungal disaccharide by mass spectrometry. A european multicenter study. DANIEL Poulain1 , MARJORIE Cornu1 , BOUALEM Sendid1 , ALEXANDRE Mery2 , NADINE Francois1 , MIKULSKA ´ Letscher-Bru4 , ELENA De Carolis5 , LAURO Damonti6 , MARIE Titecat1 , PY Bochud7 , A. Alanio8 , Malgorzata3 , VALERIE YANN Guerardel2 , MAURIZIO Sanguinetti5 , CLAUDIO Viscoli9 , RAOUL Herbrecht10 , DANIEL Poulain1 1 Inserm U995/University Hospital of Lille, LILLE, France 2 Unite´ de Glycobiologie Structurale et Fonctionnelle UMR CNRS Universite´ de Lille, LILLE, France 3 Division of Infectious Diseases, University of Genova,, GENOA, Italy 4 Laboratoire de Parasitologie Mycologie, DHPI, CHU Strasbourg, STRASBOURG, France 5 University Hospital of Roma, Institute of Microbiology, ROMA, Italy 6 Centre hospitalier Universitaire Vaudois, LAUSANNE, Switzerland 7 Centre hospitalier Universitaires Vaudois, LAUSANNE, Switzerland 8 Institut Pasteur, PARIS, France 9 Division of Infectious Diseases, University of Genova, GENOA, Italy 10 Centre Hospitalier Universitaire de Strasbourg, STRASBOURG, France Objective: We recently described a mass spectrometry (MS) method based on the detection and quantification of a serum disaccharide (MSDS) in patients with invasive fungal infections (IFIs). Investigations concerned patients from our tertiary hospital with Candidiasis (IC), Aspergillosis (IA) and Mucormycosis (MM). As MSDS seemed to provide a new contribution for a pan fungal diagnosis, we aimed here to confirm these results through a blind study involving european expert centers in the clinical management of IC, IA and MM. Methods: IFI patients were selected in each center according to availability of sera drawn around the time that clinical/mycological/imaging evidence of IFI was obtained. IC patients came from Genoa and Roma (26 patients, 57 sera), IA patients rom Strasbourg (19 patients, 52 sera), MM patients from Paris and Lille (23 patients, 72 sera). Hospitalized controls consisted in 20 neutropenic patients from Genoa (40 sera) and 20 bacteraemic patients (20 sera) from Lausanne. All sera were received blindly. Detection of MSDS was performed according to the procedure previously published. Detection of glucans (Fungitell test) was used for the diagnosis of IC and IA in parallel with detection of mannan (Mnn) and Galactomannan (GM) respectively (Platelia Candida and Aspergillus Ag tests). For mucormycosis qPCR was performed. MS-DS results were sent to the different centers for lift of blind and analysis which comprised clinical information, results from diagnostic tests. Results: For IC all tests significantly discriminated sera from IC patients from controls with bacteraemia (p ≤ 0.0009). MS-DS Se/Sp (%) per serum were 51/87 providing intermediate values when compared to BDG (70/76) and Mnn tests (45/100). The analysis per patient reached sensitivities of 79; 85; 64 without altering the specificity. MS-DS complemented more positively high specificity of Mnn monitoring than BDG. For IA, all tests significantly discriminated sera from IA patients from control neutropenic patients (p ≤ 0.0009). MS-DS Se/Sp (%) per serum were of 64/90 providing intermediate values when compared to BDG (50/100) and GM tests (44/100). The analysis per patient reached sensitivities of 63, 50, 78 without altering specificity. Interestingly the lower specificity attributed to MS-DS was related to 2 two neutropenic controls which developed later IA. For both IC and IA individual patients follow up of the 3 glycan biomarkers evidenced complex figures of release and degradation with independent or simultaneous circulation. For MM only 13 sera over 36 were concordant for MSDS and qPCR (6 positive and 7 negative), 23 sera were discordant, among which 13 were positive for MSDS alone. qPCR and MSDS contributed similarly to the establishment of MM diagnosis before mycological evidence was gained. For patients having long term monitoring persistent MSDS circulation could be observed whereas DNA was only be detected during a short period after initiation of treatment. Conclusion: This study confirms the contributions of MSDS to early diagnosis of IFI with sensitivities and specificities similar to those of tests recommended by EORTC and IDSA. Its pan fungal nature and complementarity with other tests may justify its use in combination for a better management of IFI.

PP2.172 ‘Omics’ approaches give new insights into genome variability and evolution of basal human pathogens of the order Mucorales V.U. Schwartze1 , J. Linde2 , M. Nowrousian3 , K. Riege4 , M. Groth4 , M. Marcet-Houben5 , T.E. Klassert6 , T. Veselska´ 7 , U. ¨ 8 , O. Kniemeyer2 , HORTENSE Slevogt6 , T. Gabaldon ´ 5 , K. Voigt2 Binder8 , M. Marz1 , C. Lass-Florl 1 Friedrich-Schiller-University Jena, JENA, Germany 2 Leibniz Institute for Natural Product Research and Infection Biology, JENA, Germany 3 ¨ Bochum, BOCHUM, Germany Ruhr-Universitat 4 Leibniz Institute on Aging, JENA, Germany 5 Centre for Genomic Regulation, BARCELONA, Spain 6 Jena University Hospital, JENA, Germany 7 Faculty of Science, Charles University, PRAGUE, Czech Republic 8 Medical University Innsbruck, INNSBRUCK, Austria Objective: Members of the order Mucorales are among the most basal terrestrial fungi and are found in a wide variety of habitats worldwide. The majority of mucoralean fungi are saprophytic species in the soil but some are opportunistic pathogens and can cause life-threatening infections in humans as well as other warm-blooded animals (mucormycosis). Due to the rapid progress of the infection, the lack of diagnostic tools and the limited therapeutic options, mucormycosis is associated with a high mortality rate. Mucoralean fungi also represent an interesting model to study genomics and the transition to pathogenicity in basal fungi. However, they have long been neglected by research and only little is known about the genome evolution and the molecular basis of pathogenicity. Methods: To get further insights into these aspects of mucoralean fungi, we used a combination of various “-omics” approaches to investigate Lichtheimia species, which represent one of the most ancient families of the Mucorales and the second-most common cause of mucormycosis in Europe. Results: Although mucoralean genomes have been found to be highly divergent from each other in terms of genome structure and gene content, all of them are characterized by the presence of extensive gene duplications. These duplications originate, at least partially, from lineage-specific single gene duplication events. However, it has been shown that ancient whole genome duplication events also contributed to the high amount of gene duplications in the mucoralean lineage. Such events are common in plant and mammalian genomes, but they are less commonly observed in fungi. Despite being highly divergent from the genomes of other mucoralean fungi, the genomes of pathogenic and non-pathogenic Lichtheimia species are highly similar and virulence determinants are found also in species which do not cause infections in humans. Interestingly, many of the genes are affected by gene duplication events, which seem to contribute to the occurrence of functionally diverse paralogs. While classical virulence factors are well conserved between Lichtheimia species, we identified differences in the transcriptional response to infection-associated stress conditions (e.g. elevated temperatures), which restrict the growth of non-pathogenic species but not the human pathogenic Lichtheimia species. During our genome sequencing projects, we found evidence for variations in the ploidy between Lichtheimia strains. We characterized a polyploid isolate of L. ramosa, which was interesting, since mucoralean fungi are generally haploid organisms. Further analyses revealed evidence for the onset of gene loss in the strain and a possible heterogeneity of nuclei within the isolate, which might contribute to a fast evolution in these fungi. Since differences in the nuclei appear to affect the virulence, further analyses of the corresponding single-spore isolates will help to identify factors which are involved in the pathogenesis of Lichtheimia species. Conclusion: In summary, these results are a first step into a better understanding of genome evolution in mucoralean fungi and into the mechanisms and consequences of the exceptional high amount of gene duplications as well as pathogenicity mechanisms in these organisms.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

S48

PP2.173 Extracellular vesicles in the black yeast Exophiala dermatitidis: a first characterization BARBARA Blasi1 , H. Tafer1 , ELSA Arcalis1 , SAMYR Kenno2 , ULRIKE Binder2 , KATJA Sterflinger3 1 University of Natural Resources and Life Sciences, BOKU, VIENNA, Austria 2 Medical University of Innsbruck, INNSBRUCK, Austria 3 University of Natural Resources and Life Sciences, VIENNA, Austria Objective: Extracellular vesicles (EVs) are a powerful communication tool in many biological systems and in the last years they have been characterized in several fungi, where they contribute in the transport of molecules across their complex cell wall. In pathogenic species, these vesicles can carry molecules which exert an active role in virulence, like polysaccharides and proteins. Objective of our study is a first characterization of extracellular vesicles in the model black yeast Exophiala dermatitidis, a polyextremophilic species and an emerging fungal pathogen in Europe. The fungus indeed, although mostly involved in cutaneous and subcutaneous mycosis and deep neurotropic infections in Asia, is more and more isolated from clinical specimen in the West, in special association with lungs of cystic fibrosis patients. We present here a study of the vesicles of E. dermatitidis (CBS 525.76 strain), isolated from a male patient with chromoblastomycosis. Methods: The fungus has been grown in liquid culture of 2% MEA for one week at its optimal temperature, 37◦ C. The vesicles have been then isolated with the ultracentrifugation method. The culture was first centrifuged to remove the most of the biomass and the supernatant was sterile filtrated to avoid a carryover of cells in the further steps. Afterwards, the liquid was centrifuged to remove cellular debris and finally ultra-centrifuged to obtain the vesicular fraction. Results: The obtained pellet was strongly melanized and through electron microscopy (TEM) we could observe that the melanin was present inside the vesicles, as already described in C. neoformans. The analysis with the Nanoparticle Tracking R gave an insight about the size distribution of the vesicles´ population. Further, we present a proteomic and analyzer (Zetaview) transcriptomic study to determine the molecular load of the vesicles in the experimental condition described. We could identify both some proteins and RNAs already observed in the vesicles of pathogenic fungal species and new and interesting molecular species. To understand the role of the vesicles in the pathogenicity of E. dermatitidis, we also performed virulence tests with the larvae of the lepidoptera Galleria mellonella (honeycomb moth). Conclusion: In conclusion, this first characterization of E. dermatitidis vesicles opens new perspectives to the comprehension of the biology of the black yeasts. In the next future we plan to perform new studies of the vesicles under experimental conditions mimicking pathogenic scenarios.

PP2.174 Transposable elements contribute to fungal genes and impact fungal lifestyle A. Muszewska1 , K. Steczkiewicz2 , M.M. Stepniewska-Dziubinska1 , K. Ginalski2 Institute of Biochemistry and Biophysics, PAS, WARSAW, Poland University of Warsaw, WARSAW, Poland

1 2

Objective: Transposon insertion break continuity of co-selected traits, can alter gene transcription, lead to chromosomal rearrangements through homologous recombination and to insertional mutations what can have deleterious consequences for target loci. In the last decade remarkable examples of functional impact of transposons on host fate have been described. The phenomena resulting from transposon proximity have been thoroughly studied mainly for model animals and plants but few studies involved fungal genomes despite genomic resource abundance. TE neighborhood within a window of 1 kb had repressive effect on neighboring genes in fungal taxa with functional methylation machinery but had no such effect in Saccharomyces cerevisiae which lacks methylation https://paperpile.com/c/9Y1Cjz/oN6j. Castanera and colleagues showed that the proximity of TE clusters leads to stronger gene expression silencing compared to neighbourhood of just a single TE, either upstream or downstream. Genes within 1 kb of a Gypsy or hAT transposon have lower expression in Coccidioides immitis https://paperpile.com/c/9Y1Cjz/Ajgy. In this organism transposons are often inserted in proximity of phosphorylation related genes. Methods: Encouraged by experimental screenings showing impact of TEs on gene expression we performed a systematic analysis of genomic location of TEs in 632 publicly available fungal genomes from NCBI database. TEs were predicted de novo with irf and RepeatModeler, and obtained consensus sequences together with RepBase database were used as a library for Repeat Masker search. Identified TEs were scanned against a fixed list of reference protein domains associated with TEs to detect potentially functional copies. Genomic neighborhood was analysed using available genome annotations. Ecological features were extracted from literature. Results: We found that non autonomous transposons and remnants massively overlap with regions annotated as genes. These results suggest a great contribution of transposon derived sequences to host’s genes. Younger, potentially active transposons cluster together with other transposons. Observed non random distribution of potentially active transposons might be a sign of selection against insertion of TE in gene proximity and target site preference among some types of TEs. The ubiquity of transposon fragments even in areas devoid of functional TEs does not support the hypothesis of insertion bias (omitting genes) as a key player shaping TE genomic placement. Proteins coded by genes impacted by old transposon insertions have significantly less repeat motifs and protein-protein interaction domains but are more abundant in enzymatic domains. Animal related and pathogenic fungi have more TEs inserted into genes than fungi with different lifestyles (Fig.1). The overlapping of transposon derived sequences with genes is particularly common in taxa with compact genomes. Conclusion: Here, we investigate the immediate neighborhood of transposons that contribute to a fast evolving part of the genome, with special focus on genes co-localized with transposons. Our findings show a link between the mobilome and fungal ecology. References: http://paperpile.com/b/9Y1Cjz/oN6j http://paperpile.com/b/9Y1Cjz/oN6j http://paperpile.com/b/9Y1Cjz/oN6j http://paperpile.com/b/9Y1Cjz/Ajgy http://paperpile.com/b/9Y1Cjz/Ajgy http://paperpile.com/b/9Y1Cjz/Ajgy Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 420672 f7786f47-9b83-43c1-8b1f-507de 316077b.jpg Caption 1: Distribution of transposase-containing TEs (potentially autonomous) and remnant, fragmented (non autonomous) in fungi associated with animals.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Medical Mycology, 2018, Vol. 56, No. S2

PP2.175 Combining a whole blood infection assay with biomathematical modeling to classify innate immune function 1 ¨ I. Leonhardt1 , T Lehnert1 , K Hunniger , M.T. Figge1 , O Kurzai2 Leibniz Institute for Natural Product Research and Infection Biology, HKI, JENA, Germany ¨ ¨ University of Wurzburg, WURZBURG, Germany

1 2

Objective: Sepsis is a heterogeneous clinical syndrome, resulting from highly diverse pathological conditions and showing variable disease kinetics in individual patients. So far, the treatment of sepsis has focused on hyper-inflammation and anti-inflammatory therapies and there is still no approved immunomodulatory approach for the treatment of sepsis. Furthermore, recent studies suggest that both hypo-and hyper-inflammatory responses are activated simultaneously in sepsis, further complicating immune therapy approaches. Our main objective is to provide novel methods for the individualized quantification of immune effector functions in sepsis patients by combining a human whole blood assay of infection with biomathematical modeling. Methods: Blood was obtained from healthy volunteers or cardiac surgery patients and infected with either Staphylococcus aureus or Candida albicans over a 4 h time course. Association of the two model pathogens with immune cells and the activation pattern on these immune cells was determined via flow cytometry. Based on time course data regarding pathogen distribution to different immune cells, a virtual infection model was generated and used to perform detailed and quantitative predictions on the dynamics of host-pathogen interaction. Results: Previously-generated data using blood from healthy donors infected with either C. albicans or S. aureus showed clear differences in the immune response and the rates of immune cell reaction differ considerably for infection with both pathogens. Our next step was to perform the whole-blood assay with a more homogenous population than sepsis patients. Within a pilot study, blood from patients that underwent cardiac surgery with extracorporeal circulation was analyzed. Characterized by a clear timedefined and strong inflammatory stimulus this surgery offers the possibility to distinguish between inter-individual differences and effects of inflammation. Analysis of blood samples from patients at three different time points (before cardiac surgery, immediately after surgery and 1 day after admission to the intensive care unit) revealed a strong post-operative increase in white blood cell count. Furthermore, variations in immune cell reaction rates and immune cell activation were determined and found to be higher after surgery e.g. increased rates for phagocytosis. Interestingly, pathogen-specific patterns of immune response like differences in association kinetics were diminished after surgery. Once optimized, similar analyzes of blood samples of sepsis patients and patients who have survived sepsis will follow in future studies. Conclusion: To make immunomodulatory therapy approaches for sepsis patients possible it is necessary to develop tools that enable the classification of sepsis patients by their immune status. The use of an ex vivo whole blood model of infection combined with advanced biomathematical quantification allows for the quantification of immune effector functions, thereby forming a basis for future patient stratification.

PP2.176 Determining the chemical composition and antifungal activities of aromatic water of Trachyspermum ammi K. Zomorodian1 , A. Arabi Monfared2 , S.A. Ayatollahi Mousavi2 , A. Iraji1 , D. Mehrabani1 , MR Moein1 1 Shiraz University of Medical Sciences, SHIRAZ, Iran Kerman University of Medical Sciences, KERMAN, Iran

2

Objective: Candida species, as a part of normal flora of mucocutaneous surfaces, may cause a wide range of clinical symptoms from superficial infection to mucocutaneous or visceral candidiasis. These yeasts may also cause upper gastrointestinal especially among those with imbalance normal flora or compromised immune system. Regarding universal emergence of antifungal-resistant Candida, there is a growing tendency in finding novel antifungal agents, especially from natural resources. In this regard, aromatic waters with a distilled medicinal plant containing essential oils (EOs) with known antimicrobial properties might be a good candidate. The aim of this study is to determine in vitro and in vivo antifungal activity of Trachyspermum ammi AW against Candida species. Methods: The EO of AW was extracted with solvent (Diethyl ether) prior to analysis by gas chromatography-mass spectrometry (GC-MS). The chemical composition of the essential oil from T. ammi AW was analyzed by gas chromatography-mass spectrometry (GC-MS). The antimicrobial activity of the essential oil against Candida species was evaluated by broth microdilution as per the Clinical and Laboratory Standards Institute (CLSI) methods. Moreover, biofilm formation inhibition and antioxidant activity of the AW was measured using XTT reduction and DPPH methods, respectively. The experimental activity of the AW in the prevention or treatment of GI candidiasis was also assessed in an animal model by both culture and histopathological methods. Results: GC-MS analysis revealed that Thymol (78.08%), Carvacrol (8.20%), and Carvotanacetone (6.50%) were the major constituents of the essential oil of AW. Also, T.ammi AW exhibited antimicrobial activity against all tested yeasts with MICs in the range of 0.125-0.25 V/V. In addition, the EO inhibited the biofilm formation of Candida albicans at a concentration up to 0.25 V/V (90%). The AW significantly decreased the CFUs in mice receiving AW compared to those of control group. Similarly, histopathological analyses showed that Candida colonization declined in the mice following administration of AW of T. ammi in a therapeutic trial. Conclusion: The considerable antifungal activity of the AW against the examined Candida species might be related to the high concentration of phenolic monoterpenes in the EO distilled from AW. In addition to considerable antimicrobial effects of the AW, the antioxidant activity of the AW induced healing of tissue necrosis found in mice treated with AW in comparison to the controls. Considering the wide range of antifungal activities of the examined AW, it can be used in the management of alimentary candidiasis or as a mouthwash or other pharmaceutical products.

PP2.209 Bioluminescent Mucor circinelloides - a promising new tool to study mucormycosis and antifungal drug efficacy ¨ 1 , V. Garre2 U. Binder1 , M.I. Navarro2 , F.E. Nicolas2 , C. Lass-Florl 1 Medical University Innsbruck, INNSBRUCK, Austria 2 University of Murcia, MURCIA, Spain Objective: Invasive infections caused by members of the Mucorales (mucormycosis) have increased in the last years, making it the third most common invasive fungal infection after aspergillosis and candidiasis. Despite this increasing clinical relevance, little is known about the establishment of disease, its progression and successful therapy. New tools to study this disease in more detail are needed, therefore the objective of this work was to construct a luciferase expressing Mucor circinelloides strain, as one representative of mucormycosis causing pathogens. Here, we describe the construction and functional analysis of the strains, which will further be used as a reporter system for in vivo and in vitro models of Mucorales infections. Methods: A leucine auxotroph M. circinelloides strain, R7B, was used as recipient strain to allow selection of transformants on selective medium. Firefly luciferase gene without the peroxisomal target sequence was cloned in the pMAT1477 vector under the control of a constitutive promoter. Linear plasmid was used to transfect M. circinelloides protoplasts. The targeted integration of the whole construct in the carRP gene resulted in easy identification of transformants, appearing as white colonies. Homokaryons were obtained by sequential plating on selective media and checked for light emission under various conditions in in vitro assays. Results: Expression of firefly luciferase was successful in M. circinelloides at several conditions and light emission was detectable by imaging and with a luminometer. Data so far indicate the strain being suitable for further in vivo and in vitro studies. Phenotype, virulence potential and antifungal susceptibility are currently compared to wild-type strains. Conclusion: The construction of this first bioluminescent Mucor strain will allow for the visualization of temporal and spatial progression of infection by a non-invasive method in insect and murine models, and the testing of antifungal efficacy by other means than survival only. This will give valuable new insights in the pathogenesis of Mucorales infections.

ABSTRACT

S49

PP2.210 Molecular diagnosis of invasive aspergillosis in a child with clinical suspicion of mucormycosis

PP2.213 Nanoantimicrobials: A critique on Susceptibility, Mechanism of action and Toxicity on opportunistic fungal pathogens

˜ 1 , M.J. Palare´ 3 , R. Moreno3 , A. Ferrao ˜ 2 , F. Lourenc¸o2 , J.G. Marques2 , C. Martins2 , R. F.P. Sabino1 , A. Ramos2 , H. Simoes A. Morais2 , C. Ver´Issimo1 1 National Institute of Health Dr. Ricardo Jorge, LISBON, Portugal 2 North Lisbon Hospital Centre, EPE, LISBON, Portugal 3 North Lisbon Hospital Centre, EPE,, LISBON, Portugal

K. UMAMAHESWARI, R BASKAR University of Madras, CHENNAI, India

Objective: Invasive aspergillosis is difficult to manage in immunocompromised patients. We present a clinical case of a 13year-old boy from Cabo Verde who was transferred to the Hematology Unit of a Central Hospital in Lisbon, Portugal, and diagnosed with aplastic anemia. Weeks after hospital admission, in June 2016, he presented febrile neutropenia with negative blood cultures. In August, the patient showed a necrotic lesion of the left wing of the nose. A CT scan of the sinuses showed densification and thickening of the soft tissues of the nasal pyramid, protruding into the nose. A rapid and accurate diagnosis was required since the patient was going to be subjected to bone marrow transplantation. Methods: A biopsy of the nose tissue was performed in the hospital (August 2016) and sent to the Mycology Reference Laboratory of the Portuguese NIH. Tissue fragments were sliced in small fragments and inoculated in Sabouraud dextrose agar and brain heart infusion. Samples were incubated at 30◦ and 35◦ C. In parallel to culture, DNA was extracted from the tissue using the High Pure PCR Template Preparation Kit (Roche Diagnostics Corp., Indianapolis, IN, USA), according to the manufacturer’s instructions. A panfungal PCR reaction was performed in order to detect any fungal DNA present in the tissue sample. For that purpose, the universal fungal primers ITS1 and ITS2 were used. Positive PCR products are then sequenced by Sanger method. R multiplex real-time PCR assay (PathoNostics, A specific PCR directed to Aspergillus was performed using the AsperGenius Maastricht, The Netherlands), following the manufacturer’s instructions. The detection of mutations in the Cyp51A gene for A. fumigatus conferring azole resistance was also performed. Results: A positive panfungal PCR was obtained and PCR products were sent to sequencing. Due to the urgency of the case, a real time PCR directed to Aspergillus was also performed directly from the DNA extracted from the biopsy. A positive signal was obtained for Aspergillus fumigatus and no mutations in Cyp51A gene were detected. Sequencing results revealed 100% homology with A. fumigatus sensu stricto. Results were immediately reported to the physician and posaconazole was administered with regression of the lesion. After 30 days, the cultures of the tissue remained negative. In September 2016, nodular lesions appeared in the patients’ lower limbs and voriconazole therapy was then initiated. A complete regression was observed. Multiresistant Klebsiella pneumoniae and Enterobacter asburiae were further isolated from a perianal ulcer and in October 2016 the patient revealed positive bloodcultures of multiresistant Klebsiella pneumoniae. Facing difficulties in the infection control, a multidisciplinary team decided to perform allogeneic bone marrow transplantation, with complete hematological and infections recovery. Conclusion: An early diagnosis and prompt initiation of appropriate antifungal therapy are imperative and essential for a favorable clinical outcome. In this case, the necrotic lesions of the nose and patient’s risk factors conducted to the clinical suspicion of mucormycosis. The molecular approach performed led to the rapid identification of Aspergillus fumigatus and therefore to the adequate antifungal therapy of the patient.

PP2.211 Antifungal susceptibility patterns of rare yeasts ´ ¨ M. Lackner A. Perez Hansen, C. Lass-Florl, Medical University of Innsbruck, INNSBRUCK, Austria Objective: The objectives of this study were: generating susceptibility pattern of rare yeast for commonly used antifungal drugs, setting epidemiological cut-off values, and comparing EUCAST broth microdilution method with E-test. Methods: A worldwide clinical isolates collection of 316 rare yeasts was collected. Isolates were re-identified in our laboratory using MALDI-TOF. Susceptibility was tested according to EUCAST guidelines and E-test for all isolates and antifungal drugs (itraconazole, posaconazole, isavuconazole, voriconazole, fluconazole, micafungin, anidulafungin, caspofungin and amphotericin B). Results: Among the rare yeast T. inconspicua (N = 164) was most frequent, followed by C. pararugosa (n = 59) and D. rugosa (N = 34). Compared to C. albicans, these species have higher MIC values for most antifungal drugs. According to EUCAST results, T. inconspicua MIC values for azoles are particularly high: itraconazole MIC50 = 0.25 μg/ml, posaconazole MIC50 = 0.125 μg/ml, isavuconazole MIC50 = 0.25 μg/ml, fluconazole MIC50 = 32 μg/ml, and voriconazole MIC50 = 0.25 μg/ml. For C. pararugosa MIC50 values for micafungin was 0. 5 μg/ml, for anidulafungin 1.0 μg/ml, and for caspofungin >4 μg/ml. For D. rugosa MIC50 values for micafungin was 0.125 μg/ml, for anidulafungin 2 μg/ml, and for caspofungin >4 μg/ml. Method agreement between EUCAST and E-test was low (64, and 0.06 to >16 mg/L respectively. 7 isolates were non-susceptible to both fluconazole and voriconazole. Three isolates were observed to have itraconazole MIC of >16 mg/L, far exceeding the previously reported epidemiological cutoff value (ECV) of 0.5 mg/L. Six isolates had posaconazole MIC above the previously reported ECV of 0.125 mg/L. Conclusion: VT-1161 and VT-1598 demonstrated potent activity against 7 of the 10 isolates in this collection of clinical C. tropicalis isolates. Intriguingly, MDR1 overexpression and the K143R substitution in ERG11, both of which have been associated with fluconazole resistance in C. tropicalis previously, were not observed to have an impact on VT-1161 or VT1598 MIC. Conversely, isolates possessing the Y132F substitution in ERG11 and those which overexpressed CDR1 were observed to have decreased susceptibility to both tetrazoles. Further investigation is needed to determine the direct impact of these sterol demethylase inhibitor resistance mechanisms on tetrazole MIC.

PP3.061 Optimization and application of fluorescent proteins in super-resolution microscopy of Candida albicans ´ P. Dedecker, P. Van Dijck W. Van Genechten, L. Demuyser, S. Duwe, KULeuven, LEUVEN, Belgium Objective: Fluorescent proteins with varying colors are indispensable tools for the biological research community. The use of these proteins in combination with microscopy or flow cytometry allows for simultaneous observation of organelles, proteins or analysis of protein expression, respectively. These fluorophores are often developed for use in mammalian systems, with incremental enhancements or new versions published frequently. Candida albicans specific optimization and application of these novel fluorescent proteins and their respective use in super-resolution imaging methods would be of great value to all Candida albicans related research. Methods: In this work, we present the optimization of a wide range of fluorescent proteins for use in Candida albicans based on five different codon optimization tools and strategies. Within the range of available fluorescent proteins, there are several that can be applied in state-of-the-art microscopy techniques such as super-resolution optical fluctuation imaging (SOFI). This technique overcomes the diffraction limit of light using temporal fluctuations of photoswitchable fluorescent proteins visualized with normal in vivo imaging techniques. On top of this resolution enhancement, the high autofluorescence of Candida albicans is rejected. Results: After excessive testing of the available codon optimization strategies, we found one algorithm to give the best results for Candida albicans. Using this strategy, we Candida-optimized genes encoding photoswitchable fluorescent proteins. We performed super-resolution microscopy on two proteins of interest Gcn5 and Env7, of which it was published that they are not visible with classical fluorophores when expressed from their own promoter. We were able to show accurate localization of these proteins using endogenous tagging, thereby showing the potential of these techniques. Conclusion: In the first part of this project, we were able to select a superior codon-optimization strategy for high expression of genes in C. albicans. Using Candida optimized fluorescent proteins in combination with super-resolution microscopy or SOFI, we were able to accurately visualize proteins without using overexpression constructs. Combining the increase in resolution and consequent possibility to do accurate co-localization assays with the reduction of the autofluorescence, renders SOFI an extremely valuable tool for any researcher performing fluorescence microscopy on C. albicans. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 421761 b2ea9b43-b4fb-485d-b913-1e4519b 7961c.png Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 421761 b2ea9b43-b4fb-485d-b913-1e4519b 7961c.png

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

PP3.064 Isolates of Candida glabrata from the United States are enriched for specific sequence types with distinct MSH2 alleles K.R. Healey, E. Shor, D.S. Perlin Public Health Research Institute, Rutgers NJ Medical School, NEWARK, USA Objective: Rates of acquired resistance to triazoles and echinocandins are substantially higher among strains of Candida glabrata compared to other Candida species, particularly in the U.S. We previously demonstrated that disruption of the DNA mismatch repair (MMR) gene MSH2 increases C. glabrata antifungal resistance frequencies. Here, we feature the diversity of MSH2 polymorphisms identified in strains from around the globe and highlight their associated sequence types and relevance in resistance potential. Methods: We acquired over 900 strains of C. glabrata isolates from 10 U.S. states and 7 additional countries. Sequencing of drug target mutations (FKS1, FKS2, PDR1), MMR genes (e.g. MSH2), and multilocus sequence typing (MLST) is ongoing. Two cloning assays were developed to determine the significance of MSH2 polymorphisms. Results: Among U.S. isolates, we found that 94% (59/63) of fluconazole resistant isolates (MIC ≥ 32 μg/ml) contained a PDR1 mutation and 90% (98/109) of echinocandin resistant isolates (MICs ≥ 0.25 μg/ml) contained an FKS1 and/or FKS2 mutation. Of these strains, 36 demonstrated multidrug resistance (both fluconazole and echinocandin resistance). MLST was performed on 68 of these resistant strains: ST10, ST16, ST8, ST3, and ST6 were the dominant (≥ 80%) STs. ST10, ST16, and ST8 are associated with Msh2 alleles carrying amino acid substitutions P208S/N890I, E231G/L269F, and V239L/A942T, respectively. These Msh2 alleles resulted in increased frequencies of drug resistant mutants when expressed in msh2, indicating partial MMR loss of function (LOF). In 5 of 6 clinical isolates carrying partially deficient msh2 alleles, expression of pMSH2-WT caused a decrease in their resistant colony frequencies. ST3 and ST6 are Msh2-wild type (compared to CBS138/ATCC2001). Interestingly, ST10 and ST16 (and therefore their associated Msh2 alleles) are almost exclusively found within U.S. isolates. Other Msh2 alleles, primarily identified in international isolates, imparted partial (e.g. S346T, M651T) or no (e.g. E456D, E459K, R847C) Msh2 LOF. Greater genetic diversity in terms of MSH2 sequences and STs (including many novel STs) were identified within international isolates. Conclusion: Compared to the genetically diverse international isolate populations, C. glabrata from U.S. centers are enriched for several STs and, therefore, specific Msh2 alleles. It is possible that specific STs that have the ability to become more pathogenic or acquire drug resistance at greater rates have become more widespread within the U.S. Our data shed light on factors, such as MSH2, that may influence ST distribution.

ABSTRACT

PP3.097 Development of echinocandin resistance after in vitro micafungin exposure in clinical isolates of Candida glabrata O. Rivero-Menendez1 , P. Navarro-Rodriguez2 , A. Alastruey-Izquierdo1 1 National Center for Microbiology, Instituto de Salud Carlos III, MAJADAHONDA, MADRID, Spain 2 ` Facultat de Medicina i Ciences de la Salut, Universitat Rovira i Virgili, REUS, TARRAGONA, Spain Objective: Comparing the potential development of echinocandin resistance of susceptible Candida glabrata isolates collected during several years from one center after in vitro exposure to a range of micafungin concentrations, and correlating this with their genotype. Methods: Ten susceptible wild type C. glabrata isolates collected during 2013–2017 from one center were genotyped by multilocus sequence typing (MLST) and microsatellite length polymorphism (MLP; using ERG3, MTI, RPM2, GLM4, GLM5 and GLM6 markers) analysis in order to study their strain relatedness. Adjusted inocula of these isolates was cultured on Sabouraud plates containing eight different micafungin concentrations (from 0.015 to 2 μg/mL), and checked for growth for up to 5 days at 35◦ C. After exposure, micafungin and anidulafungin susceptibility of isolates generated was performed according to EUCAST method, and the hotspot region 1 (HS1) of FKS1 and FKS2 genes was sequenced. Results: MLST and MLP yield comparable results. Four different genotypes were found among all isolates analyzed. Each strain grew up to different micafungin concentration. Several strains were able to grow up to the highest concentration tested (2 mg/L) while others showed colonies only up to 0.12 mg/L. Different mutations related to echinocandin resistance were observed in the region studied. The most frequent mutations found were S663P and the deletion of F659 at HS1 of FKS2 gene. The lowest micafungin concentration at which a point mutation was found was 0.06 mg/L. Some strains developed more than one mutation at different micafungin concentrations, and even at the same concentration. Conclusion: (i) In vitro micafungin exposure in C. glabrata generates FKS mutations that confer echinocandin resistance; (ii) The same isolate can develop different FKS mutations at different micafungin concentrations and even at the same concentration; (iii) The development of echinocandin resistance in C. glabrata after in vitro exposure to micafungin is not linked to a specific genotype.

PP3.098 Mechanisms of invisibility: 3D, real time and holographic imaging reveals dynamics of Candida albicans evasion of host recognition JUDITH M. Bain, AL J.P. Brown University of Aberdeen, ABERDEEN, United Kingdom Objective: The success of the fungal species Candida albicans in the human host, both as a commensal inhabitant and an opportunistic pathogen lies with its ability to adapt and thrive at body sites which vary in nutrient content and environmental condition. Previous studies in our group identified a C. albicans mechanism for sensing host lactate, present in the vagina and gut, and responding by reducing exposure of beta-glucan to become less visible to host innate immune cells. The aim of the study was to investigate in detail how this altered presentation of fungal beta-glucan influences interactions with macrophages. Methods: The presentation of fungal beta-glucan on the cell surface was examined using a soluble host receptor for this fungal component; Dectin-1. Fluorescence microscopy and analysis of 3D images using Volocity software was performed to determine size, frequency and intensity of regions of glucan exposure. A spinning disk microscope was used for fast acquisition imaging of bone marrow derived macrophages (BMDM) phagocytosing C. albicans grown in glucose in the presence or absence of lactate. Holographic phase imaging was used to follow the migration of BMDM in the presence of C. albicans grown in the presence or absence of lactate. Results: 3D imaging of C. albicans stained using soluble Dectin-1 revealed exposed glucan was present in a punctate pattern and prominent at bud scars on yeast grown on glucose, however, cells grown on glucose plus lactate had diminished puncta on the yeast lateral wall. Bud scar glucan was equally intense in cells grown with the presence or absence of lactate. In live cell phagocytosis interaction experiments, bone marrow derived macrophages (BMDM) bound glucose or glucose+lactate-grown yeast equally by their bud scars, representing the major tethering point by BMDM. However, following tethering, lactate cells were somewhat stalled for phagocytic enclosure into phagosomes, and overall phagocytic uptake was less efficient. Holographic imaging of BMDM showed they migrated initially more rapidly in response to glucose-grown yeast, but then slowed their migration as fungal cells were cleared by phagocytosis. However, a sustained period of migration was undertaken by BMDM responding to yeast grown in glucose plus lactate, which were phagocytosed less efficiently, driving the continued attempts by macrophages to clear the yeast. Conclusion: Lactate sensing leads to diminished exposure of beta-glucan on the C. albicans cell surface such that yeast are pursued more rapidly, but with less phagocytosis by BMDM. Yeast are bound at their bud scars by BMDM, a region that remains rich in beta-glucan when grown in the presence or absence of lactate. However, lactate-grown cells are stalled for internalisation, perhaps as they lack the punctate presentation of glucan elsewhere on their surface. These data demonstrate how the reduced PAMP exposure driven by lactate sensing facilitates immune evasion. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 420726 7c871646-df99-474f-9ada-c4944b7d 531d.jpg

S53

PP3.100 In vitro study of photodynamic inactivation against Fonsecaea monophora and the application of ALA-APDT on refractory Chromoblastomycosis L. XI1 , Y. He1 , J. Zhang2 , H. Liu3 1 Sun Yat-sen memorial hospital, Sun Yat-sen university, GUANGZHOU, China 2 Sun Yat-sen memorial hospital, Sun Yat-sen university,, GUANGZHOU, China 3 Dermatology Hospital, China Southern Medical University, GUANGZHOU, China Objective: To evaluate the photodynamic inactivation of different photosensitizers against Fonsecaea monophora in vitro and investigate their mechanisms. And to review available data regarding the APDT for CBM, discuss their application, advantages and shortages in clinic. Methods: The photodynamic inactivation efficacy of three photosensitizers, Methylene blue (MB), 5,10,15,20-tetra-(N-methyl4-pyridyl) porphyrin (TMPyP4), 5-Aminolaevulinic Acid (5-ALA) against F. monophora were compared. The reactive oxygen species (ROS) species involved in their cytotoxicity were investigated with 5-(and-6)-chloromethyl-2-,7-di- chlorofluorescin diacetate (DCFH-DA) probe. The effect of 5-ALA-PDI treated F. monophora conidia on macrophage was also tested. Moreover, A complete and systematic clinical CBM cases review and experience summary were performed. Results: In the in vitro investigation, it was observed that all of the three photosensitizers can inactivate F. monophora conidia directly with corresponding-wavelength light illumination in a concentration-dependent and dose-dependent manner. TMPyP4 had the best inactivation effect compared to other two photosensitizers, giving 5 log10 steps killing at concentrations of 50 μM with 10 J/cm2 blue light, while 5-ALA needed around 80 μM with 90 J/cm2 red light. The green fluorescence of DCFH-DA probe showed that ALA-PDT increase intracellular ROS levels in F. monophora concentration-dependently and light dose-independently. Furthermore, macrophage cell RAW264.7 was activated indirectly by photodynamical treated conidia. ALA-PDT can enhance the fungicidal ability of RAW264.7 and protect it from Infection-induced apoptosis in an indirect way. ROS generated by photodynamic treated conidia is associated with mitochondrial-related apoptosis in RAW264.7. APDT has the advantages of equal killing effectiveness regardless of antibiotic resistance. However, the antimicrobial effect will be ceased when the light is turned off and some side effects will occur with longtime application, such as pain. Several PDT sessions which is well-tolerated can result in improvement and even complete remission of lesions. Conclusion: Although most of the advanced CBM forms require long-term continuous systemic antifungal therapy, the variable modalities of physical methods are available as an adjuvant therapy. APDT could be used as promising physical approaches to decrease disease severity and duration while enhancing the quality of life of the patients. The use of different photosensitizers shows different antifungal efficacy. It is significant to choose a suitable photosensitizer for a specific pathogen. Yet the mechanism is still not clear which merits further investigation.

PP3.101 Restoration Melanin of Fonseace monophora reduced Its Pathogenicity to Galleria mellonella YINGHUI Liu1 , LIYAN Xi2 , ZHI Xie3 , CHESTER R Cooper4 1 Dermatology Hospital of Southern Medical University, GUANGZHOU, China 2 Sun Yat-sen memorial hospital, Sun Yat-sen university,, GUANGZHOU, China 3 The Guangxi Zhuang Autonomous Region people’s Hospital, GUANGXI, China 4 Youngstown state Univtersity, YOUNGSTOWN, USA Objective: Galleria mellonella has been widely used as a heterologous host for fungal pathogens. A positive correlation in the pathogenicity of some pathogens has been observed in this insect model and animal models. Melanin is a known virulence factor in a number of opportunistic and pathogenic fungi. Herein, we examine the impact of melanin on the pathogenicity of Fonsecaea monophora in the G. mellonella model using melanized and albino strains. Our purpose is to develop a model host using Galleria mellonella to investigate the virulence of melanin of F. monophora. Methods: Restore the melanin of albino mutant of F. monophora by adding exogenous scytalone released by the mel1 mutant of E. dermatitidis.monophora was incubated at 26◦ C for 14 days before conidia were collected.Conidia suspended at a concentration ∗ of 5 105 were injected to Galleria mellonellweighing 250 to 300 mg. Results: Melanin of albino mutant can be restored by E. dermatitidia mel1 rather than E. dermatitidia mel3.Albino mutant displayed a higher level of pathogenicity to G. mellonella. Restoration of melanin in the albino mutant can reverse pathogenicity. We also observed that larvae infected with the albino mutant spores darkened shortly after inoculation. Typically, larva darkening becomes more apparent by 3 days post-inoculation compared to the wild-type strain. In contrast, larvae injected with PBS remain pale in color. Conclusion: The albino mutant of F. monophora is highly pathogenic to the heterologous insect host Galleria mellonella.Our observation revealed the limitations of using this insect model for inferring the pathogenicity of F. monophora melanin-mutant strains in mammals.Our results also underscore the importance of understanding the immunity of the insect in providing insights into the difference in pathogenicity level of different fungal strains.

PP3.102 High-throughput RNA sequencing (RNA-seq) analysis of macrophages infected with Fonsecaea monophora PP3.099 Photodynamic inactivation can fight biofilms of Candida albicans strains with constitutive efflux. ´ ´ L. Cernakov ´ ´ M. Forgac, ´ S. Diˇzova, ´ M. tefanek ´ H. Bujdakov a, a, Comenius University in Bratislava, Faculty of Natural Sciences, BRATISLAVA, Slovak Republic Objective: Photodynamic inactivation (PDI) is an efficient tool for killing of microorganisms via an excitation of photosensitive compounds with light of appropriate wavelength resulting in the production of reactive oxygen species. Methylene blue (MB) belonging among phenothiazines is widely used because of its low price, high photoactivity, and ability to enter into oxidationreduction processes. Resistance has not been observed yet. Additionally, it was described being able to reverse MDR (multi-drug resistance) phenotype in bacteria. However, knowledge about MB concerning efflux mediated resistance in yeasts is still limited. The efflux pumps encoded by the CDR1, CDR2, and MDR1 genes are associated with cellular detoxication in the yeast Candida albicans. They also play an important role in resistance to azoles (fluconazole – FLC) in early phase of biofilm development. This study investigated whether PDI employing MB could be efficient on biofilms formed by FLC-resistant strains of C. albicans with constitutive efflux. Methods: The experiments were performed on 2 clinical isolates of C. albicans CY 1123 and CCY 29-3-164 with determined upregulation of the CDR and MDR genes, respectively. The standard control strain of C. albicans SC5314 manifested susceptibility to FLC. Regulation of genes encoding Cdr1p, Cdr2p, and Mdr1p were studied by qPCR. Effectiveness of PDI was tested on the 24-h pre-formed biofilms. On the basis of preliminary results, the MB concentration of 1 mmol/l was selected for experiments. This concentration did not show toxicity using experimental model Galleria mellonella. For irradiation, red laser (output power 190 mW/cm2 , wavelength 660 nm) corresponding to the fluence of 15, 23, and 57 J/cm2 was used. Survival of sessile biofilm cells was determined by CFU (colony forming units). Fitness and architecture of biofilms was evaluated by microscopy; CLSM and SEM. Results: While in C. albicans CY 1123 an upregulation of the CDR1 and CDR2 genes was confirmed, the strain C. albicans CCY 29-3-164 expressed overregulation of the MDR1 gene. Survival of biofilm cells was effectively reduced after irradiation (79, 120 and 300 s) with 40, 18, and 6% for CY 1123 and 53, 30, and 9% for CCY 29-3-164 compared to the sample with MB, but without irradiation. PDI was also efficient in the standard strain SC5314 with 61, 35 and 17% of survived biofilm cells compared to the sample without irradiation. The same trend in survival was observed using CLSM with propidium iodide staining (determination of the dead cells). CLSM and SEM also proved that clinical isolates with efflux resistance manifested reduced ability of the yeast-to-hyphae transition compared to the standard strain. Conclusion: In summary, effectiveness of PDI in the presence of MB irradiated with laser was significantly influenced by a period of irradiation and it seems that morphological form is also critical. However, it was surprising to find that neither CDR nor MDR mediated efflux significantly affected an effectiveness of PDI on biofilm compared to the control strain suggesting capacity of this approach for an eradication of fungal biofilms.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

JUNMIN Zhang1 , 2 1 Sun Yat-sen Memorial, hospital, Sun Yat-sen University, GUANGZHOU, China Objective: Chromoblastomycosis (CBM), a cutaneous and subcutaneous mycosis, is caused by a group of dematiaceous fungi, of which the melanin is a key virulence factor. So far, several genomic analyses about the pathogen have been conducted, but there is few study on the host. Here, we aim to explore the response of macrophages after infected with Fonsecaea monophora by High-throughput RNA sequencing (RNA-seq) analysis. Methods: We established the co-culture system of macrophages (J774A.1) and different F. monophora, namely the wild type (CBS 269.37), the meristematic pigmented mutant (CBS 122845) and its albino mutant (CBS 125194), at increasing MOI for 12 h and 24 h respectively in vitro. The production of TNF-α in the cell culture supernatants was measured by ELISA. Total RNAs of macrophages were extracted using the traditional trizol method and submitted to NanoDrop 2000 and Agilent 2100 Bioanalyzer to determine their quality. Deep sequencing based on the Illumina system was carried out to acquire the expression profile of lncRNA and mRNA. Results: According to the levels of TNF-α, we chose the optimum co-culture system as MOI 10 (macrophages:F.monophora = 1:10) for 12 hours. Compared to the control group, we found 185 differential expression genes in the wild type, with 80 genes up and 105 genes down regulated. Meanwhile, there were 981 differential expression genes, 397 up and 584 down, between the pigmented and albino mutant. Functional annotations of the corresponding coding genes using gene ontology (GO) showed that the biological process were mainly involved in regulation of cell proliferation, response to external stimulus, signaling, regulation of MAPK cascade and so on. KEGG (Kyoto Encyclopedia of Genes and Genomes) analysis showed the differential coding genes between pigmented and albino mutant were mainly annotated to Cytokine-cytokine receptor interaction, TNF signaling pathway, Toll-like receptor signaling pathway and MAPK signaling pathway, among which the inflammatory cytokines, such as Il-1β, Il6 and Tnf, and the chemokines including Ccl2, Ccl3, Ccl4, Ccl7, Ccr1, Cxcl10 and Cxcr4, were down-regulated in the group of pigmented mutant. RT-qPCR validation of some random selected genes, containing Tnf, Traf1, Tnfaip3, Tnfrsf1b, Fos, Il1a, Il1b, Il6, Ptgs2, Jun, Jund and Dusp5, was consistent with the sequencing results. Conclusion: The albino mutant, because of its deficiency of melanin, could be better recognized by the macrophages, yielding more pro-inflammatory cytokine and chemokines, thus being more easily to be eliminated by the host. Our results provide insights into the response of macrophages infected with F. monophora, particularly the role of melanin during the interaction between macrophages and specific pathogen Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 418842 e5eb68ae-3b39-4bf4-b9b9-b83c23b 167c4.jpg Caption 1: Fig.1 The co-culture system of macrophages (J774A.1) and different F. monophora. Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 418842 e5eb68ae-3b39-4bf4-b9b9-b83c23 b167c4.1-300dpi.jpg Caption 2: Fig.2 High-throughput RNA sequencing (RNA-seq) analysis.

S54

Medical Mycology, 2018, Vol. 56, No. S2

PP3.103 Fungal eye infections among ophthalmologic patients at ABSUTH, Aba, Abia State, Nigeria.

PP3.138 Novel Dermatophytes from Indian soils

ADA C Ngwogu, KENNETH O Ngwogu, OLUFUMILA Otuka Abia State University, Uturu, ABA, ABIA STATE, Nigeria

RAHUL Sharma, YOGESH S. Shouche National Center for Cell Science, PUNE, India

Objective: This study was carried out to investigate for the first time, the prevalence, types and aetiology of fungal eye infections among the patients. And also to investigate the influence of age, sex, occupation and the use of contact lens on these patients. Methods: Samples were collected from 100 patients comprising 49 females and 51 males attending the Ophthalmology clinic at Abia State University Teaching Hospital, Aba, Abia State, Nigeria. The samples were collected by the Ophthalmologist in charge in the form of swabs and corneal scrapings with the head faced up. The sample were properly labelled and information such as age, sex, occupation and the use of contact lens was recorded. The samples were examined microscopically in 10% potassium hydroxide solution for fungal elements. Cultures were done on Sabouraud Dextrose Agar supplemented with chloramphenicol. Positive cultures were identified using classical methods such as slide culture technique,growth on corn meal agar containing tween 80, urease, germ tube, sugar fermentation, sugar assimilation and nitrate assimilation tests. Results: The eye infections observed were keratitis and endophthalmitis. Of the 100 samples collected, 20 samples (20%), consisting of 9 from females and 11 from males grew fungi. There was no significant difference in the ratio of males to females affected at P = 0.5 confidence interval. The least incidence was found among patients aged 10 – 29 years. While the highest incidence was at the 60 – 79 years. The fungi isolated were Candida albicans (8%), Aspergillus fumigatus (6%), Fusarium solani (4%) and Candida tropicalis (2%). Out of the 100 patients examined, 3% were using contact lens and they all grew fungi. The patient’s occupation were farming, trading, students and civil servants. Conclusion: Fungal eye infections pose significant public health problems in this community. Thes infection scan lead to complete loss of sight. There is need for government and health care professionals to join hands and educate the general population on the proper care of the eye. This is of particular importance among contact lens users. Proper diagnosis and prompt treatment are important in the effective management of fungal eye infections.

Objective: 1) To study keratinophilic fungal diversity of Maharashtra soil. 2) Morphotaxonomic characterization and phylogeny analysis of novel taxa including dermatophytes. Methods: Collection of soil samples from selected habitats (barber shops, chicken shops, garbage, cattle sheds, public places etc) of various districts of Maharashtra in sealed polythene bags. Isolation of keratinophilic fungi was done by Vanbreuseghem’s hair baiting technique and subsequent culturing on Sabouraud dextrose agar by direct transfer or micro-dilution drop-trail method. For identification of fungi morphological and molecular characteristics were studied. Phylogeny analysis was carried out in MEGA5 using sequences of ITS and LSU region of rRNA gene. Results: In the present study we conducted soil survey of 24 districts of Maharashtra state, India (an area equivalent to that of UK) and recognized three new dermatophyte species; two belonged to newly circumscribed Nannizzia and one belonged to Arthroderma. Among the three new dermatophytes, two are rare species, being isolated from only one sample each from 580 soil samples analyzed. The third species is isolated from 5 samples distributed in 2 districts. Morphologically, Arthroderma dehoogi sp. nov. forms smooth walled multicellular elongated macroconidia (trichophyton like) that are broader at apex. The fungus forms irregular to globose ascomata like structures typical of genus Arthroderma but without the formation of asci or ascospores. The ascomata like structure is made up of thick walled hyphae resembling peridial hyphae with dumbbell-shaped finely asperulate cells. Phylogenetically the species is closest to A. fulvescens (90% similar in ITS region). The second species is Nannizzia graeserae sp. nov. which is phylogenetically closest to N. praecox and N. persicolor (93% similar in the ITS region) forms rough walled clavate to cylindrical macroconidia mostly broader at apex and narrower at base. The third species N. kunerti sp. nov. is phylogentically closest to N. corniculata (96-97% similar in the ITS region) forms varied types of macroconidia, one that are spindle shaped (resembling those of N. gypsea) while others are broader at apex and narrower at base. Both the Nannizzia species were able to grow at 37◦ C while A. dehoogi showed no growth at 37◦ C. Conclusion: All the three dermatophytes species known only from asexual state are distinct from known species in morphology and molecular characters. The study showed that scanning of a larger area (with focus on keratin rich habitats) is important in recovering rare forms that might be missed in sporadic samplings. This is because two of the species that we recovered were obtained from only one sample out of 580 samples analyzed.

PP3.104 The pattern of fungal infection in Isfahan, Iran A. Heidarian1 , M. Chadeganipour1 , S. Shadzi1 , P. Dehghan1 , S. Amirtaheri2 1 Isfahan University of Medical Sciences, ISFAHAN, Iran 2 medical Lab, ISFAHAN, Iran Objective: The Shafa clinical and Mycology lab is the major referral mycology laboratory in the diagnosis of suspected cases of fungal infection in Isfahan province. We can find a model of fungal infections and its causes in Isfahan by evaluating suspected cases of fungal infections that refer to this lab. In this study, patients referred to the laboratory were reviewed during one year from March2016 to March 2017. Methods: From suspected patients, a direct Smear with 20% KOH was prepared and were examined for the presence of fungal elements under the microscope, if they had a request for fungal culture, It was cultured on a Sabouraud Dextrose Agar medium and kept for at least one month at room temperature, if any fungal colony grows on the medium, this colony identified by morphological and biochemical characteristics. Results: Of the 2384 patients referred to this laboratory in this period, 1289 were women and 1095 were men in the range of 1 to 90 years old, with a positive percentage of about 33%. The most frequent fungal agents included: Candida with 185 cases, Trichophyton mentagrophytes with 88 cases, Aspergillus with 63 cases and Epidermophyton floccosum with 41 cases, most of them separated from the following areas: isolated Candida included 132 cases from hand nail, 4 cases of groin and 3 body skin, isolated T.Menta included 33 cases from foot nail, 32 foot skin and 6 hand skin and isolated Epidermophyton floccosoma included 18 cases from the skin of the hands and 13 from the skin body. Conclusion: A remarkable point in this study in compared with a study conducted on samples of a 10-year period from 2003 to 2012 in this laboratory is a change in the dominant species of dermatophytes isolated from Trichophyton verrucosun to Trichophyton mentagrophytes. The most frequent suspected patients in that period was related to Tinea Capitis, while in this period the most commonly suspected patients is related to Tinea Pedis.

PP3.137 In vitro inducing conditions to promote titan-like cells formation in C. neoformans ROCI´O Garc´ıa-Rodas, HAROLDO C De Oliveira, NURIA Trevijano-Contador, OSCAR Zargoza National Centre for Microbiology, ISCIII, MADRID, Spain Objective: Cryptococcus neoformans is an opportunistic encapsulated fungal pathogen that undergoes complex morphological changes during interaction with hosts. These changes were described during pulmonary murine infection and consist of 1) capsular enlargement, and 2) the formation of titan cells. These titan cells have not only an enlarged capsule but an abnormal cell body size (diameter larger than 15 μm). Titan cells cannot be phagocytosed and therefore they constitute a major problem for the immune system. However, research on the mechanisms involved in the formation of titan cells and their role during infection has been hampered by the need of using an animal model. In this work, we describe in vitro conditions that promote the transition from regular to titan-like cells. Methods: Capsule growth in vitro had been characterized using Sabouraud medium diluted to 10% in 50 mM MOPS at pH 7.3. These cells had enlarged both cell body and capsule size, which could be the first steps of titan cell formation. Therefore, we decided to investigate factors that could promote the formation of titan-like cells in vitro using microscopy and further image analysis. Results: Incubation of C. neoformans in low nutrient media, supplemented with serum in a CO2 enriched atmosphere induced cryptococcal cell size enlargement. Moreover, other factors, such as oxygen limitation and cell density seem to be key regulators in this process. We observed that the addition of serum and of the respiration inhibitor sodium azide led to cells that resembled the titan cells observed in vivo, although they did not reach the same size. Serum was essential for titan-like cells formation because in its absence the increase in cell size was significantly lower. Indeed, substitution of serum for phospholipids, in particular phosphatydilcholine resulted in cells of enlarged size. Subinhibitory concentrations of inhibitors of different complexes of the respiratory chain, such as sodium azide, antimycin A and oligomycin enhance the formation of titan cells, suggesting a relationship between altered respiration and cell growth. Finally, we found that titan-like cell formation depended on the strain and on the cell density of the cultures. Interestingly, titan cells were absent in cultures inoculated with high densities of cells. These findings may be explained by quorum sensing phenomenon since supernatant from high density cells cultures inhibit the formation of titan-like cells. Moreover, QSP1, the main quorum sensing molecule described in C. neoformans, inhibit the titan-like cells formation in a dose-dependent manner and therefore it may play a role in the inhibition of enlarged cells in high density cell culture. Conclusion: The identification of in vitro conditions that promote the formation of titan cells is an important contribution to the molecular toolbox needed to understand the biology of this pathogenesis-associated morphotype in Cryptococcus neoformans. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 422109 83c73853-01a5-46dd-a1af-1bfb3266 aaaa.png

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

PP3.139 In vitro and in vivo efficacy and toxicity of nonyl 3,4-dihydroxybenzoate, a potent compound against dermatophytes biofilms C. B. Costa-Orlandi1 , A. Serafim-Pinto1 , J.L.C. Bonatti1 , R.H. Pires1 , L. Scorzoni1 , J.L. Singulani2 , C.T. Santos1 , C.R. Andrade1 , P.B. Silva1 , F.P. Gullo1 , N.S. Lourencetti1 , M. Chorilli1 , L.O. Regasini1 , J.D. Nosanchuk3 , A.M. Fusco-Almeida1 , M.J.S. Mendes-Giannini1 1 UNESP (Sao Paulo State University), ARARAQUARA, SAO PAULO, Brazil 2 UNESP, ARARAQUARA, SAO PAULO, Brazil 3 Albert Einstein College of Medicine, BRONX, NEW YORK, USA Objective: This study aimed to verify the in vitro susceptibility of nonyl 3,4-dihydroxybenzoate against planktonic cells and biofilms of dermatophytes. In addition, efficacy and toxicity were tested in a murine model of dermatophytosis. The compound was incorporated into nanostructured lipid systems (NLS) in order to prove whether the incorporation was able to maintain its antifungal activity as well as, reduce toxicity in human cell lines and alternative models. In addition, the probable mechanism of action was evaluated. Methods: The preformed biofilms and planktonic cells of T. rubrum and T. mentagrophytes were treated with different concentrations of synthetic antifungal drugs and nonyl 3,4-dihydroxybenzoate. The metabolic activities were determined using the XTT reduction assay. The effects of the treatments on biofilms structures were visualized by scanning electron microscopy (SEM). The efficacy of the compound was evaluated in wild type (WT) C57BL/6 mice by determining the fungal burden and histopathological analysis. Hepatic and renal toxicity were assessed by blood analysis in the equipment Vitros 250 chemistry analyzer. After incorporation into NLS, susceptibility tests were conducted according the document M38-A2, proposed by the CLSI (2008). The toxicity of incorporation was evaluated in HaCaT cell lines by the sulforhodamine B method and in C. elegans model. Finally, the damage to cell ultrastructures was evaluated by transmission electron microscopy (TEM). Results: Fluconazole, griseofulvin, terbinafine and nonyl were able to prevent biofilm formation in all reference strains and clinical isolates tested (P < 0.05). T. rubrum and T. mentagrophytes biofilms were significantly more resistant to fluconazole, griseofulvin and terbinafine than planktonic cells (P < 0.05). However, both biofilms and planktonic cells were susceptible to nonyl. SEM results revealed that the antifungal drugs caused minor or no damage to the structure of the biofilms, and in some cases, stimulated the development of resistance structures. In contrast, the biofilms treated with the compound were seriously damaged. The fungal burden was significantly reduced after treatment and histopathological analysis showed complete tissue regeneration. R R (98-I) Epikuron In addition, there was no systemic toxicity after treatment in mice. The NSL formed by the surfactant Brij98: presented the best results of minimum inhibitory concentration (MIC), with values between 1.98 and 3.9 mg/L. Cytotoxicity tests indicated that the incorporation resulted in cell viability greater than 80% at all tested concentrations. These results corroborated with in vivo testing in C. elegans model, which indicated that the incorporation of nonyl significantly increased the survival of larvae. The results indicated that the compound may have more than one mechanism of action in the dermatophytes, causing enlargement of the vacuoles, besides derangement and formation of pores in the plasma membrane, similar to amphotericin B. Conclusion: These findings show that nonyl 3,4-dihydroxybenzoate may be a promising antifungal. Further studies are needed for its incorporated form to the nanostructures in order to verify its activity against dermatophytes mature biofilms.

Acknowledgments FAPESP, CNPq and CAPES PP3.140 New and emerging zoophilic dermatophytes in Europe A. Cmokova´ 1 , V. Hubka2 1 Faculty of Science, Charles University, PRAGUE, Czech Republic 2 Czech Academy of Science, PRAGUE, Czech Republic Objective: Trichophyton benhamiae, T. erinacei and related species are increasingly reported as a cause of dermatophytosis in pet or companion animals and their breeders or owners worldwide. A considerable genetic and phenotypic variability has been revealed in these emerging pathogens. To substantiate the initial finding, we assembled strains isolated from various hosts in different European countries, Japan and the USA. We conducted DNA sequencing of several genetic loci, microsatellite analysis, analysis of morphology, and physiological testing to elucidate whether the detected level of variability reflects undescribed species diversity or a high infraspecific variability Methods: A total number of 326 and 146 strains from T. benhamiae and T. erinacei complexes, respectively, associated with human and animal dermatophytoses were analysed using two sequenced loci, 10 and 7 microsatellites loci, respectively, and morphological and physiological methods. Results: Among T. benhamiae isolates, four distinct species were revealed, including three undescribed species (S1-S3). Species S1 and S2 have guinea pig as an exclusive host and are abundantly reported from Europe. These species differ strikingly by phenotype, physiology, produced secondary metabolites and reproductive strategy (sexual versus clonal). Species S1 is responsible for the current epidemic of dermatophytosis in Europe. Trichophyton benhamiae s. str. occurs mostly in America and is associated with infections in dogs, while species S3 has been isolates in Europe and Japan from rabbits and their owners. Only two poorly defined populations were found among T. erinacei isolates. These populations were strongly host-specific. First population was specific for African pet hedgehogs (Atelerix albiventris) and most frequently associated with mycoses in human (89% of human isolates examined). The second population was isolated exclusively from European hedgehogs. Remaining species related to mentioned pathogens, i.e., T. eriotrephon and T. bullosum, also occur in Europe but are much less frequent. Conclusion: In this study, we elucidated genetic diversity, population structure and main hosts of zoophilic pathogens from T. benhamiae and T. erinacei complexes. Based on genetic relatedness of strains of both populations, we suggest that the most virulent and closely related genotypes of T. benhamiae complex (species S1) was introduced to Europe from North America. High genetic divergence and phenotypic differences between “populations” of T. benhamiae indicate that they can be considered independent species. In contrast, molecular methods detected relatively low infraspecific variability in T. erinacei isolates that clustered into two populations occurring on different hosts.

ABSTRACT

PP3.141 Emergence of Trichophyton benhamiae in guinea pigs: a retrospective study from the mycology laboratory of the veterinary college of Alfort 1 ´ J. Guillot1 , B. Decaudin1 , C. Bulliot2 , M. Deville1 , M. Gaveriaux , R. Guechi1 , P. Arne´ 1 , B. Polack1 , V. Hubka3 , R. Chermette1 1 ´ erinaire ´ Ecole nationale vet d’Alfort, MAISONS-ALFORT, France 2 Exotic veterinary clinic, NANDY, France 3 Faculty of Science, Charles University, PRAGUE, Czech Republic

Objective: Trichophyton benhamiae is now recognized as an agent of dermatophytosis frequently affecting guinea pigs and people in close contact with them (breeders or owners, especially children). In several European countries, including France, even if there is a long tradition of guinea pig as a companion animal, Trichophyton benhamiae is considered as an emerging pathogen. Here, we report the results from a retrospective epidemiological survey based on the activity of the Mycology laboratory of the veterinary college of Alfort in France. Methods: The survey was based on the results of the mycological analyses corresponding to 664 guinea pigs examined by vet practitioners in Ile-de-France region from 2003 to 2017. For each animal, the following parameters were documented: age, gender and owners’ address. Sampling included scrubbing of animal’s fur with a small piece of sterile carpet and culturing in Sabouraud dextrose agar for mycological cultures. Plates were incubated at 32◦ C for 10 days. Dermatophyte colonies were identified according to their macroscopic and microscopic features. Sequencing of ITS rDNA region was used for confirmation of species identification in selected isolates. Results: Dermatophyte colonies were detected from 36% of animals examined (238 out of 664 guinea pigs). For 7 animals, the dermatophyte species could not be clearly identified. Trichophyton mentagrophytes and T. benhamiae were detected in 111 and 121 guinea pigs, respectively. A co-infection with both species was reported once. DNA sequencing confirmed the phenotypic identification. The presence of T. benhamiae was observed for the first time in a guinea pig in June 2008. Since then, T. benhamiae progressively replaced T. mentagrophytes (figure 1). In 2017, dermatophyte colonies were obtained from samples coming from 34 guinea pigs: T. benhamiae was detected in 33 cases whereas T. mentagrophytes was detected only once. The epidemiological situation is different in other rodents (mice, rats and chinchillas) and rabbits in which the infection by T. mentagrophytes remains largely predominant. Conclusion: The present study confirms the emergence and the spread of the zoonotic species T. benhamiae in guinea pigs used as companion animals in Ile-de-France region since 2008. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 415599 2ec5b52f-1236-41fa-9102-a1144280 e91f.31.33.png Caption 1: Figure 1. Number of mycological cultures from guinea pigs from 2003 to 2017

PP3.142 Molecular epidemiology of Trichophyton mentagrophytes - a new approach S. Uhrlass1 , I.M. Pchelin2 , A. Rezaei-Matehkolaei3 , S.B. Verma4 , R. Vasani5 , D. Koch6 , F. Wittig6 , C. Krueger6 , P. Nenoff6 1 Laboratory for medical Microbiology, MOELBIS, Germany 2 Kashkin Research Institute of Medical Mycology, ST. PETERSBURG, Russia 3 Department of Medical Mycology, School of Medicine and Health Research Institute, AHVAZ, Iran 4 Nirvan and In Skin Clinics, VADODARA, GUJARAT, India 5 Kingsway Clinic, MATUNGA, India 6 Laboratory for Medical Microbiology, MOELBIS, Germany Objective: According to the currently suggested classification and new taxonomy of the dermatophytes, the former Trichophyton (T.) mentagrophytes (TM)-complex is now differentiated in T. mentagrophytes (zoophilic strains) and Trichophyton interdigitale (TI, anthropophilic strains). Other species in this complex include T. quinckeanum as well as T. benhamiae (isolated from guinea pigs) and T. erinacei (found in hedgehogs). Methods: In the period from 2015 to 2017, approximately 40 strains of TM and TI were investigated. These were both wild strains isolated from routine diagnostics at the laboratory Molbis, Germany, and strains from patients returned from Thailand, ¨ Australia, and those from India. Strains from Iran were provided from Ali Rezaei-Matehkolaei. Sequences of reference strains from databases were used for comparison. All strains were preliminarily identified by conventional laboratory methods based on macroscopic and microscopic morphology. These findings were confirmed by analyses of the internal transcribed spacer 1 (ITS1), 5.8S, and ITS2 region rRNA sequences. In addition, sequencing using the target of the translation elongation factor (TEF)-1α gene was performed. The sequence of each strain was then compared to strains containing in databases. Based on the principle of similarity search (BLASTn search), individual strains were identified down to the species level by utilizing the validated Online Dermatophyte Database of the Westerdijk Fungal Biodiversity Institute (formerly Centraalbureau voor Schimmelcultures CBS), Utrecht, Netherlands (“www.westerdijkinstitute.nl”). In addition, samples were compared with sequences obtained from the very comprehensive – but not yet validated – database of the National Center for Biotechnology Information (NCBI) in Bethesda, Maryland. The yielded sequences of the wild type and reference strains were used for comparative molecular analysis and the generation of dendrograms based on the ITS region and of the TEF-1α gene. Due to the data of sequencing genotyping of the strains according to geographic origin and to the animal source of infection was made. Results: Due to sequencing of the ITS region of the rDNA, altogether 8 different genotypes of TM and TI could be demonstrated. These clusters or genotypes are mostly associated to the geographic origin or to the source of infection. TI forms 2 groups: Type 1 (Europe) and Type 2 (Cosmopolite). In the species TM, however, altogether 6 different genotypes were formed. These were TM Germany Type 1 (Cosmopolite), Germany Type 2, Australia Type 1, “Snowleopard” Type 1 (Europe), Australia Type 1, Thailand Type 1, Iran Type 1, and India Type 1 (Asia and Oceania). Conclusion: Due to the recent change of the taxonomy of dermatophytes, the actually in databases deposited sequences of TI und TM do not allow an exact allocation to the respective species and genotype. Based on results of sequencing preferably of the ITS region of the rDNA, we are able to demonstrate that within the zoophilic species TM, every strain corresponds to one out of six clusters or genotypes. TI showed 2 genotypes, only. Each cluster seems to be specific for e.g. a geographic area, for a country, or for a distinct animal which represents the source of infection, speaking for a special way of transmission of the infection.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

S55

PP3.143 A national survey on Tinea capitis in France: epidemiology and diagnostic procedures J. -P. Gangneux1 , M. Machouart2 , C. Miossec3 , M. Gits-Muselli4 , M. Benderdouche5 , S. Ranque6 , S. Brun5 1 Rennes University Hospital, RENNES, France Nancy University Hospital, NANCY, France 3 Fort-de-France University Hospital, FORT-DE-FRANCE, France 4 Saint-Louis Paris University Hospital, PARIS, France 5 Avicennes Paris University Hospital, BOBIGNY, France 6 Marseille University Hospital, MARSEILLE, France 2

Objective: The French Society for Medical Mycology (SFMM = Soci´et´e Franc¸aise de Mycologie M´edicale) conducted a national survey aiming to describe the epidemiology and diagnostic methods of tinea capitis in metropolitan France and overseas territories. Methods: Thirty five laboratories (26 University hospitals, 6 general hospitals and 3 private laboratories) responded to the survey and reported their tinea capitis cases during a 3-year period (2014-2016). For each case, sex, age, and species identification were collected. Diagnostic methods were also recorded: sampling procedures, cultures (medium, temperature, duration) and dermatophytes identification methods. Results: A total of 2,369 cases were recorded in metropolitan France and 211 from 3 overseas French regions, i.e. Guadeloupe, Martinique and French Guiana. The 3 anthropophilic species Trichophyton tonsurans, Trichophyton soudanense/Trichophyton violaceum, and Microsporum audouinii were predominant in metropolitan France and accounted for 33%, 31% and 19% of the cases, respectively. By contrast, zoophilic species such as Microsporum canis (10%) were less prevalent. Males were slightly over-represented (59% of cases); the prominent age-class was 5–10 years (45%); 86% of the patients were aged between 0 and 10 years. T. tonsurans was even far more represented in French overseas regions, representing 70% (16/23), 80% (64/80) and until 96% (104/108) of the cases diagnosed in Guadeloupe, Martinique, and French Guiana, respectively. Sampling methods were mainly scraping (33/35 centers) and swab collection (20/35), most often guided by Wood’s lamp examination that was available in 72% of the centers. Direct examination was mostly realized with chlorazole black or chloral-lactophenol, and culture relied mainly on the combination of Sabouraud + Sabouraud-cycloheximide media. Rarely, others media were used in particular situations, such as Malt or Borelli media to induce conidiation or Brain-Heart-Infusion to isolate Trichophyton verrucosum. Sabouraud media were incubated between 25 and 30◦ C for 3 to 4 weeks. All centers used macroscopic and microscopic examination of the cultures to identify dermatophytes; 39% and 36% of them used also more recent tools such as DNA sequencing and MALDI-TOF mass spectrometry, respectively. Conclusion: An important number of tinea capitis is still diagnosed in metropolitan France. Autochtonous but also migrant populations account for about 800 cases/year. The anthropophilic species, T. tonsurans and T. soudanense/T. violaceum, are prominent. Sampling and identification methods are heterogenous and should be standardized. New identification methods such as mass spectrometry and DNA sequencing are currently used in more than 1/3 of the centers that participated to the survey.

PP3.144 Place of Trichophyton soudanense in the Trichophyton rubrum complex: a clinical isolates analysis R. Le Guen1 , M. Gits-Muselli1 , S. Hamane1 , M. Benderdouche1 , A. Mingui1 , A. Petit1 , A. Alanio2 , S. Bretagne1 1 Saint Louis Hospital, PARIS, France 2 Institut Pasteur, PARIS, France Objective: Development of molecular laboratory tools has led to a complete revision of Arthrodermataceae classification and a consequent reduction of species number within this family. However, the phylogenetic place of Trichophyton soudanense remains uncertain inside the Trichophyton rubrum complex. Trichophyton soudanense is synonym either to T rubrum or T. violaceum according to the authors, while, more recently, De Hoog et al. gave it the status of “ borderline species “#_ftn1. T. soudanense remains one of the major etiological agents of tinea capitis in our hospital# ftn2 and its epidemiological, clinical and phenotypic features led us to consider T. soudanense, T. rubrum and T. violaceum as separate entities. All studies that have been interested in this issue have only used collection strains. The main aim of our study was to determine the phylogenetic place of T. soudanense using clinical samples obtained in dermatology consultation at Saint Louis Hospital, Paris, France. Furthermore, this study aimed at evaluating the quality of identifications by phenotypic methods in our laboratory and to determine the discriminating power of different loci used in molecular identification of dermatophytes. # ftnref1 De Hoog et al., “ Toward a Novel Multilocus Phylogenetic Taxonomy for the Dermatophytes “, 2017 # ftnref2 Gits-Muselli et al., “ Continuous Increase of Trichophyton Tonsurans as a Cause of Tinea Capitis in the Urban Area of Paris, France: A 5-Year-Long Study “, 2017 Methods: We sequenced all the isolates obtained between April and September 2016 using four loci: ITS1-ITS4, β2-tubulin gene, α1 elongation factor gene and chitin synthase gene. Molecular identification of isolates was obtained by comparing ITS R database. The sequences of the 4 loci were concatenated and a phylogenetic analysis was performed. sequences to the Mycobank In parallel, we photographed each culture on Sabouraud agar medium. The colors of the photographs were extracted and compared according to the RGB color model. Results: We analysed 122 clinical isolates phenotypically identified as T. rubrum (n = 48), Trichophyton mentagrophytes/interdigitale (n = 34), T. soudanense (n = 10), Trichophyton tonsurans (n = 22), Trichophyton sp. (n = 1), Microsporum audouinii (n = 6), and Microsporum canis (n = 1). The concordance of phenotypic and molecular identifications was 94% with no error regarding tinea capitis cases. One isolate was identified as Chrysosporium queenslandicum which has not been yet described in human pathology. The color coding of the isolates objectified the pleomorphism of the dermatophytes (Figure 1). The phylogenetic organization of the genus Trichophyton was identical to that obtained by De Hoog et al. and isolates of T. soudanense appear to be separated from those of T. rubrum. The isolates identified as T. soudanense took an intermediate place between T. rubrum and T. violaceum when comparison of ITS sequences alone (Figure 2) but appear closer to T. rubrum with the other loci. The majority of isolates identified as T. interdigitale or T. mentagrophytes present identical ITS sequences, probably corresponding to the species T. interdigitale. Conclusion: The sequence differences between T. rubrum and T. soudanense remain tenuous whereas they are easily differentiated on a clinical presentation. The comparison of their transcriptome could help to understand the origin of their differences. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 419148 1d8b2abf-ed70-4214-add2-aa49242e 9cdd.png Caption 1: Figure 1: Colors distribution of the front (left) and back (right) of the cultures by species Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 419148 1d8b2abf-ed70-4214-add2-aa49242e 9cdd.png Caption 2: Figure 2: Position of T. soudanense inside the T. rubrum complex by ITS sequence comparison

S56

Medical Mycology, 2018, Vol. 56, No. S2

PP3.177 Conductivity: A novel approach for antifungal susceptibility testing.

PP3.179 The plant defensin HXP124 has the potential to be a new safe and effective topical treatment for onychomycosis

NEELABH, K Singh Banaras Hindu University, VARANASI, India

N. L. Van der Weerden1 , B.M. Hayes2 , J.A. McKenna1 , S. Weaver3 , R.B. Turner3 , M.B. Brown3 , M.R. Bleackley2 , M.A. Anderson1 1 Hexima Limited, MELBOURNE, Australia 2 La Trobe University, MELBOURNE, Australia 3 MedPharm, GUILFORD, United Kingdom

Objective: This study aims to utilize conductivity as a parameter to comprehend: 1) Time required for the drug to reach to its optimum activity. 2) Correlation between disc diffusion and conductivity results. 3) Minimum inhibitory concentration (MIC) through conductivity studies. Methods: Inoculum preparation: C. neoformans culture was added to 0.9% sterile saline solution, and adjusted to 0.5 McFarland. This suspension was further diluted in the ratio of 1:10 with Sabouraud Dextrose Broth (SDB) to obtain the final concentration of 1.0-5 × 106 CFU/ml.

Drug preparation: Three drugs: bacitracin, cinnamaldehyde and amphotericin B were prepared so as to have final concentration as 1.375, 2.75, 5.5, 11 and 22 mg/ml for bacitracin, 0.390, 0.781, 1.56, 3.12 and 6.25 μl/ml for cinnamaldehyde and 0.0156, 0.03125, 0.0625, 0.125 and 0.25 mg/ml for amphotericin B.

Incubation and Observations: The incubation tubes containing 3.7 ml of fungal inoculum along with 300 μl of the respective drug concentration were incubated and the readings of both suspension and menstruum were recorded after 24, 48, 72 and 96 hours. Results: The conductivity values of suspension and menstruum of different concentrations of bacitracin have been plotted (Figure 1). Here, conductivity of the suspension increases with concentration of the drug and time elapsed. Rise in conductivity of fungal suspension is contingent upon 4 factors: A) Dead fungal cells pose less resistance than the live ones therefore cell death increases conductivity B) Decrease in size of the fungal cells as an action of drug facilitates the ion mobility hence increasing conductivity. C) Leakage of physiological salts due to exosmosis after cell death results in increased conductivity and D) rise in the concentration of the menstruum. In figure 1, conductivity of suspension seizes to increase after 72 hours therefore, indicating the optimum activity of the drug after 72 hours of incubation. Additionally, positive correlation value (R2 = 0.98) was obtained between the disc diffusion and suspension conductivity values (Figure 2a). Besides bacitracin, conductivity studies have also been carried out for cinnamaldehyde and amphotericin B (Figure 2b and 2c). MIC is the lowest concentration at which the cell death has taken place or in this case highest conductivity. For cinnamaldehyde and amphotericin B the MIC calculated as 1.56 μl/ml and 0.0625 mg/ml respectively lies in the range as determined by broth macrodilution assay. Conclusion: Owing to the numerous limitations of the disc diffusion, agar diffusion and broth macrodilution/microdilution assays, in the present study, we propose a novel technique utilizing conductivity to determine the efficacy of a drug against a fungus, C. neoformans. This cost effective technique can also be used to broadly assess the MIC of a drug. The digital multi-meter utilized here reduces the chances of errors and rapidity of the results obtained helps to expedite the process of identification of the best drug against a fungal pathogen. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 421902 bbd7750f-2738-44eb-bcc8-00d744c 285cc.png Caption 1: Figure 1: Conductivity values. a) 24 hours b) 48 hours c) 72 and 96 hours Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 421902 bbd7750f-2738-44eb-bcc8-00d744c 285cc.png

PP3.178 Interactions with fungal cell wall polysaccharides determines the salt tolerance of antifungal plant defensins. MARK R Bleackley1 , CHARLOTTE Dawson1 , DONNOVAN Garcia-Ceron1 , JENNIFER Payne1 , NICOLE L Van der Weerden2 , MARILYN A Anderson2 1 La Trobe Institute for Molecular Science, BUNDOORA, Australia 2 Hexima Ltd, MELBOURNE, Australia Objective: Host toxicity and the development of fungal resistance threaten the longevity of currently used clinical antifungals. The need for the development of new antifungal molecules to add to the repertoire for control of fungal pathogens is urgent. Naturally occurring antifungal peptides from plants are an attractive option for the development of next generation antifungals. Plants lack the adaptive immune system found in mammals and are thus fully dependent on their arsenal of innate immunity molecules. These antifungals are the result of millions of years of an evolutionary tug-of-war between hosts and fungal pathogens. One of the largest families of plant antifungal peptides are the plant defensins. The plant-defensin fold is extremely stable to extremes in pH and temperature as well as proteolytic degradation. Interactions with lipids and polysaccharides are key components of the mechanisms of many plant defensins. One of the major hurdles in the development of plant defensins for treatment of systemic fungal infections is that some plant defensins have reduced activity in physiological salt concentrations. Understanding why these molecules lose activity in the presence of salt and identifying members of the plant defensin family that do not lose activity in the presence of salt may aid the development of plant defensins as antifungal molecules. Plant defensins bind lipids in the presence of physiological salt leading to the hypothesis that the fungal cell wall causes the loss of activity in the presence of salt. Methods: The biochemical interaction between plant defensins and fungal cell wall polysaccharides was assessed by generating binding isotherms. Chemical and genetic modification of cell wall polysaccharide levels via treatment with chemical inhibitors or deletion of genes encoding key synthases were used to assess the effect of varying cell wall polysaccharide levels on defensin activity. Salt tolerance of defensins was assessed using micro broth dilution assays with increasing salt concentrations. Defensin activity on spheroplasts in the presence and absence of salt was also assessed. Results: By investigating the interactions of plant defensins with fungal cell wall polysaccharides we have revealed that binding to β-glucan and chitin in the fungal cell wall is a major contributor to the loss of activity of plant defensins in high salt. We have also identified a defensin that does not bind to either β-glucan or chitin and found that it retains activity in high salt medium. Conclusion: Interaction between plant defensins and fungal cell wall carbohydrates is the mechanism for the loss of antifungal activity in elevated salt concentrations. Future work will focus on further assessing the potential for these molecules to be developed as antifungals by looking at their effects on various mammalian cell types and efficacy at clearing fungal infections in animal models. The differences in the mechanisms of salt-tolerant and intolerant defensins will also be investigated.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Objective: Plant defensins with potent antifungal activity have the potential to be developed as effective and robust treatments for fungal infections in humans. The cysteine-stabilised structure of plant defensin’s makes them extremely stable and able to withstand extremes of pH and temperature. Here we investigate the antifungal properties of a novel plant defensin, HXP124, against a range of clinically important fungal pathogens. HXP124 has potent antifungal activity against a range of human fungal pathogens including Candida spp, Cryptococcus spp, dermatophytes and non-dermatophytic moulds. In particular, HXP124 has excellent activity against dermatophytes that infect skin and nails. In addition, HXP124 efficiently and rapidly penetrates human nails making it an ideal target for development of a novel onychomycosis treatment. Onychomycosis, or fungal infection of the nail, affects about 14% of the population. These infections are long-term, hard to treat, can be painful and have a cosmetic impact to the patient. Treatment options include systemic and topical therapies. Although effective, systemic therapies commonly have adverse effects, such as liver toxicity. Current topical have low cure rates due to poor nail penetration, and thus typically require long treatment times. The objectives of this study were to assess the activity of HXP124 against the major causative agents of onychomycosis and test its effectiveness in an Infected Nail Model. Methods: HXP124 was assessed in an Infected Nail Model whereby human toenail clippings were infected on the underside with Trichophyton rubrum and HXP124 was applied to the surface of the nail daily for 7, 14 or 21 days. Cell killing R assay and the ability by HXP124 was also monitored using several methods including propidium iodide uptake, a PrestoBlue of cells to grow on nutrient agar after treatment. HXP124 was assessed for toxicity in a 6-week GLP minipig dermal toxicity study. Results: HXP124 effectively killed greater than 95% of T. rubrum cells within 7 days in an infected nail model. HXP124 also kills fungal cells more rapidly and at lower concentrations than current antimycotic drugs including efinaconazole and terbinafine. HXP124 did not induce dermal irritation in a minipig study at greater than 10-times the concentration intended for clinical use. Conclusion: HXP124 is a potent antifungal molecule that efficiently penetrates human nails making it an excellent candidate for the development of a novel treatment for onychomycosis.

PP3.180 The antifungal mechanism of action for plant defensins is defined via treatment of a barcoded yeast deletion library. PARISI Kathy, NICOLE Van der Weerden, MARILYN A Anderson, MARK Bleackley Hexima/La Trobe University, BUNDOORA, Australia Objective: Plant defensins are potent antifungal peptides that represent a novel class of antifungal drug with excellent potential for clinical application. Plant defensins share a similar three-dimensional structure but vary significantly in sequence. This variation in sequence is thought to account for the different mechanisms of action observed for plant defensins. The objectives of this study were to determine if the sequence variability between defensins correlates with different mechanisms of action and whether screening of a yeast deletion library can identify different mechanisms of action. Methods: We have identified several novel antifungal plant defensins with potentially novel mechanisms of action. We are screening the Saccharomyces cerevisiae non-essential gene deletion yeast library using next generation sequencing to determine the mechanisms of action for these defensins. The yeast deletion set contains 5000 unique knockout strains that represent each of the 5000 non-essential genes. Each of these strains can be identified by individual barcodes that have been incorporated into the gene as part of the deletion procedure. The pool of this library was treated in triplicate with eight different defensins alongside an untreated control. The treatments were analysed for variable growth depending on the fitness of each strain in the presence of defensins using next generation sequencing (NGS). Results: The growth phenotypes of all 5000 strains in the deletion collection were analysed after sequencing. A clustering program was used to determine the similarity of fitness profiles for each strain in each of the defensin treatments. Using this process, we identified several strains as sensitive or resistant to all eight defensins indicating that elements of the activity of plant defensins are conserved. These strains may represent general stress response genes. However, the clustering revealed elements that are unique to each defensin. Strains resistant to at least three of the defensins tested had deletions associated with the mitochondria. Other strains resistant to two separate defensins identified strains with deletions involved in vacuolar homeostasis. These strains indicate that the mechanisms of action of specific defensins involve the targeting of either the mitochondria or the vacuole. The defensins tested in these screens appear to have a conserved mechanism of action which correlates with their degree of sequence identity. Conclusion: Understanding the mechanism of antifungal activity for plant defensins will assist in selection of defensins with different antifungal mechanisms which can be used in therapeutics to create broad spectrum resistance to fungi. Combinations of defensins with different mechanisms of action can be used to produce robust treatments that will see less development of resistance in the fungus.

PP3.181 FUNGAL STUDY OF GUANO BAT SAMPLES C. S. Goebel1 , A. Fix-Tailler2 , G. Larcher2 , JP. Bouchara2 1 Federal University of Health Sciences of Porto Alegre, PORTO ALEGRE, Brazil 2 Universite´ d’Angers, ANGERS, France Objective: The Scedosporium apiospermum complex is common in the environment, especially in environment dominated by man (agricultural soil, gardens, sewers, polluted ponds and sediments). For this reason, the precise knowledge of the habitats and the potential reservoirs of species is of epidemiological importance. S. apiospermum complex is a saprophytic filamentous fungus capable of causing a wide variety of infections in immunocompromised and immunocompetent individuals. Thus, we aim to study the fungal microbiota of bat guano by focusing on Scedosporium spp. Methods: We examined guano bat samples collected in different regions of France. The fungal growth was analyzed macro and microscopically after the incubation time of 4–7 days with the use of the semi-selective medium called Scedo-Select III along with other media like Yeast Extract – Peptone – Dextrose –Agar (YPDA) with Chloramphenicol and YPDA with voriconazol. Afterwards, some fungi were selected for PCR (on the ITS area of the genome). Results: So far, we have analyzed 54 guano bat samples in which we identified several fungi, including Aspergillus, Penicillium, Paecilomyces, Scopulariopsis, Scedosporium, Mucorales and yeast species. Out of these samples, 5 were positive for Scedosporium spp. and these were concentrated around the 3 regions of the 18 that we had studied. Conclusion: At this moment, we are waiting for the sequencing to confirm the results. We also want to investigate if bats can be a vector of fungi and if there is any association with other emerging pathogens, like species of the genus Rasamsonia, which also can cause respiratory infections (these being frequently misidentified as Penicillium or Paecilomyces species); it is for this reason, that morfological observation with molecular identification is necessary. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 424344 69d9bec5-1b43-496f-8738-33485b 97c396.png Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 424344 69d9bec5-1b43-496f-8738-33485b 97c396.png

ABSTRACT

PP3.183 Impaired phagocytosis directs human monocyte activation in response to fungal derived β-glucan particles J. Quintin Institut Pasteur, PARIS, France Objective: Recognition of the fungal cell wall carbohydrate β-glucan by the host receptor Dectin-1 elicits broad immunomodulatory responses, such as phagocytosis and activation of the oxidative burst. These responses are essential to engulf and kill fungal pathogens. Phagocytic monocytes are key mediators of these early host inflammatory responses to infection. Remarkably, whether phagocytosis of fungal β-glucan leads to an inflammatory response in human monocytes remains to be established. Methods: We performed a systematic investigation of the role of phagocytosis on fungal β-glucan-induced inflammation in human primary monocytes isolated from healthy volunteers. Results: Here, we show that phagocytosis of heat-killed Candida albicans is essential to trigger inflammation and cytokine release. By contrast, inhibition of actin-dependent phagocytosis of particulate (1-3,1-6)-β-glucan induces a strong inflammatory signature. Sustained monocyte activation, induced by fungal β-glucan particles upon actin cytoskeleton disruption, relies on Dectin1 and results in the classical caspase-1 inflammasome formation through NLRP3, generation of an oxidative burst, NF-κB activation, and increased inflammatory cytokine release. PI3K and NADPH oxidase are crucial for both cytokine secretion and ROS generation, whereas Syk signaling mediates only cytokine production. Conclusion: Our results highlight the mechanism by which phagocytosis tightly controls the activation of phagocytes by fungal pathogens and strongly suggest that actin cytoskeleton dynamics are an essential determinant of the host’s susceptibility or resistance to invasive fungal infections. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 424944 eab40934-63e8-4473-b74b-5ea2eab 63e63.jpg Caption 1: Impaired phagocytosis directs human monocyte activation in response to fungal derived β-glucan particles

PP3.184 Cutaneous infection caused by Fusarium lichenicola in a patient with verrucous hyperplasia vermiculatum manifestation Lu1 , ML Shi2 , LY Xi2 , JM Zhang3 1 Sun Yat-sen University, GUANGZHOU, China 2 Sun Yat-sen Memorial Hospital, Sun Yat-sen University, GUANGZHOU, China 3 Sun Yat-sen memorial hospital, Sun Yat-sen University, GUANGZHOU, China Objective: We report a case of cutaneous infection caused by Fusarium lichenicola and reviewed the cases of Fusarium lichenicola infection Methods: A 4-year-old girl presented with a 2 year history of verrucous hyperplasia vermiculatum in the right cheek. KOH mount of the skin scrapings was negative for fungal elements. Culture from the biopsy material grew a white mode. The isolate was identified as Fusarium lichenicola based upon morphologies and sequencing of the elongation factor 1α (EEF1α), RNA polymerase II core subunit (RPB2) and internal transcribed spacer (ITS). The drug susceptibility test showed the MICs to be 0.25ug/ml for AmB, 2ug/ml for voriconazole and posaconazole, >64ug/ml for 5-Fc, and >16ug/ml for Itr. We started treated with intravenous amphotericin B (Am B) with started dose of 0.1 mg per kg of body weight per day and increased to 0.8 mg/kg on day 7 and maintained for a total of 750 mg for 65 days. Then the girl was treated with injections of intralesional amphotericin B (2.5 mg/L) in the outpatient department once one or two weeks for 10 times with little improvement. Following treatment with oral voriconazole (50 mg bid) and is getting improved with reducing infected area till now. Results: In previous cases of infection caused by Fusarium lichenicola, this species has been characterized as causes of keratitis (4), mycetoma (1), athlete’s foot (1), scaly lesions in the webspaces (1), localized invasive lesion in a case of acute myelogenous leukemia (AML) and disseminated infection in a case of neutropenic patient with acute Leukemia (2). The clinical manifestation were characterized by localized involvement, slow pace of progression, lesion of scaly verrucous formation and laceration. Rarely, the infection leads to invasive disease in immunocompromised patients. Mostly, voriconazole and/or amphotericin B were used and showed effective for the treatment. Conclusion: Herein, we report the first case of localized cutaneous infection presented as verrucous hyperplasia vermiculatum caused by Fusarium lichenicola in an immunocompetent 4-year-old girl in Mainland China. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 416673 e244f0f0-54dc-4e7b-8a9e-949c3b 3ddd7d.jpeg Caption 1: Clinical manifestation before and after treatment

PP3.217 Genome mining and transcriptomic analysis of iron metabolism genes in Scedosporium apiospermum. 1 ` , J.-P. Bouchara1 , P. Vandeputte1 Y. Le Govic1 , N. Papon2 , S. Le Gal3 , B. Lelievre 1 Centre Hospitalier Universitaire & Universite´ d’Angers, ANGERS, France 2 Universite´ d’Angers, ANGERS, France 3 Centre Hospitalier Universitaire & Universite´ de Bretagne Occidentale, BREST, France

Objective: Scedosporium apiospermum, a ubiquitous environmental mold, is now recognized worldwide as an important cause of infection in both immunocompetent and immunocompromised individuals. It also ranks second among the filamentous fungi colonizing the airways of patients with cystic fibrosis (CF), after Aspergillus fumigatus. However, there are still few data about the virulence genes required for Scedosporium growth and persistence in vivo. Iron acquisition is crucial for survival of microorganisms and is implicated in the virulence of numerous pathogens colonizing the CF lungs. To fulfill their iron requirements, fungi have evolved fine-tuned systems such as the production of siderophores (low-molecular weight iron-specific chelators) or the reduction of insoluble ferric iron into the more soluble ferrous iron, termed reductive iron assimilation (RIA). The aim of this study was to investigate the presence of genes involved in iron homeostasis in the recently sequenced genome of S. apiospermum. Methods: Firstly, we performed a search for orthologs of Aspergillus fumigatus iron-related proteins through tBLASTn analysis against S. apiospermum genome. Organization into clusters of the genes identified by genome mining in S. apiospermum was then compared with those of A. fumigatus, A. nidulans, A. niger, Colletotrichum higginsianum and Trichoderma reesei. All relevant loci were further confirmed by studying their expression level when the fungus was grown in liquid medium under Fe-depleted (< 0.5 μM Fe) and Fe-overloaded (20 μM) conditions. Results: The tBLASTn analysis demonstrated that the S. apiospermum genome harbors almost all genes of iron metabolism described in A. fumigatus. Interestingly, siderophore biosynthesis and transporter genes were organized in two clusters, each containing a gene encoding a non-ribosomal peptide synthase (NRPS) that was demonstrated to drive the production of the hydroxamate-type siderophore fusarinin C or ferricrocin in A. fumigatus. Comparison of the siderophore-related clusters, however, showed that S. apiospermum shares more similarities with phytopathogenic molds than with human pathogenic Aspergillus species. As described in other fungi, the genes putatively involved in RIA were randomly distributed along the S. apiospermum genome. Moreover, several orthologs involved in siderophore-mediated iron assimilation or in RIA were significantly overexpressed during iron starvation, and conversely downregulated during iron overload. Conclusion: Our results revealed that the S. apiospermum genome contains all of the information needed to efficiently compete for iron. Transcriptomic analyses also suggest the siderophore production system as the major system for iron uptake. Studies are now undertaken to identify the siderophores produced by the fungus according to the iron status, and to determine the relative contribution of both siderophore production and reductive assimilation systems in its virulence.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

S57

PP3.218 Production of Scedosporium boydii CatA1 and SodC recombinant proteins: another step towards a standardized test for serodiagnosis of Scedosporium infections S. Mina1 , C. Staerck2 , A. Marot2 , C. Godon2 , A. Calenda2 , J.P Bouchara2 , M J.J Fleury2 Beirut Arab University, TRIPOLI, Lebanon ˆ ` Groupe d’Etude des Interactions Hote-Pathog ene (EA 3142), ANGERS, France

1 2

Objective: Scedosporium species are worldwide recognized pathogenic fungi causing a wide variety of infections ranging from localized infections such as subcutaneous mycetoma to disseminated infections in severely immunocompromised patients, particularly in chronically colonized CF patients who underwent lung transplantation. Serodiagnosis of these infections is limited to some specialized laboratories, and is mainly based on counter-immunoelectrophoresis using crude antigenic extracts. Therefore, it may be hampered by variations from one batch of the antigenic extract to another, and cross-reactions with other human pathogenic fungi including the aspergilli because of the numerous protein and polysaccharide antigens that are shared between these pathogens. To overcome these limitations, we investigated, using recombinant proteins, the antibody response in several groups of patients with or without an Aspergillus fumigatus or a Scedosporium infection, and evaluated their value as serodiagnostic tools to discriminate Aspergillus and Scedosporium infections and to differentiate between an airway colonization by Scedosporium species and a respiratory infection. Methods: Recombinant proteins mimicking Scedosporium boydii catalase A1 (rCatA1) or cytosolic superoxide dismutase (rSodC) or S. apiospermum alkaline potease (rAlp1) or dipeptidylpeptidase V (rDPPV) were produced in Escherichia coli. Four groups of sera were used to investigate the value of these proteins in the serodiagnosis of Scedosporium infections by enzyme-linked immunosorbent assay. Results: The results showed that only rCatA1 and rSodC allowed the detection of Scedosporium infection, and the differentiation with an Aspergillus infection. Combination of the results showed a sensitivity of 88.2% and a specificity of 97%, with a positive predictive value of 100% and a negative predictive value of 98.2%. Conclusion: These recombinant proteins therefore may be useful tools for the development of a standardized serological test for serodiagnosis of Scedosporium infections. Using these recombinant proteins, the differentiation between Scedosporium and Aspergillus infections, as well as between colonization and infection, may be particularly helpful for clinicians, to guide them in their therapeutic decision.

PP3.219 Hybrid histidine kinase III: new therapeutic target for Scedosporium apiospermum ? 1 ´ , N. Papon2 A. Herivaux 1 ˆ - Pathogene, ` Groupe d’Etudes des Interactions Hote UPRES EA 3142, ANGERS, France 2 ˆ - Pathogene, ` Groupe d’Etude des Interactions Hote UPRES EA 3142, ANGERS, France

Objective: Scedosporium apiospermum ranks second among filamentous fungus colonizing chronically the respiratory tract of patients with cystic fibrosis. Because of its thermotolerance, its capacity to disseminate in the blood and its low susceptibility to current antifungals, this pathogen remains difficult to treat. Thus, it is essential to identify new fungal therapeutic targets. In this study, we focused on the hybrid histidine kinases (HHKs) family which has been previously described as essential sensing proteins in some pathogenic yeasts and molds. In S. apiospermum, 6 HHKs belonging to 6 different groups have been identified. The group III HHKs is of main interest since it was demonstrated to play important roles in host-pathogen interaction and virulence in some yeast and mold models. In this regard, we investigate the HHK III function in S. apiospermum. Methods: We were first interested in generating a HHK III mutant strain. A disruption cassette containing the hphR gene (which confers resistance to hygromycin B in transformed cells) bordered by 5’ and 3’ homologous sequences of the HHK III gene was inserted by homologous recombination in the genome of the fungus following an adapted transformation procedure of protoplasts. The correct insertion of the disruption cassette at the corresponding locus and thus the disruption of the HHK III gene was finally validated by Southern blot analysis. Results: HHKIII mutants were obtained following the insertion of the disruption cassette in the genome of S. apiospermum. We then focused on the phenotypical comparison between the wild type and the HHKIII mutant strains. Our preliminary results shown a marked susceptibility of the mutant strain compared to wild type when cultured under high osmolarity conditions. A significant difference was noted in the morphogenesis of both strains. Long and straight filaments were observed in the wild type strain while shorter and tortuous filaments containing chlamydospores were observed in the mutant strain. No significant differences were noted between the mutant and the wild type strains in the presence of oxidant compounds or cell wall inhibitors. Conclusion: Results from the preliminary phenotypical studies suggest the involvement of the HHK III protein in osmosensing and morphogenesis in S. apiospermum. Additional analysis will be undertaken and in any case, these preliminary results must be confirmed by adding the reintegrant strain (that remains to be generated) in the phenotypical tests. This will allow ensuring that the observed phenotypes in the mutant strain exclusively derive from the loss of the HHK III gene.

PP3.220 Lignin degradation pathway in Scedosporium species Wilfried Poirier, Sandrine Giraud, J-P Bouchara ˆ ` Groupe d’Etude des Interactions Hote-Pathog ene, ANGERS, France Objective: Scedosporium are usually soil saprophytes. Among the ten species recognized within the genus, three have been regularly reported as causing human infections, particularly in patients with cystic fibrosis (CF): Scedosporium apiospermum, Scedosporium aurantiacum and Scedosporium boydii. Because of their resistance or low sensitivity to almost all available antifungal drugs, a better understanding of the pathogenic mechanisms of these fungi is required in order to identify news therapeutic targets and to develop new antifungal drugs. Likewise, identification of the origin of the contamination of CF patients may be helpful to propose prophylactic measures. In this aim, environmental studies were conducted on the ecology of these opportunistic molds. Scedosporium species are abundant in human-made environments and have been associated with nutrient-rich substrates, in relation with specific traits of the fungi: ability to survive at low oxygen pressure, to tolerate high salt concentration and to degrade hydrocarbons. Nevertheless, the natural habitat of these fungi is still unknown. Recent studies have demonstrated the correlation between the lignocellulolytic properties of filamentous fungi and their ability to degrade environmental organic pollutants such as aromatic hydrocarbons. The particular properties of lignin among the lignocellulosic compounds make it an interesting study model molecule. In this context, we attempted to study the adaptive mechanisms developed by Scedosporium species in polluted environments, and hypothesized the involvement of the lignin degradation pathway. Methods: First, the lignolytic properties of Scedosporium species were confirmed by cultural methods. Indeed, experiments performed in our laboratory highlighted the Scedosporium capacity to grow on agar media containing the different components of lignocellulose as carbon source. A literature search was then performed in order to identify enzymes involved in lignin degradation in other fungi and conserved sequences, which were then used to screen Scedosporium genomic data by tBLASTn (Basic Local Alignment Search Tool) searches. Real-Time PCR experiments were then conducted to analyze the relative expression of these genes in presence of the different lignocellulose components and the aromatic compound 4-hydroxybenzoate. Results: Fifteen candidates were identified, four encoding enzymes of the peroxidase family (conserved domain: Pfam00141) and the others belonging to the oxidase family (conserved domains: Pfam00394/Pfam07731/Pfam07732). All peroxidase and an oxidase genes were over-expressed in media containing lignocellulose components (between two to fifteen fold), and similar results were obtained in the presence of 4-hydroxybenzoate. Conclusion: These results suggesting the involvement of the corresponding enzymes in the adaptation to polluted environments. Further investigations will be performed to characterize this degradation pathway and to demonstrate its involvement in the adaptation of Scedosporium to the human host.

S58

Poster Pitch session 4 Monday 2 July, 18 :00 hrs – 19 :00 hrs. PP4.025 Molecular identification and antifungal susceptibility testing of fungal agents isolated from patients with idiopathic pulmonary fibrosis(IPF) in Tehran, Iran

Medical Mycology, 2018, Vol. 56, No. S2

PP4.028 Development and multicentre evaluation of a screening method for echinocandin susceptibility testing of Aspergillus spp. J. Meletiadis1 , M Siopi1 , L Kanioura2 , K Meinike Jørgensen3 , D Perlin4 , J Mouton2 , M. C. Arendrup5 1 Attikon University Hospital, ATHENS, Greece Erasmus MC, ROTTERDAM, Netherlands 3 Statens Serum Institut, COPENHAGEN, Denmark 4 Public Health Research Institute and Rutgers Biomedical and Health Sciences, NEWARK, USA 5 Statens Serum Institut, Rigshospitalet,University of Copenhagen, COPENHAGEN, Denmark

M. Roudbary1 , SHAHLA Roudbar Mohammadi2 , HOSSEIN keyvani1 , MAHTAB Ashrafi Khozani1 , MARYAM Esghaei1 , SEYEDALI Mousavi1 1 Iran University of Medical Sciences, TEHRAN, Iran 2 Tarbiat Modares University, TEHRAN, Iran

2

Objective: Idiopathic pulmonary fibrosis (IPF) is a chronic and progressive lung disease. Fungal colonization in patients with lung tissue damage cause of persistent infection.Fungal infections had been studied as causitive agents in cases with cystic fibrosis(CF) previously.It is expected there is a association between fungal agents and etiology of IPF. This study aimed to investigate the isolation and molecular indentification of fungal agents in IPF patients for the first time in Iran. Methods: Forty nasopharyngeal (NP) swabs or bronchoalveolar lavage (BAL) samples were obtained from patients that were diagnosed by sophisticated practitioner from April 2015 to March 2016. Direct examination by hydroxide potassium(KOH) carried out for the presence of fungal elements.The samples cultured on Sabauroud dextrose agar (SDA) medium.Conventional methodes, Polymerase Chain Reaction(PCR) and Sequencing were used for identification of fungal species. Antifungal susceptibility testing for yeast isolates which was conducted as standardized by Clinical Laboratory Standards Institute recommendation (CLSI M27- S3 and S4). Results: Of 40 IPF patients,22(55%) were female and 18(45%) were male.7(17.5%) of IPF patients were positive for fungal agents as following; 4 (10%)Candida albicans(C. albicans), 2(5%) Candida glabrata (C. glabrata)and 1(2.5%) Aspergillus fumigatus(A. fumigatus) were identified using conventional methods(culture), PCR and sequencing technique. It was found the significant correlation between C.albicans colonization in upper respiratory system tract and presence underlying disease in IPF patients (P < 0.05). Antifungal susceptibility testing showed, all C. albicans isolates were resistant to itraconazole and it is found 3(75%)C.albicans were resistance to amphoterecin B, Whereas 3(75%) and 1(25%) C. albicans isolates were susceptible dose dependant and resistant to fluconazole respectively. Morever, C. glabrata isolates were resistant to fluconazole, itraconazole and amphotricin B. Conclusion: Taken together, Fungal agents were detected in 17.5% of iranian IPF patients. Rregarding the high resistance Candida isolates against antifungal drugs, isolation and identification of fungal agents, as well as antifungal susceptibility testing is urgent necessity in IPF patients.Also clinician should be notice the antifungal prophylaxis in susceptible IPF cases, Howere the causes of IPF require more investigation.

Objective: Antifungal susceptibility testing of Aspergillus spp. against echinocandins relies on the microscopic determination of the minimal effective concentration (MEC) with broth microdilution method which is difficult-to-perform, time consuming and subjective even for trained staff. We therefore developed and evaluated a screening agar method for echinocandin’s susceptibility testing of Aspergillus spp. in a multicentre study. Methods: A total of 40 Aspergillus wild-type isolates (10 A. fumigatus, 10 A. flavus, 10 A. terreus and 10 A. niger) and 4 high MEC A. fumigatus isolates with fks alterations (AFS678P SSI-1794-homo, AFS678P SSI-765-hetero, DPLMD24053) or without (DPLDS55985) were used. MECs were determined with EUCAST E.Def 9.3. All isolates were tested blindly at three centres using 4-well screening plates, containing either caspofungin, micafungin, anidulafungin or a drug free agar. The optimal concentrations of each echinocandin were evaluated in preliminary studies using 0.002-4 mg/L concentrations and morphologic endpoints (fluffy vs. compact appearance, aerial mycelia around the colony, diameter of colony). Stability of 4-well plates was assessed with QC isolates C. krusei ATCC6258, C. parapsilosis ATCC22019, A. fumigatus ATCC MYA-3626 up to 3 months. 20 μl of 1–2 McFarland inocula in 0.1% Tween20 were added to each well and plates were incubated for 48 h at 37◦ C. Formation of fluffy colonies similar to the drug free control was recorded for each well after 24 h and 48 h. Results: The median (range) MECs (mg/L) were 0.5 (0.125-1) of caspofungin, 0.03 (0.002-0.12) of micafungin and 0.015 (0.001-0.12) of anidulafungin for the 40 susceptible Aspergillus isolates and >16(2→16) for the resistant isolates (the MEC against DPLMD24053 was 2–4) for all three echinocandins. The optimal concentrations that prevented susceptible Aspergillus isolates to form fluffy colonies similar to the ones observed in drug free media and by resistant A. fumigatus isolates were 1 mg/L of caspofungin, 0.25 mg/L of anidulafungin and 0.12 mg/L of micafungin. The 4-well plates were stable up to 3 months with the same colonial appearance of Aspergillus isolates. All centres successfully detected resistant isolates adopting fluffy colonies after 24 h at echinocandin-containing agar as endpoint criteria (Figure). None of the susceptible isolates produced such colonies after 24 h. Some susceptible isolates (8/40 for centre 1, 3/40 for centre 2, 0/40 for centre 3) produced a small (colony diameter 11 cm) Conclusion: The 4-well plate agar method is suitable for antifungal susceptibility screening of Aspergillus isolates and could be combined with the azole-screening method in order to detect azole- and echinocandin-resistant isolates. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 421818 6c3d921d-baa4-4b8b-8d53-26e23 bbd915e.jpg

PP4.026 Isolation of Aspergillus species in respiratory specimens from adult patients with acute exacerbation of non-cystic fibrosis bronchiectasis; Data from Pakistan K. Jabeen, M. Irfan, M. Khan, J.Q. Farooqi, N. Iqbal Aga Khan University, KARACHI, Pakistan Objective: To determine isolation rate of Aspergillus species in respiratory specimens from adult patients with acute exacerbation of non-cystic fibrosis bronchiectasis presenting to Aga Khan University, Hospital (AKUH) Karachi, Pakistan. Methods: This cross sectional study (2015-2017) was performed at AKUH, Karachi, Pakistan. Clinical and laboratory details of adult patients presenting to AKUH pulmonology clinics with acute exacerbation of non CF bronchiectasis was retrieved from AKU medical records. Microbial cultures (bacterial, fungal and mycobacterial) were performed in the AKU Laboratory that is accredited with the College of American Pathologists (CAP). All specimens were processed and reported using CAP standards. Results: Of the 338 non-cystic fibrosis bronchiectasis patients presenting to AKUH, 437 sputum samples were sent from 206 patients. Aspergillus species were isolated from 27/206 (13%) patients. Predominant species was A. flavus (16 patients) and A. fumigatus (8 patients). Eight patients had growth of two or more Aspergillus species in same specimen. However in 60 patients where clinicians specifically requested for fungal culture Aspergillus species isolation rate was 18/60 (30%) as opposed to 9/144 (6%) in patients where Aspergillus species was isolated from routine bacterial culture. 20/27 patients had concomitant bacterial growth. Conclusion: Aspergillus species was isolated in significant proportion of patients presenting with acute exacerbation of noncystic fibrosis bronchiectasis at AKUH. Clinical significance of these patients needs to be assessed by prospective evaluation of treatment and appropriate Aspergillus specific serological tests.

PP4.029 Molecular identification and antifungal susceptibility patterns of invasive Aspergillus species following CLSI and EUCAST guidelines Y. Dabas, I Xess All India Institute of Medical Sciences, NEW DELHI, India Objective: To know the species distribution and susceptibility patterns of the agents of invasive aspergillosis (IA) in immunocompromised hosts. Methods: Conventionally identified isolates were confirmed by ITS and β-tubulin sequencing. Antifungal susceptibility testing was carried out by reference broth microdilution techniques. Statistical analysis was done to assess the correlation between the two susceptibility testing methods using SPSS version16.0. Results: Prevalence of Aspergillus sp. was high (168/1416, 11.86%). Most isolates were Aspergillus flavus (57.7%) followed by Aspergillus fumigatus (13.1%). Table 1 shows geometric mean, MIC50 , MIC90 and modal values for all isolates. Table 2 shows the concordance and intraclass coefficients (ICC) between CLSI M38-A2 and EUCAST guidelines Conclusion: This study highlights the high rates of resistant strains of A. fumigatus and A. flavus in India. Surveillance of antifungal susceptibility patterns can provide the local MIC data to clinicians which can further aid in guiding better management in different patients groups.

PP4.027 Azole resistance in Aspergillus fumigatus. Frequency and distributions of mutations in a tertiary center in the Netherlands J. B. Buil1 , E. Snelders2 , L. Bedin Denardi3 , W.J.G. Melchers1 , P.E. Verweij1 Radboud University medical center, NIJMEGEN, Netherlands 2 Wageningen University and Research, WAGENINGEN, Netherlands 3 Federal University of Santa Maria, SANTA MARIA, Brazil 1

Objective: Azole resistance is increasingly reported in Aspergillus fumigatus, now being found all around the world. Most studies have investigated the presence of resistance in environmental and/or clinical samples over a limited time period, but longitudinal resistance studies are lacking. We describe trends in resistance frequency and distributions of mutations over a 23-year period, from 1994 to 2016. Methods: All A. fumigatus isolates recovered from patients were screened for azole resistance. Isolates were screened using an agar-slant supplemented with 4-mg/L itraconazole from 1994 to 2009. A 4-wells plate containing itraconazole (4-mg/l), voriconazole (1-mg/l), posaconazole (0.5-mg/l) and a growth control was used from 2009 to 2011. Since 2012, we used a commercial agar-based screening system (VIPcheckTM , Nijmegen). Isolates that grew on azole-containing wells were further analyzed using EUCAST susceptibility testing and sequencing of the cyp51A gene and promotor region. The patient adjusted proportion of resistance was calculated for each year as well as for each 5-year period, using the number of patients with a resistant isolate as numerator and culture-positive patients as denominator. The Chi-square test was used to test for significance. Results: The patient adjusted resistance proportion was >5% in 2001, 2005, 2009–2012 and 2015–2016. The increase of resistance was not statistically significant when the proportion of resistance for each consecutive year was analyzed. However, the 5-year proportion of resistance increased from 0.79% in 1996–2001 to 4.25% (2002-2006), 7.17% (2007-2011) and 7.04% (20122016) (Figure 1). TR34 /L98H was the most prevalent resistance mutation, being present in 77 of 109 (70.6%) patients with resistant A. fumigatus. TR46 /Y121F/T289A was first found in 2010 and subsequently in 3 patients in 2010, 2011 and 2012, respectively, but only twice in the years 2013–2016. In recent years resistant phenotypes without Cyp51A-mutations were increasingly encountered. Conclusion: In this study, we observed an increasing trend in azole resistance prevalence in clinical A. fumigatus isolates until 2011, using patients with a positive culture as denominator. After 2011 the 5-year proportion of resistance remained stable. Furthermore, in the past five years approximately 15% of resistant isolates harbored a wildtype Cyp51A-gene, suggesting that other resistance mechanisms may be emerging. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 421215 55a47de3-8fb7-40b4-aad8-e43e 968eda8b.jpg Caption 1: Patient adjusted proportion of resistance and 5-year patient adjusted proportion of resistance (horizontal bars. ∗ : P < 0.05).

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

PP4.030 The IL17RA and CARD10 genes are important in controlling Aspergillus fumigatus colonisation of the lung in allergic bronchopulmonary aspergillosis S. Gago1 , JC Soto-Debran1 , DW Denning2 , P Bowyer1 1 University of Manchester, MANCHESTER, United Kingdom 2 National Aspergillosis Centre, MANCHESTER, United Kingdom Objective: Fungal colonisation of the airway epithelium is linked to poorly controlled asthma in patients with allergic bronchopulmonary aspergillosis (ABPA) and severe asthma with fungal sensitization (SAFS). Impaired mucociliary function in patients with asthma has been associated with increased fungal growth and colonisation of the respiratory airways. However, not all asthmatics develop fungal asthma and host genetic factors might be important. The aim of this study was to characterise the role of the human genes IL17RA and CARD10 in controlling fungal colonisation of the respiratory airways. Methods: Genetic variability in the IL17RA and CARD10 genes is very high in patients with ABPA, suggesting and altered function of those genes. 16HBE bronchial epithelial cells deficient in IL17RA (16HBEIL17RA ) and CARD10 (16HBECARD10 ) were generated by CRISPR/Cas9 and used in Aspergillus fumigatus challenge experiments. Differences in cell damage induced by the fungal allergen Asp f 5 and A. fumigatus (A1163) spores were evaluated by determining cell desquamation and IL-8 release in 16HBE, 16HBEIL17RA and 16HBECARD10 after 24 h exposure. Fluctuations in the fungal burdens were determined by qPCR. GraphPad Prism was used to interpret data and P values were calculated through Two-way ANOVA test. Results: A. fumigatus A1163 and the purified allergen Asp f 5 were able to cause epithelial cell desquamation in both, 16HBE and 16HBEIL17RA (P < 0.0001). However, 16HBECARD10 desquamation was only induced by A. fumigatus hyphae. Epithelial cell detachment produced by A. fumigatus hyphae was 20% higher in 16HBEIL17RA than in 16HBE cells (P < 0.0001). These observations correlated with 5-times higher fungal burdens in 16HBEIL17RA exposed to A. fumigatus than in 16HBE cells (P < 0.05). IL-8 release by 16HBEIL17RA exposed to Asp f 5 and hyphae doubled that produced by 16HBE cells (P < 0.0001). No IL-8 response was observed in 16HBECARD10 exposed to Asp f 5 and A. fumigatus hyphae. Conclusion: Our results indicate that exposure of bronchial epithelial cells deficient in IL17RA to Aspergillus fumigatus leads to epithelial cell desquamation, high fungal loads and a strong IL-8 function. Furthermore, the response of CARD10 deficient bronchial epithelial cells is limited.

ABSTRACT

S59

PP4.031 Composting as a resource for environmental azole resistance mutation in Aspergillus fumigatus in Iran

PP4.066 Do Candida albicans biofilms contain persister cells?

B. Mousavi1 , H Badali2 , S Khodavaisy3 , J.F Meis4 , F Hagen5 , M Laal Kargar6 , Z Salehi6 , A Vaezi2 1 Paris est creteil University, PARIS, France 2 Mazandaran University of Medical Sciences, SARI, Iran 3 Tehran University of Medical Sciences, TEHRAN, Iran 4 Canisius Wilhelmina Hospital (CWZ),Centre of Expertise in Mycology Radboud umc/C, NIJMEGEN, Netherlands 5 Westerdijk Fungal Biodiversity Institute, Utrecht University, UTRECHT, Netherlands 6 Tarbiat Modares University, TEHRAN, Iran

I. Denega, S. Bachellier-Bassi, C. D’Enfert Institut Pasteur, PARIS, France

Objective: Although azoles are the mainstay of therapy in the management of invasive aspergillosis, azole resistance has serious implications in patient management as emerging over the world. Compost (decaying plant waste material) containing azole residues might be important for resistance development and following spread of resistance mutations in Aspergillus fumigatus. The aim of the present study was to assess the prevalence and emergence of resistance to triazoles in A. fumigatus isolates in commercially available composts in Iran. Methods: All compost samples were purchased from floristries in Iran. A total of 200 treated compost samples with azole fungicide were analyzed. Two grams of each sample were homogenized in sterile saline containing 0.05% Tween 80. Suspensions were inoculated on sabouraud dextrose agar (SDA) supplemented with chloramphenicol and gentamicin. The plates were incubated at 48◦ C and checked daily for fungal growth. Antifungal susceptibility testing based upon the CLSI Standard broth microdilution method for filamentous fungi (M38-A2) was performed for all A. fumigatus isolates. A real-time PCR assay for detection of tandem repeats (TR) in promoter region and mutations in cyp51A gene conferring resistance to triazoles in A. fumigatus was utilised. Results: A. fumigatus grew from 42 of 200 compost samples analysed. Azole-resistant isolates were detected in 6.5% (13/200) of the compost samples and in 31% (13/42) of the compost samples containing A. fumigatus. High minimal inhibitory concentrations (MIC) of itraconazole (≥16 mg/L) and voriconazole (≥8 mg/L) were displayed. Only four of thirteen itraconazole (ITZ) and voriconazole (VRZ) resistant isolates harboured the same TR34 /L98H STR A. fumigatus genotype. No mutation detected for other isolates displayed high MIC to ITZ and VRZ. Conclusion: Our study shows that compost utilized in flower beds can provide azole-resistant phenotypes were found. TR variants confer different azole resistance phenotypes. Therefore it is emphasised that resistance surveillance studies focusing on environmental samples are warranted to yield the emergence and prevalence of azole resistance in A. fumigatus in Iran. Also it is needed the role of exposure of immunocompromised patients to resistant A.fumigatus present in composting organic matter and should be further analyzed.

Objective: Candida albicans is known for its ability to form biofilms – communities of microorganisms embedded in an extracellular matrix, developing on surfaces. Biofilms display high tolerance to antifungals. This phenomenon has been in part explained by the appearance of phenotypic variants of wild-type cells within the biofilm, the so-called persister cells, capable of surviving very high concentrations of antimicrobial agents (LaFleur et al., AAC, 2006). As this topic remains controversial (AlDhaheri and Douglas, AAC, 2008), the main objective of this work was to reevaluate the presence in C. albicans biofilms of persiter cells. Methods: Isolation of persister cells was performed according to the modified protocols described by LaFleur et al. (AAC 2006; AAC, 2010) and Li et al. (AAC, 2015). Cells grown in YPD were washed and diluted to OD600 0.3 in either RPMI or SD containing 2% glucose. Cell suspensions were transferred into 24- or 96-well polystyrene plates and statically incubated for 1.5 hours at 37◦ C for adherence. Non-adhered cells were washed away and fresh medium was added. Biofilms were grown at 37◦ C with gentle shaking for the following 24 hours prior to antifungal treatment. A 100 μg/mL solution of Amphothericin B (AMB) in the same medium was applied to biofilms after washing. After 24 hours of incubation at 37◦ C, biofilms were washed, resuspended in PBS containing 0.05% Tween-20 and plated on YPD-agar plates. After 48 h of incubation at 30◦ C, CFU were counted. Results: According to LaFleur et al. (AAC, 2006) and Li et al. (AAC, 2015), the ratio of persister cells in C. albicans polystyrene plates-grown biofilms vary from 0.1% to 1% for different strains. We failed to reproduce these results, using either RPMI or SD as a medium, and either 96 or 24-well plates. The ratio of cells that survived AMB treatment was not consistent between repeats. In all the protocols described previously, the volumes in which the cells were incubated for biofilm growth, washing and AMB treatment were identical. We discovered that increasing drastically the volume of antifungal (filling a well to the top) led to a complete and consistent eradication of biofilms of the laboratory strain BWP17 and its derivatives. This confirms the results by Al-Dhaheri and Douglas (AAC, 2008) who showed that SC5314 does not form persister cells in biofilms grown on silicone discs. We submitted clinical isolates to our modified assay, and obtained non-consistent numbers of “persisters”. In most cases the strains displayed no persister cells. However, for some of the strains the numbers varied between different experiments from 0 to 1%. Conclusion: Persister cells are not a trait of C. albicans biofilms in our tested conditions. Although some clinical isolates are able to form persisters in biofilms, this phenomenon is rather stochastic and inconsistent. Isolation of “persister cells” by LaFleur et al. (AAC, 2006) and Li et al. (AAC, 2015) is likely the result of survival of cells that were not reached by the antifungal on the walls of the wells.

PP4.032 Overexpression of cyp51A and cyp51b contribute to triazole resistance in clinical isolates of Aspergillus fumigatus from the United States

PP4.067 Identification of recessive lethal alleles in the Candida albicans genome: a constraint on loss-of-heterozygosity events in this species

J. M. Rybak1 , W. Ge1 , C.M. Dickens2 , N.P. Wiederhold3 , P.D. Rogers1 , J.R. Fortwendel1 1 University of Tennessee Health Science Center, MEMPHIS, TN, USA 2 Texas A&M University, COLLEGE STATION, TX, USA 3 Fungus Testing Laboratory, SAN ANTONIO, TX, USA

M. Legrand1 , T Marton1 , A Feri1 , P-H Commere1 , C Maufrais1 , N Sertour1 , G Sherlock2 , M-E Bougnoux1 , C D’Enfert1 1 Institut Pasteur, PARIS, France 2 Stanford University Medical School, STANFORD, USA

Objective: In Candida albicans, mutations leading to the activation of Upc2, and upregulation genes of the ergosterol biosynthesis pathway including ERG11, represents an important mechanism of resistance to the triazole antifungals. In order to determine if activation of the ergosterol biosynthesis pathway contributes to triazole resistance among clinical isolates of Aspergillus fumigatus, we examined the transcriptional profiles of triazole resistant isolates from the United States using RNAseq. Methods: 21 triazole-resistant clinical isolates of A. fumigatus and 5 triazole-susceptible control isolates of A. fumigatus were included in this study. Genomic DNA and RNA were isolated from mature hyphal cells, sequenced on the Ion Torrent platform, and reads were aligned to the Af293 reference genome. Transcript counts among the control isolates were averaged to create a susceptible composite. This composite was then compared to the transcript count measured in individual resistant isolates to create fold- change values. In vitro assembled Cas9 ribonucleoproteins coupled with microhomology repair templates were utilized to replace 1000 bp of the cyp51A or cyp51B promoter with that of the strong hspA promoter in the akuBKU80 background. Voriconazole minimum inhibitory concentrations (MIC) for each isolate were determined using CLSI methods in duplicate. Results: Overexpression of numerous ergosterol biosynthesis associated genes, most notably cyp51A, cyp51B, erg3A, erg3B, erg13A, erg13B, erg24, erg25A, erg25B, hmg1, hapX, and srbA was observed in 6 of the triazole-resistant clinical isolates. This overexpression was observed among both isolates with previously characterized cyp51A mutations, and isolates without cyp51A mutations. Overexpression of cyp51A and cyp51B was observed to range from 3- to 67-fold and 3- to 7-fold that of the susceptible composite, respectively. Whole genome sequencing revealed no unique mutations in srbA in these 6 isolates, however mutations in genes involved in srbA activation (dscA, insA, rbdB, and sppA) were identified. Constitutive overexpression of both cyp51A and cyp51B in the akuBKU80 background using the hspA promoter led to increases in voriconazole MIC by 2 and 4-fold respectively. Conclusion: While tandem repeat elements in the promoter of region of cyp51A have been described and contribute to both cyp51A overexpression and triazole resistance, coordinate upregulation of multiple genes of the ergosterol biosynthesis pathway in resistant clinical isolates have not been reported. Overexpression of a multitude of genes associated with ergosterol biosynthesis, including both cyp51A and cyp51B, was observed in 29% (6/21) of the triazole-resistant A. fumigatus clinical isolates in this collection. Triazole MIC did not clearly correlate with the extent of either cyp51A or cyp51B overexpression, suggesting the concomitant involvement of additional resistance mechanisms. Consistent with findings reported in previous studies, overexpression of cyp51A mediated by promoter replacement in the akuBKU80 background led to a 2-fold increase in voriconazole MIC. Intriguingly, overexpression of cyp51B, which has not previously been demonstrated to have a direct impact on triazole MIC, was observed to increase voriconazole MIC above the previously reported ECV (1 mg/L) in the akuBKU80 background. Further research is needed to reveal the direct contribution of overexpression of genes associated with ergosterol biosynthesis on triazole resistance in A. fumigatus.

PP4.065 Modulation of Candida albicans infection by the non-selective muscarinic receptor agonist pilocarpine hydrochloride C. J Nile1 , E Borghi2 , A. Alghamdi1 , G Ramage1 1 University of Glasgow, GLASGOW, United Kingdom 2 Universita` degli Studi di Milano, MILAN, Italy Objective: Acetylcholine can modulate the pathogenicity of Candida albicans and promote an effective Galleria mellonella cellular immune response to C. albicans infection. Therefore it was hypothesised that C. albicans possesses a putative cholinergic receptor that can modulate pathogenicity and that cholinergic receptors can also dictate cellular immune responses in the Galleria mellonella infection model. Therefore, the aims of this study were to determine the cholinergic receptor subtype responsible for the modulation of biofilm formation by C. albicans and to investigate the role of cholinergic receptors on G. mellonella cellular immunity. Methods: Candida albicans metabolic activity and biofilm formation was assesed in the presence and absence of various cholinergic receptor agonists and antagonists using the 2,3-bis-(2-Methoxy-4-Nitro-5-Sulfophenyl)-2H-Tetrazolium-5-Carboxanilide assay and crystal violet assay, respectively. The effects of pilocarpine hydrochloride on C. albicans cell morphology and viability were further investigated using fluorescence microscopy after staining with calcofluor white and propidium iodide. The effect of pilocarpine hydrochloride on the pathogenesis of C. albicans infection was investigated in vivo using a Galleria mellonella infection model. Infection studies were performed with C. albicans in the presence and absence of pilocarpine hydrochloride and scopolamine. Larval histology was perfomed to investigate the histopathological effects of the compounds on C. albicans infection. Furthermore, the effects of pilocarpine hydrochloride and acetylcholine on haemocyte function were determined in ex vivo stimulation experiments. Results: Pilocarpine hydrochloride, but not SIB1508Y maleate, inhibited C. albicans biofilm formation. Pilocarpine hydrochloride was found to protect G. mellonella larvae from C. albicans induced mortality through inhibition of C. albicans biofilm formation in vivo and manipulation of cellular immunity. The ability of pilocarpine hydrochloride to inhibit C. albicans biofilm formation and protect G. mellonella against infection was inhibited by the general muscarinic receptor antagonist scolopamine. Furthermore, pilocarpine hydrochloride and acetylcholine differentially modulated G. mellonella haemocyte responses to C. albicans ex vivo. Conclusion: Candida albicans possesses a muscarinic-type receptor that modulates the yeast to hyphae transition, filamentation and biofilm formation. In addition, the haemocyte subsets of G. mellonella possess differing repertoires of cholinergic receptors that can modulate their differentiation and function. However, nicotinic rather than muscarinic receptors seem to play a more important role in dictating immune protetion against C. albicans in the host. Therefore, targeting cholinergic receptors may be a direct or adjunctive therapeutic strategy to prevent or treat potentially fatal fungal infections.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Objective: Candida albicans is a frequent human commensal yeast responsible for both mucosal and the majority of lifethreatening nosocomial fungal infections. Its heterozygous diploid genome is highly plastic, with examples of aneuploidies and frequent loss-of-heterozygosity (LOH) events commonly associated with acquired antifungal resistance. Although LOH events can be seen on all 8 chromosome pairs, a chromosome homozygosis bias is observed for certain chromosomes regarding the retained homolog in the homozygous state. This suggests the occurrence of recessive lethal allele(s) (RLA) that would prevent large-scale LOH events from being stably maintained. Methods: To further explore the impact of LOH on C. albicans biology, we took advantage of the Saccharomyces cerevisiae I-SceI endonuclease and fluorescent markers (GFP/BFP) to establish C. albicans strains whereby 1) a DNA double-strand break (DSB) can be induced at a specific location in the genome and 2) the occurrence of long-tract homozygosis resulting from repair of the induced DNA-DSB can be detected by FACS. Results: This approach was applied to identify RLAs on Chr7 of C. albicans strain SC5314, where haplotype B (HapB) is never found in the homozygous state, unlike haplotype A, suggesting the presence of RLA on Chr7B. I-SceI successfully targeted and induced a DNA-DSB on both Chr7 homologs as illustrated by an increase in LOH. However, our inability to recover cells homozygous for the right arm of Chr7B confirmed the existence of RLA(s). Mining of genome sequencing data for 154 C. albicans isolates allowed identifying a nonsense-generating SNP within the HapB allele of C7 03400c/MTR4, encoding a putatively essential RNA helicase. Further experiments confirmed that this nonsense SNP is indeed a RLA responsible for homozygosis bias on Chr7. As well, an RLA and a deleterious recessive allele on another chromosome (Chr4B) have been found explaining why Chr4A cannot be lost in strain SC5314. Conclusion: This methodology also allowed highlighting that repeated regions, such as major repeat sequences (MRS), are hotspots for homologous recombination between homologs and play a role in LOH dynamics by generating new allele combinations upon haplotype swapping. Overall, our work uncovers the importance of MRSs and the constraint RLAs impose on LOH events in C. albicans. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 422595 2d7e7abc-f7c5-448e-b1710d03273004d8.png Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 422595 2d7e7abc-f7c5-448e-b1710d03273004d8.png

PP4.068 Healthcare linen as a source of a mucormycosis case cluster that involved different sites of infection and different Mucorales species M. HONG Nguyen1 , ALEXANDER Sundermann1 , CHRIS Dupont2 , SINEM Beyham2 , DRISHTI Kaul2 , CORNELIUS Clancy1 1 University of Pittsburgh, PITTSBURGH, USA 2 JCVI, LAJOLLA, USA Objective: Identifying nosocomial mucormycosis and distinguishing outbreaks from background disease can be challenging. We diagnosed mucormycosis in three recently-transplanted patients (≤100 days post-transplant) over 4.5 months in 2015. Patients had undergone different transplants (heart, lung, liver), were in adjoining hospitals connected by a walkway, and had different infections (Rhizopus delemar skin, Lichthemia skin/disseminated, R. microsporus lung), arguing against a common source. We performed a genomic epidemiologic investigation of the case cluster. Methods: Whole genome sequencing (WGS) of Mucorales isolates was performed (HiSeq). A phylogenetic tree was constructed by comparing 15 core genes found in all publically-available genomes (Ete3, RAxML, FastTree). Results: Retrospective review of mucormycosis at our center between 2013–16 revealed 6, 5, 7 and 4 cases/year. There were no cases among recently-transplanted patients since 2009. Preliminary surveillance of hospital and construction sites, including air sampling, did not recover causative Mucorales species. More extensive hospital surveillance (e.g, outside window sills, within dry wall) recovered Mucorales in 3.4% of samples. Healthcare linens (HCL), which are delivered centrally for both hospitals, were not tested initially. Monthly sampling of newly arrived HCL and HCL carts in 2015–2016 recovered Mucorales in ≥30% of items. WGS and phylogenetic analysis of R. microsporus (n = 7), R. delamar (n = 19) and R. arrhizus (n = 53) clinical and environmental isolates revealed that a transplant patient’s R. microsporus (presumed to be acquired nosocomially) was indistinguishable from a newly arrived HCL isolate. These isolates were distinct from community-acquired infection isolates, and environmental isolates not linked epidemiologically to our patients. WGS of non-R. microsporus isolates revealed that D1/D2 and 16S RNA sequencing were not sensitive in differentiating R. delemar from R. arrhizus. Conclusion: R. microsporus infection in a transplant recipient was linked to contaminated HCL provided to our center. Centers should suspect nosocomial mucormycosis if a case does not fit past epidemiologic patterns, and maintain low indices of suspicion for HCL as a source even if different species and infections are encountered. HCL is increasingly recognized as a source of nosocomial mucormycosis, but remains unregulated in the U.S. The extent of HCL contamination by Mucorales at U.S. hospitals should be surveyed. New methods are need to identify Rhizopus species.

S60

PP4.069 Genetically closely related azole-resistant Candida tropicalis in environments can be a threat to healthcare Z.L. Zhou1 , J.N. Tsai2 , M.N. Tseng3 , H.L. Liu4 , C.C. Lin5 , K.T. Chen5 , K.C. Huang5 , C.H. Huang5 , W.L. Chu5 , Y.Z. Chen5 , F.C. Chen5 , M.K. Hsu5 , S.C. Wang5 , H.L. Peng1 , Y.L. Yang1 , Y.C. Chen6 , H.J. Lo5 1 National Chiao Tung University, HSINCHU, Taiwan 2 Taiwan Agricultural Research Institute, Council of Agriculture, Executive Yuan, TAICHUNG, Taiwan 3 Kaohsiung District Agricultural Research and Extension Station, CHANGJHIH TOWNSHIP, PINGTUNG COUNTY, Taiwan 4 Council of Agriculture, Executive Yuan, CHANGHUA COUNTY, Taiwan 5 National Health Research Institutes, ZHUNAN, MIAOLI COUNTY, Taiwan 6 National Taiwan University Hospital and College of Medicine, TAIPEI, Taiwan Objective: We would like to investigate the diversity of yeasts recovered from farms and the farmers. Furthermore, we characterized the genetic relatedness of azole-resistant Candida tropicalis recovered from environments and patients. Methods: Yeasts recovered from farms (fruits, soils, and water) and the farmers (armpit swabs, hand swabs, and oral rise) were identified by ribosomal DNA sequencing and the drug susceptibilities of C. tropicalis were determined by broth microdilution assay. Multilocus sequence typing was performed to explore the genetic relatedness of C. tropicalis recovered from agricultural and clinical settings. Results: Of 691 yeast isolates, comprised of 25 genera from 81 farms, 444 (64.3%) were recovered from environments. Among 98 species, 35 (35.7%) species including 286 isolates, have been reported to cause diseases in humans. Of the 5 Candida species commonly causing diseases in humans, C. krusei (26/30, 86.7%, P = 0.012) and C. tropicalis (59/65, 90.8%, P = 0.0004) were prevalent in environments, whereas C. albicans (37/39, 94.9%, P < 0.0000001), C. glabrata (3/3, 100%, P < 0.0000001), and C. parapsilosis (29/30, 96.7%, P < 0.0000001) were in humans. Interestingly, 7 of the 10 fluconazole-resistant and 16 of the 27 triadimenol-resistant C. tropicalis were belonged to diploid sequence type (DST) 225. Importantly, 21 of the 25 fluconazole-resistant and 34 of the 40 triadimenol-resistant clinical C. tropicalis collected in Taiwan Surveillance of Antimicrobial Resistance of Yeasts in 2014 were genetically closely related to DST 225. Conclusion: We have recovered pathogenic yeasts commonly causing diseases in humans from environments. The fact that genetically closely related fluconazole-resistant C. tropicalis exists in both environments and patients emphasizes a potential route for pathogenic yeasts to be transmitted from environments to humans and vice versa.

PP4.070 Mapping the interaction of the Candida albicans multidrug resistance ABC protein Cdr1 with pump inhibitor clorgyline that stimulates ATPase activity M. Niimi1 , K. Niimi2 , S. Saiwan1 , S. Assavachin1 , A. Chindamporn1 , R.D. Cannon2 , E. Lamping3 1 Chulalongkorn University, BANGKOK, Thailand University of Otago, DUNEDIN, New Zealand 3 Unigersity of Otago, DUNEDIN, New Zealand

Medical Mycology, 2018, Vol. 56, No. S2

PP4.072 The use of long and short-read sequencing technology to elucidate genomic variation and epidemiology of Candida glabrata in North America R. M. Welsh1 , L Gade1 , T Dingle2 , S Smith3 , N.A. Chow1 , S Vallabhaneni1 , N Le4 , S Lockhart4 , A Litvintseva1 1 The Centers for Disease Control and Prevention, ATLANTA, USA University of Alberta/ Provincial Laboratory for Public Health, Edmonton, EDMONTON, Canada 3 University of Alberta, Edmonton, EDMONTON, Canada 4 Centers for Disease Control and Prevention, ATLANTA, USA 2

Objective: Candida glabrata represents the second most common causative agent of systemic candidiasis in North America. Some strains of C. glabrata are resistant to multiple classes of antifungals, severely limiting treatment options. Although it is generally accepted that a majority of C. glabrata infections occur as a result of autoinfection from endogenous populations present in patient microbial flora and a smaller fraction of cases are hypothesized to be nosocomially transmitted patient-to-patient, strain typing is needed to distinguish between the two scenarios. Therefore, when faced with high prevalence of infections with drug-resistant C. glabrata, accurate information of possible transmission in healthcare settings is essential. C. glabrata exhibits extensive genetic variation and rapid evolutionary dynamics, which makes whole-genome sequencing (WGS) ideal for the analysis of the molecular epidemiology and phylogeography. Herein, we investigated the utility of WGS to assess transmission of C. glabrata within a single facility. To better understand the genomic variation and population genetics of C. glabrata in North America, we used multiple WGS methods on 73 isolates from multiple healthcare facilities across North America, including 33 from a single facility. Methods: We performed WGS using Illumina short-read as well as PacBio and MinION long-read sequencing technology on 73 North American isolates. Thirty-three isolates from 20 patients in a single facility and 40 additional isolates from 40 separate patients at multiple facilities in North America were sequenced. A C. glabrata genome sequenced on PacBio and Illumina was used to generate a de novo reference genome assembly. SNP variants were identified using SAMtools and the NASP SNP analysis pipeline. Phylogenies were inferred using a maximum likelihood algorithm. Results: All isolates had at least 50X sequence coverage. Seven major clades were identified with our phylogenetic analysis. The tightest clustering was observed within pairs of isolates from the same patient. Comparing between pairs of isolates from different patients within a single clade had a slightly larger range of genetic variants or SNPs. Of the 20 patients from a single facility, 10 had isolates that grouped in a single clade. The strain-to-strain differences between pairs of isolates from different patients within this clade were lower than the variation seen between isolates from any other clade. High levels of genetic diversity were observed within the single facility, which had isolates fall into all seven of the major clades. Conclusion: Substantial genomic diversity of C. glabrata existed even within isolates collected from a single facility. Conversely we observed evidence for potential transmission and clonal expansion of a shared single population of C. glabrata within patients as half the patient isolates from a single facility carry a genetically isolated population of C. glabrata. Continued WGS and phylogenetic analysis may help track the spread of Candida species and improve infection control.

2

Objective: The over-expression of ATP-binding cassette (ABC) transporters is a major cause of clinical fungal resistance to azole antifungals. An approach to overcoming this resistance is to identify inhibitors of these efflux pumps. The monoamine oxidase A inhibitor clorgyline has been shown to be a broad-spectrum inhibitor of fungal multidrug efflux pumps. The objective of this study was to investigate the interaction of clorgyline with fungal ABC transporters. Methods: Naturally acquired suppressor mutants of a Saccharomyces cerevisiae strain over-expressing Candida albicans ABC transporter Cdr1 that were resistant to clorgyline inhibition of rhodamine 6 G efflux were isolated on yeast extract, peptone, dextrose (YPD) agar plates containing clorgyline and sub-minimum growth inhibitory concentration (MIC) of rhodamine 6 G. Functional analyses, and molecular modeling, of Cdr1 from wild type and suppressor mutants were performed. The analyses comprised determination of mutation sites in Cdr1 suppressor mutants, measurement of the MICs of Cdr1 substrates, and whole cell rhodamine 6 G efflux and in vitro pump ATPase assays. Results: Unexpectedly, we found that clorgyline stimulated the ATPase activities of fungal pleiotropic drug resistant (PDR) transporters, including S. cerevisiae Pdr5, Candida albicans Cdr1 and Cdr2, and Candida glabrata Cdr1 and Cdr2, 4- to 5-fold. All clorgyline-resistant mutants over-expressing C. albicans Cdr1 had acquired point mutations in Cdr1 that were of highly conserved amino acids. The point mutations were F556C and F556L, both in the second transmembrane segment (TMS2), F608I and V616F in TMS3, a double mutant T671P/G915C in TMS5 and the second nucleotide binding domain (NBD2) and Q1244E in TMS8. The mutants had altered MICs for several Cdr1 substrates, and their R6G efflux and Cdr1 ATPase activities responded poorly to clorgyline when compared with wildtype Cdr1. Conclusion: Fungal PDR transporters are known to have high, but non-inducible, ATPase activities. This is why our discovery of clorgyline as a strong stimulator of the ATPase activity of fungal PDR transporters was unexpected. Our results suggest that clorgyline interacts directly with Cdr1 and inhibits drug efflux by changing the kinetics of the transporter. Our surprising discovery opens a promising new avenue for drug discovery and the fight against fungal drug resistance.

PP4.071 Metabolic adaptation triggers Candida albicans biofilm phenotype G. Ramage1 , R Rajendran1 , C Delaney1 , R Kean1 , C Munro2 1 University of Glasgow, GLASGOW, United Kingdom 2 University of Aberdeen, ABERDEEN, United Kingdom Objective: Candida albicans biofilm formation is an important virulence factor in the pathogenesis of disease, a characteristic that has been shown to be heterogeneous in clinical isolates. C. albicans forms biofilms in an adaptive manner on biotic and abiotic surfaces in response to environmental cues. The mechanisms behind adaptive biofilm formation have not yet been fully explored. Using an unbiased computational approach we investigated the metabolic adaptation driving biofilm heterogeneity. Methods: Pre-characterised C. albicans clinical isolates with high (HBF) and low (LBF) biofilm forming ability were used throughout this study. Induction of isolates biofilm formation was assessed in RPMI media in the presence and absence of stimuli such as foetal calf serum (FCS) and bacteria. Transcripts from LBF grown in RPMI ± serum for 90 min, 4 h and 24 h time points were analysed by RNA sequencing. With a dedicated computational pipeline, we identified and validated a significantly differentially expressed subnetwork of genes associated with these biofilm phenotypes. Results: FCS and S. aureus were found to be inducing the LBF isolates to form a high level of biofilm. Conversely, no such biofilm induction was found with dialysed serum, suggesting the role of small molecules including amino acids in biofilm formation. There were around 5000 genes differentially expressed between RPMI and +serum phenotypes in LBF. Our pathway analysis revealed amino acid metabolism, such as serine, glycine, arginine, threonine, alanine and thyrosine metabolism were differentially expressed between these phenotypes. Activation of serine metabolism (SER2 and SER3 genes) was found to be biphasic, up regulated with serum exposure at 90min-4 h and down regulated at 24 h. Furthermore, other serine metabolism associated genes such as CHA1 and SHM1-2 was also found to be following the same biphasic trend. Addition of L-serine significantly up regulates the biofilm formation by LBF in a dose dependant manner. However D-serine does not induce the biofilm formation in LBF and inhibits the biofilm formation by HBF. Conclusion: Collectively, these findings provide evidence that biofilm phenotype is associated with differential regulation of metabolic pathways. Understanding and targeting such pathways, such as amino acid metabolism, is potentially useful for developing diagnostics and new antifungals to treat biofilm-based infections.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

PP4.105 YEAST PANEL Multiplex PCR Assay for Identification of Invasive Yeast Pathogens: Novel Diagnostic Strategy, Useful for Developing Countries A. Arastehfar1 , F. Wenjie2 , P. Weihua2 , M. Lackner3 , W. Liao2 , P. Badiee4 , K. Zomorodian5 , H. Badali6 , F. Hagen1 , C. LassFloerl3 , T. Boekhout1 1 Westerdijk Institute, UTRECHT, Netherlands 2 Shanghai Changzheng Hospital, Second Military Medical University, SHANGHAI, China 3 Division of Hygiene and Medical Microbiology, INNSBRUCK, Austria 4 Professor Alborzi Clinical Microbiology Research Center, SHIRAZ, Iran 5 Department of Mycology and Parasitology, SHIRAZ, Iran 6 Department of Medical Mycology and Parasitology, SARI, Iran Objective: The majority of invasive fungal infections (IFIs) are attributable to human-pathogenic yeast species. Identification of pathogenic yeasts in developing countries are mainly performed by phenotypic and biochemical assays, which are time-consuming and prone to errors. False species identification might result in inefficient treatment choice and inaccurate epidemiological data. To improve rapid species identification, a panel of three multiplex PCR assays (YEAST PANEL Multiplex PCR assay) targeting the most clinically important yeast pathogens was designed. Methods: Desired sequences for primer design were retrieved from the NCBI database. Eight-hundred clinical and 400 CBS isolates, including major and less predominant clinical species of Candida, Trichosporon, Rhodotorula, Cryptococcus, and Geotrichum (Table 1) were subjected to PCR. Specificity and performance tests were performed to check for any cross-reactivity. The possibility of compatibility of pure colonies instead of purified DNA was evaluated. Recommended workflow for the “YEAST PANEL Multiplex PCR Assay” is summarized in Figure 1. Results: All targeted species were correctly identified (Figure 2). No cross-reactivity with closely- and distantly-related yeast pathogens, Aspergillus spp., and human DNA was observed. Utilization of pure colony testing showed distinct fragments for each species, eliminating the need for DNA extraction. Conclusion: This assay targets 99% of the pathogenic yeast species, which could be supplemented with other phenotypic and biochemical assays. Due to high accuracy and encompassing the wide range of pathogenic yeasts included, this assay could be used for identification of pure cultures in routine laboratories and epidemiological studies. Additionally, compared to phenotypic assays, our assay is less expensive, more time-saving and highly specific. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 412191 4b896e01-551c-4672-b1fcab3509eaf1a3.jpg Caption 1: Figure 1. Recommended workflow for YEAST PANEL Multiplex PCR Assay. Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 412191 4b896e01-551c-4672-b1fcab3509eaf1a3.jpg Caption 2: Figure 2. Identification of the most clinically important yeast pathogens using our multiplex assays.

ABSTRACT

S61

PP4.106 Increasing trend of mucormycosis mixed with other invasive mycoses from a tertiary care centre in north India.

PP4.108 A genetic and genomics approach identifies novel pathways of human antifungal immune responses

J. Chander1 , N. Singla2 , N Gulati3 , A Bhagat1 , R.P.S. Punia1 , A Dass1 1 Government Medical College Hospital, CHANDIGARH, India 2 Government Medical College Hospital,, CHANDIGARH, India 3 Governement Medical College Hospital, CHANDIGARH, India

VINOD Kumar1 , VASILIKI Matzaraki2 , MARTIN Jaeger3 , R. Aguirre-Gamboa2 , MELISSA D Johnson4 , MIHAI G Netea3 , CISCA Wijmenga2 1 University Medical Center Groningen, Radboud UMC Nijmegen, GRONINGEN, Netherlands 2 University Medical Center Groningen, GRONINGEN, Netherlands 3 Radboud University Medical Center, NIJMEGEN, Netherlands 4 Duke University Medical Center, NORTH CAROLINA, USA

Objective: Mucormycosis is an angioinvasive, aggressive and life-threatening fungal infection requiring timely intervention thereby prompt treatment. The incidence of mucormycosis, mixed with other invasive mycoses is increasing gradually with rise in vulnerable population, especially among those with uncontrolled diabetes mellitus. During recent times, we encountered mucormycosis mixed with other mycoses, whereby there was concomitant infection with hyaline or dematiaceous mold and/or yeast infection. The present study intends to evaluate the increasing trend of mucormycosis along with such infections and the underlying significant risk factors with poor prognosis if timey intervention is not instituted. Methods: A total of seventeen cases of mixed infection/co-infection occurred during last five years from January 2013 to December 2017. Biopsy tissue from nasal cavity in rhino-orbital infection, necrotic tissue from cutaneous infection and sputum in case of pulmonary infection was processed for mycological examination. The fungal etiology was established by direct examination of KOH wet mount, calcofluor white staining and conventional fungal culture on SDA and BHIA. The morphological identification of fungal isolates was done by LCB preparation. Histopathology study of tissue sections stained by hematoxylin and eosin (H&E), periodic acid-Schiff (PAS) and Gomori methenamine silver (GMS) stainings was done. The final diagnosis of isolates was established on the basis of molecular identification done by sequencing ITS region of isolates and compared with those of type strains. In vitro antifungal susceptibility testing of all mucoralean fungi was done by broth microdilution method according to the Clinical and Laboratory Standard Institute (CLSI) document M38-A2. Results: Thirteen cases were rhino-orbital clinical type, two each of pulmonary and cutaneous types. Rhizopus arrhizus and Aspergillus flavus were isolated from six rhino-orbital cases and one pulmonary case. Rhizopus arrhizus and Alternaria alternata were isolated from one rhino-orbital case while Lichtheimia corymbifera and Aspergillus flavus were isolated from one pulmonary case. Two patients showed Candida tropicalis and one showed Aspergillus fumigatus along with the direct positive findings of aseptate hyphae. The remaining cases turned out to be sterile on culture despite direct KOH/CFW showed mixed fungal etiology. Twelve cases had underlying diabetes mellitus Type-II as the underlying risk factor. In addition, a significant risk factor in cutaneous type was history of intramuscular injection. AFST revealed all strains sensitive to amphotericin B and posaconazole. All patients were treated with extensive surgical debridement and intravenous liposomal amphotericin B with good prognosis thereby survival. Conclusion: There has been an upsurge in cases of mixed fungal infection with a growing susceptible population. Diabetes mellitus appears to be a significant risk factor for the development of such infections to thrive and establish. Intramuscular injection has a major role in causation of cutaneous mixed infections. These infections carry a poor prognosis, often leading to fatal consequences, if timely not managed. The aggressive nature of disease warrants a prompt and aggressive treatment regimen in order to save the life of patient. Amphotericin B is the mainstay therapeutic drug for treatment along with extensive surgical debridement/resection and control of risk factors. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 425520 66e2d751-c019-4474-91e8-9ee8c 039c52e.jpg Caption 1: Bilateral rhinocerebral mucormycosis in a DM-II patient. Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 425520 66e2d751-c019-4474-91e8-9ee8c 039c52e.jpg Caption 2: KOH wet mount shows two type of hyphae (40X).

PP4.107 Invasive fungal diseases in patients with acute leukemia or allogeneic stem cell transplantion recepients: A prospective multicenter observational study 8 ¨ ¨ 1 , A C¸iftic¸ioglu2 , R Saba3 , A Ulu Kilic¸4 , H Yilmaz5 , K Demir6 , Y C¸ag7 , D Kiper Unal G Metan1 , S Etgul , F. Aksoy9 , H Berk10 , ¨ Tunc¸can12 , A Tombak13 , G Delibalta14 , II Balkan15 , SA C¸avus16 , B Kandemir17 , B Mutlu18 , AC Inkaya1 , G Mert11 , OG 19 4 5 6 20 10 8 ¨ ur ¨ 22 , NZ I Karadogan , LG Kaynar , MH Atay , A Keskin , FE Dursun , E Kurtoglu , G Saydam , N Erkut21 , G Ozg 23 16 24 14 ¨ ¨ oren ¨ ¨ ¨ , HG Ozsan , N Tiftik13 , S Ong , Y Unsal , FS Sari18 , H. Akan2 Ozkurt 1 Hacettepe University Faculty of Medicine, ANKARA, Turkey 2 Ankara University Faculty of Medicine, ANKARA, Turkey 3 Antalya Mestar Hospital, ANTALYA, Turkey 4 Erciyes University Faculty of Medicine, KAYSERI, Turkey 5 19 Mayis University Faculty of Medicine, SAMSUN, Turkey 6 Pamukkale University Faculty of Medicine, DENIZLI, Turkey 7 Medeniyet University Faculty of Medicine, ISTANBUL, Turkey 8 Ege University Faculty of Medicine, IZMIR, Turkey 9 Karadeniz Technical University, Faculty of Medicine, TRABZON, Turkey 10 Antalya Research and Education Hospital, Medical Sciences University, ANTALYA, Turkey 11 ¨ Gulhane Medical Academy, ANKARA, Turkey 12 Faculty of Medicine, Gazi University, ANKARA, Turkey 13 Mersin University Faculty of Medicine, MERSIN, Turkey 14 Emsey Hospital, ISTANBUL, Turkey 15 Istanbul University Cerrahpasa Medical Faculty, ISTANBUL, Turkey 16 ¨ University Faculty of Medicine, IZMIR, Turkey Dokuz Eylul 17 Necmettin Erbakan University Faculty of Medicine, KONYA, Turkey 18 Kocaeli University Faculty of Medicine, KOCAELI, Turkey 19 Antalya Medstar Hospital, ANTALYA, Turkey 20 Medeniyet University Facult of Medicine, ISTANBUL, Turkey 21 Karadeniz Technical University Faculty of Medicine, TRABZON, Turkey 22 ¨ Gulhane Military Academia, ANKARA, Turkey 23 Gazi University Faculty of Medicine, ANKARA, Turkey 24 Istanbul University Cerrahpasa Faculty of Medicine, ISTANBUL, Turkey

Objective: We aimed to investigate the incidence and outcome of invasive fungal diseases (IFDs) in patients with acute leukemia and recepients of allogeneic stem cell transplantation (ASCT). Methods: Patients ≥18-years who received cytotoxic chemotherapy for acute leukemia or recepients of ASCT with a duration of neutropenia (60 years of age (73%). In children non-albicans species dominated (52.6%). In 15 (3.2%) patients more than one yeast were isolated. In total 12 patients (8 males), fungi were isolated from CSF cultures and/or had a Cryptococcus antigen test positive (yielding an incidence of 0.12 cases per 100 000 population/year). Cryptococcus neoformans caused seven (58%), and Candida five meningitis (42%). The rates of Candida resistance to fluconazole were ≤ 1% in C. albicans and 1.5% in non- albicans species other than C. glabrata and Candida krusei that were regarded as naturally resistant to the drug. Resistance to voriconazole was rare, except for C. glabrata, C. krusei. and C.tropicalis. No Candida isolate had reduced susceptibility to amphotericin B. Reduced susceptibility/or resistance to anidulafungin was seen in 3.5% of the isolates included in the study. Conclusion: We report an increase in candidaemia but a slight decrease of C. albicans while C. glabrata complex and C. parapsilosis complex remain constant over this 10-year period. Fungal meningitis was most commonly caused by Cryptococcus neoformans followed by Candida species. Antifungal resistance was generally uncommon, but reduced susceptibility/or resistance to anidulafungin was seen in 3.5% of the isolates. Reference 1. Ericsson J, Chryssanthou E, Klingspor L, Johansson AG, Ljungman P, Svensson E,Sjolin J. Candidaemia in Sweden: a ¨ nationwide prospective observational survey.Clin Microbiol Infect. 2013;19(4)

S62

PP4.110 Comparative sequencing of ITS and D1/D2 domains of ribosomal DNA for Molecular discrimination of fungal moulds R. BASKAR, K UMAMAHESWARI University of Madras, CHENNAI, India

Medical Mycology, 2018, Vol. 56, No. S2

PP4.145 Prevalence and virulence of the zoophilic dermatophyte Trichophyton benhamiae 1 ¨ C. Kupsch1 , J. Hesse2 , U.-C. Hipler2 , Y. Graser Charite´ - University Medicine Berlin, BERLIN, Germany University Medical Center Jena, JENA, Germany

1 2

Objective: To compare and validate the Internal Transcribed Spacer (ITS) and D1/D2 domain of the large ribosomal subunit as potential targets for discrimination of fungal species Methods: A total of 80 fungal species previously isolated from clinical specimens collected from patients with Cancer and pulmonary tuberculosis were included in this study. All the fungal isolates were presumptively identified based on their macro- and micro-morphological (phenotypic) characteristics. The fungal DNA was amplified targeting the ITS and D1/D2 domains of LSU using ITS1/ITS4 and D1/D2 primers followed by sequencing the amplicons and compared with the curated molecular database for species confirmation Results: All the 80 isolates were preliminarily identified and speciated based on phenotypic characteristics. The ITS and D1/D2 domains of the ribosomal DNA were successfully amplified for species discrimination using fungus-specific universal primer ITS1/ITS4 and D1/D2 respectively. The species were confirmed as Aspergillus (A. fumigatus, A. flavus, A. niger, A. terrus, A. nidulans, A. ocharceus, A. versicolor) Mucormycetes (Rhizopus, Mucor, Rhizomucor, Syncephalastrum and Cunninghamella), Penicillium (P. oxalicum, P. chrysogenum and P. purpurogenum), Hyalohyphomycetes (Fusarium, Acremonium and Paecilomyces), Dermatophytes (Trichophyton, Microsporum), Phaeohyphomycetes (Alternaria, Curvularia and Bipolaris) and yeast like fungi (Trichosporon, Geotrichum and Rhodotorula). The primer targeting ITS region was found to be more reliable in discriminating the species of Aspergillus, Penicillium and Dermatophytes than D1/D2 primer. The sequencing results were also compared with phenotypic identifications Conclusion: Sequencing of the ribosomal genes has emerged as a useful diagnostic tool for the rapid detection and identification of pathogenic fungi. In the present study, the utility of the ITS and D1/D2 domain of ribosomal DNA as amplification targets for sequence analysis of fungal species was compared. Both the domains yielded comparable performances for fungal species discrimination, while ITS region was the most reliable primary sequencing target for discrimination of majority of the species under different genera. Analysis of the D1/D2 region could be used for further resolution, since the relevance of species-level identification has only been determined for a limited number of fungal genera

Objective: Trichophyton benhamiae has been a common cause of zoonotic dermatophytosis for some years now and was the most frequent zoophilic dermatophyte isolated from human skin infections in Central Germany in 2014 (Nenoff et al., 2014). This pathogen is predominantly transmitted from pet guinea pigs to children and young adults. It has been previously described that there is a white and a (new emerging) yellow type of T. benhamiae (Symoens et al., 2013). Recent human infections are mainly caused by the yellow type (Brasch et al., 2016). We were interested in the frequency of the two types in the colonization of pet guinea pigs and potential differences in their virulence. Methods: We sampled 59 guinea pigs from 15 pet shops in Berlin, Germany with different swab techniques and analyzed the samples via PCR for the presence of T. benhamiae. We further investigated white and yellow T. benhamiae strains from human and animal origin and analyzed various enzyme activities and growth requirements on 3D human skin equivalents (SE). Results: We found that 93% of the guinea pigs from Berlin pet shops were colonized with T. benhamiae. On 50% of the animals we isolated both the yellow type and the white type. While there was no obvious difference between the both types concerning the ability of hyphae penetrating the SE, we found higher activities of peptide and protein degrading enzymes, like collagenase or valine arylamidase in the yellow type and higher activities of sugar metabolizing enzymes, like α-mannosidase or β-glucosidase in the white type. Animal isolates caused more sever inflammatory reactions in the SE than human isolates. Conclusion: We found an alarmingly high prevalence of the yellow type and also the white type of T. benhamiae in guinea pigs in Berlin pet shops. In the human skin model used here, the yellow type exhibits higher protein degradation activity, which, however did not result in a more pronounced infection. The dominance of the yellow type in human infections may be due to different host-fungus interactions influencing the onset of disease or other, not yet examined enzyme types may contribute to the virulence of the two T. benhamiae types.

PP4.111 Molecular diagnostics of arthroconidial yeasts- frequent pulmonary opportunists ENGIN Kaplan1 , ABDULLAH M.S. Al -Hatmi2 , MACIT Ilkit1 , A.H.G. Gerrits Van den Ende3 , FERRY Hagen4 , JACQUES F Meis4 , G. SYBREN De Hoog3 1 Cukurova University, ADANA, Turkey 2 Directorate General of Health Services, MUSCAT, Oman 3 Westerdijk Fungal Biodiversity Institute, UTRECHT, Netherlands 4 Center of Expertise in Mycology Radboudumc/Canisius -Wilhelmina Hospital, NIJMEGEN, Netherlands Objective: Magnusiomyces capitatus and Saprochaete clavata are members of the clade of arthroconidial yeasts that represent emerging opportunistic pulmonary pathogens in immunocompromised patients. M. capitatus and S. clavata are physiologically differentiated by their growth responses to cellobiose, salicin, and arbutin. Despite these differences, misidentifications between the two species are frequent due to conflicting datasets. For this purpose, we adopted multilocus sequencing, amplified fragment length polymorphism (AFLP), phenotypic, and antifungal profiles for species delimitation. The present study can help to provide a stable nomenclature for this important group of fungi. Methods: We analyzed 34 reference strains obtained from Centraalbureau voor Schimmelcultures (CBS; housed at Westerdijk Fungal Biodiversity Institute, Utrecht, the Netherlands) with the goal of finding new genetic markers for classification using multilocus sequencing of (ITS, LSU, Rbp2, Act, and Tef1α) and amplified fragment length polymorphism (AFLP) fingerprinting. In addition to molecular data, physiological tests for the utilization of cellobiose, salicin, and arbutin and antifungal susceptibility profiles were tested following the Clinical and Laboratory Standards Institute M27-A3 document to verify whether there are any systematic differences in this newly defined group Results: Interspecific similarity using rDNA markers [internal transcribed spacer (ITS) and large subunit] was in the range of 96–99%, whereas that of protein-coding loci (Rbp2, Act, and Tef1α) was lower at 89.4–95.2%. Ultimately, Rbp2 was selected as the best marker for species distinction. On the basis of cloned ITS data, some strains proved to be misidentified in comparison with phenotypic characters, protein sequences, and AFLP profiles, indicating that different copies of the ribosomal operon were present in a single species. Antifungal susceptibility testing revealed that voriconazole had the lowest MIC against M. capitatus, while amphotericin B had the lowest MIC against S. clavata. Both species exhibited in vitro resistance to fluconazole and micafungin. Conclusion: In conclusion, we have provided detailed molecular characteristics of two species of arthroconidial yeasts, thereby greatly expanding the current database beyond rDNA ITS 365 sequence classification and incorporating new identification markers using multilocus sequence typing of various genes such as Rbp2. Moreover, antifungal testing revealed that voriconazole and amphotericin B are the most effective against these potential pathogens. Finally, based on our results, we suggest modifying the nomenclature of S. clavata according to updated fungal nomenclature guidelines.

PP4.112 Neglected diseases in Nigerians, diagnostics challenges: Invasive Fungal Infections RITA O Oladele1 , M Richardson2 , FT Ogunsola1 , DW Denning3 1 College of Medicine, University of Lagos, LAGOS, Nigeria 2 University NHS Foundation Trust., MANCHESTER, United Kingdom 3 Manchester University NHS Foundation Trust, MANCHESTER, United Kingdom Objective: Nigeria with a population of 182million has the second highest number of people living with HIV/AIDS in Africa. An estimated 11.8% of Nigerians suffer from a serious fungal infection annually. These infections are associated with significant morbidity and mortality. Fungal infections remain unrecognized despite the population at risk being managed by physicians with varied specialist training. Presently, only 4 antifungal agents for treating serious fungal infections are licensed for use in Nigeria There is no reference mycology laboratory in Nigeria and very few (less than 10) hospital laboratories in Nigeria has a mycology bench in their Microbiology department. A number of fungal infections are commonly misdiagnosed as tuberculosis. This review seeks to highlight the diagnostic challenges and under-recognition of invasive fungal infections in a resource-limited setting with a high HIV and TB burden. Methods: A detailed literature search using pubmed, web of science, google scholar, PubMed, Web of Science, Google Scholar, Cochrane Library, African Journals Online (AJOL), Africa-Wide: NiPAD, CINAHL (accessed via EBSCO Host) databases, and grey literature was done. Results: Literature search revealed one hundred and twenty-four reported cases of histoplasmosis over a 4-decade period and histoplasmin skin sensitivity between 3–35%; most of the cases of histoplasmosis were cutaneous and bony lesions. The prevalence of chronic pulmonary aspergillosis (CPA) in patients being managed as smear-negative or treatment failure TB was 8.7%. Of the studied population with CPA, 6.5% were HIV-positive and 14.5% were HIV-negative. A hospital-based 5.2% frequency of candidaemia in critically ill adults and 2.3% in neonates with a 91.7% and 18.5% case fatality respectively have been documented. A 12year retrospective study of patients attending a PEPFAR clinic in an urban setting revealed 18.6% had had an opportunistic fungal infection, however, 90.3% were cases of oral candidiasis and 8% esophageal candidiasis. A frequency of 36% cryptococcal meningitis has been documented with cryptococcal antigenemia of 8.9 -12.7%. A survey of 1046 doctors in residency training in Nigeria demonstrated very poor knowledge and awareness of invasive fungal infections. Only 0.002% (2) out of the 1046 respondents had a good level of awareness of IFIs. Conclusion: There is a dire need for capacity building to enhance detection of fungal diseases, integration of fungal diseases into existing health programs in Nigeria, establishing a surveillance system and concomitant integration of fungal disease into the training of the health workforce. Point of care tests for diagnosing these diseases is urgently needed. At least one reference Mycology laboratory is desirable for optimum diagnosis and management of fungal infections through its specialist laboratory services and expert clinical and technical advice and also to provide a focus for training and research in Medical Mycology in Nigeria.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

PP4.146 Epidemiology of dermatophytosis in the Caribbean H. Gugnani Retired Professor from VPCI, University of Delhi, NEW DELHI, India Objective: Information on prevalence of dermatophytes in the Caribbean is limited to a few reports. This paper presents an overview of dermatophytes causing human infections and their occurrence in soil in the Caribbean. Methods: All published papers on dermatophytic infections in various Caribbean countries were scanned by extensive and thorough search of literature using PubMed, MEDLINE, Biomed Lib, Med Facts, and different sets of key words, viz. dermatophytes, tineas in Caribbean, occurrence in animals, soil etc. The recent unpublished work on occurrence of dermatophytes in Anguilla soils is also included. Results: In Cuba, among the mycologically confirmed 249 cases of tinea capitis, 182 were caused by Microsporum canis, 56 by Trichophyton tonsurans, 3 by T. mentagrophytes, 5 by M. gypseum, 3 were mixed –T. tonsurans and M. canis. Of the 227 cases of tinea cruris, 219 were caused by T. rubrum, 3 by T. mentagrophytes, 2 by T. tonsurams, 2 by M. gypseum, and one by E. floccosum. Of the 144 cases of onychomycoses, 137 were due to T. rubrum. Of the 78 patients of tinea corporis, 46 were caused by M. canis, 15 by T. mentagrophytes, 7 by M. gypseum, 3 due to T. tonsurans, and one due to E. floccosum. In a comprehensive study of 726 patients with presumptive diagnosis of ringworm in French Guiana, Trichophyton tonsurans was the predominant agent of tinea capitis (73.9%), while Trichophyton rubrum was the commonest dermatophyte recovered from cases of onychomycosis (67.4%), tinea pedis (70.6%) and tinea corporis (52.4%). In a study of 118 cases of tinea capitis in children in Dominican Republic, T. tonsurans (61.16%), M. audouinii (24.27%), and M canis (11.65%) were the most frequent causative agents, whereas T. violaceum and T. mentagrophytes were rarely recovered. Addionally M. canis was agent of mycetoma of scalp in one case. In a small study n Haiti, T. tonsurans was the major etiological agent (63.6%) of tinea capitis. Other dermatophyte species identified included T. mentagrophytes (14.5%), M. audouinii (12.7%), T. rubrum (7.3%) and in one case, the geophilic M. gypseum (1.8%). Regarding natural occurrence of dermatophtyes, out of 163 soil samples examined from St. Kitts and Nevis, 39 (23.9%) were positive for M. gypseum complex. In Bonaire, out of 76 soil samples examined 16 were positive M. gypseum, and 8 positive for M. fulvum. Sixteen of the 46 soil samples examined from Jamaica, 16 yielded M. gypseum, and 4 yielded M. fulvum. Investigation of 110 soil samples from Anguilla yielded M. fulvun from 35 samples and M. gypseum from 8 samples. The occasional presence of M gypseum and M. fulvum on feathers of birds in St. Kits and Nevis has also been demonstrated. M. nanum has been isolated once from soil in Cuba. Conclusion: T. tonsurans is major agent of tine capitis in Haiti, Dominican Republic and French Guiana, while in Cuba it is M. canis. Preponderant occurrence of M. fulvun in Anguilla soils is noteworthy, M. fulvum being rarely recovered. There is need for further epidemiological studies in the Caribbean.

PP4.148 Long-term practice of animal vaccination against dermatophytosis M.G Manoyan, V.V. Sokolov, A.S. Gursheva, T.O. Bukanova, A.N. Panin The All-Russia State Center for Quality and Standardization of Animal Medicines, MOSCOW, Russia Objective: Current approaches to control the animal dermatophytosis are based mainly on the using of chemotherapeutic drugs while the immunogenic medicines (vaccines, immunomodulators) have dropped out of sight. Methods: Here we describe the Russian experience and prospects for the use of immunogenic medicines against dermatophytosis. Results: The era of immunization against dermatophytosis was discovered by successful vaccine LTF-130 against cattle trichophytosis elaborated in USSR in 1960 yy by A.Kh. Sarkisov and co-workers. Currently the vaccines in Russia are the primary means for both treatment and prevention of dermatophytosis while the chemotherapeutic drugs are used mainly as the auxiliary external means. Nowadays a variety of the vaccines intended for various animal species are elaborated and introduced to the clinical practice in Russia: LTF-130 against trichophytosis in cattle, Microderm against dermatophytosis in small animals (cats, dogs, rodents, fur animals) and horses. Those vaccines contain alive highly-immunogenic fungal strains which are attenuated and safe. The full-value fungal cells provoke ntense immune response which is both protective and healing. Also developed and introduced into veterinary practice inactivated vaccines against dermatophytosis animals, such as Vakderm and Polivak. The strategic significance of the vaccines is that they allow to conduct mass preventive immunization which reduces the incidence of dermatophytosis both in animals and mediately in humans. The responsible animal-owners prefer to prevent the infection rather than pay money for costly treatment. The proper administration of the vaccines is the key factor in defending humans against zoonotic dermatophytosis. Moreover the vaccines are well-proved means for the therapy providing the effective treatment without time-taking and expensive procedures. The clinical efficiency of the mentioned vaccines is well-established and approved by the practical usage for over 25 years. Conclusion: All the officially allowed vaccines are monitored by governmental regulators for compliance with the quality and safety standards. A number of researches focused on vaccination and immunogenesis were published in domestic Russian issues but their international impact seems to be negligible. We resume the vaccines possesses the great potential and abilities for prevention and treatment of animal dermatophytosis and reducing the disease incidence in humans.

ABSTRACT

PP4.149 Morphological and metabolic adaptation to environmental conditions by Talaromyces marneffei and its role in the host. ALEX Andrianopoulos, HARSHINI Weerasinghe, MICHAEL Payne University of Melbourne, UNIVERSITY OF MELBOURNE, Australia Objective: Talaromyces marneffei (Penicillium marneffei) is an important fungal pathogen of humans, in particular those who are immunocompromised. T. marneffei has the capacity to alternate between a hyphal and a yeast growth form, a process known as dimorphic switching. The strongest extrinsic trigger for dimorphic switching is in response to temperature. T. marneffei grows in the hyphal form at 25◦ C and in the yeast form at 37◦ C. The hyphal form produces conidia that are likely to be the infectious agent and believed to establish infection after inhalation. The yeast growth form is the pathogenic form found in infected patients. These yeast cells exist intracellularly in the mononuclear phagocyte system of the host. The aim of this work is to understand the mechanisms for specifying cell type and to understand how these impact on pathogenicity. Methods: The research used high throughput molecular techniques coupled with detailed genetic characterisation at the molecular and cellular levels. Results: High throughput transcriptomic and metabolomic analyses identified hyphal and yeast cell specific pathways during growth of T. marenffei. Coupled with genomics studies we characterised a number of candidates that were predicted to play a role during growth in the host. One of these was a major expansion of genes encoding aspartyl proteases. We showed that this expanded family has important roles whilst T. marneffei is growing inside host cells. We also identified a gene encoding a guanine nucleotide exchange factor like protein and showed that it has a critical role in yeast cell morphogenesi inside host cells. Cell shape is critical for T. marenffei to survive within host cells without prematurely killing them. Conclusion: T. marneffei is the only true pathogen in a genus comprising a large number of species and is also the only dimorphic fungus in this group. As an intracellular pathogen, T. marneffei must be able to utilise the available nutrient sources in order to grow while evading or tolerating the host’s defence systems. The results suggest that T. marneffei has evolved a unique set of strategies to establish and maintain its morphological state in the host and to assimilate nutrients for growth, both of which are central to pathogenicity.

S63

PP4.185 Topical use of 1% luliconazole cream cured with Fusarium oxysporum infected refractory ulcers on an elderly patient’s leg and ankle X. Ran, X. Jiang, S. Wang, Y.P. Ran West China Hospital, CHENGDU, China Objective: We report a case of a 73-year-old male patient presented with wound in the left leg and ankle for 5 months. Methods: The patient applied several kinds of fresh herbal on his wound as the treatment with topical and systemic antibiotics were ineffective. He was admitted to the hospital because the wound turned into a painful ulcer. The cutaneous examination showed left leg with moderate edema and two ulcers each sized 4cmx4cm. The ulcer surfaces covered with black crusts and yellowish exudates. Under fluorescence microscope of the fluorescence staining of the crusts showed irregular septate hyphae and large round spores. Whitish colonies developed while inoculating the crusts on Sabouraud Dextrose Agar with 25◦ C for 3 days. The pathogen was identified as Fusarium oxysporum after DNA was extracted, by PCR and sequence. Histopathology showed a large number of hyphae on the surface of ulcer, with infiltrate of neutrophils at the bottom. Hence, the diagnosis of Fusariumsis was confirmed. The crusts and wound exudates were removed by wound dressing. Based on the drug sensitivity test, itraconazole and terbinafine was excluded and treated with the topical use of 1% luliconazole cream and povidone-iodine. Results: After treating nearly for 7 months, both the ulcers reduced to 1 cm × 1 cm, with no any side effects. Conclusion: Luliconazole, a new topical use azole, is more efficient to treat Fusarium oxysporum infection, approved in vivo and in vitro in this rare case. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 421599 d2c2e50c-0bbc-4d8f-b408ace4621106bc.png Caption 1: Fluorescence microscope of the fluorescence staining showed irregular septate hyphae and large round spores.SDA Culture at 25◦ C × 3d(+) Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 421599 d2c2e50c-0bbc-4d8f-b408ace4621106bc.png Caption 2: Wound in the left leg and ankle for 5 months (day 0)(a, b, c.). Treated with the topical use of 1% luliconazole cream and povidone-iodine for 7 month

PP4.150 A Holistic Approach to the Mycetoma Management A. H Fahal, S M Bakhiet The Mycetoma Research Centre, KHARTOUM, Sudan Objective: The study objective was to tested a new approach for mycetoma services decentralisation based on available health system structure and minimum requirement of mycetoma management and control services. Methods: In this study, our team has tested a new approach for mycetoma services decentralisation based on available health system structure and minimum requirement of mycetoma management and control services. Results: In this communication, the Mycetoma Research Center, Sudan shares its experience in implementing a holistic approach to manage mycetoma patients locally at the village level. It is a comprehensive approach that has addressed the medical and health disease aspects, the community environmental and hygienic issues, and the patients’ socioeconomic constraints that hinder early presentation and treatment. This approach has also included the active local health authorities, community and civil society participation and contributions to deliver the best management. Conclusion: This holistic approach for mycetoma patients’ management proved to be effective for early case detection and management, optimal treatment and treatment outcome and favourable disease prognosis that can reduce the disease medical and socioeconomic burdens

PP4.151 Application of real-time PCR assays for the diagnosis of histoplasmosis using three molecular targets in human FFPE tissues and whole-blood ˜ 1 , A. Tobon1 , D.H. Caceres2 , V. Loparev2 , O. Clay3 , T.M. Chiller2 , A.P. Litvintseva2 , L. Gade2 , A. L. F. Lopez1 , C.O. Munoz Gonzalez4 , B.L. Gomez3 1 ´ para Investigaciones Biologicas ´ Corporacion (CIB), MEDELLIN, Colombia 2 Centers for Disease Control and Prevention (CDC), ATLANTA, USA 3 ´ para Investigaciones Biologicas ´ Universidad del Rosario and Corporacion (CIB), MEDELLIN, Colombia 4 Universidad de Antioquia, MEDELLIN, Colombia Objective: Histoplasmosis is a fungal infection that causes significant morbidity and mortality in persons living with HIV/AIDS, especially in countries with limited resources. Currently used diagnostic tests rely on culture and serology, lack sensitivity and often require weeks to obtain results causing significant diagnosis delays; molecular assays are not commercially available. Methods: we aimed to apply quantitative real-time PCR (qPCR) targeting three protein-coding genes of Histoplasma capsulatum (100-kDa, H and M antigens) for detection of H. capsulatum infection in formalin-fixed paraffin-embedded (FFPE) and whole blood (WB) samples from patients with proven histoplasmosis. Results: For FFPE samples, the sensitivity of 100-kDa, H and M qPCR assays were 93.9%, 91% and 57%, respectively; however, the same qPCR assays showed only 23%, 19% and 11.5% of sensitivity for 100-kDa, H y M qPCR assays when used with the WB samples. The specificity of qPCR was determined by testing samples from patients with other clinical infections and healthy controls and was 93%-100% depending upon the assay and the specimen type. Conclusion: we applied three qPCR assays for detecting H. capsulatum DNA in human samples, and demonstrated that the molecular protocols based on amplification of 100-kDa and H antigen can be successfully used for diagnosing this mycosis when using FFPE samples; however, we do not recommend WB for routine diagnosis of histoplasmosis by qPCR in patients with progressive disseminated histoplasmosis.

PP4.158 Metagenomic analysis of environmental samples from mycetoma endemic area in Sudan A. Ahmed1 , S.M. Bakhiet2 , N. Mahmood3 , L.Y. Mohamed3 , E.E. Siddig3 , A.M. Musa3 , E.B. Khidir4 , A.H. Fahal3 1 Umm Al-Qura University, MAKKAH, Saudi Arabia 2 University of Khartoum, Institute of Endemic Diseases, KHARTOUM, Sudan 3 University of Khartoum, Mycetoma Research Center, KHARTOUM, Sudan 4 Umm Al-Qura University, College of Applied Medical Sciences, MAKKAH, Saudi Arabia Objective: To identify and characterize the different Madurella species communities from soils, thorns, water and other environmental samples collected from Sennar State, Sudan using ITS rRNA genes sequencing. Methods: This cross-sectional study was conducted at Eastern Sennar Governate, Sudan in 2016. A total of 105 environmental specimens were collected form mycetoma endemic villages. Environmental samples were including soil, thorns, animal dung and others. DNA was extracted from all environmental samples and pooled into 18 pools according to the similarity of ecological niches. The Internal Transcribed Spacer 2 of the ribosomal DNA were enriched by PCR for sequencing using the Illumina metagenomics library preparation protocol. The libraries were sequenced using Illumina MiSeq using version 3 kits with 600 cycles. The sequence reads were checked for quality using FastQC and directly mapped to a database containing reference ITS2 sequences of Madurella mycetomatis, Madurella pseudomycetomatis, Madurella tropicana and Madurella fahalii. Additionally, the sequence reads from different samples’ pools were denovo assembled using SeqMan NGen (DNASTAR Lasergene, Madison, USA) and the assembled contigs were used for BLAST search in Unite Database. Results: Madurella mycetomatis was found in 6 environmental samples’ pools. In these 6 positive samples, Madurella pseudomycetomatis or/and Madurella tropicana were also detected. Madurella fahalii was found in only one pool co-existing with all other Madurella species. Madurella mycetomatis and Madurella fahalii were co-detected in two different contigs in the assembled reads from only one samples’ pool. Conclusion: Madurella mycetomatis was found to be more common than other Madurella species in this highly endemic area. The use of direct mapping of raw sequence reads is more sensitive in the detection of Madurella species in metagenomics environmental specimens.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

PP4.186 Primary cutaneous Fusarium solani infection in a hemodialysis patient D. Shi1 , G Ge2 , Z Yang1 , H Mei3 , G Lv3 , W Liu3 1 Jining NO. people’s hospital, JINING, China 2 Jining Medical university, JINING, China 3 Institute of Dermatology, Chinese Academy of Medical Sciences & Peking Union Med, NANJING, China Objective: Fusarium solani, a hyphomyocetous fungus, is often isolated from the environment as a laboratory contaminant, but it is also known as a pathogen causing keratomycosis, onychomycosis, and opportunistic infection of the skin and viscera. Methods: Herein, we describe a case of cutaneous Fusarium solani infection in a patient with chronic kidney failure (uremia), who has a prior history of hemodialysis twice weekly. Results: A 47-year-old Chinese female was admitted to our hospital on 24 November, 2017 (day 0 being the day of hospital admission) for treatment of sustained lesion on her right forearm. About five months ago (at day- 5 months), the patient has a red papule with 0.5 cm in diameter on her forearm with gentle itching. The lesion gradually becomes larger during the last five months without any treatment. The patient has a history of chronic kidney failure for more than 2 years and has been treated with hemodialysis twice per week. She was given right forearm graft fistula for hemodialysis. At day 0, the patient was admitted to our hospital with a localized cutaneous erythematous on the right forearm. The erythematous lesion was 20 cm in diameter with clear edge, which was covered with necrosis and black crust. Direct microscopic examination of the necrotic area showed numerous fungal elements. Culture on Sabouraud dextrose agar with cycloheximide yielded a floccose, grayish white colony. Microscopically, crescent-shaped macroconidia and oval microconidia were abundant (Figure 2C and D). The fungus was identified using gene analysis as Fusarium solani. At day 0, the patient was initially given oral itraconazole 200 mg per day combined with topical ketoconazole and terbinafine cream twice daily. The lesion was improved after one-month treatment. At day + 28, fungal susceptibilities for each testing antifungals are as follows: http://dict.cn/itraconazole minimum inhibitory concentration (MIC) is 16 μg/mL; terbinafine MIC, >0.5 μg/mL; voriconazole MIC, 16 μg/mL; http://dict.cn/Fluconazole, >64 μg/mL; 5-fluorocytosine, >64 μg/mL and fulvicin >64 μg/mL. According to these MIC data, the patient was treated with terbinafine 0.25 once daily instead of itraconazole in combination of ketoconazole cream topically twice per day. At day + 8 weeks, although direct microscopic examination of the scale on the lesion showed that the hypha was thinner than of the first-time examination, there were still full of numerous fungal elements under microscope. Today, the patient is still under our fellow up schedule. Conclusion: We present a first case of cutaneous Fusarium solani infection in a patient with chronic kidney failure. In this case the fungal infection may due to minor trauma by repeated puncture in immunocompromised host. It is believed that the treatment in the early stage of infection prevented further extension of the lesion. The long duration of treatment is needed because of the fungus resistance to most antifungal agents. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 421824 30f4d16f-189f-46f6-ae79-011e 22dec69b.jpg Caption 1: Figure 1 Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 421824 30f4d16f-189f-46f6-ae79-011e 22dec69b.jpg Caption 2: Figure 2

S64

Medical Mycology, 2018, Vol. 56, No. S2

PP4.187 Biological activity of lipids extracted from two isolates of Fusarium oxysporum (environmental and clinical) in Galleria mellonella

PP4.189 Epidemiology and in vitro susceptibility of Fusarium species from human infections in Germany - results of a retrospective multicenter study

J. A. Sepulveda-Rivera, P. Araque-Marin, C.A. Pelaez-Jaramillo, M.D.P Jimenez-Alzate Universidad de Antioquia, MEDELLIN, Colombia

2 ¨ A. G. Hamprecht1 , S. Gottig , A. Haas3 , J. Held4 , M.B. Koeppel3 , O. Kurzai5 , A. Saleh1 , M. Seibold6 , J. Steinmann7 , K. Tintelnot6 , G. Walther8 , M. Weig9 , V. Rickerts6 1 University of Cologne, COLOGNE, Germany 2 University Hospital Frankfurt, FRANKFURT, Germany 3 LMU Munich, MUNICH, Germany 4 ¨ Universitatsklinikum Erlangen, ERLANGEN, Germany 5 ¨ University of Wurzburg, JENA, Germany 6 Robert Koch Institute, BERLIN, Germany 7 Paracelsus Medical University, NUREMBERG, Germany 8 ¨ Invasive Pilzinfektionen NRZMyk, JENA, Germany Nationales Referenzzentrum fur 9 ¨ ¨ University Medical Center Gottingen, GOTTINGEN, Germany

Objective: To evaluate the virulence of conidia, the chemical composition and the biological activity of lipids extracted from two Fusarium oxysporum (F. oxysporum) isolates: environmental and clinical in the Galleria mellonella (G. mellonella) model. Methods: Fungi: Fusarium oxysporum environmental isolate was obtained from decomposing plant material with code 15H07 for the Grupo Interdisciplinario de Estudios Molecualres (GIEM), Natural and Exact Sciences Faculty, Universidad de Antioquia. Fusarium oxysporum clinical isolate was obtained from a patient with onychomycosis with code 09155 for the Grupo Micolog´ıa M´edica, School of Medicine, Universidad de Antioquia. Lipids: The lipids extracted were obtained by the soxhlet method with three solvents of low, intermedium and high polarity (hexane, dichloromethane and methanol). The lipids were characterized for high performance liquid chromatography mass spectrometry (HPLC-MS) and mono and bidimensional thin layer chromatography (TLC). Galleria mellonella model: G. mellonella caterpillar in the final larval instar stage were injected into the hemocoel via the last proleg with 104 , 105 , 106 and 107 conidia/mL from both F. oxysporum isolates using Tween 80 as surfactant. To evaluate the biological activity: 1) the lipids extracted were injected at 102 , 103 and 104 μg/mL using Tween 20 for their emulsification and 2) co-stimulus with conidia and lipids were injected to the G. mellonella caterpillars. Results: The confirmation that both isolates of Fusarium spp corresponded to Fusarium oxysporum was done by the ITS1, ITS4 and calmodulin gene sequencing by the Centro Nacional de Secuenciacion, ´ Sede Investigaciones Universitarias, Universidad de Antioquia. The average mortality of caterpillar at 48 hours post-injection with 104 , 105 , 106 and 107 conidia/mL of the environmental isolate was 30%, 53.3%, 93.3% and 100%, respectively. The average mortality of the caterpillar at 48 hours post-injection with 104 , 105 , 106 and 107 conidia/mL of the clinical isolate was 6.7%, 16.7%, 23.3% and 76.7%, respectively and also with the infection with this isolate was observed external cuticle growth on the dead larvae. The evaluation of the biological activity of the lipids extracted with methanol from the environmental isolate showed early melanization since first hour of injection and lasted until 48 hours. The average mortality of the caterpillar injected with 102 , 103 and 104 μg/mL of methanolic lipid extracted from the environmental isolate was 0%, 30% and 96.7%, respectively. The chemical characterization of the methanol extracted lipids from the environmental isolate with chromatographic techniques showed the presence of higher amount of compounds on this isolate compared with the clinical isolate. The caterpillar mortality with the co-stimulus of conidia and methanol lipid extracted from the environmental isolate was approximately 100% compared with individual treatments. Conclusion: There are significant differences on the conidia virulence, chemical composition and biological activity of the lipid extracted from the environmental and clinical F. oxysporum isolates evaluated.

PP4.188 Diversity of clinically relevant Fusarium species complexes: preliminary analysis of from an 11-yr prospective surveillance in France D. GARCIA-HERMOSO1 , K. BOUKRIS-SITBON1 , C. GAUTIER1 , F. LANTERNIER1 , O. LORTHOLARY1 , S. BRETAGNE1 , F. DROMER1 ,. French Mycoses Study Group2 1 Institut Pasteur, PARIS, France Objective: Human infections by Fusarium spp. have varied clinical presentations depending on the immune status of the host. Within this genus, at least six species complexes have been implicated in human and animal infections. However, little is known about the association between clinical manifestations and the presence of Fusarium species. We took advantage of the surveillance systems (semi-passive (RESOMYC) and active (RESSIF) reporting) implemented by the National Reference Center for Invasive Mycoses (NRCMA), to analyze these associations based on the characterization of 347 strains of Fusarium spp. using a polyphasic approach. Methods: Cases were collected over an 11-year surveillance period (2005-2016) and classified as ocular (OF) or deep IFI (DIFI), and probable or proven IFI. The phylogenetic analysis of the strains was based on DNA sequence data for the elongation factor 1-α (TEF-1α) and the RNA polymerase II subunit (RPB2) regions. Antifungal susceptibility testing was performed according to EUCAST recommendations. Results: The 382 cases corresponded to 216 (57%) OF and 166 (43%) DIFI. Major differences between OF and DIFI concerned the proportion of male patients, the underlying immunosuppression (60% and 78% in IF, respectively), and the association to local injury (97% in OF). Among the 216 OF cases, keratitis and corneal ulcer were the main clinical forms and the wear of contact lenses was reported in 146 (68%) cases. DIFI presented predominantly as fungemia (71/166, 43%) and associated with hematological malignancies but also to solid tumors and SOTs. Localized cutaneous DIFI (49/166, 29.5%) were seen in 33 patients after local injuries or severe burns. For the 347 strains characterized at the NRCMA (202 OFs, 145 DIFIs), the most common species complexes (SC) were F. solani SC (n = 133) F. oxysporum SC (n = 91) F. fujikuroi SC (n = 100) F. dimerum SC (n = 19) and F. incarnatumequiseti SC (n = 4). MICs profiles for the four complexes were similar for azoles, candins and amphotericin B except for the F. dimerum SC. Most of the 100 F. fujikuroi SC were identified in DIFI (lung (n = 28) and blood (n = 34) localizations). On the other hand, most of the 91 F. oxysporum SC (n = 76, 83.5%) were recovered from OFs. Furthermore, among the contact lens wearers with OF, F. oxysporum SC was present in 44% (64/146) while F. solani SC was more frequent in those with no report of contact lenses 56% (31/55). Conclusion: Our study shows the association between clinical manifestations and Fusarium complexes in a large cohort of patients. Members of the F. fujikuroi SC were significantly associated with immunocompromised patients and disseminated fusariosis, underlining the importance for accurate identification of this fungal group for epidemiological purposes. Further studies are needed to investigate the reasons for these apparent “tropisms”.

Objective: Fusarium species can cause severe infections in both immuno-compromised and immune-competent hosts, ranging from superficial, locally invasive to disseminated infections. Disseminated infections occur mainly in hemato-oncology patients and have an exceedingly high mortality of >90%, partly because of the high resistance rate of Fusarium species against antifungals. Data on the epidemiology of fusariosis in Germany are limited. Given the difficult species identification and the low number of clinical studies which provide identification using reliable molecular identification, the true epidemiology of fusariosis is only incompletely understood. Therefore, this study investigates the epidemiology of Fusarium infections by application of molecular identification of isolates and in vitro susceptibility testing using reference methods. Methods: Sixty non-copy patient isolates from seven medical centers in Germany were included in the study. All strains were isolated from invasive infections. Species identification was carried out using morphological, mass spectrometry and molecular methods (sequencing of EF1 alpha and RPB2 and comparison to the CBS Fusarium database and an in-house database). Susceptibility testing was done using the EUCAST microdilution reference method. Results: Fusarium fujikuroi species complex was the most frequent species complex (N = 27) with F. proliferatum as the most frequent species (N = 16), followed by FSSC (N = 20) with F. petroliphilum as the most common species (N = 9), F. oxysporum complex (N = 11) and F. dimerum (N = 2). Interestingly, in blood cultures the newly described F. musae was the most frequent species (8/20; 40%), in contrast to FSSC which was the most common species complex in skin/soft tissue infections (9/15; 60%). Resistance to common antifungals was frequent. MIC50 were 2.0 mg/L for amphotericin B, 1.5 mg/L for voriconazole, >16 mg/L for itraconazole, 4 mg/L for posaconazole and >8 mg/L for echinocandins. Among FSSC isolates, higher MICs were observed for voriconazole (MIC50 8 mg/L) compared to other species complexes. Conclusion: Fusarium infections in Germany seem to be caused by a limited number of species, with F. fujikuroi species complex and F. solani species complex being the most frequent ones. Molecular typing may be useful to understand the spread of F. musae. Resistance to most antifungals was common in isolates of German origin, with amphotericin and voriconazole retaining the best in vitro activity.

PP4.190 Type 17 immunity controls Malassezia skin infection F. Sparber1 , C. De Gregorio2 , S. Mertens1 , M. Glatz3 , F. Sallusto2 , S. LeibundGut-Landmann1 1 University of Zurich, ZURICH, Switzerland 2 Institute for Research in Biomedicine, BELLINZONA, Switzerland 3 ¨ Universitatsspital Zurich, ZURICH, Switzerland Objective: The fungal microbiota of the mammalian skin is dominated by commensal fungi of the genus Malassezia. Accumulating evidence suggests that Malassezia is involved in the development and/or exacerbation of diverse skin disorders including pityriasis versicolor, dandruff, seborrhoeic eczema and atopic dermatitis. However, the causal relationship between Malassezia and the majority of these diseases remains unclear. A prerequisite for understanding the impact of Malassezia on skin pathologies is to increase the knowledge about the complex interplay between this fungus and the skin immune system. Here, we developed a novel model of Malassezia skin infection in mice to study the mammalian immune response to Malassezia and decipher the cellular and molecular mechanisms underlying fungal control in the skin in vivo. Methods: Experimental infection of mice was induced by epicutaneous application of Malassezia spp. onto unperturbed or tape-stripped ear skin. Fungal colonization was assessed by enumeration of colony-forming units in the infected skin tissue. The local immune response was determined by analyzing skin pathology, tissue cytokine induction and immune cell infiltration. The T cell response against Malassezia spp. was assessed by flow cytometry following antigen-specific re-stimulation of skin-draining lymph node cells. Human memory T cells were also analyzed for their Malassezia-responsiveness. Results: Topical application of several different Malassezia species onto the ear skin of wild type mice resulted in a high level of fungal colonization and a robust host response to the fungus, characterized by skin thickening and infiltration of inflammatory leukocytes. Skin inflammation was further augmented by tape-stripping of the ears prior to infection, indicating that Malassezia has the potential to promote skin inflammation under atopic skin conditions such as barrier deficiency. Infected animals showed activation of type 17 immunity, as evidenced by local IL-17 cytokine production in the infected tissue and by increased frequencies of Th17 cells in the draining lymph nodes. Consistently, we found that Malassezia-specific memory T cells in healthy human individuals that respond to several different Malassezia spp. belong predominantly to the Th17 subset. Underlining the relevance of IL-17 in maintaining fungal colonization, IL-17-deficient mice are unable to prevent Malassezia overgrowth in the ear skin. Conclusion: Together, our results demonstrate a critical and so far unrecognized role of type 17 immunity in keeping the balance between the skin commensal Malassezia and the mammalian immune system. This is reminiscent of what is known about the IL-17 pathway in the control of other fungal commensals such as Candida spp. and highlights the relevance of IL-17 in host protection at barrier tissues.

PP4.191 A rapid molecular assay for direct quantification of Malassezia pachydermatis in otic swabs ˜ 1, 2 G. Castella´ 1 , L. Puig1 , F.J. Cabanes 1 ` Universitat Autonoma de Barcelona, BELLATERRA, Spain Objective: The objectives of the present work were to develop a real time PCR assay (qPCR) based on SYBR Green for detection and quantification of M. pachydermatis yeasts and validate the assay with swabs obtained from the external ear canal of healthy dogs and dogs with otitis. Methods: The qPCR was developed following the defined criteria of the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines. A primer pair specific for M. pachydermatis was designed by comparison of βtubulin gene sequences of Malassezia species. Fifteen M. pachydermatis strains were tested in order to ensure amplification of all genotypes. Also, strains from different Malassezia species were tested to assess the specificity of the qPCR. To validate the assay, swabs from the external ear canal of healthy dogs and dogs with otitis were analysed by qPCR. The presence and amount of M. pachydermatis yeasts of external ear canal swabs were also assessed by plate counting and cytological examination. Results: The primers developed amplified a 61 bp amplicon with no similarity to the dog genome. A BLAST search showed no significant similarity to other commensal and pathogenic bacteria or fungi that can be found on the ear canal of dog. The primers consistently amplified the DNA from all tested M. pachydermatis strains. Melting curve analyses yielded a single peak in all M. pachydermatis strains at 79.3-80.4◦ C of melting temperature depending on the genotype. The standard curve yielded r2 values superior to 0.990 in all runs, and slope values of approximately -3.40. The limit of quantification was established in 0.18 ng/reaction, equivalent to 1.8·104 genome equivalents (gEq). Swabs from dogs without otitis yielded no growth of M. pachydermatis or plate counts ranging from 1 to 8 CFU/plate and negative cytological examination in most of the samples. In swabs from dogs with otitis, 1–5 M. pachydermatis cells/field were observed in the cytological examination while ≥10 CFU/plate were obtained in culture. Swabs from healthy dogs yielded quantification values of ≤2.0·104 gEq in the qPCR while quantification values of ≥2.2·105 gEq were obtained in swabs from dogs with otitis. Conclusion: We developed for the first time a qPCR assay that provides accurate quantification of M. pachydermatis yeasts from swab samples from dogs. With the described method, in a few hours it is possible to achieve accurate quantification of M. pachydermatis. The application of the developed method on clinical cases could improve the diagnosis of otitis by M. pachydermatis on dogs, and consequently lead to a more accurate treatment that would enhance the prognosis of the affected animals.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

ABSTRACT

PP4.192 ‘PepBiotics’, novel antimicrobial peptides to fight fungal infections caused by Aspergillus fumigatus and Malassezia furfur H. De Cock1 , I.D. Valdes1 , M. Rosa1 , M. Morren1 , S. Boerefijn2 , B. Kraak2 , J Dijksterhuis2 , H.P. Haagsman1 , M. Van Eijk1 1 Utrecht University, UTRECHT, Netherlands 2 Westerdijk Institute, UTRECHT, Netherlands Objective: We explore the potential of a novel therapeutic approach using antimicrobial peptides (AMPs) to fight fungal infections. AMPs (15-50 amino acids) are important effector molecules of the innate immune system of vertebrates and invertebrates with a broad spectrum activity against viruses, bacteria and fungi. Here we investigated whether new cathelicidin-inspired AMPs (termed ‘PepBiotics’, patent pending) can be used to fight two clinically relevant fungal species. Aspergillus fumigatus can cause life-threatening invasive pulmonary infections in immunocompromised patients, amongst others in patients suffering from cystic fibrosis. Malassezia yeasts have been associated with superficial skin infections like dandruff, pityriasis versicolor and seborrheic dermatitis, an important and common abnormal skin condition affecting about 1–3% of the population. All Malassezia spp are characterized by lipid-dependency due to the lack of cytosolic fatty acid synthase and require lipids from the host for growth. Development of azole resistance in these fungal species is increasing worldwide and requires the development of new antifungals. We aim to develop ‘PepBiotics’ as a novel antifungal therapy to treat superficial skin infections caused by Malassezia species and to prevent or reduce fungal lung infections caused by (azole-resistant strains of) A. fumigatus. Methods: AMPs used are the natural cathelicidins L-CATH-2 (chicken) and LL-37 (human) and cathelicidin-inspired novel AMPs termed ‘PepBiotics’. A metabolic assay using 106 CFU/mL A. fumigatus spores in minimal medium with 2% glucose and resazurin conversion (OD570 nm) was used to determine the antifungal activity of AMPs against A. fumigatus wild type Af293, CEA10 and its derivatives lacking either RodA, RodB or DHN-melanine. In addition, clinical isolates of A. fumigatus from cystic fibrosis patients as well as azole-resistant isolates were tested for AMP sensitivity. Strains were typed using PCR sequencing of Internal Transcribed Spacer (ITS), benA encoding β-tubulin and the calmodulin gene (CaM). Inhibition of growth by AMPs of Malassezia furfur isolates (DTO 383-D8 and DTO 383-D9) in minimal medium with tween 60 and olive oil as lipids was determined by plating and counting CFU/mL. Propidium Iodide staining was performed to determine AMP-mediating killing of A. fumigatus at different stages of germination. Results: Clinical isolates as well as azole-resistant isolates of A. fumigatus were shown to be highly sensitive for a subset of ‘PepBiotics’(≤1 μM) with stronger activity as compared to L-CATH-2 and LL-37. A. fumigatus mutants lacking spore surface components DHN-melanine or either one of the rodlets proteins did not show increased sensitivity for the tested peptides, instead, they had a slightly reduced sensitivity for the peptides tested. PI staining suggests that killing of A. fumigatus occurs at the late stage of germination. ‘PepBiotics’ were also shown to be strongly fungicidal (≤1 μM) for two isolates of Malassezia furfur in minimal medium. Conclusion: 1. ‘PepBiotics’ were shown to be fungicidal and inhibited growth of Malassezia furfur as well as clinical isolates of A. fumigatus, including azole-resistant isolates. 2. Absence of A. fumigatus spore surface components does not increase AMP sensitivity 3. AMPs are fungicidal for A. fumigatus and killing occurs at later stages of germination

Poster Pitch session 5 Tuesday 3 July 12:15 hrs – 13:15 hrs. PP5.033 Aspergillus fumigatus uniquely harbors three 1-Cys peroxiredoxins that impact in hydroperoxide detoxification and virulence I. Malavazi1 , M.C. Rocha2 , K.F. Godoy2 , R. Bannitz-Fernandes3 , J.H.T.M. Fabri2 , M.M.F. Barbosa2 , P.A.C. Castro4 , F. Almeida5 , G.H. Goldman6 , A.F. Cunha2 , L.E.S. Netto3 , M.A Oliveira7 1 ˜ CARLOS, Brazil ˜ Carlos, SAO Universidade Federal Sao 2 ˜ CARLOS, Brazil ˜ Carlos, SAO Universidade Federal de Sao 3 ˜ PAULO, Brazil ˆ ˜ Paulo, SAO Instituto de Biociencias, Universidade de Sao 4 ˜ PRETO, Brazil ˆ ˆ ˜ Preto -Universidade de Sao ˜ Paulo, RIBEIRAO Faculdade de Ciencias Farmaceuticas de Ribeirao 5 ˜ PRETO, Brazil ˜ Preto, Universidade de Sao ˜ Paulo, RIBEIRAO Faculdade de Medicina de Ribeirao 6 ˜ PRETO, Brazil ˆ ˆ ˜ Preto, Universidade de Sao ˜ Paulo, RIBEIRAO Faculdade de Ciencias Farmaceuticas de Ribeirao 7 ˜ VICENTE, Brazil ˆ Instituto de Biociencias, Universidade Estadual Paulista, SAO Objective: Aspergillus fumigatus is a filamentous fungus with a notorious ability to infect immunocompromised individuals and cause severe systemic infections in this cohort of patients. Standing among the front defense strategies against pathogens, host phagocytic cells release various oxidants. In most cell types, peroxiredoxin (Prx) enzymes are abundant and highly reactive and specific towards oxidants, such as H2 O2 , lipid hydroperoxides and peroxynitrite. Here, we describe the characterization of three 1-Cys Prxs (Prx6 sub-class) in a fungal organism, which to our knowledge is unprecedented. Methods: Recombinant Prx1 and PrxC were expressed in E.coli and the peroxidase activity was measured by competitive kinetics with HRP. Deletion of Prx was obtained by standard genetics methods and subjected to phenotypic analysis. Sub-cellular localization of each Prx was achieved by the use of Prx::GFP fusions. Prx expression was evaluated at both protein and mRNA levels. Virulence of the Prx deletion mutants was determined by using a neutropenic inhalation mouse infection model. Phagocytosis and killing percentages were obtained by using bone marrow derived macrophages (BMDM). Results: Based on sequence homology and structural information, we observed that Prx1, PrxB and PrxC hold the conserved PVCP TTE motif of the 1-Cys Prxs (Prx6 subfamily), as well as a conserved Arg residue, essential to the peroxidatic activity. Recombinant Prx1 and PrxC decomposed H2 O2 at extraordinary elevated velocities, attaining rate constants in the 107 M−1 s−1 range. We identified the exact sub-cellular localization of the three 1-Cys Prxs from A. fumigatus, two Prxs are exclusively resident in the mitochondria (PrxB and PrxC) while Prx1 is cytosolic. Deletion mutants for each one of the three 1-Cys Prxs displayed higher sensitivity to oxidative damage induced by paraquat and menadione. We observed decreased levels of alternative oxidase (AoxA), both at mRNA and protein levels in the prx1 mutant. Although we cannot discern whether this scenario is a direct or an indirect effect linked to Prx1 loss-of-function, the concomitant depletion of Prx1 and AoxA lead to the more pronounced cell susceptibility to oxidants. In addition, we found that cytosolic Prx1 was important for A. fumigatus survival upon electron transport inhibition. Only cytosolic Prx1 played a major role in pathogenicity, since it is required for full virulence. Both the phagocytosis index and the killing levels were significantly increased in prx1 strain. Finally, expression of Prxs was dependent on the SakAHOG1 MAP kinase of the High Osmolarity Glycerol (HOG) pathway and the Yap1YAP1 transcription factor, a global regulator of the oxidative stress response in fungi. Conclusion: Taken together, our studies have uncovered that in A. fumigatus, 1-Cys Prxs represent a central group of proteins acting to tolerate oxidative stress. Our data also indicate that Prx1 is the major 1-Cys Prx involved in virulence and impacts the mitochondrial environment and local redox balance via AoxA. Importantly, since A. fumigatus uniquely harbors three isoforms of 1-Cys Prxs, these proteins are promising targets for antifungal therapy because this subfamily is underrepresented in the human host.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

S65

PP5.034 Composting as a resource for environmental azole resistance mutation in Aspergillus fumigatus B. Mousavi1 , H Badali2 , A Vaezi2 , S Khodavaisy3 , F Hagen4 , M Laal Kargar5 , Z Salehi5 , J.F Meis6 1 Paris est creteil University, PARIS, France Mazandaran University of Medical Sciences, SARI, Iran 3 Tehran University of Medical Sciences, TEHRAN, Iran 4 Westerdijk Fungal Biodiversity Institute, Utrecht University, UTRECHT, Netherlands 5 Tarbiat Modares University, TEHRAN, Iran 6 Canisius Wilhelmina Hospital (CWZ),Centre of Expertise in Mycology Radboud umc/C, NIJMEGEN, Netherlands 2

Objective: Although azoles are the mainstay of therapy in the management of invasive aspergillosis, emerging azole resistance has serious implications of patient management. Compost (decaying plant waste material) containing azole residues might be important for resistance development of Aspergillus fumigatus. The aim of the present study was to assess the prevalence of resistance to triazoles in A. fumigatus isolates in commercially available composts in Iran. Methods: Compost samples were purchased from floristries in Iran. A total of 200 azole fungicide treated compost samples were analyzed. Two grams of each sample were homogenized in sterile saline containing 0.05% Tween 80. Suspensions were inoculated on sabouraud dextrose agar (SDA) supplemented with chloramphenicol and gentamicin. The plates were incubated at 48◦ C and checked daily for fungal growth. Antifungal susceptibility testing based upon the CLSI Standard broth microdilution method for filamentous fungi (M38-A2) was performed for all A. fumigatus isolates. A real-time PCR assay for detection of tandem repeats (TR) in promoter region and mutations in cyp51A gene conferring resistance to triazoles in A. fumigatus was utilised. Results: Aspergillus fumigatus grew from 42 of 200 compost samples analysed. Azole-resistant isolates were detected in 6.5% (13/200) of the compost samples and in 31% (13/42) of the compost samples containing A. fumigatus. High minimal inhibitory concentrations (MIC) of itraconazole (≥16 mg/L) and voriconazole (≥8 mg/L) were displayed. Only four of thirteen itraconazole (ITZ) and voriconazole (VRZ) resistant isolates harboured the TR34 /L98H genotype. No mutation was detected in Cyp51A of other isolates with high MICs to ITZ and VRZ. Conclusion: Our study shows that compost utilized in flower beds contains azole-resistant A. fumigatus phenotypes TR variants confer different azole resistance phenotypes. Therefore it is emphasised that resistance surveillance studies focusing on environmental samples are warranted to monitor the emergence and prevalence of azole resistance in A. fumigatus in Iran. The role of exposure of immunocompromised patients to resistant A.fumigatus present in composting organic matter should be further analyzed.

PP5.035 AfumID: An R Shiny application for Aspergillus fumigatus genotyping T. R. Sewell1 , J.L. Rhodes1 , F. Hagen2 , J.F. Meis3 , M.C. Fisher1 1 Imperial College London, LONDON, United Kingdom Westerdijk Institute, UTRECHT, Netherlands 3 Canisius Wilhelmina Hospital, NIJMEGEN, Netherlands 2

Objective: To amalgamate a collection of population genetics tools into a user-friendly R-Shiny application that can quickly characterise an Aspergillus fumigatus isolate using its small tandem repeat (STRAf) profile. Methods: The R-Shiny application (‘AfumID’) is built upon the genetic diversity of ∼4000 STRAf-typed isolates; this typing method genotypes short tandem repeats at nine loci, which are subsequently collated into a database held at Canisius Wilhelmina Hospital in Nijmegen. Population structure of 2266 clone-corrected isolates was determined using Bayesian (structure 2.3) and multivariate (snapclust) analysis. A principal component analysis (PCA), with population definitions defined by snapclust, was used to visualise variation between isolates. Genetic distance was calculated using Bruvo’s distance metric and a maximum-likelihood phylogeny was generated. AfumID combines all R-based methods into an interactive workflow, with visualised outputs updating upon entry of a novel STRAf-type. Results: According to structure and snapclust, the 2266 clone-corrected isolates cluster into two genetically defined populations (A and B), with PCA and phylogenetics supporting these observations. Resistance alleles TR34 /L98H and TR46 /Y121F/T289A were mostly confined to one of the two populations (Population A). Following input of a novel genotype, the application re-runs the analysis successfully and pinpoints the position of an undefined isolate on the PCA plot and the phylogeny. Conclusion: Currently, AfumID is limited to identifying which population the input isolate belongs to. Certain assumptions can be made from this population association, such relationship to known drug-resistant or clinically important isolates. Future releases of AfumID will incorporate whole genome sequence functionality, allowing users to input raw FASTQ sequence data to generate a rapid diagnostic on drug resistance, pathogenicity and demographic history.

PP5.036 Environmental origin of clinical triazole resistance in Aspergillus fumigatus: a longitudinal field study SIJMEN Schoustra1 , JIANHUA Zhang1 , LIDIA Lopez-Jimenez1 , EVELINE Snelders1 , FONS Debets1 , PAUL Verweij2 , BAS Zwaan1 1 Wageningen University, WAGENINGEN, Netherlands 2 Radboudumc, NIJMEGEN, Netherlands Objective: Various studies have suggested that prevalent clinical triazole resistance in Aspergillus fumigatus may be caused by selection for resistance in the environment. The rationale for this lies in the large amount of azole fungicides used in the environment that are chemically similar to clinical triazoles. Azole fungicides are used for a wide range of applications, such as preservation of wood, sprays to protect bathrooms, up to crop protection. While these azole fungicides are primarily used to control other fungi, Aspergillus fumigatus gets exposed to these azole fungicides and could in this way acquire clinical resistance. Methods: We explored the potential relevance of this idea by sampling heaps of azole fungicide containing decaying plant material. We sampled at three locations during 16 months at regular intervals. We isolated Aspergillus fumigatus and screened for resistance to two environmental azole fungicides and two clinical triazoles. Results: We found that throughout the year, the heaps of decaying plant material contain azole fungicides up to a concentration of 20% of clinical level. We isolated over 150 A. fumigatus isolates, roughly half of which are resistant to clinical triazoles. By PCR, we typed the resistance strains for their resistance mechanism of a tandem repeat in the cyp51 promotor region as well as point mutations in the coding region of that gene. We found TR34 as well as TR46 variants in the promotor regions combined with the typical point mutations in the coding region. Our results suggest that exposure in the environment to azole fungicides can lead to resistance to clinical triazoles with similar resistance mechanisms as found in resistant clinical isolates. Conclusion: Our next steps are to assess the extent to which environmental isolates disperse and the likelihood they may reach patients as well as a more in depth analysis of the extent to which the genotypes match of strains found in the environment as well as in clinics. In all, our results suggest that the environmental route of clinical resistance development is plausible. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 425040 f706f2f9-9811-4ee2-8947-2a 01d0fbb01b.jpg Caption 1: Environmental origin to clinical resistance in A fumigatus

S66

Medical Mycology, 2018, Vol. 56, No. S2

PP5.037 Azole resistance of Aspergillus fumigatus in plant-decaying compost model

PP5.045 Chronic pulmonary aspergillosis in active pulmonary tuberculosis patients in Jakarta, Indonesia

JIANHUA ZHANG1 , LIDIA Lopez Jimenez2 , EVELINE Snelders2 , FONS Debets2 , PAUL Verweij3 , BAS Zwaan4 , SIJMEN Schoustra1 1 Wageningen University, WAGENINGEN, Netherlands 2 Wageningen university, WAGENINGEN, Netherlands 3 Radboud University Medical Center, NIJMEGEN, Netherlands 4 WAGENINGEN UNIVERSITY, WAGENINGEN, Netherlands

FINDRA Setianingrum1 , ANNA Rozaliyani2 , R. Adawiyah3 , RIDHAWATI Syam2 , MULYATI Tugiran2 , CUT YULIA Indah Sari4 , FINNY Nandipinto5 , JOHANNES Ramnath6 , DIAH Handayani7 , ERLINA Burhan7 , MARTIN C Rumende8 , RETNO Wahyuningsih2 , RIINA R Richardson9 , DAVID W Denning10 1 Faculty of Biology, Medicine and Health, University of Manchester, MANCHESTER, United Kingdom 2 Department of Parasitology, Faculty of Medicine Universitas Indonesia, JAKARTA, Indonesia 3 Faculty of Medicine Universitas Indonesia, JAKARTA, Indonesia 4 Jakarta Islamic Hospital, JAKARTA, Indonesia 5 Pulmonary Mycosis Centre, JAKARTA, Indonesia 6 Christian University of Indonesia Hospital, JAKARTA, Indonesia 7 Department of Pulmonology and Respiratory Medicine, Universitas Indonesia, JAKARTA, Indonesia 8 Department of Internal Medicine, Faculty of Medicine, Universitas Indonesia, JAKARTA, Indonesia 9 Manchester Academic Health Science Centre, University of Manchester, MANCHESTER, United Kingdom 10 National Aspergillosis Centre, Manchester University Hospital, MANCHESTER, United Kingdom

Objective: Azole resistance is a serious problem in the fungus Aspergillus fumigatus, which is involved in the vast majority of invasive infections in humans. Previous work suggests that plant-decaying compost is a hot spot for the emergence of resistance in A. fumigatus. During a longitudinal environmental sampling study of 120 compost samples throughout the year, we documented variations on azole fungicides, CFU counts of A. fumigatus, resistance levels, and the physical growth conditions in compost. We now report on an experimental compost-model based on natural compost and to validate which factors promote the emergence of resistant A. fumigatus in the environment. Methods: We use initially sterile different type of compost material that we treat with combinations of different fungicides and various concentrations as well as with /no light, low O2 /high CO2 , high/ low temperatures and so on into tubes and incubate for a period of four months. We inoculate with sensitive, resistant and combinations of strains of resistant and sensitive. Results: At the end of the experiments we will assay the resistance development in terms of resistance levels and mechanisms under different conditions. Conclusion: We directly link field compost surveys with laboratory studies, and to answer these questions How sensitive and resistant A. fumigatus propagate in compost; What are dynamic changes in A. fumigatus in compost; III. How the resistance and sensitive strains compete in model; How do different fungicides affect the inducing of azole resistance;

PP5.038 Systematic interrogation of Aspergillus fumigatus cyp51A polymorphisms for azole drug resistance CHRISTOPH Sasse1 , ANNA Dudakova2 , ELISA Kolander3 , GERHARD Braus3 , UWE Groβ 2 , OLIVER Bader2 1 Georg-August-University Goettingen, GOETTINGEN, Germany 2 University Medical Center Goettingen, GOETTINGEN, Germany 3 Georg August-University Goettingen, GOETTINGEN, Germany Objective: Azole antifungal drug resistance in Aspergillus fumigatus is an emerging public health problem concerning critically ill patients, such as stem cell transplant recipients, cancer patients or patients under intensive care. We have previously surveyed the presence of known cyp51A polymorphisms in isolates obtained from patients as well as the environment and found both, highly prevalent TR34 /L98H rand TR46 /Y121F/T289A polymorphisms as well as well as rarer substitutions whose functional relevance was unclear (e.g. F219C), despite correlation with drug resistance. Compilation of MIC values from the literature associated with individual substitutions shows heterogeneous distribution between intermediate and resistance categories in several cases, indicating the necessity of molecular studies to further elucidate this. Methods: To assess the relevance of individual polymorphisms known, we chose to express them each in a common genetic background and measure the resulting MIC values according to the EUCAST protocol. A cyp51A deletion mutant and a respective reconstituted strain were created in strain AfS35. The deletion of cyp51A resulted in a 2-4-fold reduction in MIC, which was alleviated in the reconstituted strain, where cyp51A was reintroduced under control of its native promotor. Results: Introduction of different cyp51A alleles known to cause resistance confirmed their phenotypes in our system. Testing of other polymorphisms present in the population ruled out their contribution to resistance. We have developed a system, within which we can test the cyp51A polymorphisms present in the A. fumigatus population for their relevance. Conclusion: Results for selected alleles confirm the resistance or susceptibility profiles observed in clinical or environmental isolates.

Objective: Pulmonary tuberculosis (PTB) is the most common risk factor of chronic pulmonary aspergillosis (CPA). Moreover, these two diseases have the same clinical and radiological manifestations with completely different management approach. Indonesia ranked as the second largest country with tuberculosis burden in the world. There is no single study about CPA in PTB patients in Indonesia. This study aims to estimate the burden of CPA among active PTB patients in Indonesia. Methods: We assessed PTB patients for CPA based on clinical symptoms, chest x-ray (CXR) results and Aspergillus-specific immunoglobulin G (IgG) using Dynamiker immunoassays. During period of 6 months (from February 2017 to July 2017), we studied 56 PTB patients from five hospitals in Jakarta, Indonesia. There are 27 patients in first 8 weeks (early) PTB therapy and 29 in the final 2 months (late) PTB therapy. Sputum specimens were also analysed by the GeneXpert MTB/RIF test to rule out active PTB as diagnosis. This is an interim analysis of a large CPA cohort study ongoing in Indonesia. Results: Out of 56 patients with TB (32 male, age range: 17–78 years), 10 patients (17.9%) met criteria for CPA. There are 5 CPA patients diagnosed from each group (18.5% from the early PTB therapy group and 17.2% from the late PTB therapy group). Cough, haemoptysis, fatigue and shortness of breath become the most common symptoms (each 2/5) in CPA from the early therapy group. Cough (4/5) was the most common presenting symptom in the late PTB therapy group. This compares with the non-CPA PTB patients from the late PTB therapy who described no symptoms (n = 17, 70.8%). The key radiological criterion used to diagnose CPA in this study was the presence of cavities. The CXR appearances consist of cavities (10/10), paracavitary fibrosis (8/10) and pleural thickening (6/10). The mean Aspergillus-specific IgG level in CPA patients from early PTB therapy group is 104.8 AU/ml. This level is lower than the mean Aspergillus-specific IgG level in CPA patients from the late PTB therapy group (523.4 AU/ml). Most of the CPA patients (4/5) from both of the groups showed negative results of both acid-fast bacilli smear (AFB) and/or GeneXpert MTB/RIF. There are two patients with positive AFB smears in early therapy become negative 6 months after TB therapy met criteria of CPA. Conclusion: CPA is commonly misdiagnosed as PTB in Indonesia where TB is an endemic disease. Most of PTB patients show clinical progression after 6 months therapy unless there is other concomitant disease such as CPA. The combination of clinical presentation, CXR and Aspergillus serology tests may be used as diagnostic tool for CPA. In the absence of serology in resourcelimited setting CPA should be considered if the clinical and radiological findings are in line with those of CPA and there is no evidence of active PTB. There is urgent need of research in this field to determine the true incidence and prevalence of CPA among PTB patients in Indonesia. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 419388 f24eee69-40dc-4077-92be-d841c 96df355.jpg Caption 1: Figure 1. Chest X-ray of a CPA patient. Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 419388 f24eee69-40dc-4077-92be-d841c 96df355.png Caption 2: Table 1. Demography of 56 patients.

PP5.073 The Kennedy pathway can increase the virulence of Candida albicans PP5.039 Fungal contamination in horse stables and risk of equine aspergillosis: results of a pilot study in France 1

1

1

1

´ , P. Arne´ , G. Belbis , JL. Cadore´ J. Guillot , Y. De Wittase-Thezy 1 ´ erinaire ´ Ecole nationale vet d’Alfort, MAISONS-ALFORT, France 2 ´ erinaire, ´ VetAgroSup campus vet LYON, France

2

Objective: Equine aspergilloses are rare but potentially life-threatening infections. In horses, Aspergillus fungi usually develop in guttural pouches, which are paired air-filled ventral diverticuli of the Eustachian tubes. An experimental model of guttural pouch aspergillosis was recently described (Greppi et al. 2017) but the pathogenesis of this condition remains largely unknown. The objective of the present study was to estimate the association between the fungal contamination of stables in France and the risk of guttural pouch aspergillosis (GPA) for the horses living in these stables. Methods: We examined 4 stables in Normandy and Ile-de-France regions, France (figure 1). Three out of these stables reported at least one case of GPA in the five last years in. In each stable a limited number of representative horse stalls (from 4 to 6) were selected and the following environmental parameters were collected in July 2015 and February 2016: temperature, relative humidity and intensity of air flows. For the evaluation of fungal contamination, surface samples were collected using cotton swabs and indoor R Bio-impactor). To select the growth of thermophilic air samples (100 L) were collected using an impactor sampler (Air Strategie fungi, Petri dishes filled with Sabouraud dextrose agar were incubated at 37◦ C for 3 days. Fungal colonies were subcultured and identified according to their macroscopic and microscopic appearance. For each positive sample, we estimated the level of fungal contamination by counting the number of colony forming units (cfu). We used the Mann-Whitney test to compare cfu values between the horse stalls. We also used the Wilcoxon signed rank test. A P-value of less than 0.05 was considered statistically significant. Results: Aspergillus spp. (A. fumigatus, A. flavus, A. niger and A. nidulans) and Mucorales were systematically detected in horse stables. The highest levels of fungal contamination occurred in winter just after the litter has been renewed. Interestingly, fungal contamination differed between the stables where a case of GPA had already been reported and the stable where GPA had never been observed. The mean number of A. fumigatus colonies (from surface and air samples) was significantly higher in stalls just after removing of the litter (P = 0.014), and in stalls belonging to a stable where a case of GPA had already been reported (P = 0.008 and P = 0.08 before and after renewing the litter, respectively). Conclusion: The results of the present study should be interpreted with caution because of the lack of power of some statistical tests but they are in accordance with a potential association between the level of fungal contamination in the environment and the risk of aspergillosis in horses. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 416322 fd620bcd-c526-4f43-8aa3-4c18d55e 0301.12.01.png Caption 1: Figure 1. One of the horse stables were the study was performed

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

ROBERT N. Tams1 , CHELSI D. Cassilly1 , SANKET Anaokar2 , YING-LIEN Chen3 , JANA Patton-Vogt2 , ANDREW Wagner1 , JOSEPH Jackson1 , TIMOTHY Sparer1 , TODD B. Reynolds1 1 University of Tennessee, KNOXVILLE, USA 2 Duquesne University, PITTSBURGH, USA 3 National Taiwan University, TAIPEI, Taiwan Objective: The phospholipids phosphatidylserine (PS) and phosphatidylethanolamine (PE) are important lipids of cellular membranes. Mutations that block synthesis of PS (cho1) or PE (psd1 psd2) by the de novo pathway (Fig 1) severely compromise virulence in Candida albicans in a mouse model of systemic candidiasis. Further downstream in the de novo pathway (Fig 1), PE can be methylated to form phosphatidylcholine (PC), and the role of PC synthesis in virulence has not been reported. We hypothesized that PE conversion to PC would be required for virulence. However, we found that mutations that block PE methylation to PC increase virulence. This led to the hypothesis that increased PE may enhance virulence. Methods: To test this hypothesis, we developed a strategy to increase or decrease PE/PC synthesis independently of the de novo pathway using the Kennedy pathway (Fig 1). The Kennedy pathway involves three successive enzymatic steps that synthesize PE or PC from diacylglycerol and exogenous ethanolamine or choline, respectively. By disrupting or overexpressing EPT1, the enzyme for the final step in the Kennedy pathway, we have made strains that have decreased or increased PE/PC synthesis, respectively. EPT1 was disrupted using the SAT1 flipper and was overexpressed via ectopic expression from the ENO1 promoter. Virulence of these mutants were measured in an i.v. mouse model of systemic candidiasis based on fungal burden (cfus/gram kidney) and/or survival curves. PE/PC levels were measured by using radiolabeled precursors in combination with thin-layer chromatograpy and/or scintillation counting. ß(1,3)-glucan unmasking was measured by staining cells with anti-ß(1,3)glucan antibody and immunofluorescent microscopy or flow cytometry. Results: Disruption of EPT1 (ept1/) was confirmed to block PE/PC synthesis by the Kennedy pathway, and this mutant causes reduced fungal burden in infected mice. Conversely, overexpression of EPT1 causes increased PE/PC synthesis and increased virulence in mice. Mice infected with the EPT1 overexpression mutant succumb to infection more rapidly than those infected with the wild type in survival curves. The mechanism by which virulence is enhance by EPT1 is not yet understood, however, overexpression of EPT1 appears to increase ß(1,3)-glucan masking in some conditions. ß(1,3)-glucan is a major carbohydrate polymer of the cell wall that is detected by macrophages and other immune effectors using receptors like the C-type signaling lectin Dectin-1. In wild-type ß(1,3)-glucan is partially masked from immune detection by an outer layer of mannosylated glycoproteins. However, some mutants or cell wall damaging agents cause ß(1,3)-glucan to be unmasked to Dectin-1 detection. Compared to wild-type, the cho1 mutant exhibits greater unmasking of ß(1,3)-glucan. We found that overexpression of EPT1 decreases unmasking of ß(1,3)-glucan in the cho1 background. Conclusion: Regulating of expression of the Kennedy pathway enzyme Ept1 that synthesize PE/PC controls the levels of virulence in mice in a correlative manner. We are currently exploring the mechanism by which PE/PC regulation impacts virulence, but one possible avenue is through impacting ß(1,3)-glucan masking levels. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 424443 e51ab552-0ecc-42e1-9000-cda29c27 b9f6.png Caption 1: Figure 1. Pathways for phosphatidylserine, phosphatidylethanolamine, and phosphatidylcholine biosynthesis.

ABSTRACT

PP5.074 Azole resistance and modulation of macrophage pro-inflammatory response by Candida albicans MAM33 N. Chauhan, M Chauhan, S Selvakumar Rutgers University, NEWARK, USA Objective: Mitochondria are key contributors to fungal pathogenesis. However, the biological role of most Candida albicans mitochondrial proteins is poorly understood. In the current study, we present data on the characterization of, Mam33, a putative mitochondrial protein of C. albicans. Methods: The subcellular localization of Mam33 was confirmed by fluorescence microscopy. Disruption of MAM33 causes reduced resistance to oxidative stress and hypersensitivity to SDS, suggesting cell surface defects in these mutants. To determine the role of Mam33 in interaction with host immune cells, we performed invasion (10 min) and survival (90 min) assays by using the murine J774 macrophage like cells. Results: Our results show that compared to the wildtype, mam33/ null mutant strains were defective for invasion and/or survival. We observed a reduction in the level of expression of proinflammatory molecules, including Ccl2, Cxcl10, IL6, IL12a, IL12b and Tnfa, in J774 cells infected with mam33/ compared to the wildtype. Consistent with the down regulation of proinflammatory markers, expression of IL10, an immune-suppressing cytokine, was upregulated in J774 cells upon infection by mam33/. Transcriptional profiling revealed significant down-regulation of a family of glucose transporters in the mam33/ mutant. In addition, genes involved in the glycolytic and N-acetylglucosamine metabolism pathways were also significantly repressed. However, genes involved in the TCA cycle and ATP synthesis were enriched more than 11-folds in mam33/, relative to the wildtype. Interestingly, the mam33/ strain also displayed increased resistance to fluconazole. This in vitro finding was supported by in vivo data from a mouse model of systemic infection in which higher kidney fungal burden was observed from kidneys of mice infected with mam33/ null mutant compared to WT and the reconstituted strains. Conclusion: Taken together, our study suggests a novel mechanism of azole resistance in vivo during fluconazole treatment and in host-pathogen interactions. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 425253 a5d028e1-d97a-4703-8a623b69463487c7.png Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 425253 a5d028e1-d97a-4703-8a623b69463487c7.png

PP5.075 Understanding the function of Pga15 family in Candida albicans pathobiology E. M Khatrawi, C.A Munro University of Aberdeen, ABERDEEN, United Kingdom Objective: The largest class of mannoproteins covalently attached to the Candida albicans cell wall are glycosylphospatidylinositol modified-proteins (GPI CWPs) and 66% have unknown functions. As a result of their location at the cell surface, they may be involved in sensing the surrounding environment, maintaining a robust cell wall or interactions with the host. There are 115 predicted GPI CWPs and they include 22 protein families. One family, of uncharacterised proteins, the Pga15 family includes 3 members which are Pga15, Pga41 and Pga42. Moreover, they are only found in C. albicans and C. dubliniensis. Earlier unpublished work by the Munro group has implicated this family in signalling pathways which control the morphological switch from yeast to hyphal form. So, the aim of this project is to define the functional importance of the Pga15 protein family. Methods: This study compared mutant strains lacking different members of the Pga15 family with C.albicans control strain. Hyphal growth was induced using 10% fetal calf serum (FCS) or 5Mm N-acetylglucosamine (GlcNAc) on poly-L-lysine slides and incubated statically at 37C◦ for 2 or 4 hours. Hyperpolarised bud formation was induced using 10 mM hydrogen peroxide and the cells incubated for 6 hrs at 37Co with shaking. Fluorescent stains e.g Calcofluor White, Concanavalin-A-Texas Red were used to stain cell wall components of cells grown in different yeast and hyphal induction media (e.g YPD, NGY, 10% FCS and GlcNAc). Transmission electron microscopy (TEM) was also used to examine the ultra-structure of the cell wall. Biofilm formation was assessed in 96-well polystyrene plates after incubation at 37C◦ for 4, 6 and 24 hours using crystal violet staining Results: Mutation of the different family members resulted in hyperfilmentation growth e.g. pga41, pga42 and pga41pga42 had longer hyphae in 10% FCS. Furthermore, pga15 and pga41 had longer hyphae, while pga42 had short hyphae in response to GlcNAc .Regarding neutral pH, pga15 and pga41 forming longer hyphae compared to the control, while pga42 forming short hyphae. Moreover, pga15 had increased induction of hyperpolarised buds in response to hydrogen peroxide compared to the control strain. Cell wall specific stains suggested the mutants had significant differences in chitin and mannan levels which were growth medium dependent. High pressure freezing TEM was used to examine cell wall architecture which revealed that pga15 and pga41pga42 had longer fibrils in the outer layer, while pga41, pga42 had shorter fibrils compared to the control. Biofilm formation of the mutants was also assessed and it was found that pga41pga42 had increased biofilm formation in both RPMI and 10% FCS media compared to the control strain. Conclusion: Pga15 family members may have a role in hyphal, hyperpolarised buds growth formation, also they may play a role in cell wall construction

S67

PP5.077 Addressing the Most Neglected Diseases through an Open Research Model: the Discovery of Fenarimols as Novel Drug Candidates for Eumycetoma. W. Lim, Erasmus MC, ROTTERDAM, Netherlands Objective: Eumycetoma is a chronic infectious disease characterised by a large subcutaneous mass, often caused by the fungus Madurella mycetomatis. A combination of surgery and prolonged medication is needed to treat this infection which only has success rate of 30%. Therefore, there is an urgent need to search for more effective drugs to treat this disease Methods: 800 drug-like compounds from the Pathogen Box and the Stasis Box were screened for in vitro activity against M. mycetomatis hyphae at a concentration of 100μM. IC50s were determined for each of the growth inhibiting compounds and those with an IC5010:1. Those considered representative were processed for routine bacterial culture on Sheep Blood Colistin Nalidixic Agar (BCNA), Chocolate Agar (CHOC) and MacConkey agar. The same samples were processed in parallel for the comparison study: a loopful of the purulent part (small volume) on Sabouraud’s Dextrose Agar (SDA) and Potato Dextrose Agar (PDA), and 1 ml (high volume) on SDA. All culture plates were incubated at 35oC for 5 days for rapidly growing hyaline molds. Patient information collected in the course of clinical reporting of culture, and yield of mold on type of processing was recorded. Frequencies of underlying co-morbids and mold isolation were computed. Results: Out of 41 specimens assessed, 13 were positive and 5 negative for fungal growth by all three methods. Fifteen specimens yielded fungal growth on both small and high volume fungal cultures, but not routine bacterial. An additional 8 yielded fungal growth only on high volume sample inoculation. The age of the patients ranged from 17–81y, 41.4% being females. Clinical history was available on 26 patients: 46% patients were on systemic or inhaled steroids, 42% on antibiotics and 31% had an underlying lung disease. Sixteen (61.5%) patients presented with symptoms of less than 2 weeks duration; all had mold isolated on high volume culture, but only 7 on routine bacterial culture. In patients with symptoms lasting 2 weeks or longer (n = 6), mold was isolated from 4 high-volume fungal but only 2 bacterial cultures. In patients with asthma, both high and low volume fungal cultures had a yield of 88%, while only 33% bacterial media grew mold. The predominant molds isolated were Aspergillus flavus (83%), A. niger (64%), Penicillium spp. (8%), A. fumigatus (5.5%). Conclusion: High volume sputum inoculation had the highest yield of mold compared to small volume fungal culture and routine bacterial culture, with small volume fungal culture still performing better than routine culture. These results support the recommendation of high volume sample inoculation for improved fungal yield in patients suspected of pulmonary fungal infections.

PP5.113 Predictive value of a nasopharyngeal aspirate sample for diagnosis of pulmonary Pneumocystis in infants: A prospective autopsy study. ´ ıas2 , P Borquez2 , K Hananias2 SL Vargas1 , CA Ponce1 , F Magne1 , R. Bustamante1 , M Gallo2 , V San Martin2 , M Gutierrez-Mej´ 1 Biomedical Sciences Institute, University of Chile School of Medicine, SANTIAGO, Chile 2 Medico Legal Service, SANTIAGO, Chile Objective: This work aims to describe the value of a nasopharyngeal aspirate (NPA), as a non-invasive sample, for diagnosing lung primary infection by the fungus Pneumocystis in immunocompetent infants. Most infants develop a lung primary infection before 6 months of age that goes undetected. There is no culture method for microbiologic diagnosis of this infection. Diagnosis relies on Pneumocystis-DNA-amplification of a NPA sample. However, the diagnostic yield of a NPA varies with age reaching a peak of 45% at 2 - 5 months of age in healthy live infants while examination of autopsy lung tissue samples from infants dying in the community with the diagnosis of SIDS give lung-yields over 90% at comparable ages. This yield discrepancy warrants clarification. Studies in immunosuppressed rats document numerical correlation of Pneumocystis organisms obtained from NPA and lung samples but, whether NPA predicts lung infection in immunocompetent infants has not been studied because lung biopsies cannot be obtained from healthy infants. A high positive predictive value (PPV) will validate NPA as a predictor of lung infection in infants. Methods: The protocol was approved by the University of Chile School of Medicine Ethics Committee. Paired nasopharyngeal aspirate samples and lung biopsies were prospectively obtained from presumably immunocompetent infants dying in the community and undergoing a medico-legal autopsy at the Medico-Legal Service (Coroner´s office) of Santiago between 2012 and 2017. Pneumocystis diagnosis was sought in NPA and in lung biopsy samples of 3% of the infant lung weight (average weight of the sample 0.84, median 0.75 and range 0.32 - 1.5 grams) simultaneously obtained from 27 infants of a mean age 3.55 months (median 3.05, range 1.0 to 8.9 months) dying in the community using P. jirovecii-DNA amplification of the mtLSUrRNA by nested-PCR. mtLSUrRNA was reamplified using Platinum Taq DNA polymerase enzyme and the amplification product purified for sequencing using Wizard kit SV gel and PCR clean-up system (Promega). Results: Pneumocystis jirovecii DNA amplification results from upper and lower samples were concordant in 22 (81.5%) infants and were Pneumocystis-positive in 16 (59.3%) and negative in 6 (22.2%). Five infants (18.5%) had discordant NPA/Lung results (4/0 and 0/1 positive NPA). Sensitivity, Specificity, NPV, and PPV for NPA were 80.0%, 85.7%, 60.0% and 94.1%, respectively. The mitochondrial gene was successfully sequenced in paired samples from 3 of the 16 Pneumocystis-positive concordant infants and confirmed same 80, 81, 85, 88, and 248 allelic positions in Pneumocystis isolates from paired samples. Conclusion: NPA is a valid sample for diagnosis of Pneumocystis primary lung infection with an 80% sensitivity and a positive predictive value of 94%. Identical allelic positions in the minor proportion of paired samples whose isolates were successfully sequenced suggest Pneumocystis isolates in paired samples were the same. The high PPV documented allows for comparisons of Pneumocystis incidences obtained from NPA or lung samples in infants with different diagnoses and may support etiopathogenic hypotheses. The diagnostic use of nasopharyngeal aspirate sampling in clinical studies to discern the potential pathogenic implications of this subclinical infection in infants in the general population is warranted.

PP5.114 Comparative analysis of yeast species identification using phenotypic methods and real-time PCR. V. V. Muravieva1 , A.B. Gordeev1 , L.A. Lyubasovskaya1 , J.V. Rodchenko1 , L.V. Ogneva2 , A.E. Donnikov1 , M.Y. Kirillov2 , D.V. Dubodelov1 , D.Y. Trofimov1 , T.V. Priputnevich1 , G.T. Sukhikh1 1 National Medical Research Center for Obstetrics, Gynecology and Perinatology, MOSCOW, Russia 2 Company DNA-Technology LLC, MOSCOW, Russia Objective: At present there is a trend to increase the role of fungi in the development of life-threatening infections. With the dominance of the role of fungi in the development of infectious diseases the role of less common opportunistic yeasts such as Candida non-albicans, Pichia, Rhodotorula, Trichosporon, Saccharomyces, Malassezia increases. Monitoring of species composition of yeasts and their resistance to antimycotics has not lost its relevance. Fast identification and knowledge of species-specific sensitivity to antimycotics determine the tactics of treatment of patients with mycotic infections. Therefore it is important to use methods of fast species identification. The aim of the study was to compare the results of species identification of clinically significant yeast using phenotypic methods and real-time PCR. Methods: A total of 92 isolates of yeast from vaginal discharge of women of reproductive age and from different loci of infants, and 91 samples of biological materials, obtained microbiological confirmation of the presence of yeast were observed. Inoculation on HiCrome Candida agar (Himedia, India), chlamydospore and hyphal tests were used to differentiate Candida albicans (C. albicans) from non-albicans species during phenotypic identification. Species identification of non-albicans species was conducted using VITEK 2 Compact (bioMerieux, France) and matrix-assisted laser desorbtion/ionization time-of-flight mass spectrometer (MALDI TOF MS) Autoflex III (Bruker Daltonics, Germany). Alternative yeast identification was conducted by real-time PCR with species-specific primers. Results: For C. albicans identification among isolates and samples of biological materials the results were the same in 98.7% (77 of 78) and 94.8% (72 of 76) cases respectively. In two samples the identification mistakes were related to Candida dubliniensis (C. dubliniensis) which was inaccurate identified as C. albicans, and it was identified as C. dubliniensis using real-time PCR. The identification using MALDI TOF MS and sequencing of the 26S rDNA gene confirmed that they were C. dubliniensis. Yeasts were not found in 3 of 76 samples by real-time PCR. For identification of non-albicans species (Candida glabrata, Candida tropicalis, Candida kefyr, Saccharomyces cerevisiae, Malassezia furfur) among isolates and samples of biological materials the results were the same in 100.0% (14 of 14) and 93.3% (14 of 15) cases respectively. In one sample of biological materials M. furfur was isolated by cultural analysis, but it was not found using real-time PCR. Total in 4 samples yeasts were not found by real-time PCR, but they were isolated by cultural analysis in low titer (1-3 lg CFU/ml). Conclusion: Thus, the study revealed a high degree of coincidence of results for yeast identification using phenotypic methods and real-time PCR. It is found both for pure yeast cultures and for samples of biological materials reducing the time of obtaining the results of an analysis.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

PP5.116 Molecular diagnostic strategies in cancer patients with suspected respiratory mold infections V Rickerts1 , J Springer2 , J Kessel3 , D Teschner4 , T Liebregts5 , O.A. Cornely6 , S Schwartz7 , B Willinger8 , L Meintker9 , J 2 ¨ Gerkrath10 , D Wilmes10 , J.J. Vehreschild6 , H. Einsele2 , J. Loffler 1 Robert Koch Institut, BERLIN, Germany 2 University Hospital Wuerzburg, WUERZBURG, Germany 3 University Hospital Frankfurt, FRANKFURT, Germany 4 University Medical 11 12 Center of the Johannes Gutenberg University, MAINZ, Germany 5 ¨ Universitatsklinik Essen, ESSEN, Germany 6 ¨ University Hospital of Cologne, KOLN, Germany 7 ¨ Charite´ -Universitatsmedizin Berlin, BERLIN, Germany 8 ¨ Wien, WIEN, Austria Medizinische Universitat 9 ¨ Universitatsklinik Erlangen, ERLANGEN, Germany 10 Robert Koch-Institut, BERLIN, Germany Objective: The spectrum of mold infections in cancer patients is increasing. Identification of mold pathogens is a prerequisite for optimal patient management through selection of antifungals with in vitro activity. While molecular tests generally show a higher sensitivity in the detection of Aspergillus as compared to culture and microscopy, optimal diagnostic strategies to identify a broader spectrum of molds remain undefined. We compared different molecular strategies (specific PCR assays targeting Aspergillus and Mucorales, a broadrange PCR assay and fluorescence in situ hybridization [FISH] probes with culture to identify molds in bronchoalveolar lavage (BAL) samples from cancer patients with suspected mold pneumonia. Methods: In a prospective multicenter study, BALs from eight clinical sites were collected. Adult cancer patients with suspected mold pneumonia were included. Diagnostic testing was performed in central diagnostic facilities. Clinical data were deposited in a web-based database (ClinicalSurveys.net). DNA was extracted by combining BAL supernatant and pellet fraction using beadbeating and a commercial kit (Springer JCM 2017). Specific PCR assays detecting DNA of Aspergillus and Mucorales (Springer JCM 2017) and a broadrange PCR assay targeting the 28S region (Khot AEM 2008) were applied. Appropriate controls were included to document for efficient DNA extraction, absence of PCR inhibition and contaminating fungal DNA. FISH was performed using differentially labeled probes targeting ribosomal RNA of Aspergillus, Mucorales and an unspecific eukaryotic probe on BAL samples spotted on slides. Results: Patients included between June 2016 and August 2017 (n = 111) suffered from acute leukemia (60%), other hematological malignancies (28%) or solid tumors (4%). Aspergillus was detected by culture in 7%, by FISH in 14% and by specific PCR in 28% of BAL samples. Mucorales were not cultivated but detected by FISH in 2% and specific PCR in 7%. Both, Mucorales and Aspergillus were detected by specific PCR in 3% suggesting a mixed infection. Broadrange PCR detected Aspergillus in 8% of the samples. While Fusarium spp., Pneumocystis and Rhizopus spp. were detected in single samples only, broadrange PCR amplified DNA from colonizing Candida, non-pathogenic molds such as Cladosporium or mixed fungal DNAs. Conclusion: Specific PCR assays and FISH provide a sensitive identification of target fungi superior to culture. While broadrange PCR is useful for the detection of additional fungi, these are mostly interpreted as colonizers.

PP5.117 Agreement between phenotypic and molecular method for the identification of filamentous molds: Experience from a routine diagnostic laboratory from Pakistan S. Irfan1 , M. Zeeshan1 , K. Jabeen1 , S.R. Lockhart2 , P.C. Dinh2 , A. Zafar1 1 The Aga Khan University, KARACHI, Pakistan 2 Centers for Disease Control and Prevention, ATLANTA, USA Objective: To assess the level of agreement between phenotypic identification with DNA sequencing for identification of filamentous molds isolated from clinical samples in a routine diagnostic laboratory from Pakistan. Methods: This study was conducted at the clinical microbiology laboratory, Aga Khan University, Karachi, Pakistan and the Mycotic Disease Branch, Centers for Disease Control and Prevention, Atlanta, GA, USA. A total of 23 filamentous molds isolated from tissue, respiratory tract, blood and pus over 16-month durations (January 2012- April 2013) were identified. These isolates were initially identified using colony morphology, rate of growth and microscopic morphology. For molecular identification, panfungal PCR targeting the ITS region of the ribosomal cistron was performed. For DNA sequence analysis, Sequencher version 4.8 software (Gene Codes Corp, Ann arbor, MI) was utilized to edit and align the DNA sequences and then sequences were identified using BLASTn (National Center for Biotechnology Information (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The correlation between phenotypic and molecular identification was evaluated. Results: Of the 23 molds identified phenotypically, Aspergillus species were the predominant mold (10/23). Overall excellent or good agreement between the two methods was found in 15/23 molds (65%). 7/10 (70%) Aspergillus isolates had excellent agreement with the molecular method up to the species level. Seven Mucormycetes included in the study were identified up to genus level. Good agreement was found in 3/4 isolates identified as Fusarium species. Conclusion: If performed by trained and experienced technical personnel, traditional phenotypic identification methods for molds has a good correlation up to the genus level, however it may not be reliable up to the species level. As species identification becomes vital due to rapidly emerging resistance, in resource limited settings laboratories must maintain a good relationship with reference laboratories at the national or international level for assistance with the identification of molds of unusual morphology.

ABSTRACT

PP5.118 Molecular epidemiology, risk factor analysis and Comparison of diagnostic methods for Rapid Diagnosis of Fungal Pneumonia in Critically ill Cirrhotics P.R. KALE, V Khillan, L.G. MITRA, S.K. Sarin INSTITUTE OF LIVER AND BILIARY SCIENCES, NEW DELHI, India Objective: Liver cirrhosis is associated with dysregulation of the immune system and increased susceptibility to fungal infections. We aimed to study the major risk factors and molecular epidemiology of fungal pneumonia in critically ill cirrhotic patients. Also compared the rapid diagnostic methods and biomarkers for fungal pneumonia. Methods: Single-center, prospective cohort study of 50 critically ill cirrhotic patients with fungal pneumonia between JanuarySeptember 2017. Demographics, comorbidities, and laboratory variables were recorded. Comparative analysis of culture, real time PCR and biomarkers; Bronchoalveolar lavage and serum galactomannan, serum procalcitonin were measured by ELISA and chemiluminescence assay on day 1, day 3 and day 7. The final outcome considered were mortality within one month after diagnosis or discharge of the patient with stable parameters. Genotyping was done with amplified fragment length polymorphism of clinical and air sampling Aspergillus isolates. Results: Aspergillus flavus was the most common species (34/50,68%). The risk factors identified were, neutropenia (p 0.03), steroids prior to ICU admission (p 0.02), prolonged hospitalizations >21 days (p 0.05). Culture positivity was 80%. Culture was not inferior to real time PCR for diagnosis of fungal pneumonia. BAL Galactomannan was early and better prognostic marker with median rise above >1 index value on day 1. Combination of molecular test and galactomannan could detect invasive aspergillosis in 90% cases. The median PCT level was higher from day 1in the fungal pneumonia non-survivor group (3.29 vs. 0.8 ng/ml) with higher 30-day mortality (72%). There was an association was found between PCT concentration associated bacterial infection (48%), antibiotic(74%) and antifungal therapy and renal failure. Patients with higher PCT at admission had higher mortality. Genotyping revealed; in two clusters, clinical isolates recovered from patients matched those recovered from air. Conclusion: Fungal pneumonia is a serious complication in cirrhotics with neutropenia, prolonged hospitalization and steroids as major risk factors. Aspergillus species predominate in consanguity with Asian epidemiology. Culture methods are reliable for diagnosis and combination of molecular test with BAL galactomannan is useful for rapid diagnosis. Serum procalcitonin is raised in patients with fungal pneumonia. Higher procalcitonin values are associated with higher mortality and poor outcome in critically ill patients. In our study the baseline PCT at admission to ICU was higher in non- survivor group, levels on D3 and D7 were persistantly higher. High serum procalcitonin level is an independent prognostic biomarker of mortality risk, and it’s a promising biomarker of prognosis in critically ill patients with fungal pneumonia to step up therapeutic measures. The observation of genetic relatedness of clinical and environmental sample might open new perspectives in the development of infection control measures to prevent invasive aspergillosis in high-risk patients.

PP5.11 Pneumocystis jirovecii pneumonia in patients with hematological diseases after hematopoietic stem cell transplantation and chemotherapy Y. A. Rogacheva1 , M.O. Popova1 , A.G. Volkova1 , K.A. Ekushev1 , O.V. Pirogova1 , O.N. Pinegina1 , S.M. Ignatieva2 , T.S. Bogomolova2 , O.V. Paina1 , T.A. Bykova1 , E.I. Darskaya1 , M.D. Vladovskaya1 , B.I. Smirnov1 , I.S. Moiseev1 , S.N. Bondarenko1 , L.S. Zubarovskaya1 , N.N. Klimko2 , B.V. Afanasyev3 1 R. Gorbacheva Institute of Children Oncology, Hematology and Transplantation, SAINT-PETERSBURG, Russia 2 I.I. Mechnikov North-Western State Medical University, SAINT-PETERSBURG, Russia 3 I.Pavlov First Saint Petersburg State Medical University, SAINT PETERSBURG, Russia Objective: Pneumocystis jirovecii pneumonia (PJP) is life-threatening disease in immunocompromised patients with HIV infection, after solid organ transplantations and hematopoietic stem cell transplantation (HSCT). The number of publications on epidemiology of PJP in patients with hematological diseases after HSCT and chemotherapy (CT) is limited. Methods: In R. Gorbacheva Memorial Institute of Children Oncology, Hematology and Transplantation of First Pavlov State Medical University of St. Petersburg between 2009 and 2015 yy. were performed 1008 allogeneic hematopoietic stem cell transplantation (allo-HSCT) and 433 autologous hematopoietic stem cell transplantation (auto-HSCT). A retrospective study includes 11 cases of PJP in 2006–2015 years in patients with hematological malignances and non-malignant hematological diseases after HSCT and CT. The median age was 25 y.o. (18-40). All patients received sulfamethoxazole trimethoprim prophylaxis. ECIL guidelines criteria was used for the diagnosis of proven PJP as well as to evaluate response to therapy. In 100% PJP was confirmed laboratory using real-time quantitative PCR, immunofluorescence assays and MONOFLUO test. Results: Incidence of PJP in allo-HSCT and auto-HSCT recipients was < 0,1% in time between 2009 and 2015 yy. After CT this complication developed in 2 patients. All cases of PJP developed in adults. Main underlying diseases were acute myeloid leukemia, acute lymphoblastic leukemia, Hodgkin and non-Hodgkin lymphoma, and primary myelofibrosis. The median day of onset PJP after HSCT was 154 days and after start of CT – 116 days. The main risk factors of PJP was acute or chronic graft-versushost disease (GvHD) and immunosuppressive therapy in 45,5%. In 73% and 45,5% of cases, PJP develops after or in combination with invasive aspergillosis and CMV infections. Febrile fever was the main clinical symptom of pneumonia (100%). Therapy withb sulfamethoxazole plus trimethoprim was performed in 100% patients. 12 weeks overall survival rate from the diagnosis of PJP was 73%, 1 year – 55%. Conclusion: Pneumocystis jirovecii pneumonia developed < 0,1% in patients after allo-HSCT vs auto-HSCT in time between 2009 and 2015 yy. The main risk factors: acute and chronic GvHD and immunosuppressive therapy. Sulfamethoxazole plus trimethoprim were used in 100% cases. Overall survival rates at 12 weeks and 1 year from the diagnosis of PJP were 73% vs 55%. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 422388 0dd37c26-2b89-490c-bf26-c3a 937072c50.png

PP5.120 Molecular characterization, virulence determinants and antifungal susceptibility testing of Trichosporon asahii isolates from Nepal N. Nayak1 , S.H. Subramanya1 , S.M. Rudramurthy2 , D. Shaw2 , A. Chakrabarti2 , I. Bairy1 1 Manipal College of Medical Sciences, POKHARA, Nepal 2 PGIMER, POKHARA, Nepal Objective: Trichosporon asahii is an emerging opportunistic yeast, responsible for both superficial and invasive infections. Trichosporonosis is increasingly being recognised in Nepal. Recently there were a few reports across different parts of the world, regarding limited therapeutic options, and difficulty in case management in infections due to Trichsporon asahii, mainly because of the changing virulence and epidemiological behaviour of this pathogen. This study was, therefore, undertaken to investigate the prevalent genotypes and to determine the In vitro virulence determinants, as well as drug susceptibility patterns of clinical isolates of Trichosporon asahii in Nepal Methods: A total of 31 Trichosporon isolates from various clinical samples like blood, respiratory specimens, peritoneal fluid, pleural fluid, pus, urine and indwelling medical devices collected between the period from 2013 to 2016 at the Manipal Teaching Hospital, the largest tertiary care centre in western Nepal, were studied. The isolates were identified by conventional techniques and genotyped by amplification and sequencing of the intergenic spacer 1 (IGS1) regions of r DNA. Virulence determinants were characterized by phenotypic methods. In vitro antifungal sensitivity testing for planktonic and biofilm cells were carried out by broth microdilution method (CLSI) and XTT reduction assay respectively. Results: All the 31 isolates were identified as Trichosporon asahii. Six (19.35%) of these 31 belonged to genotype IV and the rest 25 (80.65%) to genotype III. In vitro virulence determinants like cell surface hydrophobicity, superoxide dismutase, proteinase, esterase, deoxyribonuclease, and melanin production were observed in varying degrees. Neither phospholipase nor haemolytic activity could be detectable in any of the isolates. All strains exhibited high biofilm forming capabilities in terms of biofilm biomass (OD range: 0.38-1.27) and metabolic activity of biofilm cells (OD range: 0.23- 2.85). Minimum inhibitory concentration (MIC) values like MIC50 (μg/ml), MIC90 (μg/ml), and the geometric mean MICs (μg/ml) of planktonic T. asahii cells obtained against various antifungal drugs were as follows; amphotericin B: 2,2,1.74; caspofungin: 0.5,1,0.66; fluconazole: 8,8,6; itraconazole: 0.125,0.42,0.16; voriconazole: 0.125,0.49,0.18; posaconazole: 0.3,0.42,0.25; anidulafungin: 0.5,0.8,0.37; and micafungin: 4;8;5.27. In contrast to this, much higher MIC values ((MIC 50, MIC 90, geometric mean MICs) were observed among the biofilm-forming cells against drugs like fluconazole amphotericin B, and voriconazole. Conclusion: Our results suggested that genotype III was the predominant one circulating in western Nepal. Triazoles like voriconazole, itraconazole, and posaconazole exhibited satisfactory in vitro antifungal activity against planktonic T. asahii cells. Potential for biofilm formation and high level of resistance amongst the biofilm cells towards commonly used antifungal drugs, such as, fluconazole, amphotericin B, and voriconazole could have a lot of implications on the effective management and eventually on the therapeutic outcome in patients with device-associated infections due to Trichosporon asahii.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

S69

PP5.153 New insights on fibrogenesis and serum biomarkers for pulmonary fibrosis in paracoccidioidomycosis J. Venturini1 , A.R. Santos2 , M. Fernandes3 , M.A.R. Buzalaf4 , B.S. Pareira2 , S.M. Ribeiro2 , A.M.M. Paniago1 , R.P. Mendes2 , R.S. Cavalcante2 1 UFMS, CAMPO GRANDE, Brazil 2 UNESP, BOTUCATU, Brazil 3 ˜ Paulo, BAURU, Brazil University of Sao 4 ˜ Paulo, BAURU, Brazil Univeristy of Sao Objective: In the present study, we aimed to determine the serum proteomic profile of patients with chronic paracoccidiodomycosis with different pulmonary fibrosis (PF) outcomes. Methods: Twenty-nine patients with pulmonary PCM patients were followed up periodically, and blood serum samples were collected in four moments: before treatment (M0), clinical cure (M1), serological cure (M2), and apparent cure (M3). For control group (n = 15), serum samples of sex and age-matched smokers were also collected. At the end of treatment (M3), the patients were submitted to CT Scan evaluation and two groups of patients were formed based on PF outcomes: minor PF (n = 17) and major PF (n = 12). High-abundance proteins were removed from serum and submitted to shotgun proteomic assay. Peptide identification was performed on a nanoACQUITY UPLC-Xevo QTof MS system. After identifying the differentially expressed proteins, enrichment analysis and protein-protein interaction (PPI) network analysis were performed using PLGS Expression E software. Results: Before treatment, patients with minor PF, in comparison to controls, showed 91 differentially expressed proteins (60 down-regulated and 31 up-regulated). Serum of patients with major PF exhibited 70 differentially expressed proteins (66 downregulated and 4 up-regulated). Most of these proteins are involved in the regulation of biological processes. APOH and SERPIND1 were the query proteins in minor and major PF groups, respectively. As prognostic biomarkers to distinguish minor and major PF before treatment, we identified 15 targets (>2-fold): LRG1, IGHG3, A2M, HPR, IGHG1, HP, IGHG2, APOH, PZP, IGLC3, IGLC1, SERPINA3, SERPINA1, IGLC2, and GC. Conclusion: Although several proteins involved in immune response and fibrogenesis have been identified in the context of PF, this is the first study to explore proteomic tools in pulmonary PCM. Our findings provide new targets for further studies involving mechanisms of PF in PCM, and for promising potential biomarkers.

PP5.154 Human and veterinary blastomycosis caused by Blastomyces helicus and B. percursus identified among global fungal collections I. S. Schwartz1 , N.P. Wiederhold2 , C.R. Kenyon3 , Y. Jiang4 , K. Dukik5 , G.S. De Hoog5 , D. Stubbe6 , T.G. Maphanga7 , N.P. ˜ 8 , C.A. Cuomo8 , L. Sigler1 Govender7 , J.F. Munoz 1 University of Alberta, EDMONTON, Canada 2 UT Health San Antonio, SAN ANTONIO, USA 3 Institute of Tropical Medicine, ANTWERP, Belgium 4 Guizhou Medical University, GUIYANG, China 5 Westerdijk Fungal Biodiversity Institute, UTRECHT, Netherlands 6 Scientific Institute of Public Health, BRUSSELS, Belgium 7 National Institute of Communicable Diseases, JOHANNESBURG, South Africa 8 Broad Institute of MIT and Harvard, CAMBRIDGE, USA Objective: Case reports of blastomycosis diagnosed in patients without travel to areas classically considered endemic for Blastomyces dermatitidis have described atypical morphological and/or clinical features, raising the possibility that other fungal species were involved. Blastomyces helicus (formerly Emmonsia helica) and B. percursus are recently described dimorphic fungi that are morphologically distinct from B. dermatitidis/B. gilchristii. We describe the epidemiology and clinicopathology of disease caused by these fungi. Methods: We reviewed human and veterinary isolates of Blastomyces and Emmonsia from culture collections in Canada, The Netherlands, and Belgium and a clinical mycology laboratory in the United States. Identifications were confirmed by DNA sequence analysis. Epidemiological and clinicopathological features of disease caused by B. helicus and B. percursus were analyzed. Results: Isolates of B. helicus from 8 human cases and 5 veterinary cases were referred from western provinces and states of Canada and USA, respectively (Fig 1). Immunocompromising conditions were noted for 5 of 6 patients in whom this could be ascertained. The most common samples from which B. helicus was recovered (in some cases from more than 1 site) were bronchoalveolar lavage and blood (each from 4 patients), followed by pleural and cerebrospinal fluid (each from 2 patients), and then liver, bone marrow, and sputum (each from 1 patient). Histopathology frequently demonstrated small yeasts with multiple broad-based buds, sometimes forming short chains in unusual configurations. Half of affected patients died. Among veterinary cases, felines and canines each comprised 2 of 4 cases in which the host species was known. In all veterinary cases, the diagnosis was made by culture of lung tissue. Isolates of B. percursus were identified from 8 human cases, referred from Israel, Morocco, Uganda, Democratic Republic of Congo (formerly Zaire), and South Africa (Fig 2). No veterinary cases were identified. Disease occurred most commonly in immunocompetent persons (in 5 of 6 persons for whom this could be ascertained) and frequently involved skin (in 7 cases). The histopathological appearance in most cases was of large broad-based budding yeast cells with granulomatous host response similar to that seen with B. dermatitidis; however, some cases exhibited the presence of hyphal forms in tissue. Clinical outcomes were known for 4 patients, among whom 1 died. Conclusion: Blastomyces helicus differs from B. dermatitidis in causing pulmonary and systemic disease primarily in immunocompromised persons, in histopathological presentation and in its occurrence in western parts of North America. Blastomyces percursus differs from B. dermatitidis in causing primarily cutaneous disease, in histopathological presentation of some cases, and in its apparent area of endemicity that to date consists only of Africa and Israel. Our findings suggest that the occurence of blastomycosis outside of classic areas of endemicity should prompt consideration of these species. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 425550 d8aa8cb5-bc7e-4c08-855c-2e73c 9530e74.png Caption 1: Fig 2. Countries from where isolates of Blastomyces percursus were referred. Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 425550 d8aa8cb5-bc7e-4c08-855c-2e73c 9530e74.png Caption 2: Fig. 1. Canadian provinces and US states from where Blastomyces helicus isolates were referred

S70

PP5.155 Talaromyces marneffei cell wall glucans: their role in recognition by host cell and pathogenicity A. GUPTA1 , A. ANDRIANOPOULOS2 1 UNIVERSITY OF MELBOURNE, MELBOURNE, Australia 2 University of Melbourne, MELBOURNE, Australia Objective: T. marneffei is an opportunistic, human pathogen endemic to Southeast Asia. It is thermally dimorphic such that at 25◦ C T. marneffei grows in a multicellular hyphal form that can undergo asexual development to produce conidia (infectious agent). When these conidia are inhaled and enter the body, the temperature shift to 37◦ C resulting in switching to a unicellular yeast form that divides by fission. These yeasts are the pathogenic form and they reside within host macrophages, where they can withstand the cytotoxic environment. We have examined the cell wall architecture and composition of T. marneffei in the yeast and hyphal growth forms, and in this work, we have focused on the role of the β-glucan layer in immune cell interactions. Methods: Mixed linkage β-glucans are an important component of fungal cell walls. We examined the expression of these genes during growth in the different phases and in host cells. We generated mutants in these genes and characterised the effects of gene loss as well as their ability to grow and survive within host, cells. Using high resolution electron microscopy, we characterised the ultrastructure of the cell wall in different morphological forms and in the mutant strains both in vitro and in vivo. Results: In germination assays deletion strain for mixed linkage β-glucan mutants showed slightly higher rate of growth and longer germ tube length compared to wild type strain. On stress plates the mutants were more sensitive in either hyphal or yeast form. When murine cell lines were infected with spores of mutant and wild type strains there was a significant increase in the binding and phagocytosis of the mutants compared to wild type. Surprisingly, after 24 hrs post infection the survival rate of the mutants was higher than wild type strain. The mutants also showed a slightly higher MIC for the tested antifungal drug. Ultrastructure analysis showed that the mutants have altered cell wall layering of the spores with disruption in the outermost cell wall layer, thus exposing underlying cell wall layers. Spores of the deletion strains were also slightly larger than wild type strain which may be due to the over compensation of the lost cell wall layer. Conclusion: Deletion strains devoid of mix linkage β-glucan were more sensitive to stress and were readily recognised and phagocytosed by macrophages in vitro suggesting that the deletion of this layer may have exposed more a immunostimulatory components of the cell wall. Disrupting this component also had significant effects on yeast and hyphal cell wall architecture. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 415419 5a871868-b711-4dc9-94da-b9bb675c 450a.jpg Caption 1: Internalization of T. marneffei conidia (pseudo coloured as green) by murine macrophages after 15 mins of incubation shown by high resolution scanni Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 415419 5a871868-b711-4dc9-94da-b9bb675c 450a.jpg Caption 2: Image showing different cell wall layers of T. marneffei(psuedo coloured in red and green) while being internalised by a host macrophage(blue)

PP5.156 Comparative genomics of Rhinocladiella mackenziei A. Ahmed1 , L.F. Moreno2 , B. Brankovics2 , C.A. Cuomo3 , S.B.J. Menken4 , S.J. Taj-Aldeen5 , H. Faidah1 , B. Stielow2 , M Teixeira6 , F. Prenafeta-Boldu´ 7 , V. Vicente8 , S. De Hoog2 1 Umm Al-Qura University, MAKKAH, Saudi Arabia 2 Westerdijk Fungal Biodiversity Institute, UTRECHT, Netherlands 3 Broad Institute of MIT and Harvard, CAMBRIDGE, USA 4 Institute of Biodiversity and Ecosystem Dynamics, AMSTERDAM, Netherlands 5 Hamad Medical Corporation, DOHA, Qatar 6 Translational Genomics Research Institute, FLAGSTAFF, USA 7 GIRO Joint Research Unit IRTA-UPC, BARCELONA, Spain 8 Federal University of Parana´ State, CURITIBA, Brazil Objective: To assess the genetic intra-species variation in R. mackenziei and to determine the genetic signatures, such as species-specific genes; to uncover the genomic basis of the pathogenesis and potential adaptations to the conditions of arid climate regions. Methods: In this study we describe the whole genome re-sequencing of two Rhinocladiella mackenziei strains from patients in Saudi Arabia and Qatar. The two R. mackenziei isolates were sequenced using Illumina MiSeq and high-quality reads were mapped against the reference genome of the type strain of R. mackenziei. Variants were identified and SNP were annotated. Protein-coding sequences for the two R. mackenziei strains and their functional classification were determined. Orthologs and paralogs were determined by comparison of R. mackenziei proteins with the 20 previously sequenced black yeast species. Results: We found that the duplicated genes (paralogs) are more susceptible to accumulate significant mutations. Comparative genomics with other filamentous ascomycetes revealed a diverse arsenal of genes likely engaged in pathogenicity, such as the degradation of aromatic compounds and iron acquisition. In addition, intracellular accumulation of trehalose and choline suggest possible adaptations to the conditions of arid climate region. Specifically, protein family contractions were found, including shortchain dehydrogenase/reductase SDR, the cytochrome P450 (E-class) and the G-protein beta WD-40 repeat. Gene composition and metabolic potential indicate extremotolerance and hydrocarbon assimilation, suggesting a possible environmental habitat of oil-polluted desert soil. Conclusion: acquisition and primary metabolism (e.g., nitrogen metabolism, carbohydrate metabolism, fatty acid metabolism). Overall, the pathway collection in this fungus resembles that of black yeast that are able to assimilate alkylbenzene hydrocarbons. Unlike other true pathogens, R. mackenziei is a versatile fungus, holding several pathways to sequester carbon from a wide range of nutrient substrates from the environment, possibly suggesting an oligotrophic lifestyle. Opportunism may be explained by the occurrence of virulence factors which have other roles in the natural life cycle of the fungus, such as the presence of a glyoxylate cycle pathway, different strategies for acquiring iron, toxin neutralization and secondary metabolism.

PP5.157 Evaluation of Quantitative Real-Time PCR and Platelia Galactomannan Assay for Diagnosis of Disseminated Talaromyces marneffei Infection CUNWEI Cao The First Affiliated Hospital of Guangxi medical University, NANNING, China Objective: Talaromyces (Penicillium) marneffei is an emerging pathogen that causes significant morbidity and mortality in immunocompromised patients in endemic regions such as Southeast Asia. This study was conducted to compare the diagnostic performance of a well-validated real-time quantitative PCR (qPCR) target region of ITS1-5.8S-ITS2, and Platelia galactomannan (GM) assay for the diagnosis of Talaromycosis marneffei using serum sample from patients with or without HIV. Methods: Thirty six patients with Talaromycosismarneffei were enrolled for laboratory diagnosis by qPCR and GM assay. Serum samples were first tested for qPCR and later for galactomannan antigen with ELISA assay. qPCR was carried out in an automated fluorescent quantitative PCR cycles, and the results were analyzed using a receiver operating characteristic curve. The sensitivity and specificity of serum qPCR assays were calculated. GM levels were determined using the Platelia Aspergillus enzyme immunoassay. GM optical density cutoff index was ≥0.5. The sensitivities of both diagnostic methods were compared using Fisher’s test. Results: The results showed this novel qPCR method is highly sensitive and specific for detection of DNA of T. marneffei in serum sample; the limit detection and species-specificity of qPCR were five copies of DNA and 100%, respectively. In detection serum samples from 36 Talaromycosismarneffei patients, the sensitivity for qPCR was 86.11% (31/36), including 20/20 (100%) patients with fungemia and 11/16 (68.75%) without fungemia. For GM assay, the sensitivity was 80.56% (29/36) when GM optical density cutoff index was ≥0.5, including 19/20 (95%) patients with fungemia and 10/16 (62.5%) without fungemia. Conclusion: These results indicate novel qPCR and GM assay could be used as a valuable tool in the diagnosis ofT. marneffei infection. Serum sample is a convenient hematological sample to be used for T. marneffei DNA quantification. It is more scientific and appropriate to combine GM and qPCR for diagnosis of T. marneffei infection in the endemic areas.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Medical Mycology, 2018, Vol. 56, No. S2

PP5.158 Susceptibility to hydrogen peroxide and molecular characterization of catalase-encoding genes in different Sporothrix species C. Barresi1 , L.F. Moreno2 , M. G. Orlando3 , M. R Felice1 , D. Barreca1 , D. Giosa1 , G. Criseo1 , AHG Gerrits van den Ende2 , A van Diepeningen4 , G.S. De Hoog5 , O. Romeo1 1 University of Messina, MESSINA, Italy 2 Westerdijk Fungal Biodiversity Institute, UTRECHT, Netherlands 3 University of Messina, Messina, MESSINA, Italy 4 Wageningen University and Research, WAGENINGEN, Netherlands 5 Radboud University Nijmegen Medical Center, NIJMEGEN, Netherlands Objective: Sporotrichosis is a fungal (sub)cutaneous infection of humans and felines caused by a group of dimorphic pathogens of the Sporothrix genus embedded in the so-called pathogenic clade (Sporothrix schenckii, Sporothrix brasiliensis, Sporothrix globosa, Sporothrix luriei). However, the genus also contains occasional opportunists, such as Sporothrix pallida and Sporothrix mexicana (environmental clade) which have the potential to cause sporotrichosis in susceptible hosts. During infection, pathogenic fungi encounter oxidative stress that can be overcome by expressing an antioxidant defense system, including the production of catalase enzymes (CATs). Among the different Sporothrix spp., there is a high degree of variability in terms of virulence, pathogenicity and ability to survive in oxidative stress conditions. Therefore, in the light of these differences, we decided to test the susceptibility of all members of the pathogenic and environmental clades to hydrogen peroxide (H2 O2 ) under specific experimental conditions. Moreover, we also performed an in-silico analysis of the genes encoding catalases, by using the recently sequenced Sporothrix genomes, in order to understand if genetic differences exist among pathogenic and environmental Sporothrix species. Methods: A total of 55 Sporothrix isolates were examined in this study. The susceptibility to H2 O2 was assayed using the spot-assay on YEPD-agar containing 6 mM H2 O2 and by microdilution broth method. Bioinformatics analysis were performed to identify and classify the catalase-encoding genes in published genomes. CAT-genes were also experimentally validated in a sub-panel of different Sporothrix strains using standard Sanger sequencing. Results: All S. pallida and S. mexicana isolates, including the unique pathogenic S. luriei isolate, grew under oxidative stress conditions used whereas all the examined S. schenckii and S. chilensis strains resulted unable to grow in the same experimental conditions. S. brasiliensis and S. globosa strains were variably resistant to H2 O2 suggesting the occurrence of a high intraspecific variability within the populations of these two pathogens. Bioinformatics analysis of the whole-proteome of Sporothrix species revealed a total of 15 proteins containing the “Catalase Core Domain”, classified as “monofunctional catalases”. Species belonging to the pathogenic clade (S. schenckii, S. brasiliensis, S. globosa), contained 4 different catalase-encoding genes while only 3 genes were found within the environmental species S. pallida. Conclusion: This study showed that Sporothrix species differ in their response to H2 O2 and that the environmental species, S. pallida and S. mexicana, appear to be naturally resistant to this compound. However, differences were also found among members of the pathogenic clade and S. schenckii seems to be the most susceptible species to H2 O2 . Based on the obtained data, it seems that the degree of susceptibility to H2 O2 among examined Sporothrix species can be defined as S. pallida or S. mexicana > S. brasiliensis or S. globosa > S. schenckii. We also identified a different content of CAT-isoforms in the sequenced genomes but it was not possible to know their individual contribution to the different phenotypes observed. Therefore future gene expression studies will be needed in order to expand our knowledge about the molecular mechanisms associated with oxidative stress mediated by H2 O2 in Sporothrix species.

PP5.159 Tuberculosis and histoplasmosis diagnosis among people living with HIV/AIDS: the impact of using rapid diagnostics tests in Panama, 2017 D. H. Caceres1 , A.B. Arauz2 , C. Flores2 , E. Santiago2 , E. Gutierrez2 , J. Borace2 , J. Abdo3 , M. Lindsley1 , R. Flores3 , E. Stolz-Sobalvarro3 , T. Chiller1 , D. Forno1 1 Centers for Disease Control and Prevention (CDC), ATLANTA, USA 2 Hospital Santo Tomas, PANAMA CITY, Panama 3 University Research Co., LLC, CHEVY CHASE, USA Objective: The immunosuppression that characterizes people living with HIV/AIDS (PLHA) promotes the development of opportunistic infections (OI). Progressive disseminated histoplasmosis (PDH) and tuberculosis (TB) are co-infections reported frequently among PLHA in Latin America. This study describes the impact of the use of rapid diagnostics tests (RDTs) for OI detection in Panama. Methods: Between May 2017 and September 2017, a cohort of PLHA with clinical suspicion of PDH were prospectively identified at the Santo Tomas Hospital in Panama City, Panama. Urine samples were collected prior to treatment and tested using a R , Norman, OK, USA) and The Alere commercial monoclonal Histoplasma galactomannan (HGM) antigen capture ELISA (IMMY DetermineTM TB LAM (AlereTM , Waltham, MA, USA), an immunochromatographic dipstick assay for detection of Mycobacterium lipoarabinomannan (TB-LAM). Results: A total of 174 patients were identified with clinical suspicion of PDH with a median CD4 of 51 CD4 cells/μl and a viral load of 143,615 copies/ml. Urinary HGM was detected in 48 of 174 (28%) patients and urinary TB-LAM was detected in 39 of 174 (22%) patients. Concomitant HGM/TB-LAM was present in 18 of 174 (10%) patients, in whom a median CD4 of 34 cells/μl was observed. Based on antigen result, we observed that in the 48 patients with positive HGM, 18 (38%) tested positive for TB-LAM. Likewise, in 18 of the 39 (46%) patients with positive urinary TB-LAM tested positive for HGM. Conclusion: We found a high proportion of PLHA patients with PDH and TB. At least one opportunistic infection, such as PDH and TB, should be suspected in patients with an altered immune system like HIV/ADIS. Due to the similarity in the clinical presentation of PDH and TB, provision of adequate treatment is challenging. Rapid and accurate OI diagnosis can ensure proper treatment is provided adequately and timely to reduce mortality among PLHA.

ABSTRACT

S71

PP5.160 Veterinary mycosis in a tropical country

PP5.195 Molecular identification and speciation of Malassezia and its susceptibility pattern

´ ´ A. M. Calderon-Hern andez, A.M. Urbina-Villalobos National University of Costa Rica, HEREDIA, Costa Rica

P. N Romald, A.J Kindo, M.L Verraragavan Sri Ramachandra Medical College and Research Institute, CHENNAI, India

Objective: The aim of this study is to present the experience of 10 years of work in veterinary mycology and research in mycotic diseases in companion, productive and wildlife animals in a tropical country. Methods: We analyzed databases, cases and results of investigations in veterinary mycology generated in our laboratory from January 2008 to December 2017. A case of mycosis was confirmed if fungal structures were identified in clinical samples by direct microscopic examination, by the finding of fungal structures by histopathology and/or culture isolation. Results of lung cultures for avian aspergilosis controls in poultry industry are presented. We also include the main findings of theses carried out in our laboratory. Results: For the study period of 2008–2017, there were a total of 2469 cases that underwent mycological analysis and 27.8% (686/2469) were confirmed with mycotic diseases. The most common mycosis was Malassezia sp. otitis and/or dermatitis with 36.1% (248/686), followed by dermatophytosis with 31% (213/686). Aspergillus sp. in poultry, in the third place, accounted for 26.7% (183/686) of the cases. Cryptococcosis, histoplasmosis, candidiasis, pythiosis, protothecosis, conidiobolomycosis, phaeohyphomycosis and hyphomycosis were demonstrated in wild and domestic’s animals in the remaining diagnoses mainly in the last five years. Aspergillus section Fumigati was the most repetitive isolation in poultry lungs with 57.4% (105/183). Microsporum canis was the most common dermatophyte with 62.3% (96/154) in dogs and cats. Overgrowth of Malassezia sp. was observed in direct examinations and cultures from ear canal swabs of 100% (54/54) healthy pigs. Frequency of canine dermatophytosis varied among different populations: our laboratory casuistry accounts of 11.3% (97/860), a regional survey 4.72% (6/127) and dogs from rural and indigenous areas without veterinary care 20% (25/127). Dermatophyte detection in the skin of cats from all over the country was of 17.1% (21/123) while this etiology was confirmed in 32.5% (88/271) of the samples sent to our laboratory. Among the relevant findings from research performed in wild animals was the identification of Microsporum canis on fur of 5% (4/79) asymptomatic free-living monkeys, and the isolation of Candida sp. from the ear canal in 23.1% (46/199) of apparently healthy bats. Injured Caribbean sea fans were demonstrated with dark septate and hyaline septate hyphae by histopathology and cultivation of the damaged tissues yielded fungal isolation in pure culture in 33.3% (3/9). Conclusion: Due the climate conditions Aspergillus sp. is an infectious agent widely prevalent and its control is important for the food industry. Superficial mycoses in dogs and cats are the most common fungal diseases identified in this tropical country with occurrence all over the year, nevertheless variations in the frequency could be a result of the different geographic areas and living conditions of the animals. Confirmation of systemic and deep mycoses in wild and domestics animals have increased over the last years since veterinarians are more aware of the possibility of the mycotic etiology and are considering in their differential diagnosis. Mycological surveys in fauna contribute to baseline knowledge on fungal agents and further studies are needed in order to elucidate threats to wildlife conservation.

Objective: The objectives of this study are: Epidemiology - To know the age, sex and site of prevalence of Malassezia infection. Anti-fungal susceptibility -To identify the most effective anti-fungal drugs to treat infections caused by Malassezia and obtain their MIC (minimum inhibitory concentration) values. Molecular study -To do DNA extraction, Polymerase chain reaction (PCR) and sequence the extracted genome, thereby identifying and speciation of Malassezia. Methods: Malassezia species were isolated from the skin scrapping’s of the patients with hypo/hyper pigmented lesions in the Dermatology OPD of our tertiary care hospital/medical centre for a period of two years from July 2016 to February 2018.Microscopic Examination of 10% KOH treated scrapping’s were done. KOH positive samples were cultured on Modified Dixons agar (MDA) and Sabouraud’s Dextrose Agar (SDA) with olive oil overlay and incubated at 32◦ C.Gram stain, Catalase and Urease test was performed. Stock cultures were made and refrigerated. EPIDEMIOLOGY- Among the samples obtained in our tertiary care hospital for a period of two years, the commonest age of Malassezia infection,the sex in which the infection predominates and the site of maximum predilection were analysed. Anti-fungal susceptibility- was done by broth Micro- dilution method in accordance with CLSI M27-A3 guidelines. Since Malassezia’s are lipid dependant yeast, RPMI 1640 was added with glucose, peptone, ox bile, malt extract, glycerol, Tween 40, Tween 80 and chloramphenicol. Stock inoculum was prepared. Anti-fungal stock solutions of drugs were prepared and stored at - 70◦ C. Micro titre plates with 96 wells were incubated for 4 days at 32◦ C. Growth and sterility control wells were included in each test. MIC values to anti-fungal drugs - Fluconazole, Ketoconazole, Miconazole, Clotrimazole and Terbinafine were obtained as MIC 50 and MIC90 (where 50% and 90% inhibition of growth was seen).

PP5.193 Mating type and population genomics in Malassezia QI-MING WANG, KUAN LI, XIAO-LING ZHANG Institute of microbiology, CAS, BEIJING, China Objective:The yeast species of Malassezia, belonging to the Ustilaginomycotina, are known as normally skin resident of humans and animals and also associated with a number of skin disorders and systemic diseases for their hosts. The mating of Malassezia may play an important role in pathogenesis. However, only Malassezia sympodialis was reported to have two different mating-type and suggested to be a pseudo-bipolar mating systems, the complementary mating type in other sixteen species of Malassezia are still unclear at present. Here we explored the mating type for all most species of Malassezia by genomic population method. Methods: Genome was assembled by spades software with default parameters. The genes were annotated by a combination of four independent ab initio predicators Augustus, GeneMark (Version 4.30), SNAP24, and Glimmer.25. Finally, EVidenceModeler (EVM) to compute weighted consensus gene structure annotations. The maf gene identification was done by Fgenesh services online. Results: More than 300 strains of Malassezia, including M. dermatis, M. furfur, M. globosa, M. japonica, M. obtusa, M. pachydermatis, M. restricta, M. slooffiae, M. sympodialis and M. yamatoenis, have been isolated from healthy and clinical patients in China. M. globosa and M. restricta are dominant in the samples from most provinces of China, but M. furfur and M. slooffiae are most frequently isolated from those samples in Tibet, China. The following studies of population genomics of those isolates showed that M. furfur, M. globosa, M. restricta and M. slooffiae have two different mating types. Conclusion: Our results indicated that M. furfur, M. globosa, M. restricta and M. slooffiae may undergo a sexual reproduction as suggested for M. sympodialis. Those new isolates with different mating type and their genomic data will help us to explore the life cycle and virulence potential of this genus in the future.

PP5.194 Morbidity of fungal infections caused by Malassezia furfur in neonatal intensive care units J.V. Rodchenko, L.A. Lyubasovskaya, A.B. Gordeev, E.L. Isaeva, D.V. Dubodelov, V.V. Zubkov, O.V. Ionov, I.V. Nikitina, J.L. Podurovskaya, A.A. Burov, T.V. Priputnevich, G.T. Sukhikh National Medical Research Center for Obstetrics, Gynecology and Perinatology, MOSCOW, Russia Objective: To study the morbidity of fungal infections caused by Malassezia furfur (M. furfur) in neonatal intensive care units. Methods: The study was carried out from 2015 to 2017 and included infants from the neonatal intensive care unit (NICU) and the surgery NICU, all patients were admitted to National Medical Research Center for Obstetrics, Gynecology and Perinatology named after Academician V.I. Kulakov of Ministry of Healthcare of Russian Federation, Moscow. Microbiological monitoring of M. furfur included regular pharyngeal, rectal swabs and tracheal tubes once a week from the first day of life. In case of infection signs additional microbiological tests were done (blood, urine and venous catheter). All biological specimens and swabs were cultured on modified Dixon agar for 72 h at 32◦ C ± 2◦ C. The yeast identification was based on morphological and biochemical features and using an automatic bacteriological analyzer Vitek 2 Compact (bioMerieux, France). For blood cultivation liquid modified Dixon agar and Bact/Alert (bioMerieux) were used. Results: From 2015 to 2017 2793 infants were observed: 70% (1942 infants) were infants from the NICU and 30% (851 infants) - from the surgery NICU. M. furfur was found in 14% of them (293 infants): 41% of cases were infants from the NICU and 30% (174 infants) - from the surgery NICU. All observed infants had some risk factors for M. furfur colonization: low or very low birth weight, parenteral nutrition by lipid solutions, abdominal or chest operations. Average weight among all infants with M. furfur was 2124 grams Average weight among infants from the NICU was 1038 grams. Average weight among infants from the surgery NICU was 2899 grams. Totally 106 newborns (3.8%) had systemic mycoses (isolation from blood, venous catheters, urine, and autopsy material). The morbidity of fungal infections caused by Malassezia furfur in the NICU was 2.4% whereas in the surgery NICU the morbidity was 6.9%. During monitoring from feces and pharynx the morbidity was 6.7% (187 infants). Conclusion: The morbidity among the surgery NICU was 6.9% and was higher than in the NICU. The risk factors for M. furfur colonization in the surgery NICU were parenteral nutrition by lipid solutions and surgical operations. The morbidity among the NICU was 2.4%. The main risk factors for M. furfur colonization in the NICU were low or very low birth weight and parenteral nutrition by lipid solutions.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Molecular study-DNA was extracted from culture and stored at -20◦ C until used as a template for amplification.DNA was amplified using ITS-1 and ITS-4 primer and Malassezia specific primer ITSIF-N (GGATCATTAGTGATTGCCTTTATA) and ITS4-R (TCCTCCGCTTATTGATATG).Sanger’s sequencing and NCBI blast was done. Results: Of the 88 samples collected 78 showed meat ball and spaghetti appearance on microscopic examination (85%) 65 samples grew on MDA. Some samples even grew more than one species of Malassezia. 50 samples grew on SDA with olive oil overlay. 1 sample grew on SDA without olive oil. Growth on Modified Dixons agar was faster than SDA with Olive Oil overlay. Gram stain performed showed-spherical/oval/sympodial buddings All samples were catalase and Oxidase positive. Predominant age group- 10–20yrs and 20–30 yrs. Sex predominance is almost equal with little male predominance. Commonest site -Scalp, Neck and Shoulder, Hip and inner thigh RPMI1640 with added supplements were standardised The AFST reports are awaited Molecular Methods were standardised and DNA Extracted and stored for Amplification. Waiting for Sequence Reports, Blasting and Speciation. Conclusion: Speciation and anti-fungal susceptibility testing of Malassezia will help the clinician to choose the most appropriate drug to treat Malassezia infections and have good patient compliance. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 2 420960 550b7a08-6193-4bf1-86061d9979446e5f.jpg Caption 1: standardization of molecular study Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 420960 550b7a08-6193-4bf1-86061d9979446e5f.jpg

PP5.196 Activity of investigational tetrazole antifungals VT-1161 and VT-1598 against a collection of characterized fluconazole resistant Candida parapsilosis clinical isolates J. M. Rybak1 , E.L. Berkow1 , C.M. Dickens2 , C.M. Yates3 , R.J. Schotzinger4 , E.P. Garvey4 , N.P. Wiederhold5 , P.D. Rogers1 1 University of Tennessee Health Science Center, MEMPHIS, TN, USA 2 Texas A&M University, COLLEGE STATION, TX, USA 3 Viamet Pharmaceuticals, Inc., DURHAM, NC, USA 4 Viamet Pharmaceuticals Inc., DURHAM, NC, USA 5 Fungus Testing Laboratory, SAN ANTONIO, TX, USA Objective: To evaluate the activity of the tetrazole-based fungal CYP51 inhibitors VT-1611 and VT-1598 against a collection of characterized clinical Candida parapsilosis isolates with reduced susceptibility to triazoles. Methods: 10 fluconazole-resistant clinical isolates of C. parapsilosis were included in this study. We have previously characterized this collection, which includes 3 isolates with ERG11 mutations encoding the Y132F amino acid substitution, 1 isolate which overexpresses ERG11 (12-fold), as well as 6 isolates observed to overexpress CDR1 (4- to 8-fold), and 3 isolates which overexpress MDR1 (25- to 51-fold). VT-1161, VT-1598, fluconazole, voriconazole, itraconazole, and posaconazole minimum inhibitory concentrations (MIC) for each isolate were determined using CLSI methods in duplicate. Results: VT-1161 MIC (determined at 50% growth inhibition) ranged from 0.06 to 4 mg/L (MIC50 0.06 mg/L). VT-1598 MIC ranged from ≤0.015 to 0.125 mg/L (MIC50 0.03 mg/L). 3 isolates which overexpress CDR1 (4- to 5-fold) and 1 isolate which overexpresses MDR1 (25-fold), were observed to have VT-1161 and VT-1598 MIC of 0.06 and 64 mg/L), only 6 isolates were non-susceptible to voriconazole (MIC 0.25 to 1 mg/L). One isolate was observed to have an itraconazole MIC exceeding the previously reported epidemiologic cutoff value of 0.5 mg/L. Posaconazole MIC were ≤0.125 mg/L for all isolates tested. Conclusion: VT-1598 demonstrated potent activity against all isolates in this collection of C. parapsilosis clinical isolates with reduced susceptibility to triazoles. A wider range of VT-1161 susceptibility was observed, with the highest MIC (2 to 4 mg/L) obtained for isolates that possess both an ERG11 mutation encoding the Y132F amino acid substitution and CDR1 overexpression. However, neither CDR1 or MDR1 overexpression alone were found to significantly increase VT-1161 or VT-1598 MIC in this collection of clinical isolates. Further investigation is needed to determine the direct impact of these and other yet to be identified sterol-demethylase inhibitor resistance mechanisms.

S72

Medical Mycology, 2018, Vol. 56, No. S2

PP5.197 Polymerase chain reaction (PCR) diagnosis and identification of mucormycosis in patients with suspected invasive fungal infection

PP5.199 Posaconazole prophylaxis in patients with acute myeloid leukemia: A real life experience from a prospective multicenter observational study

T. Shokohi1 , N. Gholinejad Ghadi2 , Z. Seifi2 , S.R Aghili3 , E. Roilides4 , M. Nikkhah2 , R. Pormosa1 , H. Karami1 , L. Vahedi Larjani1 , M. Ghasemi1 , I. Haghani1 1 Mazandaran University Medical Sciences, School of Medicine, SARI, Iran 2 Mazandaran University Medical Sciences, SARI, Iran 3 Invasive Fungi Research Center, SARI, Iran 4 University School of Health Sciences, THESSALONIKI, Greece

8 ¨ ¨ 1 , A C¸iftic¸ioglu2 , R Saba3 , A Ulu Kilic¸4 , H Yilmaz5 , K Demir6 , Y C¸ag7 , D Kiper Unal , F. Aksoy9 , H Berk10 , G Metan1 , S Etgul ¨ Tunc¸can12 , A Tombak13 , G Delibalta14 , II Balkan15 , SA C¸avus16 , B Kandemir17 , B Mutlu18 , AC Inkaya1 , G Mert11 , OG 22 ¨ , G I Karadogan19 , LG Kaynar4 , MH Atay5 , A Keskin6 , FE Dursun20 , E Kurtoglu10 , G Saydam8 , N Erkut21 , NZ Ozkurt 16 14 24 ¨ ¨ ¨ oren ¨ ur ¨ ¨ 23 , HG Ozsan , Y Unsal , S Ong , FS Sari18 , N Tiftik13 , H. Akan2 Ozg 1 Hacettepe University Faculty of Medicine, ANKARA, Turkey 2 Ankara University Faculty of Medicine, ANKARA, Turkey 3 Antalya Mestar Hospital, ANTALYA, Turkey 4 Erciyes University Faculty of Medicine, KAYSERI, Turkey 5 19 Mayis University Faculty of Medicine, SAMSUN, Turkey 6 Pamukkale University Faculty of Medicine, DENIZLI, Turkey 7 Medeniyet University Faculty of Medicine, ISTANBUL, Turkey 8 Ege University Faculty of Medicine, IZMIR, Turkey 9 Karadeniz Technical University, Faculty of Medicine, TRABZON, Turkey 10 Antalya Research and Education Hospital, Medical Sciences University, ANTALYA, Turkey 11 ¨ Gulhane Medical Academy, ANKARA, Turkey 12 Faculty of Medicine, Gazi University, ANKARA, Turkey 13 Mersin University Faculty of Medicine, MERSIN, Turkey 14 Emsey Hospital, ISTANBUL, Turkey 15 Istanbul University Cerrahpasa Medical Faculty, ISTANBUL, Turkey 16 ¨ University Faculty of Medicine, IZMIR, Turkey Dokuz Eylul 17 Necmettin Erbakan University Faculty of Medicine, KONYA, Turkey 18 Kocaeli University Faculty of Medicine, KOCAELI, Turkey 19 Antalya Medstar Hospital, ANTALYA, Turkey 20 Medeniyet University Facult of Medicine, ISTANBUL, Turkey 21 Karadeniz Technical University Faculty of Medicine, TRABZON, Turkey 22 Gazi University Faculty of Medicine, ANKARA, Turkey 23 ¨ Gulhane Military Academia, ANKARA, Turkey 24 Istanbul University Cerrahpasa Faculty of Medicine, ISTANBUL, Turkey

Objective: Mucormycosis is a life-threatening fungal infection and accurate diagnosis based on conventional methods remains a challenge for physicians. Molecular diagnosis may greatly help diagnosis and species identification of invasive mucormycosis. We aimed to study whether molecular methods assist diagnosis and identification of Mucorales in cases of suspected invasive mucormycosis. Methods: All patients with suspected invasive fungal infection according to the EORTC/MSG criteria admitted in Hospitals in Northern Iran affiliated with Mazandaran University between April 2015 and August 2017 were included. In addition, formalinfixed paraffin-embedded (FFPE) samples of histopathologically proven mucormycosis cases during the same period were studied. PCR assays targeting the 18S rDNA of Mucorales and ITS region were performed and the PCR products were then sequenced. Results: Of 63 patients with suspected invasive fungal infections hospitalized during April 2015 and August 2017, 9 (14.3%) cases of definite mucormycosis were identified. While the culture was positive only in 5 (7.9%) cases, PCR was positive in all 9 cases of mucormycosis. Ten of 18 (55.6%) FFPE samples were positive with PCR. Overall, Mucorales PCR was positive in 19 of 27 (70.4%) samples. Species of Mucorales were Rhizopus oryzae in 12 (63.1%) cases, Rhizopus oryzae / Amylomyces rouxii in 6 (31.6%) cases and Rhizopus stolonifer in one case (5.3%). Among 27 cases of molecularly diagnosed mucormycosis 23 (85.2%) cases were rhino-cerebral mucormycosis, 2 (7.4%) cases were disseminated and 2 (7.4%) cases cutaneous. Diabetes mellitus (70.4%) and neutropenia (63.0%) were the main risk factors in this cohort of patients with invasive mucormycosis. Conclusion: We found that semi-nested PCR targeting 18S rDNA region of Mucorales is useful for detection of invasive mucormycosis and the Mucorales species causing it. In North area of Iran mucormycosis is more common in diabetic patients and rhino-cerebral form of diseases is more prevalent. Rhizopus oryzae appears to be the predominant species causing invasive mucormycosis.

PP5.198 Immunopathogenesis and virulence of invasive mucormycosis differs considerably between mucormycete species C. Speth, V. Fleischer, V. Harpf, N. Parth, C. Lass-Floerl, G. Rambach Division of Hygiene and Medical Microbiology, Christian Doppler Laboratory, INNSBRUCK, Austria Objective: Invasive mucormycosis is a life-threatening disease induced members of the Mucorales order. Mainly immunocompromised patients are affected by this disease and suffer from high morbidity and mortality. The relevance of invasive mucormycosis for at risk patients strongly demands for more data about the immunopathogenesis of this disease. Moreover, since Mucorales is a rather heterogenous group of fungal species, a comparison between the different species provides information about their characteristics in virulence and pathogenicity. Methods: Mice either immunocompetent or with depletion or deficiencies in defined immune elements (neutrophils, complement, platelets) were infected with Lichtheimia corymbifera, Lichtheimia ramosa, Rhizopus arrhizus, Rhizopus microsporus, Rhizomucor pusillus or Mucor circinelloides. Survival and clinical status were monitored over 14 days. Blood was taken at defined time points and analysed for immunological and inflammation parameters and for blood count. Results: Intravenous infection of mice revealed that the mucormycete species harboured tremendous differences in their virulence; whereas all mice infected with Rhizopus arrhizus died within 3 days post infection, infected with Mucor circinelloides only resulted in transient weight loss and fever. The virulence of all other tested species was in between these two extremes. Deficiency of neutrophilic granulocytes was a prominent risk factor in mice for severe disease and rapid mortality for all tested virulent mucormycete species. However, complement deficiency did predispose for even faster mortality in some animal groups. In addition, the pattern of affected organs and of the histopathology differed significantly between the mucormycete species as well as between mice with various immune element deficiencies. The most affected organs were kidney and brain, as well as for some mucormycetes the gastrointestinal tract. Conclusion: Innate immune elements such as neutrophils, complement and platelets can exert their antifungal reaction immediately after contact with the pathogen. Their efficiency and relevance has to be weighted carefully and separately to understand the immunopathogenesis of invasive mucormycosis. Complement seems to be the most potent weapon of innate immunity. Also thrombocytopenia influences the course of infection, implying that platelet transfusion in infected patients might be beneficial.

Objective: We aimed to investigate the effectivity of posaconazole prophylaxis (PP) in patients receiving induction chemotherapy for acute myeloid leukemia (AML) at Turkish hospitals. Methods: Patients ≥18-years who received chemotherapy for AML with a duration of neutropenia ( 32 μg/mL, respectively. However, on the third day of the culture, the color of the colonies were darkened and gradually turned into mold colonies. In Lactophenol-cotton-blue staining septate, colorless and brown, flask shaped phialides with saucer-shaped collarettes and septum at the base were seen. Brown and almost round conidia were seen on tip of the phialides and the strain was identified as Phialophora sp. Further, the ITS region sequencing identified the isolate as Pleurostomophora (Phialophora) richardsiae (accession no: CBS 142361). New urine specimens from the patient were requested and the 7 subsequent urine specimens revealed the same fungal pathogen. The patient was admitted to the Infectious Diseases Clinic for antifungal treatment. Results: A literature review on PubMed Medline using search terms ‘urinary tract infection’, ‘Phialophora richardsiae‘, and ‘Pleurostomophora richardsiae‘ was performed to determine existing evidence for the management and treatment of this organism. Only 25 cases of Pleurostomophora richardsiae were reported in the English literature since 1968. Infections in the majority of cases were as subcutaneous phaeohyphomycosis, abscess, nodule, rarely bursitis, endophthalmitis and, systemic infection in only two cases. Previously, it was believed that dematiaceous fungi do not respond well to systemic antifungals without surgical excision. Pleurostomophora have been reported to have in vitro susceptibility to systemic antifungal agents. In this patient liposomal amphotericin B 3 mg/kg/day therapy was started. On the forth day of therapy, the creatinine level increased to 1.64 mg/dL, and itraconazole 2´200 mg treatment was started and continued for 14 days. After two years, there is no mycological evidence of recurrence. Conclusion: Urinary tract infection due to P. richardsiae have not been reported previously. We present a bladder infection due to P. richardsiae. We thought that the procedures performed for the diagnosis and treatment of bladder tumor, could cause the inoculation of the agent in the bladder.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Objective: The presence of fungi in the airways of patients with cystic fibrosis (CF) is common; the most prevalent species described in this patients using conventional culture methods are Aspergillus and Candida. However, the presence of fungal microbiota is underestimated and it is unknown its role in the disease progression. The aim is to describe changes over time of fungal microbiota and evaluate clinical parameters related to CF patients Methods: Prospective observational cohort study including children and adults with CF. Clinical and functional data and a sample of sputum at baseline and at 6 months were collected. The microbiological study was performed in sputum by conventional culture. The microbiological study was performed with a metagenomic approach that allows us to amplify the fungal ITS gene by nested-PCR, and sequencing of positive samples. The prevalence of fungal colonization by both techniques and the relationship with clinical variables of patients and their evolution are analyzed Results: 60 CF patients were included, 45 adults and 15 children. In children, detection of fungi using conventional culture methods was unable, while by metagenomics tools detected 12 (80%) cases. In adults, the metagenomic screening improved from 14 cases (30.4%) by culture to 32 (69.6%). The fungi mainly detected were: Candida spp (41.8%); the uncultured fungus P. jirovecii (32.7%), followed by Aspergillus spp (12.7%) and Cladosporium spp (9.5%), besides a 30% of CF patients are colonized by more than one fungal specie. In the basal visit, patients with isolates presented a lower FEV1 and a higher proportion of inhaled steroids use. At 6 months, these isolates were persistent in 47.6% and 11.1% presented new isolates in negative subjects. Patients with acquired fungus isolation previous, presented a worse lung function FEV1 (-120 mL) as compared with persistent negative patients (+109 mL; P = 0.088) Conclusion: Fungi colonization in the airway measured by metagenomic techniques provides information on the prevalence and factors associated with this colonization. This technique enables the detection of unknown and uncultivable fungi especially in children and identifies a larger population of fungal microbiota in CF that remains over time. Newly acquired isolations have an impact on the disease progression

P115 Molecular Identification of Non-Sporulating Moulds Isolated from Patients with Fungal Sinusitis M.G. Tan, J.H.C Sim, B.C. Khoo, L.L. Tan, A.L. Tan Singapore General Hospital, SINGAPORE, Singapore Objective: Morphological identification of moulds using traditional culture methods depends largely on the development of characteristic fruiting structures. However, a proportion of moulds do not display such features despite much efforts in attempting to encourage sporulation using various laboratory methods. In addition, clinical significance of these non-sporulating moulds is difficult to determine, especially when they were recovered from non-sterile sites and the identity is unknown. The objective of this study is to examine the utility of using molecular sequencing in identification of non-sporulating moulds and their significance when isolated from patients with chronic rhinosinusitis. Methods: Five moulds were isolated in 2017 from tissue and pus obtained from the nasal cavity or maxillary sinus in patients with chronic rhinosinusitis. They were isolated were subcultured onto Potato Dextrose Agar at 30◦ C were observed for sporulation for 3 weeks. They could not be identified due to the lack of distinctive features at the end of incubation period. These moulds were sent for further workup using molecular sequencing of. Briefly, DNA were extracted and PCR was performed using primers targeting ITS, D1/D1 region of the 28 s ribosomal subunit and, where necessary, beta-tubulin gene. Amplified products were purified, sequenced and compared with available sequences in NCBI. Results: All 5 non-sporulating moulds were successfully identified to species level using molecular sequencing. Three of 5 non-sporulating moulds were identified as Aspergillus fumigatus complex using sequences from ITS, D1/D2 region and beta-tubulin gene. None of the three displayed morphological features that were typical of Aspergillus species; white woolly growth with septated hyaline hyphae were observed. These isolates also failed to grow at 42◦ C, which is another feature typical of A. fumigatus complex. In two of the cases where tissue samples were sent for histological examination, presence of mycetoma was reported, supporting the significance of A. fumigatus complex isolated. The remaining two moulds were identified as Schizophyllum commune using sequences from ITS and D1/D2 regions. Of note, only one case presented clamp connections, spicules and basidiospores from direct staining of specimen with lactophenol cotton blue wet mount. Basidiocarps were only observed from the culture plates after 4 weeks of exposure to light and dark conditions. Histology showed fungal elements with eosinophilic collections. Otherwise, only hyaline and septated thin hyphae were seen from white woolly moulds for both cases. No pronounced odour was observed from the non-sporulating S. commune cultures. Conclusion: Identification of non-sporulating moulds using phenotypic characteristics has always been challenging for most mycology laboratory. In certain clinical scenarios, failure to fully identify the moulds may result in misdiagnosis and could potentially affect management. In this study, molecular sequencing has enabled the laboratory to successfully identify all non-sporulating moulds isolated from patients with chronic sinusitis. Coupled with histological findings, molecular sequencing has assisted the laboratory in determining the significance of such moulds and differentiating them from other fungal colonisers.

P116 The first Polish report of echinocandin resistant clinical Candida isolates MARTYNA Mroczynska, ANNA Brillowska-Dabrowska Gdansk University of Technology, GDANSK, Poland Objective: The echinocandins (anidulafungin, caspofungin and micafungin) are recommended as a first-line therapy for Candida infections. Micafungin is now widely used for prophylaxis and treatment for invasive candidiasis, caspofungin is used in patients with neutropenia who have high fever and are suspected to have fungal infection. Anidulafungin can be used also to treat esophageal candidiasis. During last decade, echinocandin resistant among various Candida species has emerged word wide. Depending on different country and studies, a variety of data on caspofungin and micafungin resistance among Candida strains are described. According to the research conducted in 2013 at 20 Polish hospitals, the frequency of non-albicans infections in Poland increases. There are some data on echinocandin resistance of Polish Candida spp. isolates determined by E-test, but so far in Poland there has been no information about the echinocandin resistance occurrence. Methods: We investigated the antifungal susceptibility of caspofungin and micafungin against 70 isolates of Candida spp. collected from patients admitted to Polish hospitals between 2008 and 2012. The echinocandin susceptibility was evaluated using the broth microdilution method according to the European Committee for Antimicrobial Susceptibility Testing. Results: In our study we examined caspofungin and micafungin susceptibility of 70 Candida isolates, including 50 C. albicans, 12 C. glabrata and 8 C. krusei. According to breakpoints criteria no alarming resistance to the tested agents was found, we identified 3 caspofungin and micafungin resistant C. albicans isolates. Conclusion: Based on our research, in Poland caspofungin and micafungin resistance of Candida isolates exists but as in the other country is also very low.

S92

P117 Analyses of prognostic factors in patients with candidemia: a retrospective cohort study Fujisaki Teikyo University, TOKYO, Japan

Medical Mycology, 2018, Vol. 56, No. S2

P120 Lung cancer patients: Aspergillus niger in the indoor environment in conjunction with the presence of Radon. JOSEF Dumanov1 , M Rudenko2 , D Nadarajah3 , C DiCicco4 Mycological Institute EU US, SPARTA, USA London Allergy Clinic, LONDON, United Kingdom 3 Pulmonary Medical Associates, NEWTON NJ, USA 4 Environmental Health Sciences, PITTSBURGH PA, USA 1

2

Objective: Patients with candidemia are associated with high mortality rates. The aim of this study was to analyse prognostic factors of clinical cases of patients culturally confirmed with candidemia over a period of 5 years (April 2009-March 2015) in Teikyo University Hospital. Methods: A total of 237 adult patients was positively diagnosed with candidemia based on culture method. Primary isolation was done by serum bottle culture for 2 weeks. Identification of Candida spp. was carried out by CHROMagar and VITEK2 methods. Scoring approach of prognostic factors based on vital signs, blood analyses, and backgrounds of the patients, was developed. Results: The identification of the 237 candidemia cases revealed 51.48% Candida albicans, 22.36% Candida parapsilosis, 16.03% Candida glabrata, 6.75% Candida tropicalis, 1.69% Candida krusei, 1.69% Candida guilliermondii.Prognostic factors in patients with candidemia caused by C. albicans showed sensitivity of 72.1% and specificity of 75.4%. Conclusion: Up to now, two scoring systems have been applied to evaluate the prognostic factors of patients in emergency, SOFA and APACHE II. However, there is no efficient and reliable scoring system to examine prognostic factors in patients with candidemia. Our propose system is a promising approach.

P118 Epidemiology and identification of organism on superficial dermatomycoses at tertiary hospitals in Korea: a prospective multicenter study Hyojin Kim1 , Sang-Jin Cheon2 , Ji Hyun Lee3 , Yang Won Lee4 , Joonsoo Park5 , Moo Kyu Suh6 , Je-Ho Mun7 , Sung Yul Lee8 , Jong Soo Choi9 , Eung Ho Choi10 , Jee-Bum Lee11 , Jin Park12 , Hee Joon Yu13 , Hyunchang Ko2 1 Inje University Busan Paik Hospital, BUSAN, South Korea 2 Pusan National University Yangsan Hospital, YANGSAN, South Korea 3 Seoul St. Mary’s Hospital, College of Medicine, The Catholic University of Korea, SEOUL, South Korea 4 Konkuk University School of Medicine, Konkuk University, SEOUL, South Korea 5 Catholic University of Daegu School of Medicine, DAEGU, South Korea 6 College of Medicine, Dongguk University, GYEONGJU, South Korea 7 Seoul National University College of Medicine, SEOUL, South Korea 8 Soonchunhyang University Cheonan Hospital, CHEONAN, South Korea 9 Yeungnam University College of Medicine, DAEGU, South Korea 10 Yonsei University Wonju College of Medicine, WONJU, South Korea 11 Chonnam National University Medical School, GWANGJU, South Korea 12 Chonbuk National University Medical School, JEONJU, South Korea 13 Hanyang University College of Medicine, SEOUL, South Korea Objective: Superficial dermatomycoses are fungal infections of skin, hair or nails, which are caused most commonly by dermatophytes. Those are very common diseases on dermatologic field, but prevalence and clinical characteristics vary with geographical areas and population. Moreover, pathogenic species change constantly over time. This multicenter study was undertaken to investigate the epidemiologic and clinical findings of superficial dermatomycoses in Korea during the period 2016–2017. In addition, we sought to identify the pathogenic organisms from three different kinds of fungal infections (tinea corporis, tinea faciale, and tinea capitis). Methods: Four hundred fifty three patients from the dermatology clinic of 13 tertiary hospitals in Korea were enrolled in the study. Demographics, their comorbidities, occupation, family history of superficial dermatomycoses, suspected routes of infection, and treatment were checked. The diagnosis of superficial dermatomycoses was based on clinical manifestation, and confirmed by KOH examination. Fungal cultures and molecular analyses were performed on patients with tinea corporis, tinea faciale, and tinea capitis. Results: Of the total of 453 patients, 275 were male and 178 were female. Mean age of patients was 51.4 (0.75–92) years. In past history, 214 patients (53.4%) had at least 1 of comorbidities. Overall fungal culture positivity was 77.8% (126/162). Trichophyton rubrum was the most common causative organism of tinea corporis (66.7%, 68/80) and tinea faciale (43.8%, 14/23), and Microsporum canis was the most common agent of tinea capitis (36.7%, 11/23). Conclusion: Trichophyton rubrum was the consistently most common causative organism in superficial dermatomycoses except tinea capitis in Korea.

P119 Superficial fungal infections in Sudan, data from the mycology reference laboratory in Khartoum Z. H.D. Osman1 , M.A.I. Ismail2 , E.S. Mahgoub3 1 Sudan International University, KHARTOUM, Sudan 2 The mycology reference laboratory, KHARTOUM, Sudan 3 University of Khartoum, KHARTOUM, Sudan Objective: this study aims to determine the frequency of dermatophyte and non-dermatophyte infection of hair, nail and skin samples in Khartoum Methods: this cross sectional study was conducted at the mycology reference laboratory in Khartoum, Sudan. All patients who visited the laboratory from January 2017 to December 2017 with suspected superficial fungal infection were included in the analysis. A total of 688 samples from hair, nail and skin were examined for presence of fungal elements using KOH and methylene blue preparations. A selected number of samples were cultured on Sabouraud’s dextrose agar with or without cycloheximide. Results: Of the 688 patients evaluated in this study, 406 (59%) were positive for presence of fungal elements in direct wet mount preparation. The average age of patients was 21–30 years with female to male ratio of 1.6. Of the 406 positive samples, (40.9%) were skin, 38.2% were nails (38.2%) and (20.9%) were from hair. Fungal hyphae were observed in 113 samples (27.8%) indicative for tinea corporis, while (6.9%) of hair samples showed ectothrix spores and (2.0%) showed endothrix spores denoting tinea capitis. Skin samples with suspected Malassezia species were (21.4%) and showed the characteristic thin hyphae and spores “spaghetti and meatballs”. A high frequency of budding yeast colonization was observed (41.9%) of the total positive skin and nail samples. Identification of prevalent fungal species by applying molecular tools is under process. Conclusion: We concluded that, superficial fungal infections are prevalent among patients visited the mycology reference laboratory in Khartoum, Sudan. Skin is the most frequently encountered sample with positive fungal element. Identification of the causative species as well as antifungal susceptibility testing is paramount for better management. Furthermore, exploring the predisposing factors for infection and a good hygiene will help to reduce the burden of superficial fungal infection.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Objective: A. niger in the indoor environment in conjunction with the presence of Radon. A common association with lung cancer? Patients, including those with having been diagnosed with lung cancer, reporting that when returning to their homes or the work place experiencing respiratory discomfort, allergenic responses or neurological disorder have such locations investigated for the cause or triggers of such effects. Often mold fungi are suspect due to visual observation or odor. Clinical hygienists investigating such areas have repeatedly identified A. niger in absence of other mold fungi genera when Radon (Rn) is present. Here, we investigate the association of A. niger and it’s sorptive quaility of radon’s permutation of Lead (Pb). We offer investigative cases, studies and resulting findings, involving patients suspected of environmental exposure to A. niger in association with radon. Some patients with lung cancer often attribute it to their exposure to radon. Both A. niger and Rn are known to initiators of lung cancer. These cases studies involved physicians prescribed indoor environmental exposure risk investigations for their patient’s possible exposure to indoor agents that may have been a factor, that may have been and or continue to be a promoter of their disease promoted by their reported observation of a suspect mold like presence in the basement. During the investigations hygienists employed subClinical environmental investigation protocols sC -1 and sC-3. Routinely the residential home was identified to have a porous basement foundation, with resulting water vapor and Rn gas intrusion. Aspergillus niger was identified along with high levels of Rn and moisture. Cases studied examine the possible association of, and the relationship to A. niger when in the presence of a mutation of Rn, Pb. Methods: Fungal biomass microscopy Moisture meter Infrared imaging of concealed areas of moisture and fungal activity Radon gamma radiation detector and counter Results: Radon and A. niger share a common environment: porous subterranean environments that allow water vapor intrusion predispositional for fungal activity and radon gas perfusion. Conclusion: Patients habituating in subterranean environments when A. niger is identified as being present may also be exposed to Radon.

P121 Comparison of three read-out methods for Sensititre YeastOne Alamar blue assay for determining Minimum Inhibitory Concentrations B. Nyuykonge, PETER D. Croughs, W.W.J. Van de Sande ErasmusMC, ROTTERDAM, Netherlands Objective: Madurella mycetomatis (M.mycetomatis) is the major causative agent of eumycetoma. Eumycetoma is a neglected, inflammatory tropical infection characterized by painless lesions, grains and draining sinuses. Currently, susceptibility testing for M. mycetomatis is not routinely performed, this is possibly due to the need to use hyphal suspension as a starting material, the slow growth rate and the need to use expensive dyes for endpoint visualization. Furthermore, pyomelanin is produced by several of the isolates, which might hamper the use of other viability dyes in in vitro susceptibility testing. Commercial systems such as the Sensititre YeastONE YO10 are available but are currently not used in clinical practice.The aim of our study was to determine whether the Sensititre YeastONE YO10 Alamar blue assay can be used to determine the in vitro susceptibility of M. mycetomatis towards several antifungal agents. Endpoint reading was performed visually, via Thermo ScientificTM SensititreTM Vizion Digital MIC Viewing System (SWIN) and spectrophotometric. This to assess if pyomelanin formation would interfere with the read-out systems. Methods: The susceptibilities of 10 clinical isolates of M. mycetomatis to anidulafungin, caspofungin, micafungin, amphotericin B, 5-flucytosine, posaconazole, voriconazole, itraconazole and fluconazole were determined with the Sensititre YeastOne YO10 Alamar blue assay following manufacturer’s manual. The Minimum Inhibitory concentrations, (MICs) were determined by visual reading, SWIN reading and spectrophotometric (absorbance). The MICs and levels of agreement between various read-out methods were compared. The effect of pyomelanin secretion on MICs for each read-out method was equally evaluated Results: The lowest MICS were observed with azoles itraconazole, posaconazole and voriconazole with MIC50s of 0.030.06 μg/ml for all the readout methods. Highest MICs were observed for echinocandins for all readout methods with MIC50s all >8 μg/ml. All isolates of M. mycetomatis were resistant to 5-flucytosine and variable for amphotericin B irrespective of the read-out. In general, there were no significant differences in MIC50s obtained from the various reading methods except for fluconazole with visual vs absorbance and SWIN vs absorbance with P < 0.01 and P < 0.05 respectively. A high interexperimental agreement was observed among the majority of the isolates for visual and SWIN readings. The levels of agreement range between 30–100% and 70–100% for identical MICs and MICs within 1 dilution step difference respectively. Equally, the agreement between visual and absorbance readings ranges between 0–90% and 30–100% for identical MICs and MICs within 1 dilution step difference respectively. Furthermore, the agreement between SWIN and absorbance readings was higher compared to visual and absorbance. This agreement range was within 20–90% and 50–100% for identical MICs and MICs within 1 dilution step difference respectively. Pyomelanin secretion had an influence on the expected colour change but no effects on the MICs determination by spectrophotometry. Conclusion: The present data suggest visual and SWIN methods are comparable to the spectrophotometer as they all exhibit high experimental agreement. Pyomelanin secretion has no effect on MICs of isolates despite its influence on the expected colour outcome

ABSTRACT

P122 Metabolomic approach to tap the potential of essential oils against Madurella mycetomatis - one of the most neglected fungal infections S. A. Khalid1 , S.O. Abd Algaffar2 , J. Hohmann3 , M. Elamin1 , E.D. Coy-Barrera4 , W.W. Van de Sande5 1 University of Science & Technology, OMDURMAN, Sudan 2 Faculty of Pharmacy, University of Science & Technology, Omdurman, Sudan, OMDURMAN, Sudan 3 Szeged University, SZEGED, Hungary 4 ´ Colombia Universidad Militar Nueva Granada, BOGOTA, 5 Erasmus MC, ROTTERDAM, Netherlands Objective: There is increasing demand to develop antifungals to combat Madurella mycetomatis which has been recently added to the list of Neglected Tropical Diseases (NTDs) by the 69th World Health Assembly in May 2016 as one of the most neglected and aggressive fungal infections. Despite the number of the knowledge gaps associated with M. mycetomatis, the treatment remains the most challenging due to the resistance of this fungus almost to all currently available chemotherapeutic options. Therefore, there is an urgent need for novel approaches to overcome the resistance, biofilm formation and virulence associated with this stubborn fungus. To confront these challenges a systematic approach involving the screening of the essential oils (EOs) of a dozen taxonomically diverse medicinal plants belonging to six botanical families including: Burseraceae, Cyperaceae Euphorbiaceae Lamiaceae, Myrtaceae, and Poaceae coupled with hyphenated analysis by GC/MS was attempted. Methods: Dried plants (200 gram) of different morphological parts were subjected to hydrodistillation and their EOs were analyzed by gas chromatography-mass spectrometry (GC-MS). Each of these EOs was screened for their in vitro antifungal activity against ten M. mycetomatis employing an already established XTT assay.1. Itraconazole was used as positive control. The efficacy and toxicity of each of the oils was tested in vivo on Galleria mellonella larvae and monitored for 10 days. The results were subjected to analysis by the principle component analysis (PCA). Results: Ten out of 13 tested oils exhibited antifungal activity against M. mycetomatis isolates at MIC range (0.1250.0039%v/v). The EOs of Commiphora myrrh, Croton zambesicus, Cymbopogon citratus, and Commiphora erythraea exhibited the lowest MIC50 values when tested on the isolates of M. mycetomatis, whilst the EOs of Melaleuca alternifolia. Eucalyptus camaldulensis, and Mentha spicata showed the highest MIC50 values. Other EOs showed moderate antifungal activity in tested isolates. GC-MS analysis resulted in the identification of diverse monoterpenes and sesquiterpenrs associated with antifungal activity. The results were subjected to chemometric analysis. The in vivo results consolidated the in vivo findings. Conclusion: Essential oils considered as potential sources of novel compounds acting in vitro as natural antifungal agents.

S93

P124 Association of chromoblastomycosis and subacute cutaneous Lupus: Case report ´ C. M P S Azevedo1 , NATALIA NUNES2 , EDITH M M BATISTA2 , RENATA R GOMES3 , V A VICENTE3 , DWCL SANTOS4 , M C SILVA5 , S G MAQUES2 , P G R FURTADO6 1 ˜ LU´IS, Brazil ˜ SAO Federal University of Maranhao, 2 ˜ LU´IS, Brazil UFMA, SAO 3 UFPR, CURITIBA, Brazil 4 ˜ PAULO, Brazil UNIFESP, SAO 5 ˜ LU´IS, MARANHAO, ˜ CEUMA, SAO BRASIL, Brazil 6 ˜ LU´IS, MARANHAO, ˜ LAB CEDRO, SAO BRASIL, Brazil

References Ahmed, A.O. et al. Antimicrobial Agents and Chemotherapy, 48 (7), 2742–46, 2004.

Objective: To report the case of a patient with chromoblastomycosis (CBM) and subacute cutaneous lupus erythematosus (SCLE) and to evaluate the systemic inflammatory response Methods: This is a descriptive study of a clinical case of chromoblastomycosis in a patient, with a biopsy and blood collection. From the biopsied skin sample, culture, direct examination, histopathology and genetic sequencing of the fungus were performed to confirm the CBM. IL-6, IL-10, IFN-γ , TNF-α and IL-17A cytokines were quantified by Cytometric Bead Array (CBA) Mouse Th1 / Th2 / Th17 Cytokine Kit. Results: Male, 52 years old, with diagnosis of SCLE under treatment for 5 years, in the use of chloroquine and methotrexate, with disease under control. The patient presents cicatricial lesion, with circinate borders, that extended with infiltrative aspect in area of “”the knee, characterized also by areas of fibrosis and intense desquamation, impeding the ambulation and the correct extension of the right lower limb. Histopathological examination of skin biopsy showed muriform cells with intense fibrosis and granulomas. Culture of skin biopsy was positive for black mould suggestive of F. pedrosoi. Molecular identification by genetic sequencing of ITS region confirmed Fonsecaea pedrosoi as causative agent. In the evaluation of serum inflammatory response, only IL-6 was detected, which was more evident after 6 months of methotrexate suspension, from 3.47 pg/mL to 14.9 pg/mL. The initially slow therapeutic response, despite being prescribed 400 mg/day of itraconazole, only shows reduction of the lesion after the introduction of Imiquimod (topical imumodulator) Conclusion: It is the first study known to report the association between CBM and SCLE. The CBM of the patient has low therapeutic response, as expected for the severe disease, presenting better response after the introduction of Imiquimod, showing a drug with good perspective of adjuvant therapy. The causative agent found is Fonsecaea pedrosoi, the most isolated agent in Brazil Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 420732 9c58ec84-5a0c-42ac-890d-5bf2e24 bdeb8.DPI 300.jpg Caption 1: Initial lesion Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 420732 9c58ec84-5a0c-42ac-890d-5bf2e24 bdeb8.DPI 300.jpg Caption 2: Genetic sequencing

P123 Fluconazole resistance in Candida parapsilosis in India and analysis of sterol biosynthesis gene (ERG11)

P125 Emerging infections due to Rhizopus microsporus in India: Series of eight cases from a single centre

A. Singh, P. K. Singh, A. Chowdhary Vallabhbhai Patel Chest Institute, University of Delhi, Delhi-110007, DELHI, India

I. Xess1 , M. Pandey2 , G. Singh2 , R. Agarwal2 , R. Kumar2 , V.P. Jyotsna2 1 All India Institute of Medical Sciences, NEW DELHI, India 2 AIIMS, NEW DELHI, India

Objective: Candida parapsilosis, an emerging pathogenic species among non-albicans Candida, from bloodstream infections (BSIs) in varied geographical locations. C. parapsilosis is responsible for about 12 to 17% of cases of candidemia in the United States and most common cause of BSIs in Latin America. Although much is known concerning azole resistance in C. albicans, considerably less is understood about C. parapsilosis. The present study aimed to explore azole resistance among Indian clinical C. parapsilosis isolates and investigated the azole resistance mechanism using sterol biosynthesis gene (ERG11) sequencing. Methods: A total of 120 C. parapsilosis isolates collected from eight tertiary care hospitals in Delhi, and the adjoining National Capital Region, during a 3-year surveillance study of candidiasis from 2015 to 2017. All isolates were identified by MALDI-TOF MS using Flex Control 3.1 software (Bruker Daltonics). The antifungal susceptibility testing was carried out using the CLSI broth microdilution method, (M27-A3) against azoles, amphotericin B and flucytosine. A total of 22 isolates categorized as Fluconazole non susceptible (susceptible dose dependent, SDD MICs 4 mg/L and resistant MIC ≥8 mg/L) according to clinical break points CLSIM27/S4 2012 were subjected to ERG11 gene sequencing. Results: All isolates were C. parapsilosis sensu stricto; no C. orthopsilosis or C. metapsilosis isolates were included in the study. Blood stream isolates accounted for 57% (n = 68) isolates and the remaining 43% (n = 61) were from sputum (n = 32), bronchoalveolar lavage (BAL, n = 26), urine (n = 2) and skin (n = 1). Among the azoles, itraconazole (ITC; GM MIC 0.07 mg/L), voriconazole (VRC; GM MIC 0.05 mg/L), and posaconazole (POS; GM MIC 0.03 mg/L) exhibited potent activity. Remarkably, overall 34% (n = 41) of isolates were non-susceptible (NS) to fluconazole including 85% (n = 36) resistant (MIC ≥ 8 mg/l) and 5% (n = 6) were SDD (MIC 4 mg/l). Among 41 non-susceptible FLU isolates, 22% (n = 9) were also NS to VRC (n = SDD) and 19.5% (n = 8) exhibited SDD MIC (0.25-0.5 mg/L) to ITC. Further single isolate each (both FLU resistant) were also resistant to VRC and ITC (GM MIC 1 mg/L). Among 36 Flu resistant isolates 19 were screened for ERG11 substitutions by comparing the Erg11 sequence of ATCC 22019 C. parapsilosis isolate. Interestingly, all FLU resistant isolates screened exhibited two different amino acid substitutions K143R (n = 17) and Y132F (n = 3). Further, three C. parapsilosis isolates that had FLU MICs in SDD category screened for ERG 11 substitutions showed wild type phenotype whereas a single isolate had Y132F. Also, in three FLU susceptible isolates ERG11 sequences exhibited wild type genotype. Conclusion: The study reports first molecular analysis of azole resistant C. parapsilosis isolates from India and highlights a high FLU resistance of 34% among Indian isolates. Amino acid substitution, K143R is reported for the first time in FLU resistant C. parapsilosis in this study, which is previously strongly associated with FLU resistance in C. albicans. Further, studies to elucidate the role of multidrug transporters and expression of ERG11 isolates is warranted to gain insight in azole resistance.

Objective: The study aimed to review epidemiology, clinical features, treatment modalities and outcome of mucormycosis by emerging R.microsporus in our tertiary care centre. Methods: Over a period of three years from January 2014 to December 2016 all culture positive case of mucorales causing infections were included in the study. Cultures were identified by phenotypic and genotypic methods. Phylogenetic relatedness was studied among Indian isolates and other reported cases from the world. Results: During study period of three years, R.microsporus was identified in eight cases among a total number of 45 culture positive mucorales (18%). Seven of eight cases cases were diagnosed as rhino-orbital-cerebral mucormycosis and one with pulmonary mucormycosis. Diabetes mellitus was the most common (7/8) underlying predisposing condition followed by Chronic Myeloid Leukemia (1/8). The most common variety isolated was R. microsporus var. rhizopodiformis (7/8) followed by R. microsporus var. oligosporus.(1/8) Fatal outcome was recorded only in two cases (25%). Surgical debridement followed by liposomal amphotericin B was the mainstay of treatment in all the cases except in one who succumbed before initiation of antifungals. Conclusion: Our study reported for the first time such a large number of cases of invasive fungal infections by R. microsporus in immunocompromised individuals from a single institute of India. As incidence of mucormycosis is increasing and mortality remains high, awareness for this emerging fungal pathogen and timely and accurate management is warranted.

P126 Accurate PCR-based identification of Candida auris infections using oligonucleotides based on auris-specific GPI-protein encoding genes ´ 2, EULOGIO Valentin-Gomez1 , ALBA C Ruiz-Gaitan2 , JORDAN Fernandez-Pereira3 , ELENA Eraso-Barrio4 , JAVIER Peman PIET W.J. De Groot3 1 University of Valencia, VALENCIA, Spain 2 Health Research Institute La Fe, VALENCIA, Spain 3 University of Castilla-La Mancha, ALBACETE, Spain 4 University of Pais Vasco, BILBAO, Spain Objective: Candida auris is an emerging pathogen that is increasingly being identified as cause of life-threatening systemic infections in human societies around the world. Due to its low susceptibility to antifungal compounds, mortality rates of C. auris are high and, therefore, rapid and accurate diagnosis is crucial to successfully cure infected patients and to control outbreaks of C. auris. With the current methodologies available in most hospitals, achieving accurate species-level diagnosis of C. auris infections is complicated and has led to misidentifications with direct consequences for treatment and curing prospective. The aim of our study was to provide a new and easily accessible diagnostic tool for rapid and reliable identification of Candida auris infections. Methods: By in silico predicting GPI proteins in C. auris on a genome-wide scale, and subsequently designing oligonucleotides for auris-specific GPI protein-encoding genes and then applying these in a rapid colony PCR method, we intent to develop a new diagnostic tool for identification of C. auris infections Results: We show that C. auris isolates are easily and reliably identified by our PCR method. Robustness of the method was verified by blind testing of a library of 142 clinical isolates including 113 C. auris isolates (55 blood isolates and 58 isolates from other body sites) from a Spanish hospital (La Fe, Valencia), 27 C. auris isolates derived from hospitals in various countries (Spain, India, Colombia, Brazil, Japan, and Korea), and two non-auris isolates as negative controls. Specificity of the primers for C. auris was also validated using a set of representative Candida species including the clinically most important (e.g. C. albicans, C. parapsilosis and C. glabrata) and the phylogenetically more related C. lusitaniae and C. haemulonii. Moreover, we show that isolates that were not or not reliably identified by MALDI-TOF MS identification are correctly identified by our PCR approach. Conclusion: We propose that our PCR method based on unique GPI protein-encoding genes may be useful to achieve easy, timely and accurate diagnosis of C. auris infections, in particular for hospitals and countries where healthcare budgets do not allow acquisition of expensive MALDI-TOF, qPCR or sequencing technology.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

S94

P127 Evaluation of three cases of mycotic keratitis caused by Fusarium solani sensu stricto (FSSC5) HAZAL Boral1 , ANNE Van Diepeningen2 , ELIF Erdem1 , MELTEM Yagmur1 , G. SYBREN De hoog3 , MACIT Ilkit1 , JACQUES F Meis4 , A.M.S. Al-Hatmi3 1 C¸ukurova University, ADANA, Turkey 2 Wageningen University and Research, WAGENINGEN, Netherlands 3 Westerdijk Fungal Biodiversity Institute, UTRECHT, Netherlands 4 Canisius Wilhelmina Hospital, NIJMEGEN, Netherlands Objective: Owing to a lack of appropriate diagnostic and therapeutic approaches for mycotic keratitis, approximately one million cases of preventable corneal blindness are reported each year. The number of keratitis cases due to infection with Fusarium is increasing significantly worldwide and many cases are not treated adequately and in a timely manner due to frequent misdiagnosis. Species level identification of Fusarium strains that cause keratitis is important, since antifungal susceptibilities may vary between different species of the genus. In the current report, we describe three keratitis cases caused by Fusarium solani sensu stricto (FSSC5) from Turkey and The Netherlands, following ocular trauma. Methods: Corneal scrapings from the ulcers (Figure 1) of all of the patients were inoculated as multiple ‘C’ streaks on blood agar and brain heart infusion agar plates and incubated at 37◦ C; Sabouraud glucose agar and potato dextrose agar plates and incubated at 28◦ C. Preliminary identification at the genus or species complex level of the isolates was performed by analysis of macro- and micro-morphology on 2% malt extract agar, incubated at 24◦ C. Further identification of the strains was undertaken by partial sequencing of the elongation factor 1 alpha gene. Antifungal susceptibility testing was performed as described in the CLSI document M38-A2 using the following drugs: amphotericin B, fluconazole, itraconazole, voriconazole, posaconazole, isavuconazole, micafungin, and anidulafungin. Results: Fungal growth was recorded on SGA and PDA plates as woolly, cream-colored aerial mycelia, and colonies with cream-colored reverse. The strains (CBS 138564, CWZ 5051826267, and CWZ 6080556699) were consequently identified as F. solani sensu stricto according to results of a BLAST search against the sequences in GenBank. The etiological agent of keratitis exhibited low minimum inhibitory concentrations (MICs) of 1 μg/mL against amphotericin B, and high MICs above the published epidemiological cut off values for voriconazole (8 μg/mL). Patients were successfully treated with topical amphotericin B and voriconazole and recovered completely (Figure1). Conclusion: Although 5% natamycin is currently the most widely used topical polyene for keratitis, especially for Fusarium strains, this drug is not widely used in many countries, including Turkey and The Netherlands. Hence, the combination therapy with voriconazole and natamycin may be an alternative treatment for keratitis caused by Fusarium species. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 420762 6cbc0178-41ab-489f-9c53574179185f82.jpg Caption 1: Clinical appearance before (a, b) and after (d) the treatment and PAS-staining (c) analysis of one of the cases.

P128 Plants of the genus Copaifera: new therapeutic option for the treatment of candidiasis. 1 ´ , J.K. Bastos4 , M.J.S. Giannini3 R. H. Pires1 , M.C. Mello2 , L. Scorzoni3 , M.C. Silva1 , S.R. Ambrosio 1 University of Franca, FRANCA, Brazil 2 University of Franca, FRANCA, Brazil 3 ˜ Paulo State University - UNESP - School of Pharmaceutical Sciences, ARARAQUARA, Brazil Sao 4 University of Sao Paulo, RIBEIRAO PRETO, Brazil

Objective: The anti-Candida activity of leaf extracts extracted from Copaifera spp. were evaluated against planktonic cells as well as biofilm formation. Methods: The effects of the extract of Copaifera species (C. paupera Dwyer, C. reticulata Ducke, C. multijuga Hayne, C. pubiflora Benth, C. duckei Dwer and C. langsdorffi Desfontaine) on Candida species (C. albicans ATCC 5314, C. glabrata ATCC 2001, C. parapsilosis ATCC 22019, C. krusei ATCC 6258 and C. tropicalis ATCC 13803) were assessed by both the microdilution method with revelation by resazurin and in vivo using a nematode model. Effect of extract on Candida biofilm formation was assessed by XTT [2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide] reduction assay. Results: The best results obtained were for C. reticulata (CR) and C. paupera (CP), which showed a minimum inhibitory concentration of 0.09 μg/mL and 0.18 μg/mL, respectively, against Candida glabrata. Results showed that CR at 2.9; 5.8; 11.6 and 23.4 μg/mL prolonged the survival of C. elegans infected by C. glabrata in 68 to 75% when compared to infected and untreated larvae. Similarly, when the treatment was performed with CP, survival percentages were higher than 75%. CR and CP inhibited the formation of biofilms by C. glabrata at the concentration of 46.87 μg/mL. Conclusion: The findings from this study demonstrated that CR and CP extracts have anti-Candida activities and might be useful in the development of pharmaceutical products becoming an alternative therapeutic agent for candidiasis in the future.

Medical Mycology, 2018, Vol. 56, No. S2

P130 A High Resolution Melting Point Analysis Based Simplex PCR Assay Enables Reliable Identification of Clinically Relevant Candida Species G. Fidler1 , E. Leiter1 , S. Kocsube2 , E. Tolnai1 , S. Biro1 , M. Paholcsek1 University of Debrecen, DEBRECEN, Hungary University of Szeged, SZEGED, Hungary

1 2

Objective: The genus Candida corresponds to the most important opportunistic mycoses in the world. Among the Candida species causing invasive candidemia, nearly 95% of episodes are caused by Candida albicans, Candida glabrata, Candida parapsilosis, Candida tropicalis and Candida krusei. The remaining 5% of candidemias are caused by species, such as C. guilliermondii, C. dubliniensis provoking superinfections due to their low sensitivity to broad-spectrum antifungals. The correct identification of Candida species is of high importance because knowledge of species identity may influence adequate antifungal therapy. Here we introduce a molecular method which can identify and differentiate among seven relevant Candida species (Candida albicans, Candida glabrata, Candida parapsilosis, Candida tropicalis, Candida krusei, C. guilliermondii, C. dubliniensis) using a single primer pair for the amplification followed by a post-PCR Tm calling assay coupled with high-resolution melting analysis. The denaturation of the target DNA amplicons defines the characteristic melting peaks and the shape of the derivative melting curves represents the taxonomic footprints of the tested Candida strains. Methods: Primer design: We targeted the Candida beta-tubulin genes, and screened the sequences for melting domains covering enough mismatches to proper discrimination of the Candida species. Real time PCR platforms: Real-time PCR amplification reactions were optimized for three different PCR platforms: (P1) R 96, (P2) LightCycler R Nano (Roche Applied Science) and (P3) LightCycler R 2.0 Instrument (Roche DiagLightCycler nostics). For the amplification we used the LightCycler 480 High Resolution Melting Master (Roche). Discriminatory power, specificity and limit of detection: 7 Candida reference strains and 38 pre-characterized Candida clinical strains were investigated using our method. Cross-reactivity was tested on 34 Aspergillus strains, 10 Grampositive and 6 Gram-negative bacteria strains and on human genomic DNA. Limit of detection was measured using whole blood samples collected from healthy volunteers spiked with Candida cells in a 6 log range. Results: We optimized our method successfully on the tested PCR platforms and we could create 7 different melting clusters, representing the different Candida species (Figure 1.). Our method proved to be accurate and reliable. All of the 38 Candida clinical samples showed melting peaks in a close range of the reference strains. No cross-amplification was detected with human genomic DNA and with the G- and G+ bacteria. Contrarily mild cross reaction was detected with some Aspergillus strains providing Tm peaks at 86.35±0.16◦ C and displaying inconclusive HRM curves and peaks. The intra- and inter-assay consistency analysis also proved the accuracy of our assay. The analytical sensitivity with the lowest concentration of template DNA where reliable identifications with conclusive melting peaks and HRM curves were attainable proved to be 10 cells/1 ml whole blood on all platforms. Conclusion: Here we describe our CanTub-simplex HRM method which is able to identify 7 clinically relevant Candida species. It is sensitive, cost-effective and can provide results with a short turnaround time. The clinical validation, which includes testing our assay on hemocultures, biofilms and blood samples of patients with fevered neutropenia is now in progress. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 421002 aabdb05f-2362-41b7-bb304c81e949b0fa.jpg Caption 1: Figure 1. Whisker plots representing the seven melting clusters of the different Candida species on the three PCR platforms.

P131 A case of toenail onychomycosis with mite infestation in pustular psoriasis patient Tomotaka Sato Teikyo University Chiba medical center, ICHIHARA CITY, CHIBA-KEN, Japan Objective: A rare case of onychomycosis with mite infestation is described and discussed. Methods: A 75-year-old male pustular psoriasis patient underwent foot check of psoriasis toe nail. On clinical examination, distal and lateral subungual onychomycosis of left big toe was present. Dermoscopy, KOH direct microscopic examination of nail fragments, fungal culture and histological examination were performed. Results: KOH direct microscopic examination of nail fragments showed septate hyphae, and the surprising observation was the presence of in the subungual debris of several small mites in the forms of adults and ova indicating a true colonization not only a simple environmental colonization. Conclusion: Such a combination of onychomycosis and mite infestation of the same nail is an exceptional case but we have to be careful for not only fungal infection but also mite infestation of the same nails in psoriasis patients. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 421095 9cdc1fab-a55d-4905-997171bbfb3eb234.jpg Caption 1: combination of onychomycosis and mite infestation

P129 Alterations of Certain microRNA Expressions in Fevered Neutropenia Patients ´ 1 , R. Szasz ´ 2 , L. Rejto2 , S. Biro´ 1 , M. Paholcsek1 E. Tolnai1 , G. Fidler1 , K. Nwozor1 , A. Toth 1 University of Debrecen, DEBRECEN, Hungary 2 University of Debrecen,Institute of Internal Medicine, DEBRECEN, Hungary Objective: MicroRNAs (miRNAs) are small 19- to 23- nucleotide long, single-stranded RNA molecules. MiRNAs normally target several mRNAs through complementary base pairing with 3’- untranslated region (3’-UTR) of the corresponding target mRNAs. MiRNAs have been shown to be involved in various biological processes, including pattering of the nervous system, inflammation and immunity, cell death and proliferation, and development. MiRNAs can be detected in all kind of biological fluids. Aberrant expression of miRNAs have been associated in many diseases, and miRNA-based therapies are in progress. Accumulating evidence demonstrates that specific miRNAs can be a great promise as novel biomarkers for clinical diagnosis of many types of diseases. Invasive mycoses are life-threatening systemic fungal infections mainly caused by opportunistic strains such as, Candida, Aspergillus etc. which can invade host tissues and cause severe invasive infections (IFIs), especially in patients with neutropenia, hematologic malignancies and in patients undergoing hematopoietic stem cell transplantation. Our aim was to investigate miRNA expression profiles in patients, with fevered neutropenia. In this study we hypothesized that invasive mycosis could change the miRNA profiles in the blood during neutropenic fever provoked by different fungal infections. We intended to identify miRNAs showing altered expression under the above mentioned conditions. Our goal was to make a rapid test supporting diagnosis of IFIs. Methods: We investigated the expression levels of the following miRNAs (mir-16-5p, mir-21-5p, mir-155-5p, mir-26b-5p, mir-494-3p, mir-142-3p, mir-142-5p, mir-26a-5p, mir-375, mir-101-3p, mir-31-3p, mir-146-3p, mir-28-5p, mir204-5p, mir-21-5p, mir16-1-3p, mir140-5p, mir29a-3p, mir132-3p) in different blood samples. We obtained blood samples from 17 patients suffering neutropenic fever and from 5 healthy volunteers. We extracted total RNA from whole blood using the Magmax mirVana Total RNA isolation Kit (Thermo Fisher Scientific). MiRNAs were reverse transcribed to cDNA with TaqMan advanced miRNA cDNA Synthesis kit (Thermo Fisher Scientific). TaqMan quantitative real-time PCR (miRNA assay, Thermo Fisher Scientific) was used for detecting miRNA expression profiles. Relative mRNA expressions were calculated with the Ct method using mir191 as internal control. Results: The purpose of this study was to investigate the possible involvement of certain miRNAs by measuring their expression profiles in fevered neutropenia and fungal infections. We profiled a set of 19 miRNAs of 22 patients. The results unequivocally showed that fungal infection significantly alters the expression of several miRNAs examined. The level of expression of mir155, mir142, mir26, mir28, mir16, mir21, and mir132 were significantly altered in these conditions. Conclusion: These observations suggest that miRNAs can be used as informative biomarkers to assess and monitor the body’s physiopathological status. We concluded that miRNA might be an important component of the pathogenesis of fungi infection associated with neutropenic fever. Pharmacological interventions targeting miRNAs could have the potential to limit the pathological response following infection.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

P132 Onychomycosis: Antifungal terapeutical potential of nanoparticles against C. parapsilosis B. G. Almeida1 , M.T.G. Almeida2 , M.H. Paziani3 , T.H. Lemes1 , G. Byzynski1 , D.P. Volanti1 1 ˜ JOSE´ DO RIO PRETO, Brazil ˜ Paulo State University (Unesp), Institute of Biosciences, Humanities and, SAO Sao 2 ˜ JOSE´ DO RIO PRETO, Brazil Medical Faculty -FAMERP, SAO 3 ˜ ˜ Paulo, RIBEIRAO PRETO, Brazil University of Sao Objective: The present study aimed to evaluate the antifungal activity and cytotoxicity of silver-based nanocomposites deposited in hydroxyapatite synthesized by the hydrothermal method assisted by microwave. Methods: Tests to obtain the antifungal activity of silver nanoparticle combined with hydroxyapatite were carried out in three different concentrations, on strains of Candida parapsilosis strict sensu using the recommendations of Clinical and Laboratory Standards Institute (CLSI) M27-A2. Toxicity testing of the nanostructure in Galleria mellonella was used as extrapolation to future treatment studies for onychomycosis. Results: Results proved that nanoparticle of hydroxyapatite and silver has biocidal activity against C. parapsilosis, and in comparison, with pure silver nanoparticle, the antifungal potential was higher for all concentrations. Considering toxicity assays, no one formulation of nanostructured silver-hydroxyapatite showed toxic for Galleria mellonella, nevertheless, face to nanostructured pure silver, this event was observed. Conclusion: The silver nanoparticles synthesized and analysed in this study were found to have stronger antifungal potency not yet described in the earlier reports. It is clear that the new way of synthesis of the nanoparticle of silver-hydroxyapatite could be used effectively as topic treatment for onychomycosis, considering no existence of toxicity.

ABSTRACT

P133 Korean Guideline for the diagnosis and treatment of onychomycosis: A Consensus Update by Korean Society for Medical Mycology J. Park1 , J.H. Nam2 , J.H. Lee3 , J.S. Park4 , J.H. Mun5 , Y.W. Lee6 , J.S. Choi7 , M.K. Suh8 , K.H. Kim9 , W.J. Lee10 , J.B. Lee11 , H.C. Ko12 , H.J. Kim13 1 Chonbuk National University Medical School, JEOJNU, South Korea 2 Sungkyunkwan University School of Medicine, SEOUL, South Korea 3 College of Medicine, the Catholic University of Korea, SEOUL, South Korea 4 The Catholic University of Daegu School of Medicine, DAEGU, South Korea 5 Seoul National University College of Medicine, SEOUL, South Korea 6 Konkuk University School of Medicine, SEOUL, South Korea 7 Yeungnam University College of Medicine, DAEGU, South Korea 8 College of Medicine, Dongguk University, DAEGU, South Korea 9 College of Medicine, Hallym University, ANYANG, South Korea 10 Kyungpook National University School of Medicine, DAEGU, South Korea 11 Chonnam National University Medical School, GWANGJU, South Korea 12 School of Medicine, Pusan National University, PUSAN, South Korea 13 College of Medicine, Inje University, PUSAN, South Korea Objective: The executive committee for treatment guideline of onychomycosis of in Korean society for medical mycology is aimed to provide an up-to-date, practical, algorithmic guideline for the management of onychomycosis in Koreans. Methods: The executive committee thoroughly reviewed thoroughly relevant literatures collected on MEDLINE, PUBMED, EMBASE, RISS, and Google scholar. Then, the structured algorithm was developed through a full discussion, robust agreement between members, and, ultimately, voting on the conflicting subjects. Results: The presence of clinical signs such as yellow discoloration or thickening of the nail, onycholysis, is highly predictive; however, mycological examination (i.e. KOH, fungal culture, histopathological analysis) should be done to confirm clinical suspicion of onychomycosis and rule out other nail disorders before starting the treatment. Simple noninvasive dermoscopy can enhance clinician’s diagnostic accuracy and allow determination of the best site for adequate sampling. Various therapeutic options are available for onychomycosis and the mainstays of the therapy are topical and systemic antifungal agents. Currently, there are available antifungal agents in Korea that include oral terbinafine, itraconazole, fluconazole and topical efinaconzole, ciclopirox, amorolfine. Factors that may influence the selection of topical versus systemic therapy are the nail variables (clinical subtype, disease severity), patients’ variables (underlying medical illness, drug-drug interactions). Although systemic agents yield better cure rates, there has been a great emphasis on the development of topical agents as they have fewer side effects and drug interactions. For mild cases (DLSO 50% nail involvement of DLSO, PSO, TDO, dermatophytoma, spike, subungual hyperkeratosis >2 mm) if there are no contraindications to systemic antifungal agents. Oral terbinafine is the first-line medication for dermatophyte infection; however, it may be changed depending on the causative fungi. Combination treatment of topical and systemic antifungal agents is recommended to increased efficacy in severe cases. Adjuvant treatments, physical or chemical removal of the involved nail, are typically reserved for patients who cannot be successfully treated with medical treatment alone. Alternative treatments includes laser therapy (Nd:Yag or diode laser) or photodynamic therapy. They can be performed when standard medical treatments cannot be applicable regardless of the severity of onychomycosis. Currently, lasers are only approved for temporary cosmetic improvement of the nail on onychomycosis. During the treatment period, proper evaluation of treatment response at 3, 6, 12, 18 months after the completion of the treatment should be rendered. After a patient has achieved effective cure ( 4 antagonistic. Results: The combination of fluconazole with lactoferrin significantly reduced the MIC of fluconazole against Candida auris isolates. The MIC of fluconazole decreased from > 64 μg/ml to 1–16 μg/ml against 20 of the 21 isolates included. The combination of fluconazole with cyclosporin A did not alter the MIC of fluconazole. The effect of the combination of fluconazole with lactoferrin against 16 of the isolates was interpreted as additive and against the other five isolates was indifferent. On the other side, the effect of the combination of fluconazole with cyclosporin A against all the isolates studied was indifferent. Conclusion: The combination of fluconazole with cyclosporin A or lactoferrin did not show synergistic effect against Candida auris isolates studied, although lactoferrin-fluconazole combination significantly reduced the fluconazole MICs against most of the isolates. Funding: This study was partially financed by GIC15/78 IT-990-16 (Gobierno Vasco-Eusko Jaurlaritza), and SAF2017-86188P (MINECO, Spain).

P151 Anti-biofilm Activity of the synthetic peptide hLF 1–11 against different Candida species in Lumen Catheters R. Fais1 , M. Di Luca2 , C. Rizzato1 , P. Morici3 , D. Bottai1 , A. Tavanti1 , A. Lupetti1 1 University of Pisa, PISA, Italy University Medicine, BERLIN, Germany 3 NEST, PISA, Italy 2

Objective: Candida species are human opportunistic fungal pathogen responsible for superficial as well as systemic infections, mainly in immunocompromised individuals. The ability to grow as a biofilm embedded community resistant to most antifungals is a common trait shared by several clinically relevant species. Among these, C. albicans, C. parapsilosis, C. tropicalis, C. glabrata, represent common causative agent of nosocomial infections associated with medical prosthetic devices. The high mortality rate associated to catheter related infections points to the pressing need for new antifungal drugs, which are able to eradicate biofilmassociated mycoses. The present study aimed at analyzing the inhibitory activity of the synthetic N-terminal lactoferrin-derived peptide (hLF 1–11) against biofilms produced by clinical isolates of different Candida species characterized for their biofilm forming ability and different fluconazole susceptibility in an in vitro model of catheter-associated biofilm production. Methods: Catheter-associated Candida biofilm production was used to assess the hLF 1–11 ability to reduce biofilm formation in a catheter lumen by evaluating CFU/mL reduction and biofilm architecture changes using confocal laser scanning microscopy. PeripheralTeflon catheters (PVC) of 1 mm diameter and 32 mm length were used for biofilm formation assays and aseptically cut into 30 mm pieces. Control samples were represented by catheter pieces inoculated with an equal volume of Candida untreated cells. Following a 24 h incubation at 37◦ C, all colonized catheters were washed in PBS. Control and treated catheters were sonicated and yeast suspensions were plated on SD agar for colony-forming unit (CFU) counting. Two different experimental conditions were used to assess the peptide anti-biofilm activity: 4-fold diluted RPMI in sodium phosphate buffer and 10% glucose solution, with hLF 1–11concentrations ranging from 22 mg/L to 88 mg/L. Results: The results obtained showed that hLF 1–11 was able to induce a reduction of sessile cell viability starting from a peptide concentration of 44 mg/L in both experimental conditions. A more pronounced anti-biofilm effect (up to 3.5-log reduction) was observed when a 10% glucose solution was used as experimental condition, mimicking the environment associated to parenteral nutrition, on both early and preformed C. parapsilosis and C. albicans biofilms. hLF 1–11 showed a less pronounced inhibitory activity on C. tropicalis and C. glabrata biofilms (from 2 to 3 log reduction at the highest concentration only), while no activity could be detected on mature biofilm formed by these two species. CLSM imaging confirmed the peptide activity on biofilm formation depicting low number of viable fungal cells on the peptide-treated catheter lumen compared to untreated catheters. Conclusion: The overall findings candidate hLF 1–11 as a promising agent to prevent biofilm formation by all the Candida species tested and to treat Candida albicans and Candida parapsilosis mature biofilms grown on PVC catheters.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Medical Mycology, 2018, Vol. 56, No. S2

P152 Otomycosis in Western Iran: Clinical and Mycological Aspects K. Ahmadikia1 , MOHAMMAD Yarahmadi2 , ASGHAR Sepahvand3 Tehran University of Medical Sciences, TEHRAN, Iran Department of Medical Parasitology and Mycology, School of Public Health, Tehran, TEHRAN, Iran 3 Razi Herbal Medicines Research Center, Lorestan University of Medical Sciences,, KHORRAMABAD, Iran 1

2

Objective: Otomycosis is a globally distributed superficial infection of the auricle and external auditory canal. Its incidence differs in various geographical regions due to the different climatic conditions. The aim of this study was to determine the incidence of otomycosis in Khorramabad, Lorestan province, western Iran, using mycological besides clinical criteria Methods: In this cross-sectional descriptive study, a total of 79 patients clinically suspected to otomycosis were recruited from April 2014 to April 2015. Specimens were collected using sterile swabs. All the specimens were subjected to direct examination using 10% KOH, and culture in Sabouraud dextrose agar containing chloramphenicol, malt-extract agar, and Czapek Dox agar. CHROMagar candida and carbohydrate assimilation profile in API 32 C were used for the identification of yeasts. Results: Among 79 patients, 15 (19%) were confirmed for otomycosis. The most common agent was Candida albicans (5, 33.33%), followed by Aspergillus flavus (4, 26.64%), Penicillium spp. (3, 19.98%), A. niger (2, 13.32%), and Alternaria spp. (1, 6.66%). Females were the dominant involved group (11, 73.33%) and itching was the most frequent clinical compliant in 100% of cases with otomycosis. Conclusion: Regarding the dissimilarity in fungal spectrum in our study and other investigations and unspecificity of clinical signs and symptoms for otomycosis, mycological examination could be a beneficial measure for accurate diagnosis and treatment of otomycosis

P153 Repertoire of natural polymorphisms in genes involved in Candida albicans resistance to antifungal: a powerful tool to highlight resistance mutations E. Sitterle´ 1 , A. Coste2 , C. Maufrais3 , N Sertour4 , D. Sanglard2 , C. D’Enfert4 , M.E. Bougnoux1 1 Institut Pasteur, INRA, Universite´ Paris Descartes, AP-HP, PARIS, France 2 Institute of Microbiology, University of Lausanne and University Hospital Center, LAUSANE, Switzerland 3 Institut Pasteur, Centre d’Informatique pour la Biologie, PARIS, France 4 Institut Pasteur, INRA, PARIS, France Objective: Azoles and echinocandins are the 2 main classes of antifungal agents used to treat candidiasis. Resistance of Candida albicans isolates is a major cause of breakthrough infections. C. albicans is a diploid yeast, which displays a high genetic polymorphism. Point mutations found in genes involved in the resistance of C. albicans to antifungals could either be natural polymorphisms or can confer phenotypic resistance. Our objective was, through whole genome sequencing, to establish a comprehensive repertoire of the non-synonymous polymorphisms (natural polymorphisms and/or mutations of resistance) in genes involved in resistance to azoles and echinocandins. Methods: Two collections of C. albicans clinical isolates were used. The first one consists of 151 epidemiologically-unrelated strains susceptible to antifungal agents. The second one consists of 9 isolates resistant to fluconazole and 1 to fluconazole and caspofungin from HIV and Chronic Mucocutaneous Candidiasis patients. The whole genome sequencing was performed on an Illumina HiSeq 2000, generating 100 bp reads (roughly 100X coverage on average). The reads were mapped to the SC5314 reference genome (Assembly 22) using the BWA alignment tool. Then SNPs were detected by GATK and selected with the recommended filters. Using homemade scripts we analyzed the sequences of 5 genes involved in the resistance to azoles (ERG11, TAC1, MRR1 and UPC2) and echinocandins (FKS1) and compared them to the sequences of reference strain SC5314. Putative new resistant mutations were confirmed by transcript level measurements of CDR2 and ERG11 (for mutations in TAC1 and UPC2 respectively) with RT-qPCR and by direct mutagenesis experiments. Results: Among the 151 antifungal susceptible strains we identified 126 distinct natural amino-acid substitutions. Using this repertoire, we identified from the 10 resistant strains, 22 amino-acid substitutions in addition to the above-mentioned natural polymorphisms. Among them, 10 have already been associated to azoles or echinocandins resistance. The remaining 12 substitutions are novel putative azoles resistance mutations affecting ERG11 (n = 4/11), TAC1 (n = 6/7) and UPC2 (n = 2/3). The results of the RT-qPCR have shown an overexpression level of ERG11 for the strains harboring the 2 new mutations in UPC2 allele in comparison to SC5314 strain. We also observed an overexpression level of CDR2 for the 4 strains harboring the 6 putative new mutations in TAC1 allele in comparison to the known resistant strain harboring A736T mutation. Of the putative new mutations described above, 3 have already been introduced by mutagenesis in a wild-type allele (2 in TAC1 and 1 in UPC2). Succesfully, introduction of 2 of them result in a 7.8 fold change increase of the fluconazole MIC. Analysis of the other mutations is in progress. Conclusion: Whole genome sequencing of numerous antifungal susceptible C. albicans strains allowed us to determine a repertoire of the natural polymorphisms within the main genes involved in the resistance to azoles and echinocandins. Using this repertoire as a guide, 12 new putative mutations conferring resistance where identified. Thus this repertoire can serve as a major tool helping to rapidly unveil mutations potentially linked to antifungal resistance.

P154 Genomic perspective of triazole resistance in Aspergillus fumigatus isolates without cyp51A mutations using WholeGenome Sequencing C. Sharma1 , S. Nelson-Sathi2 , M.R. Pillai2 , A. Chowdhary1 1 Vallabhbhai Patel Chest Institute, University of Delhi, DELHI, India 2 Rajiv Gandhi Centre for Biotechnology, THIRUVANANTHAPURAM, India Objective: Aspergillus fumigatus, a ubiquitous opportunistic pathogen, is the most common etiologic agent of various clinical forms of aspergillosis. A steady increase in azole resistance A. fumigatus (ARAF) isolates has been reported from environment and clinical settings with variable prevalence worldwide leading to therapeutic failures. Although mutations in cyp51A gene have been implicated in conferring azole resistance in A. fumigatus, recent studies have demonstrated occurrence of azole resistant strains without cyp51A mutations. In view of rising prevalence of azole resistant strains with non-cyp51A mutations, in this study next generation sequencing techniques were used to reveal the genetic background of clinical and environmental A. fumigatus isolates with different cyp51A mechanisms and the expression profiling of few transporter genes with single nucleotide polymorphisms (SNPs) was undertaken. Methods: A total of four ARAF isolates with (n = 2; G54E mutants) and without (n = 2) cyp51A mutations originating from clinical and environmental sources were taken up for the study. WGS sequencing libraries were prepared utilizing Nextera XT DNA protocol to generate sequencing-ready libraries and sequenced on Illumina with MiSeq v3 protocol. The normalized libraries were processed and resulting FASTQ files were imported into CLC GENOMICS WORKBENCH for analysis. The genome data of all azole resistant A. fumigatus isolates were aligned with the reference wildtype A. fumigatus isolate (Af293) using bowtie2. The SNPs and INDELS were identified using samtools and summarized using vcftools. For the expression analysis of various genes, total RNA was extracted and RNA integrity was assessed by determination of the OD260 /OD280 ratio. The 2−CT (where CT is the threshold cycle) method of analysis was used to determine the n-fold change in gene transcription. Results: The raw reads of 4 ARAF strains were mapped to Af293 reference genome (>100X coverage) which covered at least 93.1% of the Af293 reference genome. Among all 4 strains, a total of 212,711 SNPs was identified, of which 37,829 were common to atleast 2 isolates. Also, about 5,000 INDELS were noted in each isolate on comparison with the reference strain. There are 207 single nucleotide polymorphic sites were observed in sterol biosynthesis genes, transporters, transcription regulators among the sequenced strains. We compared the expression profile of few transporter and sterol biosynthesis genes that had SNPs. The expression analysis suggested the overexpression of MFS transporter, namely, mfsC in all ARAF. None of the resistant strain showed significant upregulation of cyp51A and cyp51B gene. On the other hand, abcD was upregulated (5-fold) in the isolates with G54E mutants. Conclusion: The WGS comparative analysis revealed several punctual mutations and a large-segment deletion among different strains suggesting the involvement of resistance mechanisms other than cyp51A. To the best of our knowledge, this is the first report of whole genome data of the azole resistant strains without cyp51A mutations. Future studies involving validation of SNPs by gene cloning experiments are warranted to assess their importance in azole resistance even in a strongly drug-resistant background.

ABSTRACT

P155 Toll Like Receptor (TLR)-2 expression and Cytokine response induced by Aspergillus flavus in Chronic rhinosinusitis with nasal polyposis (CRSwNP) patients. G. Rai, S. Das, M.A. Ansari, S.A. Dar, P.K. Singh, N. Gupta, S. Sharma University College of Medical Sciences (University of Delhi) & Guru Teg Bahadur, DELHI, India

S99

P158 Molecular differentiation of Candida metapsilosis and Candida orthopsilosis isolates based on sequence analysis of ITS1-ITS2 of 26S rRNA (D1/D2 domain) ´ 3 , J Peman ´ 3 , E Eraso2 , G Quindos ´ 2 E. Mateo1 , I Jurado-Mart´ın1 , D Ros2 , C Marcos-Arias2 , E Canton Universidad del Pa´ıs Vasco / Euskal Herriko Unibertsitatea (UPV/EHU), BILBAO, Spain Universidad del Pa´ıs Vasco/Euskal Herriko Unibertsitatea (UPV/EHU), BILBAO, Spain 3 ´ Hospital Universitario y Politecnico La Fe, VALENCIA, Spain 1

2

Objective: To study the mRNA expression of TLR-2 and various cytokine response to Aspergillus flavus antigen in CRSwNP patients and healthy controls. Methods: This study is a prospective, analytical, case control study, done in a tertiary care hospital in Delhi, India. A total of 30 cases and 20 healthy controls enrolled for the study included, clinically diagnosed as CRSwNP. Postoperatively tissue biopsy samples were subjected to histopathological and standard mycological investigations. RNA extraction was done using TRIzol method from nasal polyp tissue and control tissue from the patients undergoing septoplasty because of anatomic variations and did not have sinus disease. Preoperatively, blood sample from cases and controls were collected for serum and peripheral blood mononuclear cells (PBMCs) isolation. PBMCs (1 × 106 cells/ml) in RPMI-1640 were seeded into culture plate and treated with Aspergillus flavus antigen and Phytohemagglutinin. After treating with antigen, PBMCs were incubated at 37◦ C in humidified air containing 5% CO2 for 48 hrs after which culture supernatants were harvested for various cytokine [Interleukin (IL)-17, IL-4, IL-13, IL-2 and IL-10] quantification. TLR-2 mRNA expression were analyzed using real-time polymerase chain reaction. Statistical analysis was carried out using SPSS (SPSS Inc., Chicago, IL, USA; version 20.0). Independent t-test Data was expressed as mean ± SD. All the tests were two-sided with the significance level at probability below 0.05. Results: The profiles of various CRSwNP patients and healthy controls were studied. The symptom score and CT score was recorded as 12.35±1.78 and 8.16±1.60, respectively. A total of 21 out of 30 (70%) were found positive for Aspergillus flavus from KOH/culture. IL-17 and IL-10 was significantly high (P < 0.05) in cases when treated to Aspergillus antigen as compared to controls. No difference was recorded in IL-2 levels in cases versus controls before and after stimulation. We also found significantly low IL-4 and IL13 response before and after Aspergillus flavus stimulation in patients as compared to healthy controls. A high TLR-2 mRNA expression was documented in these patients. Conclusion: Rise in IL-17 levels in patients of CRSwNP, when stimulated with Aspergillus flavus antigen indicated a skewed Th17 response and probable Treg imbalance as indicated by low IL-4, IL-13 levels. Overexpression of TLR-2 defines the traditionally associated innate immunity which may promote Th17 cells response that leads to persistence and chronicity of infection.

P156 GACA4 and GTG5 PCR primers as useful tools in comparison of Trichophyton benhamiae strains I. Dabrowska1 , B. Dworecka-Kaszak1 , Z. Bakula2 , T. Jagielski2 Warsaw University of Life Sciences WULS - SGGW, WARSAW, Poland University of Warsaw, WARSAW, Poland

1 2

Objective: The objective of this study was to identify and comparison of dermatophytes strains isolated from fox‘s hair coat (Vulpes vulpes) Methods: The samples from 75 hair coat collected from 75 foxes from a private fur farm in central Poland were used in the experiment. The animals mostly (70) have no typical clinical lesions of ringworm. Only 5 clinically affected animals had widespread alopecia and scattered crusty on the skin, mostly around neck and on the paws. All samples were collected with a brush McKenzie technique and subjected to routine mycological test: direct microscopy (15% KOH) and culture (Sabouraud Dextrose Agar (SDA, bioMerieux) at 30◦ C for up to 28 days). Pure cultures that have been identified as dermatophytes strains, (based on their macroand micromorphology) were used as material for further molecular studies. For DNA extraction from cultured fungi were used the method patented by Brillowska-Dabrowska. Species identity was confirmed by sequencing of the ITS1/2 regions of the rDNA cluster (universal ITS4 and ITS5 primers were used – according to White). Single repetitive oligonucleotide (GACA)4 and (GTG)5 primers were used for detection of intraspecies heterogeneity among clinical isolates. Results: Of the specimens examined, 20% (15) were positive for dermatophytes in direct microscopy and/or culture. Within this number were five specimens collected from animals showing typical ringworm skin lesions. The remaining 10 specimens originated from healthy animals (10/70; 14.3%). All isolates were identified as representatives of the Trichophyton mentagrophytes complex, based on morphological tests. Sequencing of the ITS1/2 loci showed a perfect match with the reference strain of Trichophyton benhamiae (CBS 112368 −100% similarity), according to CBS database (http://www.cbs.knaw.nl). Results of (GACA)4 and (GTG)5 PCR showed heterogeneity within the T. benhamiae strains even if the strains were originated from the same farm and should be expected from the same animal’s source Conclusion: Circulating among the animals dermatophytes strains maybe a different, even if the strains were originated from the same farm and should be expected to have a common ancestor. PCR with (GACA)4 and (GTG)5 primers could successfully distinguish T. benhamiae strains.

P157 Transcriptional regulatory control of Histoplasma capsulatum for biofilms formation A. M. Fusco-Almeida1 , N. S. Pitangui1 , J. C. O. Sardi1 , P. C. Gomes1 , A. M. Varani1 , C. C. Fernandes1 , G. Rodr´ıguezArellanes2 , M. L. Taylor2 , M. J. S. Mendes-Giannini1 1 Universidade Estadual Paulista, ARARAQUARA, Brazil 2 ´ ´ Universidad Nacional Autonoma de Mexico, MEXICO DF, Mexico Objective: Histoplasma capsulatum variety capsulatum is responsible for a human systemic mycosis that constitutes a major health problem in the world, named histoplasmosis. Some microorganisms attached to biological and nonbiological surfaces are able to form biofilms, which are dynamic communities enclosed in an exopolymeric matrix. Biofilm formation by H. capsulatum was described by our group as a new virulence factor. Based on the importance of biofilms and its persistence on host tissues and cell surfaces, the present study was designed to investigate the transcriptional regulation of H. capsulatum biofilms and planktonic cells. Methods: H. capsulatum biofilms and planktonic cultures were developed in vitro using EH-315 (bat clinical strain) and 60I (human clinical strain) strains. Complete sequencing of the transcribed regions was performed by HiSeq Illumina platform including construction of cDNA libraries, cluster generation and sequencing. The data obtained were analysed by software Seqyclean 1.9.9 – Next Generation Sequencing Cleaning and “de novo” assembly was performed from the sequencing data using CLC Genomics Workbench 6.5.1. software. Results: The results obtained show that the conformation of yeasts in biofilms induces a negative regulation of the transcriptional processes resulting from repressed expression of most genes (≈80% down-regulated). In addition, the identification of the transcripts products with significantly altered expression in biofilms reveals that proteins with hydrolase activity (cell wallassociated hydrolase) and an elongation factor (EF 1-alpha) appear to play fundamental roles in structuring this pathogen in complex three-dimensional networks which characterize biofilms. Conclusion: In the present study are indicated the molecules (transcripts) that constitute a potential source to delineate: a) a marker of biofilms; b) new prototypes for the therapy of histoplasmosis and; c) new biomarkers as diagnostic tools for histoplasmosis.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Objective: To evaluate the usefulness of identification of very closely related species Candida metapsilosis and Candida orthopsilosis sequencing D1/D2 region of 26S rRNA gene. Methods: Nineteen blood culture isolates phenotypically identified as Candida parapsilosis were analysed by sequence analysis of the internal transcribed spacer ITS1-ITS2 of 26S rRNA gene (D1/D2 domain). The total DNA from the isolates was extracted using DNeasy UltraClean Microbial Kit (QIAGEN, Germany) and DNA content was determined using NanoDrop 1000 Spectrophotometer (Thermo Scientific, USA). D1/D2 region of 1–10 ng of DNA was amplified using NL1 and NL4 primers and the fragments of 600 bp were purified and sequenced. Sequences were assembled manually and subjected to BLAST analysis to find similarities to sequences deposited at GenBank. Phylogenetic and molecular evolutionary analyses based on the neighbor joining and Kimura 2-parameter methods were conducted using MEGA version 4 software. Candida albicans ATCC90028, Candida dubliniensis ATCC MYA-646, Candida metapsilosis ATCC 96143 and ATCC 96144, Candida orthopsilosis ATCC 96139 and ATCC 96141 and, Candida parapsilosis ATCC 90018 and ATCC MYA-4646 were used to construct the phylogenetic dendrograms. Results: Candida parapsilosis is a complex of cryptic species phenotypically undistinguishable and only differentiated by molecular methods. Candida metapsilosis and Candida orthopsilosis have been isolated in less frequency than Candida parapsilosis, but it is likely that some clinical isolates from these species have been misidentified as Candida parapsilosis. The sequence analysis of the ITS1-ITS2 of 26S rRNA gene (D1/D2 domain) is a suitable molecular method for identifying these three species. In this study, all the nucleotide sequences obtained by D1/D2 region sequencing presented good quality and a length higher than 560 bp. The results of BLAST search on GenBank databases for all the 19 sequences showed a homology ranging from 98 to 100% with the three species of the Candida parapsilosis complex, avoiding their differentiation. Nevertheless, the phylogenetic tree constructed with these sequences confirmed the identity of isolates, all belonging to Candida metapsilosis and Candida orthopsilosis. The dendrogram grouped in two separate cluster these isolates with reference strains sequences of Candida metapsilosis and Candida orthopsilosis. Thus, from these 19 isolates, six were classified as Candida metapsilosis and 13 as Candida orthopsilosis. Conclusion: The ITS1-ITS2 of 26S rRNA gene (D1/D2 domain) can be a good tool for identifying clinical isolates from Candida parapsilosis complex when BLAST analysis with GenBank databases is implemented with a thorough phylogenetic analysis.

P159 The development of a real-time PCR assay for the rapid identification of Candida auris J. Green1 , K. Dempsey1 , GILLIAN Miller1 , MARKUS Kostrzewa2 Bruker UK, GLASGOW, United Kingdom 2 Bruker Daltonik, BREMEN, Germany 1

Objective: Candida auris is a multidrug resistant, emerging agent of invasive fungal infection in the intensive care setting, and has been responsible for recent outbreaks in healthcare institutions. Laboratory identification of Candida auris is difficult and is often misidentified as Candida haemulonii. Real-time PCR methods for the detection of C. auris could provide quick results for both colonisation and infection, help to control spread in the clinical setting and, with accurate identification, could lead to more appropriate patient management. Bruker have designed a real-time PCR for Candida auris, which complements the existing R portfolio of real-time PCRs for invasive fungal disease. Fungiplex Methods: The development of the real-time PCR for the detection of C. auris uses specific, targeted primer and probe mastermixes and a variety of controls; positive, negative and internal controls. This real-time PCR assay is designed in an easy to use format with minimum hands on time and results generated in less than 2 hours from extraction. Two specific primer and probe sequences have been designed to target C. auris. The first identifies the internal transcribed spacer 2 (ITS) sequence between the 5.8S and 28S rRNA genes and the second identifies the Mating Factor (MFα1) gene; both have been evaluated for this study. Analytical studies have previously demonstrated a limit of detection of 20 input copies (ipc) using the standardised Fungiplex assay real-time PCR conditions. Extracted DNA from 28 different strains of Candida auris have been tested using these PCR methods, as well as a specificity panel, consisting of species closely related to C. auris. All extracts were analysed in triplicate. Results: 100% detection of the Candida auris strains was achieved when targeting the Mating Factor gene, with no crossreactivity with other species observed. Results from the ITS region show sporadic detection of some strains and a trend of much higher Ct values, some cross-reactivity is also evident. Results are shown in Table 1 where the number of replicates detected (from a total of 3) are reported, along with the average resultant Ct value. Conclusion: This new PCR test for the detection of Candida auris has shown excellent analytical sensitivity from both plasmid DNA and when extracted directly from a variety of cultured Candida auris strains. Superior performance for both sensitivity and specificity was observed when the Mating Factor (MFα1) gene was targeted. This assay will be validated using additional strains, concentrations and specificity panels. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 421770 785ab011-d47b-471d-84b8780ddf0ece4d.jpg Caption 1: Table 1: Results for detection of Candida auris strains and additional species tested for specificity purposes

S100

P160 Candidemia in neonatal Intensive care unit and its response to fluconazole therapy A. K. Joshi1 , R.D. Kulkarni2 1 S Nijalingappa Medical College, BAGALKOT, India 2 S D M College of Medical Sciences and Hospital, DHARWAD, India Objective: To determine the prevalence of Candidemia in neonates admitted to NICU (Neonatal intensive care unit) To identify the various species of Candida causing Candidemia in NICU To determine the anti-fungal susceptibility pattern of the Candida isolates To monitor the response to treatment by anti-fungal drugs Methods: Specimen collection: Blood samples collected for culture from neonates admitted to NICU were processed in BACTEC/BACT-Alert automated blood culture machine. The bottles flagging positive in the automated blood culture machine were subcultured on Blood agar, Sabouraud’s dextrose agar plate and Mac Conkey’s medium and incubated at 35–37◦ c for 48 hours. A preliminary gram’s stain was also done on the bottles flagging positive for growth. Colonies resembling yeast were subjected to identification and speciation by Germ tube test, Slide culture by Delmau’s method and Sugar assimilation test by modified Wickerham and Burton method. Antifungal susceptibility to fluconazole and voriconazole was determined by modified disk diffusion test as mentioned in the CLSI guidelines (2015) using Muller Hinton agar supplemented with 5% glucose and methylene blue. Response to treatment was monitored by observation. Results: A total of 258 blood samples from different neonates in NICU were collected for culture in the study period spanning 6 months. Average time of stay in NICU at the time of positive blood culture was 7.5 days. A total of 55 (21.3%) were positive for Candida spp. The species distribution was as follows: C. krusei 43 (78%), C. tropicalis 10 (18%), C. gulliermondii 01 (1.8%), C. albicans 01 (1.8%). The sensitivity pattern of various isolates is as follows C. krusei: Fluconazole: Sensitive 7/43 voriconazole: Sensitive 43/43 C. tropicalis: Fluconazole: Sensitive 10/10 Voriconazole: Sensitive 10/10 C. albicans Fluconazole: Sensitive 01/01 voriconazole:Sensitive 01/01 C. guilliermondii: Fluconazole: Sensitive 01/01 Voriconazole: Senstive 01/01 A total of 55 Culture positive neonates received intravenous fluconazole treatment for an average period of one week. The treatment outcome was as follows: Dead: 06, Unimproved: 07, Improved: 42 Conclusion: Prevalence of 21.3% cases of Candidemia in neonates was noted in the study C. krusei, which is noted for its intrinsic resistance to fluconazole, was the predominant species (78%) causing Candidemia in the neonates in NICU All Candida species were sensitive to fluconazole and voriconazole, except C. krusei, which was resistant to fluconazole in 87% of cases. A large proportion of cases recovered after receiving fluconazole treatment, including those who had C. krusei candidemia, indicating in-vivo sensitivity of C. krusei to fluconazole or the other hypothesis could be that the Candidemia was transient. But nothing could be conclusively proved. Voriconazole showed uniform sensitivity across all species and could be the drug of choice for empirical and specific treatment in cases of neonatal Candidemia in settings where echinocandins are not easily available

P161 Distribution, characterization and antifungal susceptibility profiles of Penicillium and Talaromycesspp in clinical specimens in a Chest hospital in Delhi, India P. K. Singh1 , A. Masih1 , A. Singh1 , J. Houbraken2 , P.E. Verweij3 , J.F. Meis3 , A. Chowdhary1 1 Vallabhbhai Patel Chest Institute, University of Delhi, DELHI, India 2 Westerdijk Fungal Biodiversity Institute, UTRECHT, Netherlands 3 Radboudumc/CWZ, NIJMEGEN, Netherlands Objective: Penicillium species are ubiquitous saprobic fungi with more than 300 known species, but only a few are currently known to be human pathogens. Although Penicillium species are emerging as pathogens in immunocompromised and immunocompetent patients their distribution and antifungal susceptibility patterns in varied clinical settings is not yet well explored. The study aimed at molecular characterization, MALDI TOF-MS identification and antifungal susceptibility profiling of Penicillium species originating from respiratory samples in a referral chest hospital, Delhi, India. Methods: A total of 35 Penicillium isolates from respiratory specimens of patients with pulmonary disorders during 2012–15 were preliminarily identified based on colony colour and morphology on potato dextrose agar plates incubated at 37˚C for 3–5 days. All isolates were identified by MALDI TOF-MS (Bruker, Germany) and sequencing of the ITS region and a part of the β-tubulin gene. Antifungal susceptibility testing (AFST) was performed for azoles, amphotericin B and echinocandins using a broth microdilution method (CLSI M38-A2). Results: Of the 35 isolates, sequencing identified 5 Penicillium and 5 Talaromyces species: 13 isolates each of P. citrinum and P. oxalicum, two of P. chrysogenum and single isolates each of P. chermesinum, P. griseofulvum, Talaromyces beijingensis, T. cnidii, T. fusiformis, T. islandicus, and T. stollii. The MALDI Biotyper could only identify P. citrinum and P. chrysogenum and the remaining were either identified as Penicillium species or could not be reliably identified. P. citrinum and P. oxalicum had low MICs for posaconazole (PSC) (GM MIC 0.7 μg/ml, 0.3 μg/ml), amphotericin B (AMB) (GM MIC 0.5 μg/ml, 0.09 μg/ml), caspofungin (CFG) (GM MEC0.2 μg/ml, 0.5 μg/ml), micafungin (MFG) (GM MEC 0.09 μg/ml, 0.12 μg/ml) and anidulafungin (AFG) (GM MEC 0.15 μg/ml, 0.12 μg/ml) respectively. However, P. oxalicum had high MICs for isavuconazole (ISA, GM MIC 4 μg/ml) and variable MICs for VRC (range 1→16 μg/ml) and P. citrinum had high MICs for VRC (GM MIC 12.6 μg/ml). Barring a solitary isolate of P. chermesinum (ITC 4 μg/ml, VRC 4 μg/ml) the other Penicillium species isolates had low MICs. On the other hand, Talaromyces species had high MICs for azoles (MIC90 ITC 16 μg/ml, VRC 8 μg/ml, ISA 8 μg/ml, POS 16 μg/ml). Conclusion: P. oxalicum is an emerging species in pulmonary mycotic infections and has been reported previously in breakthrough infections in patients on VRC therapy. Interestingly, various species of Talaromyces were identified in chronic respiratory diseases patients, which were labelled as Penicillium species by morphological features. T. fusiformis, T. islandicus, T. beijingensis are reported for the first time from clinical specimens and have thus far only been isolated from indoor environments. Furthermore, azoles have no activity against Talaromyces species; therefore the importance of generating their antifungal susceptibility profiles is emphasized. Although the commercial database for Penicillium species in the Bruker MALDI-TOF is limited, it is an effective and reliable method for identification of Penicillium species provided an in-house database is created for the locally prevalent species.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Medical Mycology, 2018, Vol. 56, No. S2

P162 In vitro activity of Isavuconazole against Candida auris by time-kill and postantifungal-effect assays ´ 2 , G. Quindos ´ 1 , N. Jauregizar1 U. Caballero1 , E. Eraso1 , J. Peman 1 Universidad del Pa´ıs Vasco/Euskal Herriko Unibertsitatea, LEIOA, Spain Hospital Universitario y Cl´ınico de La Fe, VALENCIA, Spain

2

Objective: Candida auris is an emerging species causing disseminated candidiasis whit remarkable characteristics: difficult diagnosis and challenging treatment due to multidrug-resistance. Isavuconazole, an extended-spectrum new triazole antifungal agent, was analyzed in vitro by a time-kill (TK) methodology to assess its activity against Candida auris. Methods: In vitro static TK experiments and postantifungal-effect (PAFE) assays were performed as previously described (1) against three Candida auris clinical blood isolates from the outbreak of candidiasis at HUP La Fe (Valencia, Spain) (2). Concentrations assayed of isavuconazole (Basilea, UK) for both experiments were 0.06, 0.125, 0.25, 0.50 and 1 mg/l, based on MIC values previously determined by EUCAST E.def 7.3 method (3). For PAFE assays, cells were exposed to isavuconazole for 1 h. For both experiments, samples for viable count were taken at 0, 2, 4, 6, 8, 24 and 48 h. Plots of averaged colony counts (log10 CFU/ml) versus time were constructed and compared against a growth control (in absence of drug). The assays were performed in duplicate. Results: None of the concentrations assayed in TK experiments showed fungicidal activity, even though a concentrationdependent reduction trend was observed when compared with control curve. As it could be expected from TK results, no PAFE effect was observed against any of the studied isolates. Conclusion: Despite the low MICs, isavuconazole did not show significant activity against the studied Candida auris isolates in the performed TK experiments. These results suggest that special care should be taken when interpreting the MIC values for resistant species such as Candida auris and other in vitro methodologies, like TK experiments, should also be considered for a more complete characterization of antimicrobial activity. Funding: This study was partially financed by GIC 15/78 IT-990-16(Gobierno Vasco-Eusko Jaurlaritza), PI17/01538(FIS, Spain) and SAF2017-86188-P(MINECO, Spain). Unai Caballero has received a grant by the University of the Basque Country(UPV/EHU)

P163 Therapeutic drug monitoring (TDM) of voriconazole in haematologic malignancy patients N. Sharad, G. Singh, I. Xess, R. Agarwal, T. Seth, K.H. Reeta AIIMS, NEW DELHI, India Objective: Voriconazole is a triazole antifungal with a narrow therapeutic range and non-linear kinetics. Therefore, the objective of the study was to monitor the trough voriconazole serum levels in patients with haematological malignancy with clinically suspected invasive fungal infections. Methods: The study was conducted from March 2016 to October 2017. All patients having haematologic malignancies with clinically suspected invasive fungal infections being treated with only voriconazole were included. The analysis was performed by using the ‘bioassay’. Trough serum levels were obtained on the fifth day of starting the drug. In case of dose alterations, the TDM was repeated. All the demographic and clinical details of the patients were noted. The study was approved from the institute ethics committee Results: A total of 39 patients were evaluated, 15 children and 24 adults. The most common underlying malignancy was AML. Neutropenia due to chemotherapy sessions was the major risk factors in these patients. After first TDM, 15/39 had levels 6 mg/l. In people with sub-therapeutic and supratherapeutic levels, doses were altered accordingly, and TDM was repeated on day 5, to check for the new levels. The clinicians were informed about the same and proper interventions were made according to the levels and the clinical condition of the patients Conclusion: Only half of our patients had voriconazole serum levels within therapeutic range. Dose alterations had to be done in the rest for achieving recommended serum levels. Thus, we recommend TDM for all patients of hematologic malignancy receiving voriconazole for appropriate management.

P164 microRNA regulates antimicrobial responses expression during the infection of Cryptococcus neoformans A. M. Fusco-Almeida1 , F. P. Gullo1 , J. L. Singulani1 , J. C. O. Sardi1 , M. C. G. Da Silva1 , M. Costa2 , F. J. Enguita2 , M. J. S. Mendes-Giannini1 1 Universidade Estadual Paulista, ARARAQUARA, Brazil 2 Instituto de Medicina Molecular, LISBOA, Portugal Objective: Cryptococcosis is an important systemic mycosis that mainly affects immunocompromised patients and is classified as the fungal infection with higher mortality among individuals with HIV. Although efficient, the treatment it is observed high number of cases of relapses, development of resistance and toxicity problems. In front of these problems, this study proposes the possibility to development of new therapies for the treatment of cryptococcosis, through of study microRNAs (miRNAs) involved in the interaction between yeast and human glioblastoma cells (U87-MG), in order to use them as regulators of infection, since this is a recently disclosed strategy in a variety of diseases. Methods: For this study, the interactions were performed by in vitro test with cellular culture and the infections were quantified by flow cytometry. Then the RNA of infected cells and normal cells were extracted, purified and quantified. The miRNA expression was evaluated by quantitative PCR using plate miRCURY LNATM Universal RT miRNA Ready-to-Use PCR for human cells. Results: We observe that 10 miRNAs were over-expressed during the interaction of C. neoformans and U87-MG cells and it was noted that these miRNAs regulate the signaling pathway of TGF-β, MAP kinase (MAPK) and the receptor and matrix extracellular components (MEC) interaction. These data were compared with data from transcripts of the interaction and the GTPase-3 and COP-1 protein were selected as important in this process. Such proteins are associated to Rho-GT pathway Rho-GTPase which is essential for the yeast adhesion into host cells and showed increased expression in infection. Conclusion: Our results indicate that the inhibition of expression of miRNAs during fungus-cell interaction may be interesting to control fungal infection, because we believe that once inhibited, the yeast can reduce invasion of host cells, being the miRNAs interesting new therapeutic targets.

ABSTRACT

S101

P165 Candidemia in large tertiary pediatric hematology/oncology center in Russia: etiology and treatment outcomes - results of five years analysis.

P168 Triosephosphate isomerase of Mucorcircinelloides is recognized as a main antigen by sera from infected immunosuppressed mice

G.G. Solopova, R.P. Pirumova, A.A. Maschan, G.A. Novichkova D. Rogachev National Research Center of Pediatric Hematology, Oncology and Immun, MOSCOW, Russia

A. Arbizu-Delgado1 , X Guruceaga1 , A Antoran1 , L Martin-Souto1 , J Capilla2 , A Martin-Vicente2 , A Rementeria1 , F.L Hernando1 , A Ramirez-Garcia1 1 University of the Basque Country (UPV/EHU), LEIOA, Spain 2 Universitat Rovira i Virgili, REUS, Spain

Objective: Invasive infections due to Candida spp. are among the leading causes of morbidity and mortality in immunocompromised pediatric patients. Candidemia incidence still remains high, despite continuous efforts in prophylaxis and improvements of diagnostics and treatment tools. It impacts negatively not only outcomes of cancer treatment, but also raises the incurrent treatment costs. As for now, there are no data available on the epidemiology of invasive candida infections in pediatric hematology/oncology patients in Russia. Methods: All blood cultures drawn from 01.01.2013 to 01.01.2018 and all first patient-episode pairs were included. Spectrum of Candida species, patient’s characteristics, treatment strategies and outcomes were analyzed. Results: During study period, 54 episodes of candidemia occurred with identification of 56 isolates of Candida spp. Total number of patients was 52 (34 boys/18 girls), 2 patients experienced 2 separate candidemia episodes and in 2 cases more than one Candida spp. was cultured. The median of age was 5,6 years (7 months – 21,8 years). The majority of patients had hematological malignancy (n = 22, 42%), 18 patients - primary immunodeficiency (35%) and 12 patients - solid tumors (24%). Seventeen (32%) patients were recipients of HSCT with a median 3 months (7 days – 32 months) after transplant. Interestingly, half of the episodes (27) occurred at a granulocytes level above 1500/mm3 , while the others with granulocytes less than 500/mm3 . 25% of cases were classified as CLABSI. Associated risk factors were: enterocolitis 36%, systemic corticosteroids use 27%, multiple organ failure 25%, TPN 18%, hemodialysis 7%. Septic shock occurred in 25% of cases and dissemination to different organs was noted in 20%. Clear predominance of Candida non-albicans was noted and C. parapsilosis was responsible for the majority of episodes (52%) (Picture). As a first line therapy 33 patients (63%) received echinocandins, 9 – lipid amphotericin B, 8 – fluconazole and 4 – voriconazole. In all cases antifungals were started promptly after isolation of Candida spp. 7 patients required second line therapy (4 – echinocandins, 3 - lipid amphotericin B) due to toxicity effects. Central line was removed in 41 (76%) cases with a median of 2 days (0 – 12 days) after (+)-ve blood culture. Outcomes: In 35 episodes (65%) favorable outcome was noted (33 patients), whereas 19 patients died. Mortality directly attributed to candidemia was 11% (6 cases) with the median interval of 18 day (3 – 37 days) after 1-st (+)-ve culture. Thirteen patients died from progression of onco-hematological disorder and multiple organ failure. Importantly, was noted that failure to remove central line was associated with significantly higher mortality rate (84,6 vs 19,5%, P < 0,0001). Conclusion: Invasive candidiasis is a common complication in pediatric hematology/oncology patients. In our hospital during 2013–2017 candidemia accounted 36 patients per 10000 hospitalizations and 6,5% of all bloodstream infections. C. parapsilosis was responsible for the majority of cases. Echinocandins have proven to be an effective treatment, even in C. parapsilosis cases. The attributive mortality was 11%. For success treatment prompt initiation of antifungal therapy and central line removal are essential. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 421896 695e2478-10f7-4102-b85d-38a7e 9bc2b37.png Caption 1: picture

P166 Evaluation of species diversity among Indian clinical Schizophyllum commune using matrix-assisted laser desorption ionization-time of flight mass spectrometry and MLST P. K. Singh1 , J.F. Meis2 , A. Chowdhary1 1 Vallabhbhai Patel Chest Institute, University of Delhi, DELHI, India 2 Radboudumc/CWZ, NIJMEGEN, Netherlands Objective: Schizophyllum is an important plant and animal pathogen in the genus basidiomycetes. Schizophyllum commune is the best-known species causing allergic and invasive mycoses since 1950. Key morphological features necessary for the recognition of these fungi are the presence of clamp connections on hyphae and the development of fruiting bodies. However, the final identification needs confirmation by molecular methods. The aim of this study was to determine the species diversity among Indian clinical isolates of Schizophyllum using matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) and multilocus phylogenetic analysis. Methods: Thirty-seven molecularly identified clinical isolates of S. commune were selected from the culture collection of Medical Mycology, V. P. Chest Institute, Delhi to determine the species diversity and the reference strain of Schizophyllum radiatum (CBS 301.32) was included. The markers used for sequencing were the internal transcribed spacer (ITS), a portion of the nuclear large subunit (LSU) of ribosomal DNA, the RNA polymerase II second-largest subunit (RPB2), and the translation elongation factor 1α (EF-1α) gene. The neighbor joining (NJ) phylogenetic tree was constructed using MEGA (v.6) software. Support of the internal branches was assessed by the bootstrap method with 1,000 replications, where values of ≥70 were considered significant. The isolates were also processed for identification and to upgrade the in-house database by creating the main spectrum (MSP). Results: The LSU, EF-1α, and RPB2 markers showed consistency and concatenated sequences were analyzed. The analyses revealed two main clades in the phylogenetic tree. One clade included all the Indian strains of S. commune (n = 37), and the other clade included only reference strain of S. radiatum (CBS 301.32) used in the study. Both clades showed high bootstrap values. The reference strains of S. umbrinum and S. fasciatum acted as outgroups since the genetic distance to the clades of S. radiatum and S. commune were elevated. MALDI-TOF MS showed all the isolates as S. commune including S. radiatum reference strain as the Bruker database does not contain main spectrum (MSPs) for S. radiatum. MSP was created for S. radiatum isolate and again identification was done. MALDI-TOF MS correctly identified all the isolates after the upgradation of database. MSP dendogram also showed two different clusters for S. commune and S. radiatum, which was in concordance with the NJ phylogenetic tree based on concatenated sequences. Conclusion: The importance of Schizophyllum in the clinical setting has been demonstrated by the number of reported cases and strains isolated. In Indian scenario, S. commune is the prevalent species in clinical settings instead of S. radiatum which is most frequently recovered species from USA. It was also observed that EF1 and RPB2 alone can differentiate between these two species of Schizophyllum and thus the two markers can be used for the identification of Schizophyllum species. MALDI-TOF MS plays an important role in rapid identification of Schizophyllum species as it takes only half an hour for the identification but it has limited database. Creation of in-house database can improve the identification rate drastically.

P167 Spectrum of Scedosporium apiospermum infections in a tertiary care centre in North India: Experience over three years G. Singh1 , I. Xess1 , R. Agarwal2 , J. Sachdev1 , M. Soneja1 , K. Madan1 All India Institute of Medical Sciences, NEW DELHI, India 2 AIIMS, NEW DELHI, India 1

Objective: Scedosporium apiospermum infections are an emerging cause of invasive disease both in immune-compromised as well as immune-competent individuals. Therefore, the primary objective of this study was to ascertain the spectrum of infections, predisposing factors, treatment and outcomes of patients suffering from Scedosporium apiospermum infections attending outpatient clinics or admitted to our hospital. Methods: This was a retrospective study of three years from January 2015 to December 2017. All cases of infections due to Scedosporium apiospermum were included in the present study. Demographic characteristics, clinical and laboratory data, and mycological examinations were analyzed. Results: During the study period, a total of eight cases were identified. The mean age was 49 years (range of 2–78 years). There were five male and three female patients. Five of the eight cases presented with pulmonary symptoms. Of these two patients were known cases of HIV (2/5), two had COPD being treated with steroids (2/5) and one case had silicosis (1/5). There were two cases of invasive sinusitis and both the patients had no underlying condition. There was one case was of B cell acute lymphoblastic leukemia (ALL) who presented with acute suppurative otitis media with mastoiditis. Six of the eight cases were treated with voriconazole and had a successful outcome Conclusion: Scedosporium apiospermum is a highly pathogenic fungus which has potential to cause angio-invasive disease and fungemia. The burden of such cases is ever increasing. An early diagnosis with correct identification to the species level helps in initiation of accurate therapy with voriconazole.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Objective: Mucormycosis, infections caused by fungi of the order Mucorales, are a group of emerging infectious diseases characterized by rapid progression and high aggressiveness. The genera Mucor is one of the most common etiological agents, being Mucor circinelloides the most frequently isolated species. Moreover, their virulence mechanisms are still unknown and there is no effective diagnostic method for this disease apart from classical methods. In this context, the aim of this study was to identify the antigens of M. circinelloides recognized specifically by immunosuppressed infected mice sera. Methods: Mucor circinelloides was grown into potato dextrose broth at 37◦ C with 120 rpm agitation for 24 hours. After that, the fungal material was separated from the medium by filtration and incubated at 37◦ C with 120 rpm agitation in PBS 2% glucose for 20 hours. Then, the supernatant was filtered, sterilized and dialyzed, and finally, proteins were precipitated and resuspended in 2-DE buffer. Protein separation was carried out by two-dimensional electrophoresis and antigen detection was performed by Western Blot against a pool of sera obtained from 5 mice infected intravenously with 1 × 105 conidia of M. circinelloides NRRL 3631 and 5 control sera from non-infected mice. These mice had been previously immunosuppressed by giving them 100 mg/kg cyclophosphamide intraperitoneally at -4 days and, then, every three days until the day 20 in which the mice were sacrificed and the sera was obtained. Finally, the most immunoreactive proteins specifically detected by sera from infected mice were identified by LC-MS/MS. Results: Eight immunoreactive proteins were specifically detected by sera from infected immunosuppressed mice. Four of them were detected at isoelectric point (pI) of 4,8 -5,4 and a molecular weight (Mr) of 70 kDa and the other four at 5,45,7 pI and Mr 15 kDa. The first four mentioned antigens were the most immunoreactive and were identified as triosephosphate isomerase by LC-MS/MS. The reactivity of these antigens was also observed when sera of infected mice were tested individually. Conclusion: This study identifies Triosephosphate isomerase as a major antigen of M. circinelloides, which is recognized by sera from infected mice even in an immunosuppressant state. The study of the reactivity of this antigen might be very useful to develop a sensitive and specific serological diagnostic test, taking into account that these fungal infections occur mainly in immunosuppressed patients.

P169 The contribution of MRR2 mutations to fluconazole resistance and CDR1 expression in a collection of azole-resistant Candida albicans clinical isolates 2 ¨ , P.D. Rogers1 A. T. Nishimoto1 , Q. Zhang1 , B. Hazlett1 , J. Morschhauser 1 The University Of Tennessee Health Science Center, MEMPHIS, USA 2 ¨ ¨ Wurzburg, ¨ Universitat WURZBURG, Germany

Objective: Mutations in genes encoding zinc cluster transcription factors (ZCFs), such as TAC1, MRR1, and UPC2, play a key role in azole antifungal resistance in Candida albicans. Amino acid substitutions in the ZCF Mrr2 have recently been reported to influence fluconazole susceptibility through overexpression of the gene encoding the Cdr1 efflux pump. The purpose of this study is to determine the contributions to resistance of mutations in MRR2 among isolates within a collection of azole-resistant clinical C. albicans isolates. Methods: MRR2 was sequenced in 52 C. albicans clinical isolates (42 fluconazole-resistant and 10 fluconazole-susceptible isolates) previously characterized for mutations in TAC1, MRR1, UPC2, ERG11, and ERG3, as well as expression CDR1, MDR1, and ERG11. Polymorphic MRR2 alleles found to occur uniquely among resistant isolates were introduced into reference strain SC5314 using the SAT1 flipper cassette. Susceptibility tests were performed according to the CLSI broth microdilution method and by E-test strip (Biom´erieux) plating on RPMI-agar. Relative mRNA abundances of target genes were measured via qPCR. Results: Mutations in MRR2 resulting in 15 amino acid substitutions were uniquely identified among resistant isolates, including 4 amino acid substitutions (S466L, A468G, S469T, T470N) previously reported in the literature to influence fluconazole susceptibility. Four additional non-synonymous mutations were discovered uniquely in fluconazole-resistant isolates leading to R45Q, A459T, V486M, and V582L amino acid substitutions. When introduced into both MRR2 alleles of isolate SC5314, no change in fluconazole MIC or CDR1 expression was observed for any of the mutations in MRR2 found uniquely among the fluconazole-resistant isolates in this collection. However, artificial activation of MRR2 increased resistance to fluconazole as well as CDR1 expression. Moreover, in our hands, amino acid changes in Mrr2 reported previously to have the strongest effect on fluconazole susceptibility and CDR1 expression also did not cause increased CDR1 expression or fluconazole resistance relative to the parent strain. Conclusion: While all of the known mechanisms of fluconazole resistance are represented within this collection of clinical isolates and contribute to their resistance to fluconazole to different extents, no activating mutations in MRR2 that would alter expression of CDR1 or contribute to resistance were found in any of these isolates.

P170 Geographic distribution of cryptococcosis in the state of mato grosso do sul, central-west brazil region 2 ˆ Junior ´ , R. P. Mendes2 , S. S. Weber2 , A. M. M. M. R. Chang1 , R. A. S. Tsujis2 , G. M. E. Lima2 , A. B. Colman2 , D. Correa Paniago2 1 Universidade Federal de Mato Grosso do Sul, CAMPO GRANDE-MS, Brazil 2 Federal University of Mato Grosso do Sul, CAMPO GRANDE, Brazil

Objective: The Central-West Brazil region presents favorable environmental conditions (tropical of altitude climate and average temperature between 20◦ C and 25◦ C) for the development of these fungi. The state of Mato Grosso do Sul is home to 65% of the Pantanal, an incredible biodiversity scenario with rich fauna and flora, where birds migrate that can influence the geographical distribution of Cryptococcus spp. in the region. Map the cases of cryptococcosis in Mato Grosso do Sul and determine the molecular types of Cryptococcus spp. Methods: Were included Cryptococcus spp. isolated from different clinical specimens of patients attended at the Maria Aparecida Pedrossian University Hospital of the Federal University of Mato Grosso do Sul from May 1997 to December 2016. The molecular types were identified by the URA5-RFLP method. Results: Of 79 cities in the state of Mato Grosso do Sul, 35 (44.3%) had at least one case of cryptococcosis in the period. Of the 220 cases studied, 150 (68.2%) were from Campo Grande, capital of Mato Grosso do Sul (126; 84% C. neoformans VNI, 9; 6% C. neoformans VNII and 15; 10% C. deuterogatti). In the majority (33; 94.3%) of the cities were found C. neoformans VNI, whereas C. neoformans VNII in four (11.4%) cities and C. deuterogattii in nine (25.7%). Twenty-five (71.4%) cities presented cases of cryptococcosis exclusively by C. neoformans VNI. Costa Rica, Coxim, Miranda and Sidrolandia presented cases by C. ˆ neoformans VNI and C. deuterogattii and only Parana´ıba presented cases by C. neoformans VNI and VNII. Nioaque and Santa Rita do Pardo cities presented only a single case of cryptococcosis caused by C. deuterogattii. The cities of Campo Grande, Navira´ı and Sao ˜ Gabriel do Oeste presented cases for the three molecular types VNI, VNII and VGII. Eight cases of cryptococcosis were mapped in three of the cities that make up the Pantanal region (Aquidauana, Anastacio, Corumba, and Miranda), seven by ´ ´ Ladario ´ C. neoformans VNI and one by C. deuterogattii. Conclusion: As observed in most Brazilian states and in the world, cases of cryptococcosis by C. neoformans VNI are more frequent in the Pantanal region and in the state of Mato Grosso do Sul and should be better investigated, since they are a potential ecological niche for Cryptococcus spp.

S102

Medical Mycology, 2018, Vol. 56, No. S2

P171 Study the effect of phytochemical combination against Candida septicaemia by rapid screening method

P174 Difficulties in identifying Nannizziopsis species: about two cases of disseminated infection in kidney transplant recipients

ANIRBAN Mukherjee Gurudas College, KOLKATA, India

A. Jabet1 , S Hamane1 , M Gits-Muselli1 , D Garcia-Hermoso2 , B Denis1 , M Siguier1 , M.N Peraldi1 , N Guigue1 , A. Alanio2 , S Bretagne1 1 ˆ Hopital Saint-Louis, PARIS, France 2 Institut Pasteur, PARIS, France

Objective: Multidrug resistance candida infection has now become a threat worldwide. Natural product and their combination with synthetic drug could be an effective way to combat drug resistant yeast infection. The aim of the study was to evaluate the previously reported rapid process of screening of phytochemicals as a method to screen a combination of phytochemical with fluconazole against blood candida infection. Methods: Mammalian blood was seeded with Candida and combination of phytochemical at 37◦ C to observe interaction with WBC in terms of shrinkage under high resolution microscope by micrometry Results: upon incubated with fluconazole resistant Candida isolates, demonstrated significant decrease in diameter of WBC (from 10.099 μm±0.498 to 6.26μm± 0.906 and 6.534μm± 0.823 for Candida albicans and Candida glabrata respectively) within 4 hr of incubation instead of conventional 72 hr of incubation as required to test blood culture. The shrinkage of WBC was reduced by 78.94 to 83.31% with the combination therapy as compare to fluconazole (32.34 to 50.7%) and plumbagin (12.5 to 68.94%) alone emphasising higher efficacy of combination therapy which was evaluated statistically using two sample one tailed Z test. The result is significant at P < 0.05. Hence, this investigation crosschecked the efficacy of purified Plumbagin (Plumbago zeylinica) in combination therapy against test organism in mammalian blood in-vitro system. Conclusion: This would be an effective and rapid method to identify the effect of combination drug in vitro and could also be used as a routine method to screen the effect of several phytochemical against yeast infection.

P172 In vitro activities of the novel investigational tetrazoles VT-1598 and VT-1161 against azole-resistant strains and clinical isolates of C. albicans 4 ¨ , E.P. Garvey5 , P.D. Rogers1 A. T. Nishimoto1 , N.P. Wiederhold2 , S.A. Flowers1 , Q. Zhang1 , S.L. Kelly3 , J. Morschhauser The University Of Tennessee Health Science Center, MEMPHIS, USA The University of Texas Health Science Center at San Antonio, SAN ANTONIO, USA 3 Swansea University, SWANSEA, United Kingdom 4 ¨ ¨ Wurzburg, ¨ Universitat WURZBURG, Germany 5 Viamet Pharmaceuticals, Inc., DURHAM, USA 1

2

Objective: The fungal Cyp51-specific inhibitors VT-1598 and VT-1161 have emerged as promising new therapies to combat fungal infections and possess activity against a broad spectrum of fungal species, including Candida spp. We evaluated the in vitro activity of these compounds against a collection of well-characterized azole-resistant C. albicans clinical isolates, as well as against mutant strains representing the major mechanisms of azole resistance. Methods: Minimum inhibitory concentrations (MICs) were determined for fluconazole (FLU), voriconazole, VT-1598, and VT-1161 for 57 clinical isolates previously well-characterized for known mechanisms of azole resistance, as well as 66 mutant strains representing individual mechanisms of azole resistance. Susceptibility testing was performed according to CLSI methods. Results: Among the 57 azole-resistant clinical isolates, 46 had consistently elevated VT-1161 MICs (3 2 dilutions; MIC range 0.06 to >8 mg/L) compared to that of FLU-susceptible isolates (≤0.015 mg/L). A subset of these (29 of 46 isolates) also displayed VT-1598 MICs of 3 2 dilutions. Only four isolates showed high MICs to these novel antifungals; these four isolates had VT-1161 MICs of ≥8 dilutions (≥4 mg/L) and VT-1598 MICs of >9 dilutions over FLU-susceptible isolates (>8 mg/L). These four isolates likewise exhibited FLU and voriconazole MICs >64 and >16 mg/L, respectively. For one of these four isolates the high-level resistance could be explained by a premature stop codon in ERG3. While VT-1598 and VT-1161 MICs in the remaining isolates did not correlate with the degree of expression of CDR1, MDR1, ERG11, or any specific ERG11 mutation, there was a significant correlation with isolates having MICs ≥4 dilutions and ≥2-fold increase in CDR1 expression for both VT-1598 (P < 0.01) and VT-1161 (P < 0.05). A ≥2-fold increase in ERG11 expression also correlated with VT-1161 MICs ≥4 dilutions compared to those of FLU-susceptible isolates. Individual mutants with activated Tac1, Mrr1, or Upc2 exhibited VT-1598 MICs identical to the azole-susceptible isolates. Among mutants carrying specific ERG11 mutations, no single mutant exhibited a change in VT-1598 susceptibility. Only the combination mutation homozygous for Y132H and heterozygous for the K143R amino acid substitutions exhibited elevated VT1598 MICs, and the MIC ≤ 0.125 mg/L. No other combination tested had any greater effect than a single dilution increase in VT-1598 MIC. VT-1161 MICs increased 2–3 dilutions (0.06 – 0.125 mg/L) over FLU-susceptible strains in Tac1-activated mutants. Similarly, strains containing the ERG11 mutations for Y132F, the combination mutations Y132F and K143R, or the combination mutation homozygous for Y132H and heterozygous for the K143R amino acid substitutions exhibited increased VT-1161 MICs of ≤ 0.125 mg/L. Conclusion: VT-1598 exhibits potent activity against isolates overexpressing CDR1, MDR1, and ERG11, as well as 95% of unique ERG11 mutations tested. VT-1161 MICs were elevated for CDR1 overexpressing strains and three ERG11 mutation combinations, but showed activity against MDR1 and ERG11 overexpressing strains. While mutations affecting Erg3 activity appear to greatly reduce susceptibility to VT-1598 and VT-1161, three isolates exhibiting greatly elevated MICs to both VT-1598 and VT-1161 could not be explained by known mechanisms of azole resistance, suggesting the presence of undescribed resistance mechanisms to tetrazole- and tetrazole-based sterol demethylase inhibitors.

P173 Case report Chronic Mucocutaneous Candidiasis Caused by Azole-Resistant Candida albicans O. Kozlova, E Frolova, T Bogomolova, E Vybornova, Y Yakovleva, N Klimko I. Mechnikov North Western State Medical University, SAINT-PETERSBURG, Russia Objective: Chronic mucocutaneous candidiasis (CMC) is a rare disease characterized by persistent and recurrent infections by Candida due to changes in cellular immunity and may be associated with autoimmune endocrine disorders. We present the case of a familial CMC, characterized by a refractory infection caused by C. albicans resistant to azoles. Methods: Determination of Candida species was made with AUXACOLOR 2 (BioRad, USA) and MALDI-TOF MS. CLSI M44-A disk-diffusion method was used for in vitro sensitivity testing to fluconazole and voriconazole. Results: A 7-year-old boy presented with persisted oral thrush, labial fissures, and erythematous-desquamating dermatosis involving the face, limbs, nails, esophageal candidiasis and non-specific symptoms such as fatigue, weight loss of 2 kg in 6 months. The fungal infection started at 2 years. The patient’s family included unaffected parents as well as two unaffected brothers. The patient received short courses of systemic treatment with clotrimazole and fluconazole. However, recurrence of candidiasis occurred shortly after halting antifungal therapy. Esophagoscopy revealed fibrinous exudates on the mucosal surface esophagus. Histology showed candidiasis. Specimens from esophageal, pharyngeal and buccal swabs were positive for C. albicans. All C. albicans isolates showed the same susceptibility profiles to antifungal drugs. They were resistant to fluconazole, voriconazole, Lymphopenia was present with lymphocyte count upon admission of CD3+ 1.07∗ 109/l (n = 1.3-2.1∗ 109/l), CD4+ 0.39∗ 109/l (n = 0.7-1.1∗ 109/l), CD8+ 0.59∗ 109/l (n = 0.60.95∗ 109/l), CD19+ 0.39∗ 109/l (n = 0.25-0.6∗ 109/l), and CD16+56+ 0.04 ∗ 109/l (n = 0.2-0.4∗ 109/l). Endocrinopathies or other defined autoimmune diseases were excluded. Molecular genetic study has shown heterozygous mutation in the STAT1 gene. The diagnosis of familial CMC was confirmed. Patient was treated with fluconazole 150 mg (6 mg/kg) for two weeks, then once a week 2 months with clinical response and disappearance of symptoms. The therapy was temporarily discontinued after 2.5 months. About 4 weeks later, a relapse of candidiasis was observed, although it was limited to the oral mucosa. Fluconazole was then started again at a dosage of 150 mg for 2 weeks and then once a week for 2 months. The treatment was well tolerated and brought complete control of the C. albicans infection in all sites. Conclusion: We present case of chronic mucocutaneous candidiasis caused by azole-resistant C. albicans. In-vitro tests indicated that the isolate was resistant to fluconazole and voriconazole. An increase of the dose of fluconazole was clinically effective and well tolerated.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Objective: Members of the genus Nannizziopsis are known as reptile pathogens causing skin infections with frequent dissemination. We describe here difficulties encountered to identify these molds. Methods: Direct microscopic examination was performed using Calcofluor white in 10% potassium hydroxide. Samples were cultured on Sabouraud glucose agar tubes at 30◦ C. Lactophenol cotton blue was used for microscopic examination of cultures. Molecular identification of strains was made by sequencing of the ITS1-5.8S-ITS2 rDNA region. Results: Case one: A 58-year-old diabetic woman from Mali in France for 30 years reported for two weeks asthenia, cough, dyspnea and chest pain without fever, one year after renal transplantation while receiving tacrolimus 4 mg and mycophenolate mofetil 750 mg twice a day and prednisone 5 mg/day. A Computed Tomography (CT)-scan showed a nodule which was biopsied. Meanwhile, nodular skin lesions of legs and back were observed and also biopsied. Direct examination showed septate, irregular filaments. White and fluffy colonies with cream-colored reverse were observed on Sabouraud agar tubes. Microscopic examination showed thin, hyaline hyphae with numerous clavate sessile conidia (Figure 1). A first presumptive identification as Trichophyton rubrum was made, despite rapid culture (48 h) and presence of numerous conidia. Meanwhile, whole body PET (Positron Emission Tomography)/CT scan suggested a widely disseminated fungal disease. Molecular identification placed the fungus in the genus Nannizziopsis. Serum (1-3)-β-d-Glucan was at least once >523 pg/mL. Case two: A 62-year-old man from Guinea in France for 12 years with a kidney transplant for eight years was hospitalized for recurrent erysipelas with no bacteria identified after a first abscess drainage. He received mycophenolate mofetil 500 mg twice a day, tacrolimus 7 mg and prednisone 5 mg /day. Samples from a second surgery biopsy showed septate, irregular filaments. Colonies had yeast-like aspect with urease activity and microscopic examination showed arthroconidia (Figure2). An identification R failed to provide identias Trichosporon sp. was first proposed. But MALDI-TOF mass spectrometry (Vitek MS BioM´erieux) fication. The fungus was identified as Nannizziopsis sp by ITS sequencing. PT/CT revealed hypermetabolic lesions in muscles of both lower limbs, and pulmonary micronodules, suggestive of disseminated infection. Serum (1-3)-β-d-Glucan was at least once >523 pg/mL. Conclusion: Only five cases of human Nannizziopsis infections have been reported including four disseminated disease, and three among immunosuppressed patients (two HIV-positive patients and one kidney-transplant recipient). Four patients were from West-Africa. Initial misidentification as Trichophyton rubrum and as Geotrichum sp was also highlighted in two reported cases. The positivity of glucan test (and serum galactomannan consistently negative) supports the diagnosis on invasive disease with a high fungal burden. After 6 months of posaconazole, the PET/CT scan showed only residual hypermetabolic lesions in both patients. Difficulties to correctly identify Nannizziopsis species by morphology and recent knowledge about them suggest that these molds could have been under-diagnosed. Both of our strains were identified only to the genus level. The similarity searches and sequence alignments performed at the NCRMA grouped the sequences close to the species N. obscura. Further molecular analyzes are ongoing to establish the species of these isolates. Currently, molecular identification is mandatory to avoid false identification. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 422046 238e4f5e-3be9-4268-8bf6-2881904 e5e0e.jpg Caption 1: Figure 1 Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 422046 238e4f5e-3be9-4268-8bf6-2881904 e5e0e.jpg Caption 2: Figure 2

P175 Aspergillosis in Cystic Fibrosis Patients in Russia - the results of a prospective research Y.V. Borzova1 , I.E. Suslova2 , Y.I. Kozlova2 , T.S. Bogomolova2 , S.I. Ignateva2 , O.V. Aak2 , J.E. Melekhina2 , T.A. Stepanenko3 , T.A. Filippova3 , V.R. Mahmutova3 , A.V. Orlov A.4 , S.A. Krasovskiy5 , N.N. Klimko6 , N.V. Vasilyeva2 1 North-western State Medical University named after I.I.Mechnikov, SAINT-PETERSBURG, Russia 2 North-Western State Medical University named after I.I Mechnikov, SAINT-PETERSBURG, Russia 3 Municipal Hospital ?2, ST. PETERSBURG, Russia 4 Municipal Children’s Hospital of St. Olga, ST. PETERSBURG, Russia 5 Federal Pulmonology Research Institute, Federal Medical and Biological Agency of, MOSCOW, Russia 6 Kashkin Research Institute of Medical Mycology, SAINT-PETERSBURG, Russia Objective: The aim of the study was to evaluate the prevalence of different variants of pulmonary aspergillosis in CF patients Methods: In 2014–2017 yy. in prospective study were included 190 CF patients, 130 children. The median age was 14 y (range 1 - 37), 96 males. In all patients were performed total IgE test, specific A. fumigatusIgEand IgG tests in serum, and skin tests with six fungal allergens. In case of pulmonary aspergillosis suspicion chest CT scan was made, and bronchoalveolar lavage (BAL) and sputum were examined with calcofluor white microscopy and culture. The diagnosis of CPA was established with Denning et al. 2016 criteria, ABPA – Stevens et al. 2003, IA – EORCT/MCG 2008. Results: Total IgE serum level varied from 1 to 3891 IU/ml (median - 149). Sensitization to fungi was identified in 57% patients. The highest frequency of fungal sensitization was connected with Candidaspp. (73%), Alternaria spp. (34%) andAspergillus spp. (27%). Occurrence of sensitization to other fungi: Rhizopusspp. – 20%, Penicilliumspp. – 10%, and Cladosporiumspp. – 6%.A. fumigatus IgG was detected in 68% patients. BAL and sputum cultures identified A. fumigatusin 18% patients, A.flavus- 4,7%,A. niger- 3,7%, A. nidulans – 0,5%, andA. tereus - 0,5%. ABPA was diagnosed in 4,7% patients, CPA– 4,2% patients, and invasive aspergillosis – 0,5%. Severe CF was observed in all patients with ABPA and CPA. Patient with IA underwent liver transplantation nine months before. The main clinical manifestations of ABPA were cough (100%) and dyspnea (100%), exacerbation of CF (22%) and fever (22%). In all patients with ABPA was identified sensitization to A. fumigatus, total serum IgE level varied from 196 to 2000 IU/ml (median – 990).Main etiology agents of ABPA were A. fumigatus (77%) andA. flavus (11%). In ABPA patients chest CT scan abnormalities were central bronchoectases (100%), infiltrates (100%) and atelectasis (11%). In patients with CPA the main clinical manifestations were exacerbation of CF (100%), cough (100%), fever (62%), and hemoptysis (50%). Low lung function (FEV1% 103 CFU/ml and presence of only Candida species in urine specimen) were enrolled as case group and urine samples with concomitant infections were excluded. Thirty four patients with negative direct examination and culture were included as control patients. Then IL-17 and IL-22 were measured in the lyophilized and non lyophilized urine. The relevant cytokine titers of the two groups were compared and the association of cytokine elevation and candiduria was investigated. Results: The majority of candiduric patients were from ICU and urology units of women. Only 4 patients (11.7%) manifested fever and dysuria. Massive leukocyturia (>50 WBC per hpf) was observed in urine of 4 patients. Candida glabrata was commonly isolated species (44%). Levels of the urine IL-17 and IL-22 were significantly elevated in candiduric patients when compared to non-candiduric control subjects. While an increased IL-17 level was significantly associated with candiduria {Odds ratio1.09, 95% confidence interval 1.003-1.17; P = 0.04}, an increased IL-22 level was not. The results showed that lyophilized urine samples will maximize the detection power of urinary cytokines. Conclusion: Our results indicate that direct examination, fungal urine culture and investigation of IL-17 and IL-22 are useful tools for diagnosis of Candida urinary tract infection.

P192 Haemocyte responses in Galleria mellonella infected by Candida glabrata, Candida nivariensis and Candida bracarensis ´ 2 Hernando1 , E. Mateo2 , E. Eraso2 , G. Quindos 1 Universidad del Pa´ıs Vasco/Euskal Herriko Unibertsitatea, BILBAO, Spain 2 Universidad del Pa´ıs Vasco/Euskal Herriko Unibertsitatea (UPV/EHU), BILBAO, Spain Objective: To determine the haemocyte responses during invasive infections caused by Candida glabrata, Candida nivariensis and Candida bracarensis in a Galleria mellonella model. Methods: Galleria mellonella larvae were distributed in groups of five and infected with each of the following reference strains: Candida glabrata ATCC 90030, Candida glabrata NCPF 3203, Candida nivariensis CBS 9984, Candida nivariensis CECT 11998, Candida bracarensis NCYC 3397 and Candida bracarensis NCYC 3133. Larvae were inoculated with 10 μl of 1 × 105 , 1 × 106 and 1 × 107 yeast/ml in the last left pro-leg with a precision syringe. Two control groups were used: untouched larvae and larvae inoculated with PBS buffer supplemented whit ampicillin (20 μg/ml). After infection, larvae were incubated for 3 h at 37 ◦ C and then, haemolymph of each larva was collected. The same volume of haemolymph, 50 μl, was mixed with IPS buffer (Insect Physiological Saline buffer) to avoid melanisation. The haemocyte response was determined by counting cells using a haemocytometer. Each assay was repeated at least three times. The results obtained with each inoculum were analysed using one-way ANOVA to evaluate the differences between strains (P < 0.05 was considered as statistically significant). Results: Larvae infected with both Candida glabrata strains presented the same behaviour: statistically significant differences in the response of haemocytes were observed between the untouched larvae and those infected with the 1 × 105 and 1 × 106 inocula, but not differences were detected with 1 × 107 cells/ml inoculum (Table 1). Similar results were obtained in larvae infected with Candida nivariensis CECT 11998 but not with CBS 9984 strain, in which differences were detected with 1 × 107 and 1 × 105 cells/ml but not with 1 × 106 cells/ml. Otherwise, haemocyte responses of larvae infected with Candida bracarensis strains presented differences with untouched larvae; however, no significant differences between larvae infected with all the assayed inocula were showed. Conclusion: Galleria mellonella is a useful model to study invasive candidiasis throughout analysis of haemocyte responses to the infections caused by Candida glabrata, Candida nivariensis and Candida bracarensis. The haemocytes responses in Galleria mellonella larvae infected with Candida glabrata and Candida nivariensis was similar but differences between the inocula injected were observed. However, there were no differences in the haemocytes production in larvae infected with Candida bracarensis.

Funding: This study was partially financed by GIC15/78 IT-990-16 (Gobierno Vasco-Eusko Jaurlaritza). AH has a grant from the UPV/EHU. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 422355 74bed42a-f421-4167-9f82-16f55 808f184.jpg

P193 Comparative study of the pathogenicity and humoral response of Lomentospora, Scedosporium and Aspergillus infections in a murine model I. Buldain, L. Martin-Souto, A. Pellon, A. Antoran, A. Rementeria, F.L. Hernando, A. Ramirez-Garcia University of the Basque Country UPV/EHU, LEIOA, Spain Objective: Lomentospora prolificans is an emerging pathogen that causes infections with high mortality rates associated with the lack of effective treatments and the difficulties to perform a rapid and accurate diagnosis. Therefore, it is necessary to deep into the understanding of its pathobiology and the identification of new specific diagnostic markers According to this, two main objectives were proposed. A comparative study of pathogenicity between Lomentospora, and the other clinically important filamentous fungus Scedoporium apiospermum, S. aurantiacum and Aspergillus fumigatus was carried out in a murine model. On the other hand, the cross-reactivity with L. prolificans of the serum IgGs from mice infected with the other fungal species was studied, identifying the most immunoreactive antigens. Methods: Swiss female 8-week-old immunocompetent mice were used. They were separated in 5 groups (6 animals/group, except for the group infected with L. prolificans (12 mice)) and infected intravenously with 105 conidia/animal of different fungi (L. prolificans, S. apiospermum, S. aurantiacum and A. fumigatus), and saline solution for the control group. Once infected, a daily follow-up of clinical signs associated with infection was carried out. Twenty-eight days after infection, surviving animals were sacrificed for blood and organ extraction. Blood samples were used for obtaining sera and organs for CFU counting and histopathological analyses. Pooled sera from each infected group were used over L. prolificans proteome to detect antigens by 2-DE immunoblotting. Afterwards, the most immunoreactive antigens were identified by LC-MS/MS. Results: Mice infected with Lomenstospora and Scedosporium species developed signs associated with infection, such as changes in fur consistency, weight loss, and neurological signs. In contrast, no signs were observed in A. fumigatus infected mice. Survival rates obtained were different, observing 50% in L. prolificans infected group, 83.3% in S. apiospermum and S. aurantiacum, and 100% in A. fumigatus. According to this, in Lomentospora and Scedosporium infected groups high CFU counting were obtained in spleen, kidneys and liver. It is worth highlighting the high number of CFUs observed in the brains of L. prolificans group. Moreover, the histological analysis showed renal affectation of the groups infected with Lomentospora/Scedosporium, being especially relevant the high amount of conidia observed in the case of Lomentospora. However, in animals infected with A. fumigatus, very few CFUs were collected. Regarding the immunoproteomics study, the Heat shock protein 70 (Hsp70) was identified as the major antigen, with a percentaje of volume 20 times higher than the next most immunoreactive antigen. All the most immunoreactive antigens showed cross-reactivity with the sera from mice infected with Scedosporium species but not with Aspergillus, which showed a completely different immunome pattern. Conclusion: A model of disseminated infection was developed in immunocompetent mice with Lomentospora and Scedosporium species. Using this model, Lomentospora was shown to be more virulent than Scedoposporium and, above all, Aspergillus species. Moreover, the immunoproteomic study revealed great differences between the antigenic pattern of Lomentospora/Scedosporium and A. fumigatus, which is valuable to identify new diagnostic markers. In this sense, the Hsp70, as the major antigen of Lomentospora/Scedosporium species, stands out as interesting candidate.

S106

P194 Molecular identification of selected fungi species in patients with bronchial asthma Anna Hofman, Teresa Hofman Centrum Alergologii, Poznan, Poland

Medical Mycology, 2018, Vol. 56, No. S2

P198 Sulfamethoxazole dosage in monitoring of the treatment of paracoccidioidomycosis patients treated with cotrimoxazole RS Cavalcante1 , A. P. R. Pereira2 , C Marc¸on1 , RP Mendes1 1 ˜ Paulo State University, BOTUCATU, Brazil Botucatu Medical School - Sao Universidade Federal de Mato Grosso do Sul (UFMS), CAMPO GRANDE, Brazil

2

Objective: The cause of bronchail asthma is still unknown. The aim of this study was to identify the fungi species in sputum form patients with bronchial asthma, and their role. Methods: In examined group we had 58 patients, diagnosed with bronchial asthma, aged 18–76. Control group consist of 12 healthy volunteers. From all subjects sputum was taken by inhaled provocation test. We examined the sputum by PCR method, looking for DNA of fungi- Candida albicans, Aspergillus fumigatus, Penicillium chrysogeum and Fusarium oxysporum. Results: In 53(91.4%) patients with bronchail asthma we had found fungi DNA- in 34 (58.6%) for Asperillus fumigtus, in 17 (29.3%)- for Candida albicans, in 5 (8.6%) for Fusarium oxysporum, and in 2 (3.4%) for Penicillium chrysogeum. In 5 patients we have found DNA for few fungi in one material. In healthy group we hven/t found any fungi DNA. Conclusion: The fungi, mainly Aspergillus fumigatus, play an important role in ethiopathogenesis of bronchial asthma. They are responsible for chronic inflammation. Antifungal medication should be considered for their treatment.

P195 R R Western Blot for ABPA and Aspergillus LDBIO Diagnostics Evaluation of the PlateliaTM Aspergillus IgG BioradELISA diagnosis in cystic fibrosis patients. ` SOLENE Le Gal1 , SALLY Dipoko2 , JEAN Le Bihan3 , YOHANN Le Govic4 , KRISTA Revert5 , ANNE Dirou5 , SOPHIE Ramel5 , GILLES Nevez2 , DOROTHEE Quinio2 1 University Hospital of Brest, BREST, France 2 Brest University Hospital, BREST, France 3 Ildys Foundation, ROSCOFF, France 4 Angers University Hospital, ANGERS, France 5 Ildys foundation, ROSCOFF, France Objective: Allergic bronchopulmonary aspergillosis (ABPA) is a bronchial-related hypersensitivity reaction involving predominantly Aspergillus fumigatus. It occurs frequently in patients with cystic fibrosis (CF). The diagnosis of ABPA in CF patients remains difficult because clinical signs are common to both diseases (CF and ABPA). ABPA diagnosis is based on clinical, radiological, and biological arguments, including serum anti-Aspergillus antibody detection. The objectives of the present study were: i) to evaluate R ELISA and Aspergillus LDBIO Diagnostics R Western Blot (WB) for ABPA the two techniques Platelia TM Aspergillus IgG Biorad diagnosis, ii) to choose between two approaches, one that consisted in combining systematically ELISA and WB techniques [ELISA + WB], another one that consisted in performing WB only if ELISA was positive [ELISA +/- WB]. Methods: We retrospectively enrolled 66 CF patients monitored at the CRCM of Roscoff - Perharidy (ILDYS foundation) who had undergone serum anti-Aspergillus antibody detection using ELISA and WB assays from November 2014 to May 2015. These patients were sorted in two groups according to ABPA criteria defined by the ISHAM. The performance of the two assays and the two above approaches were evaluated through sensitivity, specificity, predictive value (PPV, NPV), and likelihood ratio (LR+, LR-) assessment. Results: The sensitivity, specificity, PPV, NPV, LR+, LR- were 100%, 58%, 11%, 100%, 2.4, and 0 respectively for the ELISA assay. The sensitivity, specificity, PPV, NPV, LR+, LR- were 100%, 26%, 7%, 100%, 1.4, and 0 respectively for the WB assay. The sensitivity, specificity, LR+, LR- were 100%, 15%, 1.2, and 0 respectively for the [ELISA + WB] approach. The sensitivity, specificity, LR+, LR- were 100%, 63%, 2.7, and 0 respectively for the [ELISA +/- WB] approach. Conclusion: The results show a better performance of the [ELISA +/- WB] approach. According to this approach a negative result provides a strong argument to rule out ABPA diagnosis.

P196 Multilocus phylogeny of clinical and environmental Sporothrix isolates reveals an indeterminate clade C. Toriello, C. Brunner-Mendoza, L. Parra-Jaramillo, H. Navarro-Barranco, A. Perez-Mejia, M.R. Reyes-Montes Universidad Nacional Autonoma de Mexico, MEXICO CITY, Mexico Objective: Sporothrix schenkii has been subject to several taxonomic changes in recent years. Previous multilocus analyses have suggested that the populations of S. schenkii are in process of divergence. It is essential to clarify the identity of isolates originally classified as S. schenckii according to the last taxonomic revisions to deepen in its epidemiology and guide public health interventions. Methods: In this study, 54 isolates, ten Mexican soil isolates and the remaining from clinically diagnosed patients with sporotrichosis, 31 from Mexico (MX), 8 from Colombia (CO) and 5 from Guatemala (GT) were used. Total DNA was extracted using the Dneasy Plant Mini Kit (Qiagen, US). For quantification and purity of DNA a spectrophotometer DeNovix Inc. was used and the results were confirmed by electrophoresis. Calmodulin (CAL), translation elongation factor (TEF1) and beta tubulin (TUBB) regions were amplified by PCR for all isolates and the products were sequenced and later edited in Geneious v. 8.1.8 software. For the phylogenetic analysis CAL, TEF and TUBB sequences from reference strains obtained from the GenBank were included. Alignments were made with MAFFT v. 7.017 with default settings. Phylogenetic hypotheses were developed by Bayesian Inference (BI) with MrBayes 3.2.6 to determine posterior probabilities (PP). Results: TEF1 and CAL topologies were highly congruent between them, showing an indeterminate clade formed by 26 isolates from MX and GT with a very high posterior probability (PP = 1). On the other hand, the remaining isolates were identified as S. schenkii (n = 17) and S. globosa (n = 11). In previous analysis with some of these isolates, a high variability within the S. schenkii clade was evident suggesting divergent genotypes. TUBB topology was consistent with TEF1 and CAL topologies except for the polytomy that not allowed the recognition of the S. schenkii clade and the indeterminate clade. All isolates identified as S. globosa (n = 11) were obtained from human sporotrichosis, 7 from CO, 2 from MX and 2 from GT. No sequences from the isolates studied were identified as S. brasiliensis, S. lurei, S. chilensis, S. mexicana, S. pallida or S. lignivora. Conclusion: Our results suggest a new monophyletic group mainly formed from clinical isolates from Mexico, although it is still necessary to apply polyphasic taxonomy for the recognition of new taxa in Sporothrix.

P197 Fungal patch tests diagnosis ANNA Hofman, TERESA Hofman Centrum Alergologii, POZNAN, Poland Objective: The aim of this study was to identify the role of fungi in atopic dermatitis. Methods: We examined 54 adult patients with atopic dermatitis- 34 women and 20 men.In all we have done patch tests with fungal allergens. We used allergens for: Alternaria alternata, Aspergillus mix., Botrytis cinarea, Candida albicans, Cladosporium herbarum, Epidermaphyton, Mucor racemosus, Fusarium moniliforme, Penicillium mix, Rhizopus mix, Trichothecium, Trichophyton mix, Tilletiaceae, Sacharomyces mix and Blumeria graminis. Results: In 49 patients (90.7%) we saw positive results. Mainly, in 43 (79.6%) tests were positive for Candida albicans, in 13 (24.1%) for Rhizopus nigricans, in 11 (20.4%) for Penicillium mix. Botrytis cynarea in 11 (20.4%), Cladosporium herbarum and Blumeria graminis in 11 too (20.4%), Tilletiaceae in 8 (14.8%), Aspergillus mix in 5 (9.3%), Sacharomyces mix in 5 (9.3%) and Mucor racemosus in 5 too. 5 patients(9.3%)-had negative results. Conclusion: 90% of patients with atopic dermatitis have posotive patch tests with fungi, mainly Candida albicans. The results show late allergic reaction type IV for these allergens

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Objective: Paracoccidioidomycosis (PCM) is systemic mycosis caused by thermodymorphic fungi of the genus Paracoccidioides. Trimethoprim-sulfamethoxazole, also called cotrimoxazole (CMX), is one of the main therapeutic options. In the current treatment of PCM, CMX is used in the dose of 2,400 mg of sulfamethoxazole, which corresponds to six tablets divided into two daily doses, a fact that has led to the patient’s lower adherence to antifungal therapy. Experimental studies have observed that the single daily dose may be sufficient to treat PCM. This study aimed to evaluate the efficacy of murine PCM treatment with CMX administered in one and two daily doses. Methods: Thirty-six patients with a confirmed diagnosis of PCM, attended by the Department of Infectious Diseases of University Hospital of Botucatu Medical School - UNESP, from 1996 to 2013, were selected for this study. Clinical and laboratory data were obtained from medical records. Patients underwent monthly SMX dosing until clinical cure (initial treatment) and every three months until serologic cure (complementary treatment) was achieved. It was considered as SMX adequate serum levels when 80% or more of the measurements reached desired therapeutic values “”(70 mg/mL for initial treatment and 50 mg/mL for complementary treatment). The continuous variables were presented in median, 1st and 3rd quartiles and analyzed by the Mann-Whitney test, with P values “”lower than 0.05 being considered significant. Results: The 36 patients received CMX throughout the treatment of PCM. There was no difference in time to reach clinical cure between patients with the acute form with adequate levels [176 days (141–201)] and inadequate sulfa [195 days (123–251); P = 0.59]. However, in patients with chronic form (CF), clinical cure was shorter in those with adequate levels [96 days (55 - 126)] than in inadequate [224 days (147–319); P = 0.002]. The time to reach serological cure was also shorter in patients with CF with adequate levels [313 days (240–825)] than those with inadequate levels [720 days (473–1598); P = 0.04]. Patients who presented more than 80% of SMX serum levels above 70 mg/mL at initial treatment reached earlier clinical cure than those with SMX levels between 50–70 mg/dL [126 days (77 – 159) vs. 201 days (173 – 236), P = 0,02]. Conclusion: These findings demonstrate the great importance of serum monitoring of SMX levels during the PCM treatment with CMX for earlier clinical and serologic cure.

P199 Comparison of gene expression for lipase of Candida albicans sensitive and resistant to fluconazole isolated from patients with oral Candidiosis AYATOLLAH NasrollahiOmran1 , SHARBANO Kihanian2 , S. Mehri3 1 Faculty of Medicine, Tonekabon Branch,Islamic Azad University, Tonekabon, Iran, TONEKABON, Iran 2 Faculty of Medicine, Tonekabon Branch,Islamic Azad University,, TONEKABON, Iran 3 Faculty of Biology Sciences,Tonekabon Branch,Islamic Azad University, TONEKABON, Iran Objective: With the development of drug resistance in strains of fungi, there is a considerable resistance of Candida albicans strains to the fluconazole. Molecular studies to determine the relationship of such a drug resistance associating with the increased gene expression of enzymes produced in drug-resistant Candida isolates are developing. This study was aimed to evaluate the relationship between extracellular lipase gene (LIP8) expression of Candida albicans isolates from patients candidiasis with sensitivity or resistance to fluconazole. Methods:: Drug susceptibility testing of Candida albicans was performed on the oral and vaginal candidiasis to determine the proportion of strains sensitive or resistant to fluconazole with the NCCLS method. To evaluate and compare the expression of these genes in the susceptible and resistant strains, RT REAL TIME PCR reactions were used Results: Candida albicans was isolated from 46 cases which identified 20 susceptible isolates, 12 semi-susceptible isolates, and 14 isolates resistant to fluconazole. By using the PCR reaction, the results showed that the expression of this gene in fluconazolesusceptible isolates was moderate, while the expression of these genes in the isolates resistant to fluconazole was high. Conclusion: The results of lipase gene (LIP8) expression showed that additional expression of some genes enzymes responsible for virulence of Candida may also play a role in resistance to the fluconazole.

P200 Evatuation of Drug susceptibility of Aspergillus species isolated from ICU of Hospitals in Invitro Ayatollah NasrollahiOmran1 , Student Karami2 1 Faculty of Medicine, Tonekabon Branch,Islamic Azad University, Tonekabon, Iran, TONEKABON, Iran 2 Tonekabon Branch,Islamic Azad University, TONEKABON, Iran Objective: Invasive aspergillosis is the most threatening disease inimmunocompromised patients that it has the highest morbidity and mortality rate amongst invasive fungal infections in the hospitals. The aim of present study was to assess antifungal susceptibilitytesting versus Aspergillus spp isolated from the hospitals enviroment Methods:: After collecting 160 plates containing Sabouraud dextrose agar from the air and the environment of hospital’s ICUs (intensive care units), the phenotypic and molecular identification of the colonies was performed in order to identification of Aspergillusspp. After DNA extraction, the molecular identification was carried out using universal fungal primers (ITS gene) and DNA sequencing. Antifungal susceptibility testing was performed with using the CLSI broth microdilution (M38-A2) method for Aspergillus isolates. Results: Out of 160 hospital environmental samples, 11Aspergillus species were obtained. The eleven Aspergillus spp. were identified by sequencing as: 5 A. flavus, 3 A. sydowii, 1 A. fumigates and 2A. Oryzae. Our antifungal susceptibility testing results indicated that A. sydowii and A. fumigatus were sensitive to Amphotericin and Voriconazole and were resistant to Itraconazole. A. sydowii was resistant to Caspofungin while A.fumigatus was sensitive to the thisdrug. A. flavus was susceptible to all the drugs Conclusion: There were a number of reasons including delayed diagnosis, lack of appropriate curing, and the existence of various diseases and neutropenia which could lead to the high mortality rate of patients with Aspergillosis, especially in patients of hospital’s ICUs.

ABSTRACT

S107

P201 Onychomycosis caused by Arthrinium arundinis in leprosy patient: Case report

P203 Plaque lesion type chromoblastomycosis caused by Fonsecaea monophora: Case report

P. L. Tavares1 , Daiane Heidrich1 , Let´Icia M Eidt2 , Danielle Pagani1 , Amanda C Ribeiro1 , Gerson Vettorato3 , TA´IS G Amaro3 , Maria L Scroferneker1 1 Universidade Federal do Rio Grande do Sul, PORTO ALEGRE, Brazil 2 ´ Secretaria Estadual de Saude, PORTO ALEGRE, Brazil 3 ´ Complexo Hospitalar Santa Casa de Misericordia de Porto Alegre, PORTO ALEGRE, Brazil

P. L. Tavares1 , Daiane Heidrich1 , Danielle Pagani1 , Amanda C Ribeiro1 , Gerson Vettorato2 , TA´IS G Amaro2 , Maria L Scroferneker1 1 Universidade Federal do Rio Grande do Sul, PORTO ALEGRE, Brazil 2 ´ Complexo Hospitalar Santa Casa de Misericordia de Porto Alegre, PORTO ALEGRE, Brazil

Objective: to report a case of onychomycosis caused by Arthrinium arundinis, a rare infectious fungus, in lepromatous leprosy patient in Rio Grande do Sul, Brazil. Methods: a female patient with 56 years-old, with relapsing lepromatous leprosy, in first readministration of multidrug therapy, the collection of nail material for mycological exams was performed after clinical observation of total toenails distrophy (Figure 1) suggesting onychomycosis. Direct and cultural mycological examinations were performed and for species identification, the sequencing of Internal Transcribed Spacer (ITS) of rDNA using primers ITS 5 and 4 was realized and it was confirmed by evaluation of novel collection isolate. Eleven clinical antifungals (all Sigma-Aldrich, USA) were evaluating according to the protocol M38-A2 of the Clinical and Laboratory Standards Institute (CLSI), using the microdilution technique. Results: Direct examination of the nail scrapings showed hyaline septate hyphae, branching at acute angles. In Mycosel culture, white and flat colonies weakly sporulated was observed after 14 days of incubation in 25◦ C and no growth was observed at 37◦ C. In potato dextrose agar, after 7 days at 25◦ C showed pale-brown single-celled conidia with a clear brightly opalescent equatorial ring. Conidia were sympodially generated and large cluster-aggregated conidiogenous cells were observed. The species, Arthrinium aurundinis, was identified by ITS sequencing whit 99% of identify and 100% of coverage with type strain CBS 106.12. The minimal inhibitory concentrations (MICs) obtained of antifungals were (μg/mL): terbinafine (0.0312); amphotericin B (0.5); posaconazole (1.0); ketoconazole and ciclopirox olamine (8.0); itraconazole, voriconazole and tioconazole (≥16.0); fluconazole and griseofulvin (>64.0). The minimal effective concentration (MEC) for caspofungin was >64 μg/mL. Excepting terbinafine, amphotericin B and posaconazole, the isolate had higher MICs/MEC for all other antifungals. Therefore, the initial treatment was topic terbinafine twice a day, since rifampicin, one of the antibiotics administered in multidrug leprosy therapy, increase the clearance or metabolization of some antifungal, such as terbinafine and itraconazole, respectively, leading to a decrease in the effectiveness and efficacy of mycosis treatment. Conclusion: This is the second report of onychomycosis caused by A. arundinis and the first relate of this fungus infection in leprosy patient. Non-dermatophyte fungi usually present profiles less susceptible to antifungal than dermatophytes and patients with leprosy are predisposed to be infected by these fungi due to the ease of their entry by the frequent injuries caused by the neural compromise caused by Mycobacterium leprae during its infectious process. Thus, evaluations of superficial mycoses, with identifications and antifungal tests, besides patient follow-up, are important for the outcome of the cases. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 422565 5a846c6b-7f86-4dc4-967f-bb5397 f8b4e1. Arthrinium.jpg Caption 1: Figure 1. Onychomycosis caused by Arthrinium aurundinis in leprosy patient.

Objective: to report a case of chromoblastomycosis with plaque lesion type, the least common type lesion of the disease, that was caused by Fonsecaea monophora in Rio Grande do Sul, Brazil, and, additionally, antifungal assay was performed. Methods: the lesion on arm of a 65-years-old man had slow and progressive desenvolver during five years. On physical examination, erythematous plaque, formed by the coalescence of multiple papules, with well defined borders and discreet surface scaling (Figure 1). In dermatoscopy, there was erythema with vascular polymorphism (irregular, glomerular and dotted linear vessels), and multiple bright white lines, acquired orthogonal arrangement in some regions, delimiting areas with the presence of red-orange points. Against these characteristics, initial hypotheses were cutaneous non-melanoma skin cancer, cutaneous lymphoma or sarcoidosis or atypical mycobacteriosis (tiraria micobacteriose). For diagnostic, an incisional biopsy with punch 4 mm was realized. The stains hematoxilin and eosin, Zhiel Neelsen and Groccot were performed. Besides that, mycological cultural examination in Mycosel medium was requested after fungal evidence. For species identification, the sequencing of Internal Transcribed Spacer (ITS) of rDNA using primers ITS 1 and 4 was performed comparing the sequence with the type strains of the genus in phylogenetic tree. The minimal inhibitory concentrations (MICs) of amphotericin B, itraconazole, ketoconazole, voriconazole, posaconazole and terbinafine (all Sigma-Aldrich, USA) were evaluating according to the protocol M38-A2 of the Clinical and Laboratory Standards Institute (CLSI), using the microdilution technique. The minimum fungicidal concentrations (MFCs) were also determined. Results: anatomopathology showed pseudoepitheliomatous epithelial hyperplasia, granulomas in the superficial dermis with prominent peripheral lympho-histiocytic infiltrate and sclerotic cells, indicating chromoblastomycosis. Besides, Ziehl Neelsen was negative and Grocott was positive. In culture, colony of Fonsecaea spp. was developed and the species, F. monophora, was identified by ITS sequencing. The MICs obtained of antifungals were (μg/mL): posaconazole (≤0.03); ketoconazole and terbinafine (0.06); itraconazole and voriconazole (0.125); amphotericin B (>16.0). The MFC of terbinafine was 0.5 μg/mL and for all the others, the MFC were ≥4.0 μg/mL. Excepting amphotericin B, the isolate had lower MICs for all other antifungals, including itraconazole, which is the unique oral antifungal with free governmental distribution in Brazil. Therefore, itraconazole 400 mg/day was prescribed for the patient, which is being accompanied by the medical staff and showed improvement of the lesion during six months of treatment. Conclusion: chromoblastomycosis was not among the initial hypotheses of diagnosis, since the atypical lesion (plaque type) of this case. However, the pathology requested was determinant for the diagnosis of the disease. In addition, this report shows that F. monophora has been taking place in the diagnosis in the country with the highest prevalence of Fonsecaea pedrosoi. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 422610 e7d59d66-3f1f-4085-bec3a832922d7cfb. Fonsecaea.jpg Caption 1: Figure 1. Chromoblastomycosis with plaque lesion caused by Fonsecaea monophora on the arm.

P202 Epidemiological characteristics of otomycosis in Tehran, Iran:with emphasis on molecular identification and antifungal susceptibility of species within Aspergillus section Nigri

P204 Identification of chromoblastomycosis agents by Fourier Transform-Infrared Spectroscopy supervised by ITS rDNA region

Zahra Kamali sarwestani1 , Roshanak Daie ghazvini2 , Shahram Mahmoudi2 , K. Ahmadikia1 , S.JAMAL Hashemi2 , A. Davari3 1 Tehran University of Medical Sciences, TEHRAN, Iran 2 Department of Medical Parasitology and Mycology, School of Public Health, Tehran, TEHRAN, Iran 3 Mazandaran University of Medical Sciences, Sari, Iran

´ 3 , Carina Timotheo1 , Danielle Pagani1 , Maria L P. L. Tavares1 , Valeriano Corbellini2 , Mauricio Ram´ırez-Castrillon Scroferneker1 1 Universidade Federal do Rio Grande do Sul, PORTO ALEGRE, Brazil 2 Universidade de Santa Cruz do Sul, SANTA CRUZ DO SUL, Brazil 3 Universidad Santiago de Cali, CALI, Colombia

Objective: Otomycosis is a superficial infection of the ear caused by a spectrum of various fungal agents in particular species under Aspergillus and Candida genera. Black aspergilli (section Nigri), particularly Aspergillus niger and is the most prevailing causative agents of otomycosis. However, using morphological criteria alone, discrimination of species within section Nigri -A number of different species whose morphological features resemble those of A. niger- cannot be reliably achieved. Due to different susceptibility patterns among species under sectionNigri to antifungal agents and appropriate treatment, species delimitation of this section is issue of great importance.The aim of this study was to determine the frequency of otomycosis in Tehran, Iran, with emphasis on molecular identification and determination the susceptibility pattern of a set of black aspergilli isolated from otomycosis patients. Methods: From Apr 2016 to Jan 2017 a set of 412 subjects with a suspicion of external otitis were included. Clinical examination and specimen collection was performed by an otorhinolaryngologist. Subsequently, direct examination and culture was performed on specimens and isolated molds were identified morphologically. Yeast isolates were identified using CHROMagar candida medium and PCR-RFLP of ribosomal DNA whenever needed. Black Aspergillus isolates from otomycosis patients were identified by using the PCR-sequencing of the β-tubulin gene. Furthermore, the susceptibility of black aspergilli isolates to three antifungal drugs, including fluconazole (FLU), clotrimazole (CLT), and nystatin (NS), were examined according to CLSI M38-A2. Results: A total of 117/412 (28.4%) included patients were diagnosed with otomycosis including 64 (54.7%) males and 53 (45.3%) females. Patients were within the age range of 10–75 years and the highest prevalence was found in the age group of 46–55 years (30.77%). Pruritus (89.74%) and auditory manipulation/trauma (83.76%) were the predominant symptom and predisposing factor, respectively. From 117 patients 126 isolates were recovered, black aspergilli (n = 43, 34.1%) were the most common etiologic agents and Candida glabrata (n = 25, 20%) was the predominant isolated yeast. Furthermore, 16 cases of mixed otomycosis were identified and coinfection due to A. niger and C. glabrata (seven cases) were the predominant pattern. While, with sequence-based methods the majority of black aspergilli isolates were identified as A. tubingensis (32/43, 74.42%) followed by A. niger (11/43, 25.58%). The lowest minimum inhibitory concentration (MIC) values were observed for NS with geometric means (GM) of 4.65 μg/ml and 4.83 μg/ml against A. tubingensis and A. niger isolates, respectively. CLT showed wide MIC ranges and a statistically significant inter-species difference was observed between A. tubingensis and A. niger isolates (P < 0.05). FLU was inactive against both species with GMs >64 μg/ml. Conclusion: Species other than A. niger can be more frequent as observed in our study. In addition, considering the low and variable activity of tested antifungal drugs, empirical treatment can result in treatment failure. Accurate identification and antifungal susceptibility testing of isolates is, however, recommended

Objective: differentiate the chromoblastomycosis (CBM) agents for identification at level species using Fourier TransformInfrared Spectroscopy (FTIR) supervised by sequencing of Internal Transcribed Spacer (ITS) rDNA region. Methods: seventy-seven isolates of five genera of CBM agents were identified by comparison of ITS sequences of type strains available in GenBank using BLAST algorithm. Phylogenetic trees were performed when necessary for differentiation of Fonsecaea pedrosoi and Fonsecaea monophora. The strains prepared for Attenuated Total Reflection (ATR) with a new methodology using slices in glass fixing-modeling proposed. Five spectra were recorded from 4000 to 650 cm−1 for a strain and the average spectra of each one was calculated. The data set was pre-processed by sample (normalization and multiplicative scatter correction-MSC) R Software. The algorithms used for analyzing the spectra were Hierarchical cluster and by variable (mean-centering) in Pirouette analysis (HCA) to observe similarities and differences between species and Partial Least Square Regression (PLS) to propose the model of identification, which was evaluated by cross-validation and external validation. Results: the strains were identified with 99% of identity with type strain of each species of thirteen species distributed on five genera of CBM. The identified species were: F. pedrosoi (41), F. monophora (15), F. pugnacious (1), F. nubica (1), C. carrionii (3), C. bantiana (1), P. verrucosa (2), P. americana (5), E. spinifera (3), E. xenobiotica (2), R. quaspersa (1), R. tropicalis (1), R. similis (1). Dendrogram of HCA had similar result to phylogenic tree when comparing F. pedrosoi and F. monophora, since these species presented 81.2% and 78% of similarity by the two tools, respectively. In relation to regions bands of FTIR obtained, the regions between 4000 and 3100 cm−1 (attributed to NH and OH stretching) together with the bands 1650 (amide I of proteins), 1050 and 1025 (polysaccharides bands) and the 900-800 region (fingerprint) (Figure 1). It was the fraction of spectra of FTIR most related to the differences between CBM species, as observed by regression vector in PLS. The model proposed could classify the thirteen CBM species, with high coefficient of determination and low error (RMSECV) of the tendency line obtained (Figure 2), indicating that this model can be efficient to identify these species of CBM agents. Conclusion: CBM is a fungal infection caused by species of different dematiaceous genera that are identified by sequencing of one or more regions of DNA and phylogenic tree, which become an expensive and difficult work. FTIR demonstrated to be a faster and inexpensive alternative for identification of CBM agents. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 422643 ee8de146-611d-40a0-b691-ad83 fe4fea9d.png Caption 1: Figure 1. FTIR total spectrum presenting the bands found in chromoblastomycosis agents Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 422643 ee8de146-611d-40a0-b691-ad83 fe4fea9d.FTIR identification.jpg Caption 2: Figure 2. Calibration set and validation set curves of the chromoblastomycosis agents species identified by DNA analysis of ITS region with the specie

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

S108

P205 Prediction of the itraconazole minimal inhibitory concentrations (MICs) of chromoblastomycosis agents using Fourier Transform-Infrared Spectroscopy and chemometrics P. L. Tavares1 , V Corbellini2 , A Koehler1 , M.L. Scroferneker1 1 Universidade Federal do Rio Grande do Sul, PORTO ALEGRE, Brazil 2 Universidade de Santa Cruz do Sul, SANTA CRUZ DO SUL, Brazil Objective: use Fourier Transform-Infrared Spectroscopy (FTIR) and chemometrics to predict the itraconazole minimal inhibitory concentrations (MICs) for chromoblastomycosis (CBM) agents. Methods: seventy-seven isolates of five genera of CBM agents were identified by comparison of ITS sequences of type strains available in GenBank using BLAST algorithm. Antifungal susceptibility of CBM agents to itraconazole (Sigma-Aldrich, USA) was performed according to the protocol M38-A2 of the Clinical and Laboratory Standards Institute (CLSI), utilizing the microdilution technique with a final antifungal concentration varying between 0.03-16 μg/mL to determine MICs. For FTIR analysis, the strains were prepared for Attenuated Total Reflection (ATR) with a new methodology using slices in glass fixing-modeling proposed. Five spectra were recorded from 4000 to 650 cm−1 for each strain. The data set was sample pre-processed by amplitude normalization R Software. PLS-FTIR algorithm was performed with quintuplicates using two orthogonal and 1st derivative (5 points) in Pirouette signal correction components and leave-one-out cross-validation. Results: the strains were identified with 99% of identity with type strain of each species of thirteen species distributed on five genera of CBM. The identified species were: F. pedrosoi (41), F. monophora (15), F. pugnacious (1), F. nubica (1), C. carrionii (3), C. bantiana (1), P. verrucosa (2), P. americana (5), E. spinifera (3), E. xenobiotica (2), R. quaspersa (1), R. tropicalis (1), R. similis (1). The geometric mean of itraconazole MICs was 0.784 μg/mL ranging between 0.06 μg/mL and 32.0 μg/mL, with MIC50 equal to 0.5 μg/mL and MIC90 equal to 2.0 μg/mL. FTIR analysis presented bands in the regions between 4000 and 3100 cm−1 (attributed to NH and OH stretching) together with the bands 1650 (amide I of proteins), 1050 and 1025 (polysaccharides bands) and the 900-800 region (fingerprint) (Figure 1). In the PLS-FTIR model, the merit figures presented error less than 0.001 microgram/mL and determination coefficient (R2 ) of 1.00 with 10 latent variables (Figure 2). The major contributions to regression model were observed in fingerprint region (regression vector, Figure 1). Conclusion: CBM is subcutaneous mycosis caused by different dematiaceous fungus belonging to many species and genera. Considering that each species can show different responses to antifungals, it is fundamental to determine the MIC. This model enables direct prediction of MICs, without necessity to identify the CBM agent or to perform antifungals susceptibility assays, which are more expensive and laborious than the methodology proposed here. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 422661 93dbb5c1-894a-40fe-93da-6b80 c7e91f46. FTIR itra.jpg Caption 1: Figure 2. Regression analysis of PLS-FTIR model of prediction of MIC of 77 samples of chromoblastomycosis agents against itraconazole supervised by CL Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 422661 93dbb5c1-894a-40fe-93da-6b80 c7e91f46. FTIR itra.jpg Caption 2: Figure 1. FT-IR mean spectrum of 77 samples (385 spectra) of chromoblastomycosis agents and regression vector of PLS-FTIR model of prediction of antif

P206 Subgingival sites and oral cavity as reservoirs for Candida spp. in diabetics and non-diabetics M. Radunovic1 , S Matic Petrovic1 , M Cimbaljevic1 , J Kuzmanovic Pficer1 , D Pavlica1 , V Arsic Arsenijevic2 , A Pucar1 1 School of Dental Medicine, University of Belgrade, BELGRADE, Serbia 2 School of Medicine, University of Belgrade, BELGRADE, Serbia Objective: Chronic periodontitis (CP) and oral mucocutaneous candidiasis have been considered as chronic complications of Type 2 Diabetes (T2D). The potential role of yeasts in the pathogenesis of periodontitis is especially important for diabetic patients, because antibiotics are commonly used in the treatment of periodontitis. The aim of this study was to detect Candida spp. on the tongue and in subgingival sites from systematically healthy subjects and subjects with T2D and CP. Furthermore, the present study aimed to find a potential difference in the detection of yeasts on the tongue and in subginival samples, in order to determine subgingival areas as potential reservoirs of yeasts. Also, the study searched for confounders of positive yeast detection in mentioned samples Methods: A total of 146 patients were included in this study. They were divided into four groups: group A consisted of non-diabetics with healthy periodontium, group B of non-diabetics with CP, group C of patients with T2D with glycoregulation and CP and group D of patients with T2D with poor glycoregulation and CP. Cotton swab samples from tongue and subgingival samples were obtained from each patient using sterile paper points and a sterile curette. Swab cultures were made on Sabouraud dextrose agar. Two sterile paper points were placed into the pocket for 30 s. Immediately after, subgingival samples were obtained from the same pocket by sterile curette. Both subgingival samples were inoculated in separate sterile plastic tubes containing 1 mL of Sabouraud dextrose broth, vortexed and 20μl of suspension was streaked on SDA. The number of CFUs was counted. Information about parameters that could potentially predict the presence of Candida spp. was collected. It included self-reported information about education, xerostomia, blood type, everyday intake of sweets and smoking habits. Fasting plasma glucose levels (FPG), HbA1c, hematological parameters (RBC, Hgb, HCT, MCV, MCH, MCHC, RDW) and sedimentation rate were measured Results: Candida spp. was detected on the tongue of 40/146 subjects (27.4%). Candida spp. was more prevalent in diabetics with poor glycoregulation than in other groups (χ 2: A vs D, P = 0.019, B vs D, P = 0.002 and C vs D, P = 0.025). Subjects with T2D had a significantly higher prevalence of Candida spp. detection (37.3%), than systematically healthy subjects (χ 2, P = 0.013). The presence of Candida spp. in subgingival areas detected by both sampling methods was 29.25% (43/146). Occurrence of Candida spp. in group D was significantly higher than in group A (χ 2, P = 0.018), group B (χ 2, P =P = 0.023) and group C (χ 2, P = 0.005). There were 22/146 (15.07%) cases where yeasts were not detected on the tongue, but were found in the subgingival area. Multivariate regression model showed that HbA1c was only the predictor of Candida spp. on the tongue and in subgingival plaque samples. Conclusion: Presence of Candida spp. on the tongue and subgingival sites is higher in diabetics with poor glycoregulation and is influenced only by HbA1c serum level. High frequency of Candida spp detection in subgingival areas (even when they are not found on the tongue) should be clarified as potential resevoir of these microorganisms.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Medical Mycology, 2018, Vol. 56, No. S2

P207 Candida spp. identification and susceptibility to fluconazole and butoconasole in women with vulvovaginitis in Serbia D. P. Srebro, M.B. Petrovic, V.S. Arsic Arsenijevic Faculty of Medicine, University of Belgrade, BELGRADE, Serbia Objective: Vulvovaginal candidiasis (VVC) is defined as vulvovaginitis associated with vaginal carriage of Candida spp. The most common causative agents are Candida (C.) albicans but the prevalence of non-albicans Candida (NAC) species is increasing. Also, is increasing the antifungal drug resistance in Candida spp. making treatment of this infection more difficult. The aim of this study was to determine (i) the prevalence of VVC among patients with non-recurrent and recurrent vaginitis, (ii) the frequency of different Candida species, (i) and their susceptibility profile to fluconazole and butoconazole nitrate, the most common use antifungals in Serbia. Methods:Swab samples were obtained from female patients with a clinical presentation suggestive of VVC (n = 161; control group/CG) and from patients with a clinical presentation of recurrent VVC (n = 148; study group/SG). The relation between other risk factors, such as diabetes mellitus, antibiotic and corticosteroid use, history of sexually transmitted diseases and contraceptive methods, was recorded. The samples were cultured on Sabouraud dextrose agar and on CHROMagar Candida and species were identified by culture. Antifungal susceptibility testing of fluconazole (Pfizer, USA) and butoconazole nitrate (Richter Gedeon, HU) was performed using the CLSI M27-A3 broth dilution method. C. parapsilosis ATCC 22019 and C. krusei ATCC 6258 were used as a control strains. Results: Prevalence of VVC in CG was 10.5% based on laboratory-proven positive Candida findings (n = 17). The main clinical manifestation was moderate whitish discharge. C. albicans was isolated in 76.5% (13/17), NAC in 23.5% cases (4/17) presented with following species: C. krusei (n = 3) and C. parapsilosis (n = 1). Prevalence of VVC in SG was 24.3% (36/148). Approximately 20–50% of patients had moderate to severe symptoms and signs of infection. The main risk factors were use of corticosteroids and/or steroid hormone (45.3%), pregnancy (41.2%), while diabetes mellitus was less common (4%). C. albicans was presented in 69.5% (25/36) and NAC in 30.5% (11/36) cases. NAC represented follow species: C. krusei (6/36), C. tropicalis (3/36), C. glabrata (1/36) and C. parapsilosis (1/36). Sensitivity to fluconazole for C. albicans and NAC species were 84.2% (32/38) and 73.3% (11/15%), respectively, while sensitivity to butaconazole were higher for NAC species 87% (13/15) than for C. albicans 76% (29/38). Conclusion: Our results showed that (i) VVC is a common problem in women from Serbia, even those without risk factors; (ii) in vitro sensitivity are common for C. albicans and NAC strains for tested azoles (iii) butoconazole showed higher in vitro sensitivity for NAC strain in comparison to C. albicans strain. These results are promising for the treatment of recurrent VVC. Standardization for in vitro testing for butoconazole need to be established in the future, which will make a possible valid comparison of susceptibility or resistance data for butoconazole.

P208 Serum B-D-glucan as a biomarker for, or exclusion of, invasive fungal disease - a pilot study C. L. Halliday1 , M Jayawardena1 , N Gilroy2 , T Hassan2 , N Joshi Rai2 , J Kok1 , V Nayyar2 , D Gottlieb2 , S. C-A Chen1 1 NSW Health Pathology, WESTMEAD, Australia 2 Westmead Hospital, WESTMEAD, Australia Objective: The detection of fungal biomarkers in blood, such as B-D-glucan (BDG), has good potential for early diagnosis, or for exclusion of invasive fungal diseases (IFDs), but there are no data of its clinical utility in Australia. The objectives of this study were to: 1) Perform a pilot study to derive experience of serum BDG testing in an Australian setting for the first time 2) Determine the clinical utility of serum BDG testing in the early detection (or exclusion) of IFD in high risk haematology and intensive care unit (ICU) patients Methods: Serum from patients with proven IFD was employed to establish “positive” controls. Serum from high risk haemopoeitic stem cell transplant [HSCT] and acute leukaemia patients were collected prospectively during their neutropenic R assay (Associates of Cape Cod Inc.). For ICU patients, serum was collected daily period and tested for by BDG using the Fungitell for the first 3 days in ICU in those with medium-to-high IFD risk including complex gastrointestinal (GI) surgery procedures. BDG results were not used in clinical management. Patients were assessed for IFD with EORTC/MSG criteria Results: A total of 126 specimens from 31 patients were studied; 18 were haematology patients and 12 were ICU patients. There was a single renal transplant patient with endovascular IFD infection. This patient had 6 samples tested over 3 months all returning a positive BDG result; Aspergillus hyphae were seen in arterial tissue. Of haematology patients with malignancy, 15 had received an allogeneic or autologous transplant. All 6 patients who had a consistently negative BDG test (average 3 specimens) had no evidence of IFD. Two patients had proven IFD (aspergillosis, fusariosis) and had consistently elevated BDG levels in multiple specimens (mean OD, 1994 pg/ml; range, 1742–2436 pg/ml). Three patients had probable IFD with mean ODs of 676 pg/ml and range of 163–2557 pg/ml. The 4 patients with possible IFD had intermittent positive BDG tests (mean OD, 255 pg/ml; range, 96–536 pg/ml). In general, patients with definite/probable infection had 4 times higher OD reading compared with patients with possible IFD. There were 3 patients classed as no IFD with intermittently positive BDG tests. Of 12 ICU patients, 38 serum specimens were studied. Positive BDG results were obtained for 7 patients (15 samples); 2 had definite IFD (candidemia and intra-abdominal candidiasis) and two had possible intra-abdominal IFD. The mean OD in patients with definite IFD was 122 pg/ml (range 103–145 pg/ml). The remaining 3 patients were considered to have no IFD (mean OD, 256 pg/ml; range 92–627 pg/ml) Five patients had no IFD and had consecutively negative results; all were receiving antifungal prophylaxis at time of sampling Conclusion: As expected, the serum BDG assay performed well in patients with definite/probable IFD. For patients with possible IFD, the BDG assay may have helped upgrade patients to probable IFD if the test was available. Patients with consistently negative BDG are unlikely to have IFD and in ICU, antifungal prophylaxis could have ceased. Testing of a larger cohort of our patient is essential

ABSTRACT

S109

P209 Breakthrough mucormycosis during voriconazole prophylaxis for invasive aspergillosis in a patients with relapsed acute lymphoblastic leukemia and transplant failure Zahra Seifi1 , Nahid Gholinejad ghadi1 , Tahereh Shokohi1 , S.R Aghili2 , Ali Sharifpour1 , Roya Ghasemian1 , Ehsan Zaboli1 , R. Abdi1 1 Mazandaran University of Medical Sciences, SARI, Iran 2 Invasive Fungi Research Center, SARI, Iran Objective: The patients with hematologic malignancies and hematopoietic stem cell transplantation (HSCT) recipientsare at high risk for invasive fungal diseases (IFD) mainly due to the severe and prolonged neutropenia related to high-dose chemotherapy.Voriconazole prophylaxis is recommended for possible IFDs. Breakthrough mucormycosis (BM) is a fulminant infection which occurs during voriconazole prophylaxis for invasive aspergillosis in immunocompromised hosts. Methods: a -20-year-old man was admitted to Imam Khomeini Hospital in Sari. He was diagnosed with acute lymphoblastic leukemia (ALL) for 2 years prior. 2 months after graft failure and 4 months before the last admission; The fever continued despite of broad spectrum antibiotics and he developed dyspnea, and hemoptysis. Serum galactomannan assay was negative. Chest computed tomography (CT) scan revealed multiple nodules with halo signs consistent with invasive pulmonary aspergillosis (IPA). The patient had been treated for 3 weeks by broad spectrum antibiotics and amphotericin B deoxycholate according to possible IPA (CT-scanbased). In chest computed tomography (CT) scan, multiple focal area in bilateral parenchymal consolidation with surrounding ground glass opacity were seen. Another granuloma consolidation with surrounding irregular rim of opacification (reverse halo sign), with extension to visceral pleura in anterior segment of left upper lob had suggested the diagnosis of pulmonary metastasis, Wegener’s granulomatosis, mucormycosis and septic embolus. In paranasal sinus CT scan, osteomeatal complex (OMC) obstruction, diffuse mucosal; thickening with soft tissue attenuation in maxillary sinus, ethmoid air cell with nasal cavity, pterygopalatine fossa involvement and lamina papyracea destruction revealed consistent acute sinusitis. In Brain MRI just mild generalized cortical atrophy, mucosal thickening with enhancement at the all paranasal sinuses were seen. On the first day of clinical diagnosis of rhinocerebral mucormycosis, treatment was started with liposomal amphotericin B, vancomycin and meropenem. Surgical debridement of the necrotic tissues of hard palate was postponed to the 3rd day of admission because of sever thrombocytopenia. Potassium hydroxide (KOH) and/or KOH with Calcofluor white (CFW) preparation of debrided tissues were investigated. Then, specimens were inoculated in two plates containing sabouraud dextrose agar (SDA; Difco), with chloramphenicol (50 μg/ml), and without chloramphenicol in C-shaped streaks and were incubated at 30◦ C for at least 2–3 weeks. Molecular study on samples using PCR and sequencing was performed using the primers located within the V4 and V5 variable regions of the 18S rDNA. Results: Microscopic examination of the debrided tissues demonstrated right angle branching and broad aseptate hyphae, consistent with mucormycosis, although cultures showed no growth. Amplification of DNA yielded a band of approximately 400 base pair (bp) in gel electrophoresis. Rhizopus oryzae was confirmed after comparing the sequence with NCBI database. The sequences were submitted to GenBank and received the accession no; MG 388335. Outcom: After two weeks, posaconazole (6 mg/kg body weight IV. BD) was added to liposomal amphotericin B. Unfortunately, the patient died on day 29 of the last admission. Conclusion: Clinician’s awareness of this entity and timely diagnosis using conventional and molecular methods are the promising approach for the management of this devastating infection.

P210 Comparative performance of two real time PCR for the rapid diagnosis of Pneumocystis jirovecii pneumonia (PJP) using non-invasive samples. 1

1

1

2

M. T. Martin-Gomez , J. Aguilar Company , I Ruiz Camps , L Goterris Bonet 1 Vall d’Hebron University Hospital, BARCELONA, Spain 2 Universitat Autonoma de Barcelona/Vall d’Hebron University Hospital, BARCELONA, Spain Objective: PJP is a re-emerging entity among immunocompromised (IC) HIV (-) patients in whom microbiological diagnosis difficult: microscopy has a poor sensitivity due to the low fungal loads associated to PJP in these patients; moreover, the poor condition of patients often prevents the collection of bronchoalveolar lavage (BAL) specimens. The higher sensitivity of molecular techniques is a suitable tool for PJP diagnosis and can be successfully applied to non-invasive samples. Nevertheless, the sensitivity of PCR techniques may vary depending on the DNA sequence targeted. This study was aimed to compare the performance of two different DNA targets applied to oral washes (OW) and BAL for the molecular diagnosis of PJP in a cohort of IC adult patients with suspected PJP. Methods: Between March 2016 and January 2018, paired oral washes (OW) and BAL were obtained, 32 mg/l. After bloodstream infection diagnosis, antifungal treatment with amphotericin B was prescribed for 10 days. Patient outcome was favorable and he remained hospitalized until he received a new treatment regimen for his underlying disease. Conclusion: This case illustrates clinical presentation Prototheca zopfii sepsis in an immunocompromised host with a favorable outcome after amphotericin B antifungal treatment. Ribosomal DNA sequencing was a useful tool for correct identification. Optimal antifungal treatment of protothecosis is controversial as in vitro minimal inhibitory concentrations are difficult to interpret due to established clinical cut-off points lack.

P212 A. niger in the indoor environment in conjunction with the presence of Radon. A common association with lung cancer? JOSEF Dumanov1 , M Rudenko2 , D Nadarajah3 , C DiCicco4 1 Mycological Institute EU US, SPARTA, USA 2 London Allergy Clinic, LONDON, United Kingdom 3 Pulmonary Medical Associates, NEWTON NJ, USA 4 Environmental Health Sciences, PITTSBURGH PA, USA Objective: A. niger in the indoor environment in conjunction with the presence of Radon. A common association with lung cancer? Patients, including those with having been diagnosed with lung cancer, reporting that when returning to their homes or the work place experiencing respiratory discomfort, allergenic responses or neurological disorder have such locations investigated for the cause or triggers of such effects. Often mold fungi are suspect due to visual observation or odor. Clinical hygienists investigating such areas have repeatedly identified A. niger in absence of other mold fungi genera when Radon (Rn) is present. Here, we investigate the association of A. niger and it’s sorptive quaility of radon’s permutation of Lead (Pb). We offer investigative cases, studies and resulting findings, involving patients suspected of environmental exposure to A. niger in association with radon. Some patients with lung cancer often attribute it to their exposure to radon. Both A. niger and Rn are known to initiators of lung cancer. These cases studies involved physicians prescribed indoor environmental exposure risk investigations for their patient’s possible exposure to indoor agents that may have been a factor, that may have been and or continue to be a promoter of their disease promoted by their reported observation of a suspect mold like presence in the basement. During the investigations hygienists employed subClinical environmental investigation protocols sC -1 and sC-3. Routinely the residential home was identified to have a porous basement foundation, with resulting water vapor and Rn gas intrusion. Aspergillus niger was identified along with high levels of Rn and moisture. Cases studied examine the possible association of, and the relationship to A. niger when in the presence of a mutation of Rn, Pb. Methods: Fungal biomass microscopy Moisture meter Infrared imaging of concealed areas of moisture and fungal activity Radon gamma radiation detector and counter Results: Radon and A. niger share a common environment: porous subterranean environments that allow water vapor intrusion predispositional for fungal activity and radon gas perfusion. Conclusion: Patients habituating in subterranean environments when A. niger is identified as being present may also be exposed to Radon.

S110

Medical Mycology, 2018, Vol. 56, No. S2

P213 Candidemia viewed after introduction of dedicated medical mycology service in a secondary hospital

P215 Elevated levels of IL-17, IL-6 and IL-10 in candidemic patients compared with levels in bacteremic patients

Khaled Alobaid Minisrty of health, HAWALLY, Kuwait

S. J. Taj-Aldeen, F. A. Mir, A. AbdulWahab Hamad Medical Corporation, DOHA, Qatar

Objective: Examine the role of dedicated medical mycologist in management of candidemia Improve understanding of epidemiology of candidemia Methods: Candidemia surveillance was taken prospectively from 1st of March 2017 till end of January 2018. Role of medical mycologist was ensuring optimized care of patients with candidemia in the form of: Rapid initiation of antigungal agent after diagnosis. Direct face to face communication with clinician and education about management. Following IDSA guidelines in management. Using echinocandins for initial therapy Ensuring proper dose especially in morbid obesity Advice for rapid removal of central line Repeat blood cultures to estimate duration Investigate source Arrange for proper retinal exam Ensure antifungal susceptibility tests are done Consider de-escalation Use surveillance for rapid detection of possible cross infection Results: 36 cases were found. Species distribution Species distribution was as follows: C parapsilosis 11, C albicans 10, C glabrata 6, C tropicalis 6, C krusei 1, C guilliermondii 1, and C kefyr 1 Antifungal susceptibility 9 isolates were either dose dependent or resistant to fluconazole, all belong to C glabrata except one which is C guilliermondii Majority were susceptible to fluconazole except 8 isolates (7 C glabrata and one C. guilliermondii) with MIC ranges between 8–32. All isolates were susceptible to amphotericin B and caspofungin. Demography 21 patients were aged 65 years or above. Two children were affected. Male to female ratio was 1:2. Risk factors Majority of patients had central line in place and almost all received broad spectrum antibiotics. One fifth of patients underwent GI surgery prior to candidemia. Similar proportion of patients had TPN or hemodialysis. Mortality All cause 14 day mortality was 40% Complications 2 cases of endocarditis were found and 2 cases of eye infections including one patient with retinitis. Conclusion: Candidemia carries high risk of complication, failure and death. Therefore, optimized management is need through dedicated medical mycologist and multidisciplinary approach to ensure better outcome. C parapsilosis is replacing C albicans as a leading cause of candidemia which may suggest suboptimal line care. Extremes of age is the main group affected. Detection of 4 complicated cases e,g retinitis or endocarditis suggests that these are not rare events and presence of dedicated mycologist is essential

Objective: Candida species is one of the leading pathogens causing sepsis in immunocompromised hosts. Candida bloodstream infections cause significant morbidity and mortality among hospitalized patients. In addition to exogenous factors, it is believed that variation in immune system also plays an important role in susceptibility to sepsis. Although clinical and microbiological factors affecting prognosis have been identified, the impact of the innate immune responses mediated by cytokines on outcomes of infection remains to be studied. This study aims to measure the serum levels of interleukin (IL)-1β, IL-6, IL-17A, IL-10,IFN-¡, IL-4, IL-2, IL-8, IL-12p70, tumor necrosis factor (TNF)-α, C-reactive protein (CRP), and procalcitonin (PCT) in cases of candidemia and to compare them with those observed in bacteremia. Methods: A total of 49 serum samples from patients including 31 patients with candidemia and 18 with bacteremia were investigated for interleukins level. In addition, 10 healthy control samples were used for comaprision. The cytokines were measured in the serum of these patients by The BDTM CBA Human Th1/Th2/Th17 and Human Inflammatory Cytokine Kits from BD Biosciences USA. Both the measurement and analysis was done according to the manfacturers protocol. Candida and bacteria were characterized by MALDI-TOF MS. Results: While no significant differences were found among the groups in terms of IL)-1β,IFN-¡ IL-4, IL-2, IL-8, IL-12p70, tumor necrosis factor (TNF)-α, and C-reactive protein (CRP), the PCT levels were significantly greater in the bacterial sepsis group in comparison with samples from the candidemia. The most interesting result of our investigation was the significantly higher levels of the IL-6, IL-10 and IL-17A type cytokine in the serum samples from patients with candidemia in comparison with samples from patients with bacterial sepsis and the healthy subjects. Conclusion:This study demonstrates IL-17 and IL-6 as a potent inflammatory cytokines in patient with candidemia in coparison to bacteremia

P214 Invasive Candida duobushaemulonii infections in Panama hospitals: importance of laboratory surveillance and accurate species identification R. Ramos1 , D.H. Caceres2 , M. Perez1 , N. Garcia1 , W. Castillo1 , E. Santiago3 , J. Borace3 , S.R. Lockhart2 , E.L. Berkow2 , L. Hayer4 , A. Espinosa-Bode2 , J. Moreno1 , B.R. Jackson2 , J. Moran1 , T.M. Chiller2 , G. De Villareal1 , N. Sosa1 , ∗ Red Nacional de Vigilancia4 , S. Vallabhaneni2 1 Instituto Conmemorativo Gorgas de Estudios de la Salud, Panama, Panama 2 Centers for Disease Control and Prevention (CDC), ATLANTA, USA 3 Hospital Santo Tomas, PANAMA CITY, Panama 4 Ministerio de Salud de Panama, PANAMA CITY, Panama Objective: Candida duobushaemulonii, like Candida auris, is an emerging multidrug-resistant yeast. This report describes 14 cases of Candida duobushaemulonii (10 invasive infections), in Panama, Central America, during 2016–2017. Methods: Given the emergence of C. auris, the Panamanian Ministry of Health implemented laboratory surveillance for C. auris in October 2016. Suspected C. auris isolates (isolates identified as Candida haemulonii, Candida famata, or Candida spp. by VITEK R  2 , which was available in laboratories within Panama’s national laboratory network) were forwarded to the national reference laboratory for further identification by matrix assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF) and antifungal susceptibility testing (AFST). Results: During November 2016–May 2017, 36 isolates from 31 patients were obtained as part of C. auris surveillance; all were initially identified as C. haemulonii. Seventeen (47%) were confirmed as C. duobushaemulonii, eight (22%) as C. haemulonii, five (14%) as C. auris, and six (17%) as other Candida species. C. duobushaemulonii isolates (n = 17) were obtained from 14 patients who were hospitalized at six medical institutions in four geographical regions of Panama. Of the 14 cases of C. duobushaemulonii infection or colonization, 10 involved bloodstream infection (BSIs). Two patients with BSIs had multiple positive blood cultures. In the remaining four cases, C. duobushaemulonii was recovered from endotracheal secretion (n = 2), surgical mesh (n = 1), and exposed bone (n = 1). Three cases, all BSIs, were in children. AFST revealed elevated minimum inhibitory concentrations for fluconazole, voriconazole, and amphotericin B. No resistance to caspofungin or micafungin was observed. Conclusion: In recent years, we have seen the emergence of invasive infections caused by highly drug-resistant Candida such as C. auris and now C. duobushaemulonii. These species are often misidentified using commonly used yeast identification methods, and much remains to be understood about their transmission, pathogenesis, and reservoirs. Expanded laboratory surveillance is an important step in the detection and control of such emerging pathogens.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

P216 Cerebral phaeohyphomycosis caused by Cladophialophora bantiana presenting as glioblastoma Nidhi Singla, Reetu Kundu, Pallavi Dhawan, Vipin Gupta, Neelam Gulati, Jagdish Chander Government Medical College Hospital, CHANDIGARH, India Objective: Cladophialophora bantiana is a dematiaceous fungus considered to be found in soil. It is a known neurotropic agent too causing cerebral phaeohyphomycosis both in immunocompetent and immunocompromised patients. Till date, maximum numbers of cases have been diagnosed from Asia. Most common route of infection could be paranasal or pulmonary disseminating to brain. The disease masquerades as tumour or tuberculosis (in endemic areas, often the first diagnosis). Since the awareness is less and clinicians are not suspicious, the treatment in form of antifungals is not timely instituted thereby further compromising the situation. Antifungal treatment given is amphotericin B/liposomal amphotericin B, although good response has been reported with voriconazole, posaconazole and itraconazole too. Hereby, we report a case of Cladophialophora bantiana which presented as space occupying lesion and was thought to be a case of glioma clinically. Methods: A 62 year male, presented to the Emergency Department with sudden onset of severe, dull headache on the right side of head for the last 7 days which was not relieved on medication. There was no history of fever. Patient was a known case of asthma for the last 3 years. There was no history of diabetes, hypertension, seizures or tuberculosis. He was calm with stable vital signs. On magnetic resonance imaging, a large, heterogeneous space occupying mass in right frontal lobe was identified with central necrosis. The lesion was 4.1 × 3.7 × 3.8 cm. There was compression of right lateral ventricle and shift of midline to left by 6 mm. On right frontal craniotomy and right frontal lobectomy, a complete surgical removal of the lesion was done and the sample was sent to the Department of Pathology and Microbiology. Results: On frozen section, dematiaceous fungus was identified. KOH wet mount was also positive for septate phaeoid fungus. Immediately the report was conveyed to the clinician regarding the pathology to be infectious. The special stains like PAS, GMS and Masson-Fontana, were found to be positive. Patient was put on voriconazole 200 mg twice a day. In the meantime, a consolidation patch was identified in the lung tissue of the patient for which he was advised CECT. Patient was discharged 15 days post surgery in stable condition and good clinical improvement. However, 10 days post discharge, he developed respiratory distress and was taken to the local hospital where he could not be survived. Culture grew dark grey to green, velvety colonies with black reverse after 6 days of incubation. On slide culture, the fungus was identified to be Cladophialophora bantiana phenotypically. Conclusion: Cladophialophora bantiana is known to be causing fatal infections with bad prognosis. Lung being predominant route of entry may be the primary centre but in most of the cases, it is difficult to ascertain this source. India, predominantly being an agriculture country, in tropical area with high temperature definitely helps in thriving of this fungus. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 422910 e099aa33-2c6a-4f8c-a23ee63d64033ce3.jpg

P217 Risk factors and clinical outcomes of patients with fluconazole nonsusceptible Candida tropicalis bloodstream infections P.Y. Chen, Y.C. Chuang, U.I. Wu, H.Y. Sun, J.T. Wang, W.H. Sheng, Y.C. Chen, S.C. Chang National Taiwan University Hospital, TAIPEI, Taiwan Objective: Fluconazole non-susceptibility (FNS) rates increase among C. tropicalis isolates in Asia. We aimed to explore the proportions and risk factors of candidemia caused by FNS C. tropicalis and the impact of FNS on patient outcomes. Methods: There was a prospective Candida bloodstream infections (BSIs) cohort in a single medical center at Northern Taiwan. We retrospectively analyzed the first episode of C. tropicalis BSIs between 2011 and 2016. Antifungal susceptibility testing of the first isolate of each episode was performed by the microdilution colorimetric Sensititre YeastOne SYO-09 panel, and the results were interpreted according to Clinical and Laboratory Standards Institute (CLSI) species-specific breakpoints Results: During the study period, two hundred and eighty-five episodes of C. tropicalis BSIs were identified. Of them, 47 (16.5%) first blood isolates were non-susceptible to fluconazole, including 10 isolates belonging to susceptible dose-dependent and 37 isolates belonging to resistance. The proportions of FNS among C. tropicalis BSIs increased by years (test for trend, P < 0.05). There were no differences of patient outcomes, including 14-day and 30-day mortality, and persistence, between FNS BSIs and fluconazole susceptible (FS) BSIs. Compared to patients with FS BSIs, those with FLS BSIs had higher proportions in neutropenic status, of receiving steroid therapy, and of receiving azole therapy within 30 days of candidemia onset (40.0% vs. 26.5%; 65.2% vs. 48.2%; 38.3% vs. 11.3%; all P-value < 0.05). Of note, around 60% patients with FLS BSIs were azole na¨ıve and no significant risk factors were identified. Conclusion: Fluconazole nonsusceptibility significantly increased in C. tropicalis BSIs, but didn’t worsen patient outcomes. Immunocompromised hosts and those with azole exposure were at risk for FLS C. tropicalis BSIs. Further investigations were warranted for azole na¨ıve patients with FLS C. tropicalis BSIs.

ABSTRACT

S111

P218 Role of combined Candida mannan/antimannan test in antifungal stewardship in a secondary care hospital.

P221 Study of frequency of dermatophyte agents isolated from ownership dogs with skin lesions

Khaled Alobaid1 , O. Al-Musallam2 1 Minisrty of health, HAWALLY, Kuwait 2 Ministry of health, HAWALLY, Kuwait

Basiri Mazandaran university of medical science, SARI, Iran

Objective: Examine usefulness of negative combined Candida mannan/antimannan test in ruling out candidemia. Examine usefulness of combining bedside candida score with Candida mannan/antimannan test to minimize the use of antifungals Methods: For the purpose of detection of Candida antigen/antibody in sera samples, our mycology reference lab uses special kits manufactured by Bio-Rad medical supplies company that are called Platelia Candida ag Plus and Platelia Candida ab Plus, respectively. Two hypotheses were made: Negative combined mannan/ antimannan test rules out candidemia caused by common Candida species Negative combined mannan/ antimannan test can be used with bed side Candida score to decide about stopping antifungal if the score is low. All candidemic patients were tested for mannan/ antimannan test for a period of 2 months. They are called group1. Group2 include patients (non candidemic) who are screened for mannan/ antimannan test. They were subjected to further evaluation if both tests are negative. Evaluation was done using Ostrosky-Zeichner’s rule, which includes antibiotics, CVC, surgery, immunosuppression, TPN, dialysis, corticosteroids and pancreatitis. Results: Eight candidemia cases were found. Seven out of eight candidemia cases had at least single positive test i.e. either antigen or antibody test. However, C kefyr case had both negative antigen and antibody result. In complicated candidmeia cases such as endocarditis (one case) and retinitis (one case), both antigen and antibody were positive. Six patients with combined negative test were identified. Using Ostrosky-Zeichner’s rule, all patients had low Candida score. table: documented candidemia cases with mannan/antimannan test results Conclusion: Negative combined Candida mannan/antimannan test appears to be sensitive in ruling out candidemia due to most common Candida species. Positive combined Candida mannan/antimannan test may suggest complicated candidemia. Using bed side Candida score combined with mannan/ antimannan test can be helpful in minimizing antifungal agents use. P219 Fungal keratitis in Tanzania C. Oliveira dos Santos1 , A.M.S. Al-Hatmi2 , M.J. Burton3 , P.E. Verweij1 1 Radboudumc, NIJMEGEN, Netherlands 2 Westerdijk Fungal Biodiversity Institute, UTRECHT, Netherlands 3 International Centre for Eye Health, LONDON, United Kingdom Objective: Fungal keratitis is a common eye infection in the tropical and subtropical areas of the world. Early therapy of localized disease is important to prevent progression to a more aggressive or disseminated infection. A major complication of fungal keratitis is monocular blindness, especially in the developing world where there often is a delay in diagnosis and adequate therapy. Most cases of fungal keratitis are caused by Fusarium species. The in vitro antifungal susceptibility patterns of Fusarium species varies greatly within each species but most of them have high minimal inhibitory concentrations (MICs) to the currently most used antifungals. In this study, we aimed to describe the molecular epidemiology and susceptibility profiles of fungal keratitis isolates from patients in Tanzania, Africa. Methods: In 2016 ocular scraping samples from patients with keratitis visiting the ophthalmology department of a hospital in Tanzania were collected. In total 23 fungal strains were isolated according to the standard cultural techniques. All fungal isolates were identified up to genus level using conventional techniques. For more accurate identification, sequencing of the ITS1-5.8S-ITS2 region of the rDNA and TEF1 were performed to determine the identity of the fungal species. Antifungal susceptibility testing was performed using EUCAST method for conidia forming moulds. The antifungal agents tested were amphotericin B, voriconazole, posaconazole, miconazole, natamycin, 5-fluorocystosine, chlorhexidin and caspofungin. Results: The most common isolated fungus from our patients was Fusarium (65%) followed by dematiaceous (18%) and other hyalohyphomycetes (17%) fungi. The Fusarium species were identified up to the species level. The lowest MICs were obtained with amphotericin B, natamycin and chlorhexidine (see table 1). It was not possible to determine MIC values for half of the miscellaneous group due to lack of in vitro sporulation. Conclusion: The most common route of fungal keratitis is by (micro) trauma or disruptive ocular surface and in this study, the most isolated fungus is Fusarium. Molecular identification of the causative agent up to the species level and the antifungal susceptibility testing are important for clinicians in order to choose the most effective treatment option. Chlorhexidin is potentially an effective, affordable and accessible treatment for fungal keratitis, which could benefit millions of people who currently have no options. The MICs of chlorhexidine are well below the standard treatment solution of 0.2% which corresponds to 1024 mg/L. Therefore, in vivo data from full-scale trials of chlorhexidin 0.2% are warranted to provide the evidence for its use. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 423024 ff4dcc0f-9f09-4a17-b01c-c4b857 ef98d4.jpg Caption 1: Table 1. Molecularly identified isolates and their antifungal susceptibility profile of fungal keratitis patients in Tanzania. P220 Report from the AMRSN-Antimicrobial Resistance Surveillance Network; data from 2013–2017 spanning four geographically distant tertiary care hospitals in India S. M. Rudramurthy1 , M Dhaliwal2 , R Singh3 , I Xess4 , S J Michael5 , K Walia6 , V Ohri7 , H Kaur8 , A Ghosh2 , A Chakrabarti2 1 Postgraduate Institute of medical Education and Research, Chandigarh, CHANDIGARH, India 2 PGIMER, Chandigarh, CHANDIGARH, India 3 JIPMER, PUDUCHERRY, India 4 AIIMS, New Delhi, NEW DELHI, India 5 CMC, Vellore, VELLORE, India 6 ICMR, New Delhi, NEW DELHI, India 7 ICMR, NEW DELHI, India 8 PGiMER, Chandigarh, CHANDIGARH, India Objective: This study was designed to establish an “Antifungal Resistance” in India and to monitor trends in fungal species distribution, susceptibility landscapes, creation of a national database and eventually establish guidelines on combating the spread of antifungal resistance in India. Methods: This multicentre study was initiated in 2013 and is ongoing. Postgraduate Institute of Medical Education and Research, Chandigarh is the nodal centre and 3 other tertiary care centres including, All India Institute of Medical Sciences, New Delhi; Christian Medical College, Vellore; and Jawaharlal Institute of Postgraduate Medical Education and Research, Puducherry are collaborating centres. Clinical details and the yeasts isolated were collected from all the centers. All the yeasts were identified by MALDI-TOF and some by DNA Sequencing. Antifungal susceptibility testing was performed as per broth microdilution technique of CLSI M27 protocol. Interpretation of the breakpoints were done as per the recent guidelines. Results: During this study period, 3185 yeasts were collected from four tertiary care centres in India. In concordance with the previously published reports, Candida tropicalis was the major yeast species isolated (29%), followed by C. albicans (16.5%), Wikerhamomyces anomalous (7.9%), C. krusei (7.6%), C. parapsilosis complex (6.2%), C. glabrata (5.5%), and others yeasts in low numbers. C. tropicalis had the highest resistance to fluconazole (6.4%) followed by 5.9% to caspofungin and 3% to voriconazole. C. albicans isolates were 7% resistant to fluconazole, 6.7% to voriconazole and 2.5% resistance was documented against caspofungin. In C. glabrata caspofungin resistance was highest (14.3%), followed by 10.3% resistance against voriconazole, 8% against micafungin, 2.3% resistance against anidulafungin and only 1.7% resistance against fluconazole. Conclusion: The spectrum of Candida species causing invasive infections has expanded. W. anomalous is emerging an agent of invasive candidiasis and is seen as third most common yeast. Fluconazole and caspofungin resistance to C. tropicalis, the major agent in India is of concern. Fluconazole resistance with C. albicans is as per earlier rates but increasing trend of resistance to voriconazole and caspofungin has been noted.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Objective: Dermatophytosis is a common and epidemic fungal infection caused by keratinophilic fungi called dermatophytes. These fungi are transmitted from animal to animal or animal to human, and can cause some problems. Identification of animal sources of infection is performed to prevent the familial outbreak and progressive epidemics of infection. Methods: In this study, 130 stray dogs in rural areas of meshkinshahr in Ardabil province were examined from April 2011 to November 2012, during 19 months. Of the 130 dogs, 110 cases had suspicious lesions of dermatophytosis, skin lesions and alopecia, in 20 cases, there were no significant lesions and were apparently healthy. Skin and hair samples were examined by conventional laboratory methods such as direct examination with Lactophenol cotton blue and KOH 10% staining and then cultured in SC and SCC and DTM and were incubated at 37, 30 and 25◦ C for up to 4 weeks. Results: Of the 130 samples, two dermatophyte species including Microsporum canis (2 cases) and Trichophyton terrestre (2 cases) were isolated. Alternaria was the most Common saprophytic fungi that isolated from samples and other fungi including Penicillium (18.2%), Aspergillus (9.5%), Cladosporium (7.1%), Chrysosporium (7.1%), Stachybotrys (6.3%), Fusarium (4.7%), Acremonium (3.1%), Scopulariopsis (2.4%), ulocladium (2.4%), Paecilomyces (1.6%), Chaetomium (0.8%) and Nattrassia (0.8%) were isolated respectively. Conclusion: According to low prevalence of dermatophyte species among fungi that isolated from dogs with lesions and without lesions (normal), it can be concluded that the dogs in rural areas of Meshkinshahr are not source of infection and don, t have any role in the epidemiology of dermatophytosis.

P222 Chronic pulmonary aspergillosis in patients with bronchiectasis O.I. Munteanu, V.I. Botnaru, I. Voloscic, E. Scutaru State University of Medicine and Pharmacy Nicolae Testemitanu, CHISINAU, Moldova Objective: Aspergillus-related diseases can complicate patients with already established bronchiectasis and lung architectural disruption, for example, an aspergilloma in a patient with post-tuberculosis bronchiectasis. Furthermore, other coexistent diseases such as chronic obstructive pulmonary disease or bronchial asthma can increase the risk of Aspergillus-related disease but also independently can be associated with bronchiectasis. To evaluate the prevalence, clinical and radiological characteristics of chronic pulmonary aspergillosis (CPA) in patients with bronchiectasis. Methods: Of 334 patients registered at the Moldovan National Bronchiectasis Centre between Dec 2009 and Dec 2017 post-tuberculosis bronchiectasis was identified in 88 cases (26%). This group was screened for CPA by HRCT, culture results and serum anti-Aspergillus IgG. Results: 14 of 88 patients meat CPA criteria, most of them 10/14 (71%) males, with a median age of 55.7±14. Four patients had a history of treated pulmonary tuberculosis, and calcifications as a possible imaging marker of “spontaneous recovery” were identified in 12 patients (86%). Asthma was present from childhood in 2 cases that developed ABPA, one of them was treated for pulmonary tuberculosis (4 treatment episodes). The median interval between ABPA and onset of CPA was 5 years. Other underlying lung conditions included chronic obstructive pulmonary disease (n = 6; 42%) and previous thoracic surgery (n = 1). All patients presented with chronic pulmonary or systemic symptoms, such as purulent sputum (100%), cough (100%), haemoptysis (n = 10, 71%) and weight loss (n = 11, 78%). The most common location of cavitary lesions (figure 1) was the right lung (n = 8, 57%). Death occurred in 2 patients (14%). Conclusion: Post-tuberculosis bronchiectasis is a common sequela in a high burden TB country and coexistent CPA may arise and should be considered, especially in smear negative patients suspected for TB reactivation. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 422397 e7019d4e-1692-44a6-9cad-07a417 d2a8bd.jpg

P223 Establishment and optimization of a combined MLST scheme for Pneumocystis jirovecii L. Pasic, L Irinyi, S Chen, T Sorrell, W Meyer University of Sydney, SYDNEY, Australia Objective: Pneumocystis jirovecii is a unique unicellular fungus that most commonly causes Pneumocystis Pneumonia (PCP) an opportunistic infection with high morbidity and mortally rates. It is the most prevalent opportunistic disease in AIDS patients, and may be more life threatening in patients who are severely immunocompromised (e.g. organ transplant patients). Prevention is essential but not always possible, since the ecological niche and route of transmission remain uncertain. Multilocus sequence typing (MLST) is currently considered the preferred approach for the analysis of genetic diversity of P. jirovecii. Currently there are 17 DNA regions which are used in different MLST schemes to study the allelic polymorphisms of P. jirovecii isolates. There is still no consensus MLST scheme for P. jirovecii, with the different proposed MLST schemes including from 3 to 8 loci. The aims of the herein presented study were: (A) Comparison of all MLST schemes currently used worldwide, establishing the discriminatory power for each locus using Hunter-index. (B) Establishing a MLST scheme combining the loci with the highest amplification efficiency and discriminatory power. (C) Analysing various factors influencing MLST genotyping: source, effectivity of sample site of source, extraction and amplification techniques. (D) Applying the combined MLST scheme to explore the genetic diversity, disease burden, and establish the epidemiological relatedness of global strains. (E) Establish a global database, combining genetic and metadata of all studied isolates. Methods: A literature review was performed to select the most appropriate loci, the discriminatory power for each loci was determined using the H-index. P. jirovecii isolates collected from sputum, BAL and pharyngeal swab were used to test several DNA extraction methods to establish the optimum conditions for maximum DNA yield. Application of the combined MLST scheme is underway. Results: The discriminatory power of the 8 most common loci: mt26s, 26S rDNA, ITS1, β-TUB, SOD, CYB, DHPS, and DHFR, was determined to enable the selection of the most appropriate locus. The DNA extraction was optimised by adapting the Norgen DNA extraction kit, with the addition of a liquid nitrogen grinding step, resulting in a reliable high yield of DNA. Conclusion: This study highlights the importance of an effective DNA extraction method to minimise yield lost during DNA preparation for MLST analysis. Additionally, it determined a new MLST scheme with the highest discriminatory power, for P. jirovecii, indented to become the globally accepted consensus MLST scheme for this important human pathogen, to improve genotyping consistency; facilitating worldwide collaborations and the establishment of a global database. Future studies will include the adaptation of the new MLST scheme to next generation sequencing using the MinIONTM from Oxford Nanopore Technologies for simultaneous detection and typing of P. jiroevicii in patient samples. All interested researcher are invited to join the project by contacting either Lana Pasic at: mailto:[email protected], Laszlo Irinyi at: Laszlo Irinyi at: [email protected] and Prof. Wieland Meyer at: [email protected].

S112

P224 Fungi isolated in blood cultures in Ege University Medical Faculty, Childrens Hospital between 2008–2017. ¨ ¨ SUleyha Hilmioglu Polat, Zumrut Sahbudak Bal, Gizem Guner, Dilek Y. Metin, Ferda Ozkinay, Zafer Kurugol, SUleyha Hilmioglu Polat Ege University, Medical Faculty, IZMIR, Turkey

Medical Mycology, 2018, Vol. 56, No. S2

P227 Prevalence and antifungal susceptibility profile of Cryptococcus neoformans recovered from environmental and clinical sources in Nsukka, Southeastern Nigeria. P. E. Chidebelu1 , F Hagen2 , J. Meis3 , E.I. Nweze1 University of Nigeria, Nsukka, ENUGU, Nigeria Westerdijk Fungal Biodiversity Institute, Utrecht University, UTRECHT, Netherlands 3 Canisius Wilhelmina Hospital, NIJMEGEN, Netherlands 1

2

Objective: Although the spectrum of fungi causing bloodstream fungal infections continues to expand, Candida spp. remains responsible for the majority of these cases. The distribution of Candida species varies according to countries, regions and institutions. In this study, we evaluated retrospectively the distribution of Candida species yielded from blood cultures of hospitalized patients in Ege University, Childrens Hospital between the dates. Methods: The frequency of fungi among agents growing in blood culture was evaluated. In case of the recurrent positive culture from the same patient, only one strain was taken into consideration. Besides, after 15 days of negativity in blood culture, a positive culture was considered as a new candidemia episodes. Fungi were isolated from the blood cultures using the BacktAlert system (bioM´erieux, France). They were identified with conventional mycological methods and their assimilation profiles were determined with ID 32 C (bioM´erieux, France) between 2008–2014; and identified by MALDI TOFF MS (bioM´erieux, France) between 2014–2017. Results: A total of 281 fungal species from 252 patients were evaluated. Candidemia was common in pediatric surgery unit followed by pediatric intensive care, gastroenterology and oncology services. Two hundred seventy five of these strains (97.8%) were Candida species, while six were other fungi. The most common species of Candida was C. parapsilosis. Of the isolates, 32.4% (91/281) were C. albicans and 65.4% (184/281) were non-albicans Candida; C. parapsilosis (41.6%), C. glabrata (6.4%), C. tropicalis (5.3%), C. krusei (2.8%), C. kefyr (2.1%) and other Candida species (7.2%). Conclusion: As a conlusion, although C. albicans was the most common species in the first two years of this period, C. parapsilosis took the first place in the following years. Taking infection control measures into consideration can reduce the incidence of candidemia due to C. parapsilosis.

P225 Wickerhamomyces anomalous - Antifungal susceptibilities/ECOFFs of an emerging yeast in paediatric population from a tertiary care center in India M. Dhaliwal, SM Rudramurthy, S. Adekhandi, J Muralidharan, H Kaur, A Ghosh, A Chakrabarti Postgraduate Institute of Medical Education and Research, CHANDIGARH, India Objective: Wickerhamomyces anomalous is emerging as an important yeast causing invasive infection in paediatric population of our hospital. Being a rare yeast, the clinical breakpoints (CBPs) are not available. Hence, the aim of the present study is to define epidemiological cut-offs (ECOFFs) values for commonly used antifungal agents. Methods: The yeasts isolated during January 2016 to October 2017 from pediatric patients were included in the study. The yeasts were identified by MALDI-TOFMS and by DNA sequencing. Antifungal susceptibility testing was performed for amphotericinB, fluconazole, voriconazole, itraconazole, posaconazole, caspofungin, micafungin and anidulafungin as per CLSI M27 broth microdilution technique. The epidemiological cut-offs values were calculated using the ECOFFinderXL2011 for Mac. The MIC50, MIC90 and GM were calculated for commonly used antifungals. Results: Of the 815 yeasts isolated during the study period, W. anomalous was the commonest yeast (n = 215;26.3%) followed by Candida tropicalis (n = 201;24.7%) and C. albicans (n = 93;11.4%). The MIC50/MIC90 of the isolates (in μg/ml) were 0.5/0.5 for amphotericin (range = 0.03-1); 2/4 for fluconazole (range = 0.12-64); 0.12/0.5 for voriconazole (range = 0.03-1); 0.25/0.5 for itraconazole (range = 0.03-1); 0.25/1 for posaconazole (range = 0.03-2). For the echinocandins, MIC50/MIC90 were 0.25/0.50 for caspofungin (range = 0.03-4.0); 0.03/0.12 for anidulafungin (range = 0.03-2) and 0.12/0.25 for micafungin (range = 0.03-2). The 97.5% ECOFFs for amphotericin-B was 1 μg/ml, fluconazole 8 μg/ml, voriconazole 0.5 μg/ml, itraconazole 1 μg/ml, posaconazole 2 μg/ml, caspofungin 0.25 μg/ml, anidulafungin 0.06 μg/ml and micafungin 0.25 μg/ml. Conclusion: The spectrum of yeasts causing invasive disease in pediatric patients is different from adult patients in our centre. Wickerhamomyces anomalous has emerged as the major yeast causing infection in this pediatric population. As the breakpoints are not available for this yeast the ECOFF values obtained in this study may help in the management of invasive infection due to this agent. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 423459 11129b21-da17-4b58-af63-ef70 f07ff287.png

P226 Ecoffs of Candida clinical isolates and application of antifungal clinical breakpoints in a diagnostic laboratory J. Guitard, P. Serve, Y. Senghor, C. Hennequin ˆ AP-HP, Hopital St Antoine, PARIS, France Objective: The EUCAST antifungal breakpoints (CBP) have been recently revised. The aims of this study were (i) to compare the epidemiological cut-offs (Ecoff) of various antifungal drugs against Candida clinical isolates to the previous and current EUCAST and the CLSI CBPs (ii) to measure the impact of the application of the EUCAST and CLSI CBPs on the categorical assignment of the strains. Methods: We reviewed all MIC values determined for Candida albicans, Candida glabrata, Candida parapsilosis, Candida tropicalis and Candida krusei clinical isolates against amphotericin B, fluconazole, voriconazole and micafungin using the Etest method between May 2005 and March 2016. The Ecoff values for each of the couples species-antifungal were determined using the Kahlmeter eyeball method. Comparison of Ecoffs to the CBPs was expressed as the percentage of discrepancies i.e. strains having MIC below the Ecoff but considered as non-susceptible using the CBPs. Categorical agreement (CA) was calculated between the use of previous and the new values of EUCAST CBPs and CLSI CBPs. Results: Main results are presented in table 1. After putting aside the cases of the exclusion of susceptibility to some drugs for certain species (candins vs C. parapsilosis, fluconazole vs C. glabrata), it appears that the higher percentage of discrepancy concerns micafungin against C. albicans, as 24.1% of the strains are considered as wild-type strains based on the Ecoff while classified as non-susceptible using the new EUCAST CBPs. The CLSI CBPs appear more congruent to our Ecoffs with discrepancy % ranging from 0 to 5.9% (C. krusei-micafungin). Overall, compared with the use of the previous EUCAST CBPs, using the new EUCAST CBPs improve the CA with the CLSI categorization with the noticeable exception of C. albicans-micafungin (CA: 75.9%). Conclusion: The use of the new CBPs EUCAST tends to closer categorisations obtained with the EUCAST and the CLSI. However, micafungin CBPs overestimate the number of non-sensitive strains of C. albicans when using MICs determined with the Etest. Further studies are necessary to decipher this limitation. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 423762 c1163850-d9bf-473c-b4d1-e7b69a73 b4f1.20.43.png

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Objective: We investigated the prevalence of C. neoformans in clinical and environmental samples within our study area, and compared the antifungal susceptibility profiles of the isolates from the two sources. Methods: A total of 500 samples of pigeon droppings, and 300 blood samples of HIV/AIDS patients were collected respectively from 5 market squares and 3 tertiary health cares within Nsukka area of South eastern Nigeria. Identification of the isolates was done using the MALDI TOF MS and MLST molecular techniques. The susceptibility of the isolates to seven antifungal drugs including amphotericin B, fluconazole, 5 – fluorocytosine, itraconazole voriconazole, posaconazole, and isavuconazole based on the CLSI M27 – A3 protocol was studied Results: C.neoformans was recovered from 6(1.2%) samples of pigeon droppings and 6(2%) blood samples of HIV/AIDS patients. The isolates were confirmed to be C.neoformans VNI (serotype A) with the sequence type 32 (ST32). Infection with C.neoformans was independent of sex (P =P = 0.5135) and age (P = 0.9724) of the patients investigated. Both the environmental and clinical isolates were susceptible (100%) to the seven antifungal agents, and there is no significant difference in susceptibility of environmental isolates compared with clinical isolates to amphotericin B, 5 – fluorocytosine, isavuconazole, itraconazole, posaconazole, voriconazole (P = 0.9999), and fluconazole (P = 0.4545). Conclusion: We have confirmed for the first time, the prevalence of C.neoformans VNI (ST32) in environmental and clinical samples from Nigeria. Our data from the susceptibility assay may indicate that antifungal resistance by C. neoformans is rarely encountered. However, further in vivo studies should be correlated with this, as well as more in vitro assays, in order to allay the clinical concern especially in HIV/AIDS endemic settings.

P228 Molecular typing of environmental isolates of Aspergillus fumigatus from Mexico using the CSP microsatellite ´ 2 , G. Acosta-Altamirano2 MR Reyes Montes1 , E Mart´ınez Herrera2 , C Toriello1 , E Duarte Escalante1 , MG Fr´ıas De Leon ´ ´ ´ Universidad Nacional Autonoma de Mexico, CIUDAD DE MEXICO, Mexico ´ Hospital Regional de Alta Especialidad de Ixtapaluca, ESTADO DE MEXICO, Mexico

1 2

Objective: Environmental isolates molecular typing of Aspergillus fumigatus from Mexico using the CSP (cell surface protein) strategy, which analyzes the DNA sequence of the 12-mer tandem repeat region of the gene AFUA 3G08890 in order to determine the variation genetics by comparison with the genotypes found in other countries. Methods: Twenty seven isolates of A. fumigatus from hospital environments were used. The isolates were identified using phenotypic methods (macro and micromorphology and thermotolerance) and genotypic (β-tubulin gene) methods. Subsequently, the PCR of the CSP gene partial sequences from the A. fumigatus isolates was carried out, under the conditions reported. Later, the sequences were manually edited and aligned using the BioEdit v7.0.9 software. Repeat and CSP sequence types were assigned to isolates as defined in the proposed nomenclature (Klaassen et al., 2009). The prevalence of the CSP types observed in Mexico was calculated and compared with that reported from other countries (Holland, Australia and China). Results: The 27 isolates were identified as A. fumigatus based on their phenotypic and genotypic characteristics. Seven types of repetition were identified in the isolates and a total of 5 CSP types, designated as t01, t02, t03, t04A and t10. These are among those reported by Klaassen et al. (2009), which are located in three lineages (A, B and C). In Mexico prevail in decreasing order: t04A (55.6%), t01 (14.8%), t03 and t010 (11.1%) and t02 (7.4%). No new variants were identified. It is relevant that the higher prevalence of t04A in this study was consistent with the results obtained with Australia’s environmental isolates. Conclusion: In A. fumigatus isolates, the most frequent type of CSP was t04A. The recognition of CSP types in Mexico is significant in order to maintain the standardized nomenclature of these, facilitating the understanding of the genetic diversity of A. fumigatus.

P229 Epidemiology of invasive fungal diseases in a reference center of pediatric oncology in Brazil. Leticia Marques1 , Fabianne Carlesse1 , Adriana Silva1 , Dayana Fram2 1 ˜ PAULO, Brazil Pediatric Oncology Institute (IOP)/GRAACC, Pediatric Departament, Federal Univer, SAO 2 ˜ PAULO, Brazil ˜ Paulo Hospital. Infectology Department, Paulista, SAO Infection Control Division, Sao Objective: Analyzing the epidemiology, risk factors and outcomes of IFD in a reference center of pediatric oncology in a 6 years period Methods: We evaluated the epidemiology and outcome of IFD between January 2011 to December 2016 following the European Organization for Research and Treatment of Cancer/Mycosis Study Group (EORTC/MSG) consensus criteria, identified in a reference Hospital of Pediatric Oncology in Sao Paulo- Brazil. Data were collected from medical records. Categorical variables were presented as absolute (n) and relative frequencies (%). Results: We identified 125 episodes of IFD in 112 patients, 61.6% (69/112) were male, median age was 10 years old. Regarding the IFD episodes, 46.4% (58/125) had leukemia and 44.8% (56/125) had a solid tumor, and 27% (34/125) of patients had a relapsed disease. The IFD were classified as proven 80% (100/125), probable 12% (15/125) and possible 8% (10/125).The fungal infections retrieved classified as proven were caused by 106 fungal agents, yeasts in 74.5% (79/106) and mold in 25.5% (27/106). The majority of patients with yeast infections had solid tumors (55.7% - 44/79) among mold infections 51.8% (14/27) of patients have leukemia. Among yeasts, Candida parapsilosis complexo was the most frequent agent (29% - 23/79) followed by Candida albicans (20% - 16/79) and about mold species Fusarium spp were identified in 62.96% (17/27) of the cases, 70.58% (12/17) in blood culture and 41.17% (7/17) in skin culture, followed by Aspergillus spp, in 35.3% (6/17) of the mold agents, identified mainly in pulmonary culture 66% (4/6). Among risk factors: 92% (92/100) of all them used central catheter (CVC), 41% (41/100) used antifungal previously and 44% (44/100) were neutropenic when the IFD happened. Probable IFD – 93.3% of the episodes (14/15) had lung involvement, 86.7% (13/15) of them had CVC when IFD happened and 66.7% (10/15) used antifungal therapy previously. Regarding IFD (proven and probable) by molds 65,8% occurred in patients that were not in protect enviroment (HEPA air filtration and mineral filtered water). The general mortality rate in the episodes of IFD was 28.7% (33/115), 26% (26/100) in proven infection and 46.7% (7/15) in probable. Regarding proven infection, 21.5% (17/79) of patients that had infections by yeast and 40.7% (11/27) of mold infections died during the infection occurrence. Conclusion: IFD in oncology pediatric patients remains an important cause of morbidity and mortality, C. parapsilosis was the most prevalence yeast invasive infection according with the literature and Fusarium spp. as mold infection, which shows a particularity of our country. The mainly underlying disease in patients with yeasts infection were solid tumors, and in mold infections were hematological diseases. Risk factors as CVC and period of neutropenia show us the importance of basic behaviors like hand hygiene for infections caused by yeast and hospitalization during neutropenia in a protected environment for patients with hematological disease. Despite the fact that almost all identified infections have been adequately treated, our mortality associated with proven infections caused by mold agents puts us on the alert for early identification of IFD and associated risk factors.

ABSTRACT

S113

P230 Genetic diversity and reproductive mode of Histoplasma capsulatum clinical isolates from Mexico, Guatemala, Colombia, and Argentina

P234 Molecular identification, species distribution and antifungal susceptibility profile of Candida species isolated from ICU patients in a tertiary care hospital

3 ´ ML Taylor1 , JH Sahaza Cardona2 , D Estrada Barcenas , E Duarte Escalante1 , C Canteros4 , MR Reyes Montes1 1 ´ ´ ´ Universidad Nacional Autonoma de Mexico, CIUDAD DE MEXICO, Mexico 2 ´ para Investigaciones Biologicas, ´ Corporacion MEDELL´IN, Colombia 3 ´ ´ Instituto Politecnico Nacional (IPN), CIUDAD DE MEXICO, Mexico 4 ´ BUENOS AIRES, Argentina INEI ANLIS Dr. Carlos G. Malbran,

2

Objective: We analyzed the genetic diversity and reproductive mode of Histoplasma capsulatum human isolates, using Random Amplified Polymorphic DNA (RAPD) assay to consider associations of these data with the geographic distribution of clinical isolates from Mexico, Guatemala, Colombia, and Argentina. Methods: The level of genetic diversity was detected by percentage of polymorphic loci, effective number of alleles and the Shannon’s index, whereas the heterozygosity was performed using allelic frequencies according to Zhivotovsky’s Bayesian method. Recombining and clonal populations were distinguished by the association index test (IA). Thirty-seven clinical isolates of H. capsulatum were used. Results: The RAPD-profile of all isolates showed three groups by unweighted pair-group method with arithmetic mean (UPGMA), highlighting Group I that was formed by five subgroups related to their geographic origin. The consistency of the UPGMA-dendrogram was estimated by the cophenetic correlation coefficient (CCCr = 0.94, P = 0.001). Conclusion: The findings indicate that the isolates from Mexico and Colombia have higher genetic diversity than the isolates from Argentina. Isolates from Guatemala grouped together with references strains from United States of America and Panama. The IA values suggest a recombining population for Colombia and Mexico H. capsulatum isolates, and a clonal population for the Argentinean isolates.

P231 Building materials: analysis of the efficiency of the ammonium quaternary to control Sick Building Syndrome B. G. Almeida1 , N.S.B Mazuchi2 , J.A.A. Paschoal3 , E.M Castilho2 , M.T.G Almeida2 1 ˜ JOSE´ DO RIO PRETO, Brazil ˜ Paulo State University (Unesp), Institute of Biosciences, Humanities and, SAO Sao 2 Medical Faculty -FAMERP, SAO JOSE´ DO RIO PRETO, Brazil 3 Paulista University- UNIP, SAO JOSE´ DO RIO PRETO, Brazil Objective: Three specimens of four different types of bricks, totaling 12 bricks, were the objects of analysis of the present research: calcium silicate bricks, clay bricks, ecological brinks and concrete bricks. The bricks were immersed for 30 minutes in R solution thereby guaranteeing the infiltration of the product. All the bricks freshly prepared 2% ammonium quaternary (SHINE) R was prepared according were weighed before and after immersion in order to analyze differences in weight. Commercial mortar ` to the instructions of the manufacturer, with and without the use of 2% SHINE disinfectant. Matte white acrylic paint (RomaO) was also used in the tests with disinfectant being incorporated in half of the paint and the other half being used according to the original formulation. The surface of all the bricks were inoculated using an automatic pipette with 30 mL Aspergillus fumigatus fungus inoculum prepared using the McFarland scale. The specimens were placed in plastic boxes and incubated in an oven at 30◦ C with records of the humidity and environmental temperature made daily. Colony forming units (CFU) were counted and phenotypic variation of fungal growth was investigated Methods: Three specimens of four different types of bricks, totaling 12 bricks, were the objects of analysis of the present research: calcium silicate bricks, clay bricks, ecological brinks and concrete bricks. The bricks were immersed for 30 minutes in R solution thereby guaranteeing the infiltration of the product. All the bricks freshly prepared 2% ammonium quaternary (SHINE) R was prepared according were weighed before and after immersion in order to analyze differences in weight. Commercial mortar ` to the instructions of the manufacturer, with and without the use of 2% SHINE disinfectant. Matte white acrylic paint (RomaO) was also used in the tests with disinfectant being incorporated in half of the paint and the other half being used according to the original formulation. The surface of all the bricks were inoculated using an automatic pipette with 30 mL Aspergillus fumigatus fungus inoculum prepared using the McFarland scale. The specimens were placed in plastic boxes and incubated in an oven at 30◦ C with records of the humidity and environmental temperature made daily. Colony forming units (CFU) were counted and phenotypic variation of fungal growth was investigated Results: The number of fungal colonies on the bricks, mortar and paint treated with 2% SHINE disinfectant alone was lower or even eradicated compared to the control group. On comparing the different types of bricks treated with the disinfectant, ecological bricks were the best and concrete bricks were the worse in terms of inhibition of fungal growth. Conclusion: The inhibitory activity observed in this research is important because Aspergillus fumigatus is often resistant to different chemical compounds. Future research with this disinfectant should investigate new research proposals, with adaptations and standardizations in respect to time, concentration and the stability of the product.

P232 Enhanced differentiation of Fonseca pedrosoi into sclerotic cells using fetal bovine serum Carmen Molina-Torres, Thelma Orizaga y Quiroga, Jorge Ocampo-Candiani, Lucio Vera-Cabrera Universidad Autonoma De Nuevo Leon, MONTERREY, Mexico Objective: Fetal bovine serum (FBS) has been used as a culture enrichment medium to promote cell differentiation. It is constituted by nutritional factors such as albumin, growth factors, amino acids, sugars, lipids and hormones. In this work we evaluate the effects of FBS to induce sclerotic cells of Fonsecaea pedrosoi, identified as the main causative agent of chromoblastomycosis The in vitro isolation of sclerotic cells from Fonsecaea pedrosoi mycelial forms may be a difficult and time-consuming procedure. Different agents such as propranolol and platelet activating factor (PAF) have been used in other studies, however these methods require 45 days to obtain results. Methods: In the present work we the describe a technique using propranolol as a differentiating agent and adding FBS from the beginning, this modification to the previously described method with propranolol shortens sclerotic cell differentiation to 30 days. Results: These results indicate that induction of Fonsecaea pedrosoi mycelial forms into sclerotic cells using propranolol may be enhanced by the early addition of FBS, decreasing time for cell differentiation. Conclusion: The nutritional properties of FBS may reproduce similar conditions to the human host and thus enhance cell induction.

P233 Pcr multiplex in the detection of tinea unguium in patients from caracas - venezuela. Primavera Alvarado, Laurymar Camacaro, Michelle de Arbeloa, Alexis Fernandez, Elsy Cavallera Instituto de Biomedicina, CARACAS, Venezuela Objective: The aims of this study was to compare the effectiveness of PCR multiplex vs. traditional methods in the diagnosis of dermatophyte infection of the ungueal plate, and to determine future parameters for its standardization. Methods: Forty nine patients with diagnosis of tinea unguium and 10 samples of healthy control individuals were evaluated. Conventional techniques and PCR multiplex were applied to all samples to identify common DNA sequences of dermatophytes and specific sequences of T. rubrum (TR) and T. mentagrophytes Results: PCR multiplex was positive for dermatophytes in 19 patients, overcoming the mycological culture by 11 samples (38.8% vs. 16.3%) respectively, detecting the sequence of T. mentagrophytes and other dermatophytes, which were negative to the mycological culture. Conclusion: The positive cultures for T. rubrum were positive in the PCR multiplex, with a concordance of 100%. A high sensitivity of 97% and a specificity of 73.2% were obtained.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Rungmei S Marak1 , Tasneem Siddiqui1 , Afzal Azim1 , Ajai KR Dixit1 , T N Dhole2 Sanjay Gandhi Postgraduate Institute of Medical Sciences, LUCKNOW, India SGPGIMS, LUCKNOW, India

1

Objective: Candidemia is a life threatening infection in intensive care unit (ICU) patients. Incidence varies from 0.24 to 34.3 patients/1,000 ICU admissions. High mortality rate (35 - 75%) is reported therefore early antifungal therapy is necessary. Incidence and prevalence of candidemia is increasing in many countries and few studies indicate the increasing trend of candidemia in some tertiary care hospitals in India. In recent years, there has been an increase in the proportion of non-albicans Candida spp. and has become the predominant cause of nosocomial candidemia. Variations in susceptibilities to antifungal agents among Candida species, identification to species level is important to ensure quick and appropriate treatment. This study was undertaken to study the species distribution; molecular characterization and antifungal susceptibility pattern of Candida isolated from patients admitted to the ICU in a tertiary care hospital. Methods: A prospective study was undertaken from January 2016- 2017; which included all adult patients admitted in the intensive care unit. BACEC blood cultures were collected at day 0, 3, 7 days. Patient proforma included information regarding age, gender, date of admission, ward, date of sampling and date of candidemia onset, underlying medical /surgical conditions such as DM, GI surgery, CVC, mechanical ventilation, urinary catheter, use of broad spectrum antibiotics or corticosteroids, dialysis, TPN, antifungal therapy and outcome. A single isolate was further subjected to phenotypic identification, colony PCR and RFLP and antifungal susceptibility testing Results: Prevalence of candidemia was 9%. Major risk factors were mechanical ventilation, urinary catheterization, broad spectrum antibiotic therapy, total parenteral nutrition and abdominal surgery. Main comorbidities found in the study were CKD, sepsis, respiratory disorders, DM and pancreatitis. Incidence of candidemia due to non-albicans Candida species accounted for 81% of candidemia. Among the non-albicans Candida species the most common species was C. auris 15 (35.7%) followed by C. tropicalis 14 (33.3%), C. glabrata 2 (4.8%), C. parapsilosis 2 (4.8%) and a single isolate of Candida rugosa. The results colony PCR-RFLP were similar to conventional phenotypic methods and isolates of Candida could be detected in 32 μg/mL but remained susceptible to itraconazole (ITZ) (MIC 0.023 μg/mL). Methods: To clarify the TRF-resistance mechanism in the 47C strain, the expression of the pleiotropic drug resistance (PDR1), multidrug resistance (MDR1), MDR2, and MDR4 genes were investigated by real-time quantitative PCR (RT-qPCR) analysis and sequenced SQLE encoding gene. Results: The expression of the PDR1, MDR1, MDR2, and MDR4 genes was 2 to 4 times higher in the TRF-resistant strain grown in the presence of TRF than in TRF-susceptible strains cultured in the absence of TRF. The SQLE gene from the 47C strain encoded a protein with I100M and F395L substitutions. The sequence determined in this study has been deposited in GenBank (Microsporum canis 47C SQEL mRNA for squalene epoxidase, complete cds; GenBank accession no. LC348388). Conclusion: To the best of our knowledge, this work represents the first report that TRF-resistant strains of M. canis exhibited the overexpression of ABC transporter proteins and encodes missense mutations in the SQLE. We speculate that the overexpression of genes in the TRF-resistant strain is not sufficient to prevent the antifungal effects of ITZ. Further investigation will be needed to determine the mechanism of TRF resistance in M. canis, given that feline dermatophytosis due to TRF-resistant strains is readily transmitted from cats to humans.

P262 Antimicrobial efficacy of personal productive herbal- maked toothpaste on oral pathogens related to caries and oral fungal infections B. Sadeghi-Nejad1 , E. Moghimipour2 , S. Yusef Naanaie3 1 Abadan School of Medical Sciences, Abadan, Iran, AHVAZ, Iran 2 School of Pharmacy, Ahvaz Jundishapur University of Medical Sciences, Ahvaz,Iran, AHVAZ, Iran 3 The Agricultural and Natural of Resources center, Ahvaz, Iran, AHVAZ, Iran Objective: Objectives: Dental plaque is an important risk factor for the development of dental and periodontal disease. In most cases tooth brushing only removes a limited amount of dental plaque and other chemical agents are required to reduce the microbial load. The purpose of this survey was to determine in vitro antimicrobial effects of herbal-made toothpaste containing the extracts of Artemisia dracunculus, Satureja khuzestanica and Myrtus communis against oral pathogens related to caries and oral fungal infections. Methods: Materials and methods: Antimicrobial effectiveness an herbal-made toothpaste was evaluated against five microorganisms: Streptococcus mutans, Lactobaccilus caseie, Streptococcus sanguis, Streptococcus salivarius and Cadida albicans by agar well diffusion method. Agar well diffusion method. The herbal- maked toothpaste was tested at four different concentrations: 1:4(25%), 1:1(50%), 3:4(75%) and full strength (100%) with sterile distilled water as the diluent. Results: Results: After 24 hours of incubation, the maximum mean diameter of inhibition zone against tested oral pathogens by Lactobaccilus caseie (17 to 30 mm), C. albicans (15-27 mm) and the minimum mean diameter of inhibition zone against Streptococcus mutans (17-20 mm). Conclusion: Conclusions: The results indicate tested herbal toothpaste was a significant product to inhibit the growth of plaque bacteria and Candida.

P263 Effect of Farnesol on Responsive Gene Expressions in Hyphal Morphogenesis Transformation of Candida albicans F. Nikoomanesh1 , S.H. Roudbarmohammadi1 , M. Zareei2 1 Faculty of Medical Sciences,Tarbiat Modares, TEHRAN, Iran 2 Faculty of Medical Sciences, Tarbiat Modares, TEHRAN, Iran 2 I.R.Iran police Force, TEHRAN, Iran Objective: Candida albicans a polymorphic fungus can grow as yeast, pseudohyphae and true hyphae forms. The hyphal form has a key role in infection process during invasion to mucosal membrane. Generally, colonization mainly is composed with yeast cells only while hyphal cells are more invasive to host epithelial cells. This morphology has key role in the infection process. During the infection, the hyphal form invades to epithelial and endothelial cells via releasing of hydrolytic enzymes, causes damage to the tissue. A cluster of genes contribute in controlling of hyphae formation in C. albicans, include Aspartyl Proteinase6 (SAP6), Hyphal Wall Protein1 (HWP1) and RIM101 (alkaline-responsive transcriptional regulator). Farnesol is a quorum sensing molecule which inhibits switching of yeast-to-hyphae form. In this study we aimed to investigate the inhibitory effect of farnesol on yeast-to-hyphae morphogenesis and its related gene expressions in C.albicans. Methods: C.albicans was exposed to various concentration (5, 10, 20, 50, 100, 150 and 300 μM) of farnesol and the rate of yeast cell proliferations and germ tube formation was evaluated by different methods such as colony counting and microscopic examination. Real time-PCR was performed to assess the expression levels of the hyphae-specific genes SAP6, HWP1 and RIM101. Results: We verified that 300μM concentration of farnesol, strongly inhibited yeast cells growth. Colony counting of the treated- cells in 300μM concentration of farnesol showed the least growth of C. albicans cells in comparison to other concentrations and negative control (>5% and P < 0.05). The results of hyphal growth and germ tube formation indicated that 300μM farnesol is able to inhibit hyphae and germ tube formation and only blastospores were observed. Moreover, real time-PCR analysis showed that 300μM farnesol decreases HWP1 and SAP6 gene expressions significantly in comparison to control group (P < 0.05), whereas, there was no difference in the expression of RIM101 gene Conclusion: According tothis study results, farnesol in 300μM concentration can inhibits growth and proliferation of C. albicans yeast cells and also inhibits hyphal formation. As mentioned, farnesol can affect the expression of virulent genes including pathogenic genes that are associated with hyphae morphogenesis such as SAP6 and HWP1. This action can reduce the pathogenicity and prevention C. albicans invasion of mucous membranes. Future studies at in vitro and in vivo conditions can evaluate the molecular mechanisms of farnesol effects. Also, farnesol inhibitory effects can be used on new targets and for designing naturalbased antifungal agents for therapy fungal disease

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

2

Objective: Yeasts including Candida species are isolated from the infected environment of hospital in southeastern of Iran. Exposure to fungi has been reported to cause several types of human health problems, primarily irritations, infections, allergies, and toxic effects, and it has been suggested that toxigenic fungi are the cause of additional adverse health effects. On the other hand, the most of synthetic antimicrobial products have some side effects, which make them less popular. Hence, the aim of this study was to evaluate the antifungal properties of Zataria Multiflora extract against Candida species isolated from the infected environment of hospital in southeastern of Iran. Methods: In this study, we assessed the activities of Zataria Multiflora leaf extracts against Candida species, including C. albicans, C. glabrata, C. tropicalis, using the agar-well diffusion method. Results: The minimal inhibitory concentrations (MICs) values of fruit and leaf extracts from Zataria Multiflora leaf extract ranged 1.56-12.5 mg/ml against the tested Candida species. Conclusion: Based on the results, the ethanolic extracts of the selected plants exhibited antifungal potency against the tested fungi and could be used as alternative natural antimicrobial agent and recommended to be used in formulation of herbal disinfect for the inhibition of growth of microbial environment in future researches.

P265 Distribution and antifungal susceptibility testing of aspergillus species in patients with increased risk for invasive aspergillosis G. Mirchevska1 , V. Kotevska1 , N. Panovski1 , K. Popovska1 , Z. Stojanoski2 , S. Fustik-Naceva3 , M. Petrovska1 , E. TrajkovskaDokic1 1 Institute of Microbiology and parasitology, Medical faculty, Skopje, SKOPJE, Macedonia 2 University Clinic for Haematology, University Sts Cyril and Methodius, SKOPJE, Macedonia 3 University Clinic for Pediatric diseases, University Sts Cyril and Methodius, SKOPJE, Macedonia Objective: To determine the distribution and antifungal susceptibility of Aspergillus species to antifungal agents, in clinical specimens from patients with increased risk for invasive aspergillosis. Methods: During a 2-year period, clinical specimens from 125 patients divided into 4 groups were analysed at the Institute of Microbiology and parasitology, Faculty of Medicine, Skopje, Macedonia. These groups included patients with primary immune deficiency, critically ill patients treated in intensive care units, patients with chronic aspergillosis and cystic fibrosis. All specimens were investigated with conventional mycological methods. Identification of Aspergillus was performed with macroscopic analysis of mold colonies and further microscopic analysis of the reproductive structures. E-test strips of voriconazole, itraconazole, amphotericin B and caspofungin (AB bioMerieux, France) were used for determination of the antifungal susceptibility profile of Aspergillus. Results: Four isolates of Aspergillus species in blood culture and 67 isolates of Aspergillus species in respiratory specimens were confirmed in our patients. In respiratory cultures, Aspergillus was most frequently detected in the group with chronic aspergillosis (63,33%), followed by 56,67% in cystic fibrosis group, 51,43% in primary immune deficiencies and 43,33% in patients with prolonged ICU stay. Differences in respiratory cultures positivity, between the four groups were statistically insignificant (P = 0,46). In 79,1% (53/67) of positive respiratory cultures, A.fumigatus was confirmed in all groups, out of which 32,1% (17/53) in chronic aspergillosis, followed by primary immune deficiencies - 26,42% (14/53) and cystic fibrosis - 26,42% (14/53), and 15,1% (8/53) in the group of ICU treated patients. Other species confirmed in positive respiratory cultures were A.flavus 16,42% (11/67) and A.terreus 4,48% (3/67). All isolates of Aspergillus were sensitive to voriconazole and caspofungin. Resistance to amphotericin B was detected in 5 isolates (2 isolates of A.fumigatus and 3 isolates of A.terreus). Only one isolate of A.fumigatus was resistant to itraconazole. Conclusion: A.fumigatus was confirmed to be the most prevalent species among our patients with increased risk for invasive aspergillosis. Low resistance to amphotericin B was detected in 5 isolates. Only one isolate of A.fumigatus was resistant to itraconazole.

P266 Searching for effective and safe antifungals against cryptococcosis among halogenated carboxylic acids and their derivatives M. Dylag1 , E. Leniak2 , W. Jasinska3 , M. Koziol-Galczynska4 1 University of Wroclaw, Institute of Genetics and Microbiology, WROCLAW, Poland Max Planck Institute of Molecular Plant Physiology, POTSDAM, Germany 3 Ben-Gurion University of the Negev, BEERSHEBA, Israel 4 Wroclaw Medical University, WROCLAW, Poland 2

Objective: The aim of these studies was the evaluation of anticryptococcal activity of chosen halogenated carboxylic acids. Equally important was the cytotoxicity assessment of the tested molecules toward mammalian cells. For the most active compounds was determined type of interaction with antifungal drugs used in the therapy of cryptococcosis. Methods: The antifungal susceptibility testing was performed based on CLSI M27-A3 (2008) protocol. Evaluation of cytotoxicity of the tested compounds was performed on human lung (A549) and mouse fibroblast (L929) cell lines by sulphorodamine B (SRB) assay. To assess the interactions between amphotericin B (AMB) or fluconazole (FLC) and one of two the most active compounds 2D checkerboard microdilution test was performed in RPMI-1640 medium. Results: Our studies demonstrate very different anticryptococcal activity of the tested compounds. The highest antifungal effect was achieved for 3-bromopyruvate (3BP) and its propyl ester derivative. The MIC values were in the range 0.12-0.15 mM and 0.06-0.08 mM, respectively. The highest susceptibility toward these compounds showed all the Cryptococcus neoformans strains followed by Cryptococcus gattii and other environmental, non-pathogenic Cryptococcus spp. strains. Despite these results the cytotoxicity tests allow to continue more advanced studies only for 3BP. This compound is non-toxic even at concentrations 200-times higher than determined MIC values. Moreover, for this pyruvate derivative hipersynergistic and neutral effect with AMB and FLC was showed, respectively. Conclusion: Considering that cryptococcosis is responsible for 15–17% AIDS-related deaths globally and treatment options are limited mainly to AMB and FLC our results have strongly applicable character. We just showed that 3-bromopyruvate, especially in combination with amphotericin B could be developed as a novel anticryptococcal drug.

ABSTRACT

P267 Low level laser therapy increases production of fungicidal products by paracoccidioides brasiliensis-stimulated neutrophils and decreasing IL-10 secretion in a model of acute infection in air pouch subcutaneous E. Burger1 , AC.S.C. Mendes1 , J.C. Grisolia1 , L.A. Santos1 , Z.P. De Camargo2 , L.M. Verinaud3 1 Federal University of Alfenas (UNIFAL-MG), ALFENAS, Brazil 2 ˜ Paulo (UNIFESP), SAO PAULO, Brazil Federal University of Sao 3 State University of Campinas (UNICAMP), CAMPINAS, Brazil Objective: Paracoccidioidomycosis (PCM) is caused by the fungus Paracoccidioides brasiliensis (Pb), in which innate immunity is an important component of host defense. In this context macrophages and neutrophils (PMN) play a central role. The treatment consists of prolonged administration of antifungals, which may cause many side effects. Low level laser therapy (LLLT) has been used as an adjuvant treatment for many ailments and its modulating effect on neutrophils has already been demonstrated; however it is necessary to better understand the mechanisms involved in this process. The aim of this work was to establish the effect of in vivo LLLT application on bone-marrow immature neutrophils on mature neutrophil activity and immunological profile of subcutaneous (SC) air pouch cells obtained from mice infected with either Pb18 or Pb265 isolates. Methods: We evaluated the effects of LLLT (100 mW of power; wavelength of 808 nm; energy density of 35,7 J/cm3 ; 10 seconds per point) applied in vivo on alternate days at two points on each hind paw of mice, aiming the bone marrow. These mice were infected in the SC air pouch with either the virulent (Pb18) or avirulent (Pb265) P. brasiliensis isolate. Unirradiated animals were used as controls. After 8 days of infection, the cells from the air pouch were collected and analyzed for the number, protein concentration and release of reactive oxygen species (ROS), mitochondrial activity of PMN and also migration profile and secretion of cytokines (IL-12, IFN-γ , GM-CSF, IL-17, IL- 4 and IL-10) by the cells present in the exsudate. Results: Pb18-infected LLLT-treated animals showed increased mitochondrial activity, protein content and release of ROS by exudate cells and also decrease in the number of cells and secretion of IL-10. Infection with Pb265 also led to an increase in mitochondrial activity, but there was a decrease in protein concentration and the release of ROS was similar to that of unirradiated controls. No differences were observed in LLLT-treated and controls in the secretion of the IL-12, IFN-γ , GM-CSF, IL-17 and IL-4 cytokines by exudate cells stimulated by either fungal isolate. Regarding cell migration to the SC air pouch, PMN were the main cell type found at the inoculum site (70%), followed by lymphocytes and monocytes. The number of PMN decreased after treatment with LLLT when the stimulus was Pb18 and increased when it was Pb265. The number of lymphocytes increased in the group stimulated with LLLT and infected with Pb18 and decreased when the stimulus was Pb265 after LLLT therapy. Monocytes number were not altered in LLLT-treated mice and in their controls when the stimulus was Pb18 and when the stimulus was Pb265 a decrease was observed in the group treated with LLLT. Conclusion: Our results suggest that treatment with LLLT elicits an activation and increased production of fungicidal products by exudate cells (comprised mainly of PMN), especially ROS, and decreased secretion of IL-10 by exudate cells when stimulated with a virulent Pb isolate, whereas infection with an avirulent isolate caused only increase of mitochondrial activity. CNPq_305216/2016-3, FAPEMIG APQ 012941-16 Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 411237 c041f75e-ad89-4237-9f16f613d60d30d8.jpg Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 411237 c041f75e-ad89-4237-9f16f613d60d30d8.jpg

P268 Reducing animal usage in antifungal drug development: near-infrared reporter strains and imaging fungal infection. A.F. Chapuis University of Aberdeen, ABERDEEN, United Kingdom Objective: Fungal infections are a major burden on global health. Fungal diseases range from minor infections to lifethreatening systemic infections. Difficulties in diagnosis and limited therapeutic options increase the risk of mortality in immunosuppressed patients and there is a clinical need for new therapies. Traditional in vivo investigation of infection and new therapies in mice is carried out using post mortem methodologies. However, fluorescent proteins have become valuable tools for biomedical research. In particular, reporter proteins in the near-infrared spectrum (650-900 nm) allow good results for in vivo imaging. These new techniques address ethical concerns, as they allow a significant reduction in the number of animals required to evaluate a new drug, if the same animals are imaged during treatment. These new techniques also allow a better understanding of the growth of the pathogen during infection. Methods: We are developing novel near-infrared reporter systems for imaging fungal infection in live mice. Two reporters in the near-infrared spectrum have been selected: near-infrared fluorescent protein (iRFP) and mKate. Both reporters have been optimised and codon modified to integrate into the Candida albicans genome. Results: Results of imaging an iRFP strain in vivo in a Candida albicans gastrointestinal infection model allowed us to determine the efficacy of one promoter over another one (CAT1 and PGA59) and to refine the protocol for future experiments. Conclusion: Future work will focus on optimising mKate as a reporter for in vivo imaging of fungal infections.

S119

P270 Misidentification of genome assemblies in public databases: the case of Naumovozyma dairenensis and proposal of a protocol to correct misidentifications A.A. Stavrou1 , V. Mixao2 , T. Boekhout1 , T. Gabaldon2 Westerdijk Fungal Biodiversity Institute, UTRECHT, Netherlands Centre for Genomic Regulation, BARCELONA, Spain

1 2

Objective: Online sequence databases serve as a tremendously useful platform for researchers to share published data. However, submission systems lack control for errors such as misidentification, which once entered in the database can be propagated and mislead downstream analyses. Here we present an illustrating case of misidentification of Candida albicans from a clinical sample as Naumovozyma dairenensis based on whole-genome shotgun data. Part of our current work is the identification of species-specific genomic regions of human pathogenic yeasts. We have identified one such region, which is species-specific to C. albicans. However, during our work, when performing a BLASTn search against the Whole-genome shotgun (WGS) contigs database one of the obtained hits was a region of the Naumovozyma dairenensis (763 NDAI) assembly. As this species is phylogenetically distantly related to C. albicans the BLASTn hit seemed suspicious. Methods: Analyses of phylogenetic markers, read mapping and single nucleotide polymorphisms (SNP) served to correct the identification. To verify whether the 763 NDAI strain was correctly identified, we used phylogenetic markers traditionally used to identify filamentous fungi and yeasts: ribosomal DNA, elongation factor 1, DNA-directed RNA polymerase II, actin1 and translation elongation factor 1 alpha from the N. dairenensis type strain CBS 421. To confirm that the WGS reads from 763 NDAI deposited in Sequence Read Archive (SRA) actually correspond to a C. albicans strain, as possibly indicated by the previous BLASTn hits, and not to N. dairenensis, we performed read mapping and single nucleotide polymorphism (SNP) calling on two available C. albicans reference genomes for strains SC5314 and WO-1 and to the reference genome of N. dairenensis CBS 421. Results: The results from the BLASTn analysis of all the sequences, phylogenetic markers, showed 99–100% identity for C. albicans strains in the nucleotide database and 100% identity with the N. dairenensis strain 763 NDAI and other C. albicans strains in the NCBI WGS database, suggesting 763 NDAI strain may indeed be C. albicans. On the genomic analysis only 1.2% of the reads mapped to the N. dairenensis CBS 421 reference, while 98% and 96.7% of the reads were successfully mapped to C. albicans SC5314 and WO-1 genomes, respectively. Conclusion: Unfortunately, although misidentifications are rather easy to detect with comparative analyses the errors are difficult to eliminate from the databases. Therefore, these errors can be propagated to other studies, thus compromising their quality. To avoid such situations, we propose checkpoints to avoid misidentifications: the habitat of the isolate gives a first indication, deposition of the isolate in a public collection, D1-D2 and ITS domains are useful phylogenetic markers, other markers are described as suitable depending on the taxonomy of an isolate. An automated procedure to detect and compare phylogenetic markers in a submitted sequence could be included in the submission process of public databases and used to detect potential misidentifications upon submission. A warning coupled with a provisional halt of the submission, would allow correcting clear-cut errors before the sequences are publicly available.

P271 Deletion of ADA2 increases antifungal drug susceptibility and virulence in Candida glabrata Y.L. Chen, S.J. Yu, Y.L. Chang National Taiwan University, TAIPEI, Taiwan Objective: Candida glabrata, the second most frequent cause of candidiasis after Candida albicans, is an emerging human fungal pathogen that is intrinsically drug tolerant. Currently, studies of C. glabrata genes involved in drug tolerance are limited. Ada2, a component serving as a transcription adaptor of the Spt-Ada-Gcn5 acetyltransferase (SAGA) complex, is required for antifungal drug tolerance and virulence in C. albicans. However, its roles in C. glabrata remain elusive. Methods: All deletion mutants were generated from the prototrophic wild type strain CBS138 using the SAT1 flipper. To obtain an ADA2 complementation strain, we restored the ADA2 gene in the ada2 mutant background. Several experiments such as the determination of acetylation level of H3K9 and H3K14, growth kinetics, the determination of minimum inhibitory concentration, agar invasion assay, murine model of systemic infection, and analyses of immune modulators in mice were performed. Results: we found that C. glabrata ada2 mutants demonstrated severe growth defects at 40◦ C but only mild defects at 37◦ C or 25◦ C. In addition, C. glabrata ada2 mutants exhibited pleiotropic phenotypes, including susceptibility to three classes of antifungal drugs (i.e., azoles, echinocandins, and polyenes) and cell-wall perturbing agents, but resistance to the endoplasmic reticulum stressor tunicamycin. According to RNA sequence analysis, the expression of 43 genes was down-regulated and the expression of 442 genes was up-regulated in the ada2 mutant compared to the wild type. C. glabrata ADA2, along with its downstream target ERG6, controls antifungal drug tolerance and cell wall integrity. Surprisingly, ada2 mutants were hypervirulent in a murine model of systemic infection, possibly due to the up-regulation of multiple adhesin-like genes, increased agar invasion, and overstimulation of murine TNF-α production. Conclusion: Deletion of ADA2 increases antifungal drug susceptibility and virulence in Candida glabrata.

P272 We need more powerful microsatellite assay for population genetic studies of Trichophyton rubrum P269 In Situ Hybridization for Madurella mycetomatis using Madurella specific probe W. Erasmus MC, ROTTERDAM, Netherlands Objective: Mycetoma is a poverty associated neglected tropical disease mainly affecting the foot. It is a chronic granulomatous infection that is characterised by grain formation. There are more than 56 mycetoma causative agents but the most common is Madurella mycetomatis. Histology and/or culturing are used to identify these causative agents. However, due to the lack of specific characteristics, these identification method often lead to misidentifications. Only by using molecular diagnosis causative agents can be differentiated. Molecular identification on isolates has been developed, but not for molecular identification on histology slides. Here we develop and demonstrate a sensitive and specific In situ hybridisation method for staining mycetoma grains. Methods: ISH staining was performed on slides containing grains from Madurella mycetomatis infected patient tissue, fungi grown on agar and in liquid with a pan-fungal probe and a Madurella spp specific probe designed in this study. To determine the best method to increase staining, 5 pre-treatment methods were applied to the specimens: 1. Cell wall lysing enzyme; 2. Zymo lysis buffer; 3. Bleach; 4. Manganese peroxidase; 5. Antigen retrieval. Results: In situ hybridisation staining was not possible without first permeabilising the grains. It appeared that pre-treatment with antigen retrieval was the best method to increase staining intensity and range. Cell wall lysing enzyme and Zymo lysis buffer resulted in no staining and is not suitable to use in ISH as it resulted in high amount of cell damage. Melanin degradation using bleach and manganese peroxidase gave similar results. Formalin fixation has a negative impact on ISH staining as staining can only be observed in samples fixed in formalin for a short period. Conclusion: This is the first study suggesting ISH method can be used to diagnose mycetoma. Antigen retrieval pre-treatment method is able to increase ISH staining intensity and range. Formalin fixation has a negative impact on ISH and samples should be processed as soon as possible to yield better ISH staining.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

I. M. Pchelin1 , M.A. Kryuchkova1 , T.V. Bogdanova1 , G.A. Chilina1 , L.G. Boronina2 , E.S. Olina3 , O.A. Shurpitzkaya1 , N.V. Vasilyeva1 , A.E. Taraskina1 1 North-Western State Medical University named after I.I. Mechnikov, ST. PETERSBURG, Russia 2 A.M. Gorky Ural State University, YEKATERINBURG, Russia 3 Regional Children’s Clinical Hospital No. 1, YEKATERINBURG, Russia Objective: Currently available microsatellite assay for molecular typing of Trichophyton rubrum consists from 8 loci and was published in the year 2016 by Gong et al. We assessed the performance of this assay for uncovering genetic structure of bipartite Russian population of T. rubrum. Methods: A total of 41 clinical isolates of T. rubrum were isolated in St. Petersburg and Yekaterinburg, Russia in the years 2015–2017. Species identification was performed by DNA sequencing of ITS region. Urease activity was assessed by use of Christensen’s urea broth. We performed molecular strain typing by sequencing of A7C99 6411 locus and amplification of eight microsatellite loci according to Gong et al. 2016. Bruvo pairwise genetic distances were calculated on the basis of the lengths of microsatellite markers in polysat package for R and further subjected to PCA analysis and construction of phylogenetic network in SplitsTree program. Simpson’s index of genotype diversity was calculated in the package polysat. Results: The sequencing of ITS rDNA region revealed one sequence throughout the sample, identical to KT285224. All isolates were urease-negative. The protein-coding locus A7C99 6411 was polymorphic at the position 793, containing alternatively adenine or guanine. Mutation in this locus is known to be correlated with mutation in another protein-coding locus A7C99 6714 and TRS-1 genotype of an isolate, dividing Russian population of T. rubrum in two clearly defined genetic lineages. However, genetic distances that were obtained by microsatellite typing were distributed unimodally (Fig. 1A) and principal component analysis of these distances revealed a single cloud (Fig. 2B). The phylogenetic network did not contain a well-defined clade for either A7C99 6411 genotype (Fig. 1C). These results suggested one uniform population. On the other hand, Simpson’s index of genotype diversity differed significantly for representatives of particular A7C99 6411 genotypes (Fig. 1D). This index measures the probability that two individuals randomly selected from a sample will belong to the same genetic lineage and its lower value for A7C99 6411 793 G genotype is indicative of higher genetic diversity. Conclusion: Thus, the microsatellite assay used had not enough discriminative power to resolve the structure of local T. rubrum population and more loci should be involved in further studies. This task appears to be challenging, since Gong et al. reported only 6 microsatellite loci from 100 studied to be polymorphic. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 414711 ce458ccf-5025-438d-b1f91102b8a435f1.jpg

S120

P273 Phagocytosis of Mucorales spores by lung epithelial cells and macrophages ¨ V. Naschberger, D. Wilflingseder U. Binder, C. Lass-Florl, Medical University Innsbruck, INNSBRUCK, Austria Objective: Opportunistic infections represent a serious health threat to immunocompromised patients nowadays. One group of relevant fungal pathogens are the Mucorales. Members of this group play an increasing role in the clinic, but still only little is known about their biology, disease establishment, progression, and immune response. As for other filamentous fungi, the infectious agents are inhaled spores. Therefore, we study the interaction of clinically relevant Mucorales with bronchial and alveolar epithelial cells that are most likely the first cells of contact. Methods: In order to enhance throughput and facilitate comparison of different Mucorales species, we adapted a flow cytometric method to study phagocytosis by lung epithelial cells and macrophages in vitro. With this method we can distinguish between internalized and attached spores by differential staining using FITC and uvitex. As representatives of alveloar epithelial cells we used A549 cell line and NHBE cells as an example for bronchial epithelial cells. Furthermore, we tested our method also with ThP1- macrophages. Results: Our results so far show that significant difference in phagocytosis rates are obvious within the various Mucorales species by lung epithelial cells, whereas in macrophages phagocytosis rates of different Mucorales species were similar. Conclusion: Our results so far indicate that mechanisms for recognition, binding and uptake of Mucorales spores is not only species dependent, but also is variable in different cell types. Future work will aim to elucidate the parameters involved in recognition and uptake and shed light on the fate of internalized Mucorales spores.

P274 Generation and evaluation of stable Lifeact-expressing A549 cell lines for investigation of A.fumigatus interaction with pulmonary epithelial cells N. Schiefermeier-Mach1 , C. Zenzmaier1 , S. Angerer1 , C. Zulmin1 , S. Geley2 , S. Perkhofer1 1 University of Applied Sciences Tyrol, INNSBRUCK, Austria 2 Medical University of Innsbruck, INNSBRUCK, Austria Objective: A human cancer-derived A549 lung epithelial cell line is widely used in studies analyzing the interaction of A. fumigatus with pulmonary epithelial cells. Previous studies showed that conidia can adhere to A549 cells and enforce formation of actin-rich pseudopods followed by conidia invagination and endocytosis (1-4). Moreover, secreted fungal proteases were suggested to cause loss of actin fibers and focal adhesions in A549 cells, followed by cell detachment and necrosis (5). The aim of our study is to investigate the interaction of A.fumigatus conidia with alveolar epithelial cells and changes of the actin cytoskeleton Methods: Using lenti-viral transduction A549 –derived cell lines that stably express LifeAct (GFP) (6) or LifeActRed (mCherry) were generated. These cell lines were then infected with either a GFP-expressing strain of A.fumigatus (3) or a wild type strain (ATCC 46645) for fluorescence live cell video microscopy. Results: Our preliminary data suggest that the formation of actin-rich pseudopods around cell membrane attached conidia is a rare and a highly conidia concentration-dependent event. In line with previous studies, in A549 cells infected with high conidia numbers (108 conidia/ml), pseudopod formation could be observed along with a strong depolymerisation of F-actin. However, when cells were infected with lower numbers of conidia (103 -104 conidia/ml), the actin cytoskeleton remained intact. Moreover at the sites of conidia-membrane interactions we could observe an increase in stress fiber formation, suggesting activation of possible “protective” mechanisms against conidia internalization. Using the WST-1 assay, we also observed that treatment of A549 with either A.fumigatus culture filtrates or with A.fumigatus cellular extracts caused strong inhibition of metabolic activity in a concentration- and time- dependent manner. Interestingly, the R plates, effect of culture filtrates and cellular extracts was strongly decreased when A549 were seeded on CELLBind (Corning) suggesting the importance of cellular adhesion for the A.fumigatus interaction. Conclusion: Our preliminary data suggest that cell systems where A549 are confronted with a high amount of A.fumigatus conidia may not be optimal to investigate cell-pathogen interactions. Further use of live microscopy and stable A549 cell lines may help reinvestigation of initial interactions of conidia /epithelial cells with high optical resolution. References: Bromley IM and Donaldson K., Thorax. 1996. DeHart DJ et al., J Infect Dis. 1997. Wasylnka JA and Moore MM., Infect Immun. 2002. Wasylnka JA and Moore MM., J Cell Sci. 2003. Kogan TV et al., J Infect Dis. 2004. Riedl J et al., Nat Methoda. 2008.

P275 Autophagy activity contributes to the killing of Talaromyces marneffei in vitro and in vivo X. W. Huang1 , Y.H. Liu2 , L.Y. Xi2 , E. Mylonakis3 , K. Zeng1 1 Nanfang Hospital, Southern Medical University, GUANGZHOU, China 2 Dermatology Hospital, Southern Medical University, GUANGZHOU, China 3 Warren Alpert Medical School of Brown University, PROVIDENCE, USA Objective: Talaromyces marneffei, an intracellular pathogenic fungus can cause life-threatening systemic mycosis in immunocompromised hosts. Autophagy, as a cytoplasmic maintenance pathway, is discovered to participate in the defense against intracellular pathogens. However, it’s still poorly understood whether autophagy plays a role in host defense against T. marneffei. Here we wonder to discover the effect of autophagy during T. marneffei infetion both in vitro and in vivo. Methods: In this study, we detected autophagosomes formation in the co-culture system of macrophages with T. marneffei, and the effect of autophagy on T. marneffei within macrophages through western-blot and confocal microscope. Then we inhibited the autophagy gene lgg-1 in Caenorhabditis elegans and examined their survival following T. marneffei infection. In addition, we measured the anti-inflammatory and anti-fungi activities of the autopahgy inducer - rapamycin in mice infected with T. marneffei. Results: We demonstrated that in macrophages, T. marneffei actually induced autophagy and the induction of autophagy could suppress T. marneffei activity. In C. elegans, the inhibition of autophagy conferred their susceptibility to T. marneffei. In BALB/c mice infected with T. marneffei, the autophagy inducer reduced the fungal burden and inhibited the inflammation of the lung. Conclusion: Thus, we conclude that autophagy plays a crucial role in host defense against T. marneffei both in vitro and in vivo. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 414945 99ab48c8-9799-4271-af4d539484cd35df.bmp

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Medical Mycology, 2018, Vol. 56, No. S2

P276 Expression of Cu, Zn superoxide dismutase recombinant protein from Talaromyces marneffei in Pichia pastoris and its resistance to oxidative stress S. Khanthawong1 , R. Pratanaphon2 , K. Wongsawan2 , N. Vanittanakom2 1 Naresuan University, PHITASANULOK, Thailand Chiang Mai University, CHIANG MAI, Thailand

2

Objective: Talaromyces marneffei is an intracellular dimorphic fungus that causes a fatal disseminated disease in human immune-deficient virus-infected patients. The factors that affect the pathogenicity of this fungus remain unclear. Superoxide dismutase has been shown to contribute to the virulence of many human-pathogenic fungi through its ability to neutralize toxic levels of reactive oxygen species generated by the host. In this study, we constructed the recombinant Cu, Zn superoxide dismutase clone from T. marneffei in Pichia pastoris to determine for specific enzyme activity and Cu, Zn SOD overexpressed yeast was tested for resistance to the oxidative stress conditions. Methods: Full-length sodA gene encoding Cu, Zn SOD of T. marneffei, was amplified then cloned into pPICzαB plasmid and transformed into TOP10 E. coli competent cells. The positive clone was amplified and linearized with the MssI restriction enzyme. The fragments were transformed into P. pastoris X-33 competent yeast cells by electroporation and selected the positive recombinant yeast cells with media containing zeocinTM . The positive clones were then checked with PCR and sequencing. The selected clone was induced for recombinant protein expression. The recombinant Cu, Zn SOD was purified and enzymatic activity was examined by Native-PAGE activity. Moreover, the antioxidant property of Cu, Zn SOD recombinant yeast was determined by culture in heat shock condition, H2 O2 , paraquat or menadione. Results: An approximate molecular mass 20 kDa of secreted recombinant Cu, Zn SOD was detected by Coomassie blue staining-SDS-PAGE and his-tag was detected by western blot with Ni-NTA. The results from Native-PAGE revealed that the purified Cu, Zn SOD recombinant protein had an enzymatic activity that was similar to the standard enzyme. The sodA-pPICzαB recombinant yeast appeared to be more resistance to oxidative stress conditions than pPICzαB recombinant yeast Conclusion: This is the preliminary study for expression and enzyme activity determination of recombinant Cu, Zn SOD protein from T. marneffei. The further study will focus on protein characterization of the immunogenic and virulence properties.

P277 Role of Elm1 in cell wall integrity and virulence of Candida glabrata Y. Ito1 , T. Miyazaki1 , H. Nakayama2 , A. Morita2 , T. Takazono1 , T. Saijo1 , S. Shimamura1 , K. Yamamoto1 , Y. Imamura1 , K. Izumikawa1 , K. Yanagihara1 , S. Kohno1 , H. Mukae1 1 Nagasaki University Hospital, NAGASAKI, Japan 2 Suzuka University of Medical Science, MIE, Japan Objective: The calcineurin signaling pathway plays critical roles in antifungal resistance and virulence in pathogenic fungi, including Candida albicans, Candida glabrata, Cryptococcus neoformans, and Aspergillus fumigatus, and has attracted attention as a novel target for antifungal therapy. However, as the current calcineurin inhibitors have immunosuppressive effects, it is difficult to use these drugs for fungal infection in clinical practice. Therefore, it is expected that new calcineurin-related protein is discovered. The serine/threonine protein kinase Elm1 is regulated by calcineurin and involved in multiple cellular functions, including mitosis, cytokinesis, and morphogenesis in Saccharomyces cerevisiae. In this study, we performed functional analysis of Elm1 in the clinically important fungal pathogen Candida glabrata. Methods: A Candida glabrata elm1 strain was constructed using the one-step PCR-based technique. Cell morphology was examined under fluorescence microscope and transmission electron microscope. The major cell wall components were measured using alkali-insoluble cell wall fraction. A spot dilution assay was performed to evaluate sensitivity to environmental stresses, including high temperature, iron depletion, serum, as well as cell wall damaging agents. Antifungal susceptibility was examined using a commercially prepared colorimetric panel, Sensititre YeastOne microtiter panel. Virulence of the elm1 strain was examined using mouse and silkworm models of disseminated candidiasis. Mice were intravenously inoculated with C. glabrata cells, and spleen, liver and bilateral kidneys were excised 7 days after injection. Appropriate dilutions of organ homogenates were plated and CFUs per organ were calculated. In a silkworm infection model, C. glabrata cells were injected into the hemolymph through the dorsal surface of larvae and 50% lethal dose (LD50 ) was determined 24 h after injection. Results: The elm1 mutant displayed impaired cell division and elongated morphology. In addition, the elm1 mutant had significantly thicker cell wall and increased chitin content compared to the wild-type and ELM1-reconstituted strains, although there was no difference in the amount of β-glucan. The loss of ELM1 also resulted in a decreased growth rate and increased sensitivity to high temperature, iron depletion, serum, and cell wall damaging agents including echinocandins, Congo red, and calcofluor white. Supplementation of iron into media rescued growth in the presence of serum but not morphology of the elm1 cells. Lastly, mice infected with the elm1 mutant exhibited significantly reduced fungal burden in all organs examined in this study. In addition, LD50 of the elm1 mutant was significantly higher than that of the wild-type strain in a silkworm infection model. These results indicate attenuated virulence of the elm1 mutant. Conclusion: This study characterized various phenotypes of the C. glabrata elm1 mutant for the first time, demonstrating that Elm1 is required for cell wall integrity and virulence in C. glabrata. To understand molecular basis of these phenomena, further analyses using an elm1 strain controlled by the tetracycline-regulatable promoter and an elm1 kinase-dead mutant are now in progress.

P278 Understanding the mechanism of action of the anti-dandruff agent zinc pyrithione against Malassezia restricta M. Kim1 , Y. Cho2 , Y.W. Lee3 , W.H Jung1 1 Chung-Ang University, ANSEONG, South Korea Korea Polar Research Institute, INCHEON, South Korea 3 Konkuk University, SEOUL, South Korea 2

Objective: Dandruff is known to be associated with Malassezia restricta, which is the most frequently isolated fungus from human skin. To treat the disease, zinc pyrithione (ZPT) has been used as an anti-dandruff ingredient in various anti-dandruff shampoos. There have been several studies that have investigated the mechanism of ZPT; however, they mainly used a nonpathogenic model yeast Saccharomyces cerevisiae and a different Malassezia species M. globosa whose contribution to dandruff is known to be minimal. The aim of the current study was to understand how ZPT inhibits the growth of M. restricta. Methods: We analyzed the intracellular metal contents of ZPT-treated M. restricta cells. The transcriptome profile of the ZPT-treated cells was also compared with that of untreated cells. The transcriptome changes caused by the ZPT treatment were confirmed by expression analysis of the proteins and by assessing the enzymatic activities. Results: Our data show that the ZPT treatment dramatically increased the intracellular zinc levels along with a small increase of the intracellular copper content in M. restricta. This result was different from what was shown in the study using S. cerevisiae. However, similar to what was found in a previous study, our transcriptome analysis showed that ZPT inhibits Fe-S cluster synthesis in M. restricta. Apart from the above findings, we observed that ZPT treatment causes a significant reduction in the expression of lipases whose activities are believed to contribute to the survival and virulence of M. restricta on human skin. Conclusion: Overall, the results of our study suggest that at least three inhibitory mechanisms may be associated with the action of ZPT against M. restricta: i) an increase in the intracellular zinc levels, ii) the inhibition of the Fe-S cluster synthesis, and iii) a decrease in lipase expression.

ABSTRACT

P279 Function Analysis of Stress-related Gene Afpab1 of Aspergillus fumigatus L. Wang1 , D. He1 , D.Y. Wang1 , S. Gao2 1 Jilin University, CHANGCHUN, China 2 Beijing ZhongKaiTianCheng Bio-technology Co., Ltd., BEIJING, China Objective: Aspergillus fumigatus Afpab1 is the ortholog of Aspergillus oryzae cytoplasmic messenger ribonucleoprotein granules Aopab1 which has the function with depressing the initiation of translation during stress. A. fumigatus can regulate its cellular physiology in response to environmental stresses, but there has been no research on pab1 in A. fumigatus. Analyzing the relationship between Afpab1 and pathogenicity will be better to understand the pathogenesis of aspergillosis. Methods: Mutant afpab1 and revertant afpab1C of A. fumigatus were generated with the method of Agrobacterium tumefaciens - mediated transformation. The associated gene Afpab1 was replaced with a hygromycin-selectable marker. Morphological changes of wild-type strain, mutant and revertant were observed under heat shock, hyperosmotic, nutritional and oxidative stresses. The expression of oxidative stress-related genes was detected by Real-time PCR. The reactive oxygen species (ROS) scavenging ability was tested with DCFH-DA stain. And the virulence was detected using the mouse model of invasive pulmonary aspergillosis. Results: Phenotypic analysis showed that the afpab1 grew more weakly than the wild-type strain when exposed to oxidative stress. Also the germination rate of afpab1 was decreased, and the morphology of spores showed great changes. The expression of superoxide dismutase sod1 and transcriptional regulator afyap1 of afpab1 decreased significantly. And ROS scavenging ability of it was declined. Pathogenicity testing showed that the virulence of afpab1 had decreased. Conclusion: The function of Afpab1 is correlated with susceptibility to oxidative stress, and deletion of Afpab1 from A. fumigatus possibly leads to observed hypovirulence in an immunosuppressed mouse model. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 415881 9753e942-540f-43d3-bac497345a7f5806.jpg Caption 1: Colony of A. fumigatus cultured with H2O2 Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 415881 9753e942-540f-43d3-bac497345a7f5806. fumigatus cultured with H2O2.jpg Caption 2: ROS scavenging ability stained with DCFH-DA

P280 Effect of simultaneous itraconazole treatment and low level laser therapy on neutrophils in experimental paracoccidioidomycoses E. Burger1 , J.C. Grisolia1 , L.A. Santos1 , AC.S.C. Mendes1 , L.M. Verinaud2 , Z.P. DE Camargo3 1 Federal University of Alfenas (UNIFAL-MG), ALFENAS, Brazil 2 State University of Campinas (UNICAMP), CAMPINAS, Brazil 3 ˜ Paulo (UNIFESP), SAO PAULO, Brazil Federal University of Sao Objective: Paracoccidioidomycosis, caused by the fungus P. brasiliensis (Pb) is a severe mycosis, common in Brazil. The treatment is long and complicated, justifying studies to expand therapeutic options. The presence of neutrophils (PMNs) in the lesions is conspicuous, indicating their central role in the early response to the fungus during the innate immunity through efficient fungicidal activity and positively modulating the subsequent acquired immune response. Recently we demonstrated the activating effect of low level laser therapy (LLLT) on PMNs of mice inoculated with Pb. Here we propose to provide the theoretical basis for the development of a shorter treatment with fewer side effects of PCM, through the activation of neutrophils by the simultaneous administration of the antifungal drug Itraconazole and adjunctive therapy with LLLT, to provide better control at initial phases over Pb, its causative agent, leading to a more efficient and protective immune response, resulting in control or cure of this disease. Methods: For this, we used a highly purified PMNs preparation by inoculating Pb in subcutaneous (sc) air pouches of mice. We evaluated the effect of drug and/or LLLT on the size of the air pouch formed, on the cell population that migrated to this infection site in terms of their composition, protein metabolism and mitochondrial activity an also on their ability to synthesize reactive oxygen species (ROS). Results: Our data show that the composition of the cellular exsudate at the sc air pouch was not altered either by antifungal therapy with any Itraconazole dose employed or by LLLT; 75% of the cells collected being PMNs, with a small number of lymphocytes and monocytes also present. None of the treatments had adverse effects on cellular viability, which was always higher than 70%. Cellular viability after 50 mg/mL Itraconazole treatment was significantly higher than that of cells from untreated controls and laser-treated mice, suggesting that decrease in the number of viable Pb due to either treatment resulted in higher cell viability. The results of mitochondrial activity and absolute cell counts showed significant differences between untreated and laser-treated groups and between mice treated with different dosages of Itraconazole with or without LLLT. Cells from mice treated with 10 mg/mL Itraconazole produced the highest levels of ROS in comparison to the other treatments, followed by cells from mice administered with 3 mg/mL; the lowest levels were produced with the 50 mg/mL dosage. Analyzing the air pouch size in terms of volume, weight and diameter, we observed significant differences between the groups treated with different Itraconazole doses and also when this treatment was associated with LLLT. Conclusion: The highest, 50 mg/ml Itraconazole dose resulted in significant reduction of the air pouch as well as in the number of cells present and their mitochondrial activity, thus indicating that the higher the Itraconazole concentration, more effectively this antifungal drug acts at the infection site, showing a dose-response phenomenon as well as an additive protective effect of the hosts’ PMNs, the antifungal drug Itraconazole and laser therapy in this model of experimental paracoccidioidomycosis. CNPq 305216/2016-3, FAPEMIG APQ 012941-16 Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 415932 9bf9f7fe-cfff-4b87-843f28af328d3bac. Eff.jpg Caption 1: Figure 1 Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 415932 9bf9f7fe-cfff-4b87-843f28af328d3bac.jpg Caption 2: Figure 2

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

S121

P281 Comparative efficacy of fluconazole and liposomal amphotericin B in diabetic mice infected with azole resistant or sensitive Candida albicans S. Simargi, J.A. Olson, J.P. Adler-Moore California State Polytechnic University, POMONA, USA Objective: Diabetes compromises blood circulation and immune responses, as well as major metabolic pathways, which can lead to increased susceptibility to infection. In the present study, we examined this possibility using diabetic versus non-diabetic mice with systemic candidiasis caused by a Candida albicans azole sensitive(C.alb-S) or azole resistant(C.alb-R) strain. Infected mice R AmBi). were treated with fluconazole (Flu) or liposomal amphotericin B (AmBisome, Methods: ICR male mice (3-4 weeks old) were maintained on a high (60%) fat diet for 4 weeks. Diabetes was then chemically induced by one intraperitoneal nicotinamide (60 mg/kg) and streptozotocin (100 mg/kg) treatment; by day 7–14 mean blood glucose levels were ≥200 mg/dL. Diabetic mice (n = 9-14/gp) and non-diabetic mice (n = 14-16/gp) were challenged intravenously (IV) with C.alb-R (ATCC 62342) (diabetic: 3.5 × 10e×6 cells/mouse; non-diabetic: 1.4 × 10e×6 cells/mouse) or C.alb-S (CP620) (diabetic: 1.5 × 10e×6 cells/mouse; non-diabetic: 6.9 × 10e×6 cells/mouse) and 24 h later, given 5 mg/kg AmBi or 5% dextrose in water (D5W) intravenously for 6 days or Flu 40 mg/kg PO 2X/day for 6 days. Tissues (kidneys, liver, spleen) were collected (n = 3-6/group) on d4 (diabetic) and d7 (non-diabetic) post-challenge, homogenized and plated on Sabouraud’s agar to determine fungal burden (CFU/g). Other mice (n = 6-10/gp) were monitored for morbidity to d28. Results: With a C.alb-R infection, AmBi treated, non-diabetic and diabetic mice, had significantly better survival than Flu or D5W treated mice (AmBi 83–100% survival, Flu 0–30% survival, D5W (0-20% survival) (p≤0.01). Significant decreases in CFU/g kidneys were observed with AmBi treatment versus D5W or Flu in diabetic and non-diabetic mice (p≤ 0.04); no fungi were recovered in livers or spleens of AmBi treated mice (p≤ 0.04). In comparison, with C.alb-S infection, AmBi or Flu treated, non-diabetic mice had 100% and 80% survival, respectively, but in diabetic mice, survival was 100% for AmBi and only 16% for Flu even though this was a Flu sensitive strain (P = 0.0021). D5W yielded 0% (non-diabetic) and 14% (diabetic) survival. The fungal burden in the livers and spleens was significantly lower with AmBi treatment versus Flu or D5W, with AmBi treatment reducing the liver and spleen fungal burdens to undetectable levels. In the kidneys, the fungal burden in non-diabetic mice was significantly lower for AmBi versus Flu or D5W, but there was no significant difference in kidney fungal burden in diabetic mice given AmBi or Flu. Conclusion: In non-diabetic mice, AmBi and Flu were effective in treating systemic candidiasis caused by a C. albicans azole sensitive strain, while AmBi was effective in treating non-diabetic and diabetic mice infected with a C. albicans azole sensitive or resistant strain. Notably, in diabetic mice challenged with a C. albicans azole sensitive strain, Flu was associated with poor survival and elevated tissue fungal burden, indicating that the diabetic condition enhanced susceptibility to systemic candidiasis whether it was caused by a C. albicans azole sensitive or resistant strain.

P282 Basidiomycetous yeast biota and dynamics of koala nasal cavity K. Satoh, T. Tamura, M. Maeda, Y. Umeda, K. Makimura Teikyo University, TOKYO, Japan Objective: As cryptococcosis is a fatal disease in koalas (Phascolarctos cinereus), Cryptococcus spp. and related basidiomycetous yeasts are major targets for yeast microbiota analysis in koalas. In the course of a study of the yeast microbiota of koalas, we isolated a number of basidiomycetous yeasts from koalas and the breeding environments in Japanese zoological parks. We published plural new yeast species (ex. Spolobolomyces koalae1 and Cryptococcus yokohamensis2 isolated from koalas. In this study, further new species and the basidiomycetous yeast biota of the koala from previous presentation (ISHAM 2012, Berlin) to 2017 will be reported Methods: Most of the morphological, biochemical, and physiological characteristics were investigated using the methods described by Kurtzman et al. (2011). Nasal smears of several healthy koalas and the breeding environments were collected with swabs and inoculated onto CHROMagar Candida (CHROMagar) spread with micafungin (30 mg per plate). The isolated strains were identified by comparison with DNA sequences registered in GenBank/EMBL/DDBJ as described previously1 . Since 2016, we have checked all colonies using MALDI Biotyper. Results: Over 500 strains of yeast were isolated from nasal smears of koala and the breeding environments. The dominant genus was Cryptococcus (mainly C. neoformans). Rhodotorula was the next most dominant genus by culture methods. Furthermore, new species of Cryptococcus lacticolor sp. nov. and Rhodotorula oligophaga sp. nov. were discovered3 . Conclusion: Genus Cryptococcus was predominance, but a variety of basidiomycetous yeast habitually resided to the nasal cavity of the koala. 1. Satoh K, Makimura K 2008: Int. J. Syst. Evol. Microbiol., 58, 2983–2986. 2. Alshahni MM et al. 2011: Int. J. Syst. Evol. Microbiol., 61, 3068–3071. 3. Satoh K et al. 2013: Antonie van Leeuwenhoek, 104, 83–93.

P283 The genomic tandem quadruplication is associated with ketoconazole resistance of Malassezia pachydermatis. M. Kim1 , M. Park1 , Y. Cho2 , S.Y Hwang3 , W.H Jung1 1 Chung-Ang University, ANSEONG, South Korea 2 Korea Polar Research Institute, INCHEON, South Korea 3 Haemaru Small Animal Research Institute, SUNGNAM, South Korea Objective: Malassezia pachydermatis is a commensal yeast found on the skin of dogs. However, M. pachydermatis is also considered an opportunistic pathogen and is associated with various canine skin diseases including otitis externa and atopic dermatitis, which usually require treatment using an azole antifungal drug such as ketoconazole. In this study, we isolated a ketoconazole resistant M. pachydermatis from the external ear canal of a dog with otitis externa and analyzed its resistance mechanism. Methods: To understand the ketoconazole resistance of the clinical isolate M. pachydermatis KCTC 27587, the whole genome of the yeast was sequenced using the PacBio platform and compared with M. pachydermatis type strain CBS 1879. Results: We found that an ∼84 kb region in chromosome 4 of M. pachydermatis KCTC 27587 was tandemly quadruplicated. The region contains 52 protein coding genes including the homologs of ERG4 and ERG11 whose overexpression is known to be associated with azole resistance. Conclusion: Our data suggest that the quadruplication of the ∼84 kb region may be the cause of the ketoconazole resistance in M. pachydermatis KCTC 27587.

S122

P284 Horizontal gene transfer in the skin fungus Malassezia: NO resistance is mediated by a bacterial flavohemoglobin G. Ianiri Duke university, DURHAM, USA Objective: The skin of humans and animals is colonized by numerous microganisms that comprise the skin microbiome. They mainly include both commensal and pathogenic fungi and bacteria that share the same ecological niche and established intense interactions. Malassezia species are the most abundant fungal skin inhabitant of all warm-blooded animals. Previous genomics studies revealed the presence of genes of bacterial origins in the Malassezia genus likely acquired through horizontal gene transfer, including the flavohemoglobin-encoding gene YHB1. The aims of the present study are to 1) use functional genetics to characterize the role of the bacterial YHB1 gene in Malassezia sympodialis, and 2) identify additional Malassezia species-specific horizontal gene transfer events. Methods: A recently-developed Agrobacterium tumefaciens transconjugation approach was used for targeted deletion of the bacterial YHB1 gene in M. sympodialis, and for the following functional complementation using GFP-tagged proteins. The yhb1 mutant and the complementing strains were subjected to in vitro and in vivo phenotypic characterization. Bioinformatics approaches were carried out to elucidate the evolution and phylogeny of the flavohemoglobin in the whole Malassezia genus, and to identify additional species-specific horizontal gene transfer events. Results: In the present study, using targeted gene deletion and complementation in M. sympodialis, we demonstrated that the bacterial Yhb1 is a cytoplasmic protein required for nitric oxide detoxification and nitrosative stress resistance under aerobic conditions. Moreover, analysis of the available Malassezia genomes identified two different flavohemoglobin-encoding genes (YHB1 and YHB101) present as a single copy in different species, and further analyses revealed that both were acquired through two independent horizontal gene transfer events from different donor bacteria that are part of the mammals’ microbiome. Similar to Yhb1, the flavohemoglobin-encoding gene YHB101 rescues the sensitivity of the M. sympodialis yhb1 deletion mutant to nitrosative stress-inducing agents, and it localizes to the cytoplasm. Both flavohemoglobin-encoding genes are predicted to play a role in the pathogenic interaction of Malassezia with the host. Lastly, additional genus- and species- specific horizontal gene transfer events were identified. Conclusion: In conclusion this study demonstrates that two different Malassezia flavohemoglobins were acquired through independent horizontal gene transfer likely to overcome nitric oxide toxicity and nitrosative stress generated by host cells. Moreover, the presence of several other additional genes acquired through horizontal gene transfer from bacteria suggests that these events shaped Malassezia genomes and may have contributed to its evolutionary trajectory as the main fungal skin inhabitant.

P285 Characteristics of Cryptococcus gattii isolated from mainland China D. I. Shen1 , L. Jin1 , H. Wu2 , L.F. Wang1 , Y. Ma1 1 General Hospital of Chinese PLA, BEIJING, China 2 Hainan General Hospital, HAIKOU, China Objective: To investigate the microbiological characteristics of C.gattii from patients in different parts of mainland China. Methods: Strains initially identified as Cryptococcal spp. were grown on SDA and CGB agar. The isolates with blue pigmentation were identified and analyzed by MALDI-TOF MS (Bruker Biotyper). MLST were carried out by amplifying seven unlinked loci, including six housekeeping genes (CAP59, GPD1, LAC1, PLB1, SOD1, URA5) and one non-coding region gene (IGS1), and then by bi-directional sequencing for each gene, according to the method described by ISHAM Cryptococcal Working Group. Sequences were uploaded to the MLST Database for the Cryptococcus neoformans/C. gattii species complex (http://mlst.mycologylab.org) one by one. Antifungal susceptibility test was carried out by both ATB fungus 3 (bioM´erieux SA, France) and Yeast one (Trek Diagnostic Systems Ltd, UK). Results: Results: 8 out of 254 strains showed blue pigmentation on CGB agar. Although they were identified as C.neoformans by VITEK 2 compact, the 8 strains were identified as C.gattii by MALDI-TOF MS. 6 strains of C. gattii possessed genotype VGI and another 2 strains possessed genotype VGII which were subtyped into VGIIa and VGIIb respectively as shown in table 1. Results of antifungal susceptibility test were listed in table 2. Table 1 Genotype and Allele numbers of 7 loci for 8 C. gattii strains #tropical area; ∗ subtropical area; “temperate area Table 2 Results of antifungal susceptibility test by ATB fungus 3 and Yeast one a: ATB fungus 3; b: Yeast one abbreviations for antifungal drugs: 5-FU: 5-flucytosine; AMB: Amphotericin B; FCA: fluconazole; ITR: Itraconazole; VRC: voriconazole; PSZ: posaconazole Conclusion: C.gattii isolates existed in different parts of mainland China. It is important for clinical laboratory to correctly identify the pathogenic Cryptococcus.

P286 ERG6 and ERG2 are major targets conferring reduced susceptibility to amphotericin B in clinical Candida glabrata isolates Z. Khan1 , S. Ahmad2 , L. Joseph1 , J.E. Parker3 , S.L. Kelly3 , M Asadzadeh1 1 Kuwait University, SAFAT, Kuwait 2 Kuwait University Faculty of Medicine, SAFAT, Kuwait 3 Swansea University Medical School, SWANSEA, United Kingdom Objective: Candida glabrata is among the second or third most commonly isolated yeast species causing candidemia and other invasive infections in critically ill patients. The species is intrinsically less susceptible to azole antifungal drugs and increasing reports of breakthrough infections in patients receiving echinocandins have been described in recent years limiting the choice of antifungal drugs to treat such infections. This study investigated the molecular mechanisms responsible for reduced susceptibility to amphotericin B (RS-AMB) in a collection of amphotericin B-resistant C. glabrata strains isolated from different patients in Kuwait. Methods: Twelve C. glabrata strains with RS-AMB were used. Six amphotericin B susceptible isolates were also analyzed for comparison purposes. Antifungal susceptibility testing was done by Etest and/or by Vitek 2 system. The sequences of three (ERG2, ERG6 and ERG11) genes involved in ergosterol biosynthesis were determined. Sterol content of the isolates was analyzed by gas chromatography-mass spectrometry (GC-MS). Phylogenetic relationship among the isolates was investigated by multilocus sequence typing. Results: None of the six amphotericin B-susceptible isolates contained a resistance conferring mutation in ERG2, ERG6 or ERG11 and the sterol content of two representative isolates was similar to that of the wild-type reference strain (ATCC90030). Among RS-AMB isolates, four isolates contained a nonsynonymous (AGA48AAA, R48K) mutation in ERG6. however, this mutation was also present in three amphotericin B-susceptible isolates. Three isolates contained a nonsense mutation (two isolates at codon Trp286 and one isolate at codon Tyr192), one isolate (Kw105-3/13) contained deletion of a nucleotide (nucleotide 1021) resulting in premature termination due to frame shift at codon Leu341 and two other isolates contained a nonsynonymous (V126F or C198F) mutation in ERG6. The sterol content of these six isolates were consistent with ERG6 deficiency. Two other isolates contained a nonsynonymous (G119S or G122S) mutation and the sterol content of these two isolates were also consistent with ERG2 deficiency. Isolate Kw105-3/13 also contained Y141H + L381M mutations while another isolate contained a nonsense mutation at codon 495 in ERG11. The remaining 10 RS-AMB isolates did not contain any nonsynonymous mutation in ERG11. Multilocus sequence typing data showed that nearly all individual patient isolates and all isolates with ERG6 or ERG2 or ERG11 mutations were genotypically distinct strains. Conclusion: We have identified the molecular basis of decreased susceptibility to amphotericin B among clinical C. glabrata isolates. Our data show that ERG6 and ERG2 are major targets conferring resistance to amphotericin B in eight of 12 isolates. Four isolates involved novel nonsense/deletion mutations in ERG6 that resulted in truncation of the ERG6 protein and consequent changes in the sterol content of the cells. Two other isolates contained a novel nonsynonymous mutation in ERG6 including one isolate with C198F mutation that has been described previously. Interestingly, two other isolates contained nonsynonymous (G119S or G122S) mutations in the same region (Thr121) of ERG2 protein that has previously been shown to be involved in causing reduced susceptibility to amphotericin B and changes in the sterol composition of C. glabrata.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Medical Mycology, 2018, Vol. 56, No. S2

P287 Isolation and identification of phaeoid/dematiaceous fungi from phaeohyphomycosis in a tertiary care hospital in Chandigarh (India) P. Dhawan, N Singla, R Kundu, J Chander Government Medical College Hospital, Chandigarh (India), CHANDIGARH, India Objective: Phaeohyphomycosis refers to infections caused by phaeoid/dematiaceous or darkly pigmented fungi. The colonies are typically brownish to black in color. The clinical spectrum ranges from superficial, cutaneous and subcutaneous infections to life-threatening systemic infections in the form of cerebral abscesses. As awareness is gradually increasing, newer species of phaeoid fungi are being recognized. Hence, the present study is being undertaken to further increase our knowledge about the causative agents and risk factors involved in causing phaeohyphomycosis. This promotes, prompt and specific diagnostic and therapeutic interventions, which may be life-saving for the patients. Methods: This study was conducted on samples received from patients with unresolving infections ranging from superficial infections, subcutaneous cysts, pneumonia, brain abscess and disseminated infection. These samples were collected in two sterile containers containing normal saline and 10% formalin and were processed in the Department of Microbiology and Pathology, respectively. Patients in whom direct microbiological examination or cytology/histopathology was positive showing dark grey, brown or black colored fungi were included in the study irrespective of their age and sex. Fungal culture on Sabouraud’s dextrose agar (SDA) was put up and the growth obtained as dark brown/black colonies with/without black reverse, was examined by lactophenol cotton blue (LCB) mount. Slide culture was put up wherever needed for further identification. Antifungal susceptibility testing was done on the basis of CLSI guidelines using M38-A2. Results: We isolated phaeoid fungi from five cases of phaeohyphomycosis from August 2017 to January 2018. Of these, two were females and three were males. One belonged to pediatric age group and four were adults. Two patients presented with subcutaneous cyst (malleolar swelling), one with splenic abscess, one with right foot abscess and one was a case of right hip septic arthritis with fluid collection around the joint. Direct KOH and growth of phaeoid fungi on SDA was positive in all the cases. Cytology was positive for phaeoid fungi in two cases. We isolated Nigrospora species, Curvularia species, Exophiala species and Exserohilum species from these cases. The phaeoid fungus from the fifth case is yet to be identified. Surgical removal of the lesions was done in all cases. There was significant improvement after surgical removal in four cases, hence the clinician decided not to start antifungals. However, in the fifth case, the lesion recurred after one week hence the patient was started on oral fluconazole 150 mg OD for seven days and is currently on follow up. Conclusion: Black fungi are no longer viewed as neglected, rare or exotic fungi. We now realize that they are all around us. Dematiaceous fungi are particularly significant because they cause infections which range from mild cutaneous infections to fatal brain disease. In developing countries, phaeohyphomycosis is often confused with other diseases with similar presentations like tuberculosis and cancer. This study has created more awareness about this disease at the clinician, pathologist and microbiologist level. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 416310 9e61424d-690e-42a3-9b060a26f7f14e2f.png Caption 1: Isolation and identification of phaeoid/dematiaceous fungi from phaeohyphomycosis in a tertiary care hospital in Chandigarh (India)

P288 Characterization of gamma-glutamyl transpeptidase and urease of paracoccidioides brasiliensis during nitrogen starvation ´ L.O.S. Silva, V.R.M. Cruz-Leite, L.D.C. Sudario, M.V. Tomazett, J.A. Parente-Rocha, J.D. Paccez, C.M.A. Soares, C.L. Borges ˆ ´ GOIANIA, Universidade Federal de Goias, Brazil Objective: This study aims to evaluate the role of nitrogen in Paracoccidioides brasiliensis (Pb18) pathogenesis through characterization of two proteins, gamma-glutamyl transpeptidase and urease, that are related to nitrogen metabolism regulation in pathogenic fungi. We will perform the characterization by heterologous expression in Escherichia coli system and by gene silencing using antisense RNA technology. Methods: In order to perform the heterologous expression, the gene coding for Gamma-glutamyl transpeptidase (ggt) and Urease (ure) were obtained by PCR, cloned in pET32a expression vector and transformed into E. coli pLysS cells. Protein expression was optimized using different concentrations of IPTG and it was used for production of polyclonal antibodies. Furthermore, enzymatic assays were performed. For gene silencing, antisense sequences from ggt and ure were amplified by PCR, subcloned into pCR35, then cloned into pUR5750, transformed in Agrobacterium tumefaciens LB1100 by electroporation and co-cultivated with Paracoccidioides brasiliensis. Results: The optimal concentration for production of soluble Ggt was with 0.05 mM of IPTG for 1 hour. We observed the formation of inclusion bodies during urease induction and we are testing other protocols to produce the protein in its soluble form. Furthermore, analysis using enzymatic assays indicate that the recombinant proteins produced are catalytically active. The antisense mutant Pbggt-aRNA remained stable after successive growth in the presence of hygromycin, demonstrating that the transformation was well succeeded. Pbure-aRNA construction, as well as the functional studies, are under progress. Conclusion: Ggt and Ure proteins were successfully expressed in bacterial heterologous system and demonstrated to be biologically active. Functional analysis of heterologous proteins will still be performed, as well as the application of in vivo model for mutants validation. In conclusion, characterization of Ggt and Ure may help to elucidate their roles during nitrogen starvation, contributing to the elucidation of their roles in the host-pathogen relationship, biology and virulence in Paracoccidioides.

P289 Molecular modeling of HSP90 and small molecules identification for drug development against paracoccidiodomycosis A. K.R. Abadio1 , E.S. Kioshima2 , P.A. Silva3 , A.M. Nicola3 , B. Maigret4 , M.S.S. Felipe3 University of Mato Grosso State, NOVA XAVANTINA, Brazil 2 ´ Brazil ´ MARINGA, State University of Maringa, 3 University of Bras´ılia, BRAS´ILIA, Brazil 4 Lorraine University, NANCY, Brazil 1

Objective: In order to develop new antifungal drugs against Paracoccidioides lutzii, a fungus that causes the endemic systemic mycosis named Paracoccidioidomycosis, the objective of this work was to evaluate the drug target HSP90 (heat shock protein of 90 kDa), including the homology modeling of the N-terminus domain of P. lutzii HSP90 protein, the molecular dynamics simulations to obtain the model with stability, the virtual screening in chemical libraries for select the main small molecules that interact with HSP90 model and the in vitro activity antifungal assays with the molecules selected after virtual screening. Methods: The 3D model of P. lutzii HSP90 was constructed by homology modeling based on known structures with high percentage of identity in amino acid sequences. The known template structures were searched in the Protein Data Bank (PDB). The amino acid residues sequence of P. lutzii HSP90 was compared with the primary sequences of the structures deposited in PDB using the BLAST program. The 3D model of P. lutzii HSP90 was constructed using the Insight II software package (Biosym/MSI, San Diego, Accelrys Inc. 2001). The NAMD program version 2.6 was employed in conjunction with the CHARMM22 force field to performer the molecular dynamics simulations in order to gain a better relaxation and a more correct arrangement. For virtual screening simulations, a bank of commercially available compounds from Life Chemicals database was docked with the stable model using GOLD program. In vitro activity antifungal assays were performed with the molecules selected after virtual screening using the broth microdilution methods developed by the Clinical and Laboratory Standards Institute. Results: In the absence of structures solved experimentally, the available homology modeling tools were extremely useful for the structural prediction of the HSP90 protein of P. lutzii. The 3D model of N-terminus domain of P. lutzii HSP90 protein was obtained and the molecular dynamics simulations revealed that the evolution of the system is very stable. The folding stability of the model during the simulations was checked by monitoring secondary structure conservation over simulation time. With the model stable, virtual screening was performed and allowed to select 20 molecules that interact with the target. These molecules were synthesized for validation and in vitro activity antifungal assays for Paracoccidioides brasiliensis and P. lutzii. From 20 molecules tested, one of them (MOL90) showed antifungal activity in vitro against the fungi. Conclusion: The incidence and severity of systemic infections caused by fungi have increased around the world. This work allowed the identification of a new antifungal compound against fungi that causes paracoccidioidomycosis. This offered new perspectives on technological development and innovation of antifungal agents to human pathogens.

ABSTRACT

S123

P290 Increasing growth rate of Verruconis gallopava, could it be one of the factors supporting its pathogenicity in warm blooded-animals?

P293 Towards understanding the molecular link between cell cycle regulation and hypoxic adaptation in Cryptococcus neoformans

Kittipan Samerpitak1 , A.H.G Gerrits Van Den Ende2 , Sybren G. De Hoog2 1 Faculty of Medicine, Khon Kaen University, KHON KAEN, Thailand 2 Westerdijk Fungal Biodiversity Institute, UTRECHT, Netherlands

SUSUMU Kawamoto1 ,2 , ZUZANA Moranova3 , ERIC Virtudazo1 , MISAKO Ohkusu1 , AKIKO Suganami4 , YUTAKA Tamura4 , VLADISLAV Raclavsky3 1 Medical Mycology Research Center, Chiba University, CHIBA, Japan , Japan 3 Palacky University, Faculty of Medicine and Dentistry, OLOMOUC, Czech Republic 4 Graduate School of Medicine, Chiba University, CHIBA, Japan

Objective: To investigate the growth rate behaviors of V. gallopava in varied temperatures. Methods: Nineteen strains of V. gallopava were grew on malt extract agar (MEA) plates (90 mm in diam.) and incubated at 24◦ C, 14 d, for preparation of the circular inocula (2 mm in diam.) by using a metallic puncture tube. The inocula were, then, grew in duplicate on MEA plates and incubated for 3 wk at the temperatures varied from 4 to 40◦ C with mostly 3◦ Cinterval. Colony diameters were measured after 3, 7, 11, 14, 18, and 21 days. The growth rates in all investigated temperatures were calculated and compared by Microsoft Excel and T-test. Results: The growth of all investigated strains of V. gallopava could not be observed at the temperatures lower than 15◦ C. The growth of colonies were significantly increased dependent to increasing the 3◦ C interval from 18◦ C to 37◦ C, (t ≥ tα 0.05 ), no significant difference was detected between 9◦ C to 15◦ C, and 37◦ C to 40◦ C, (t = tα 0.05 ). The lowest growth rate was 0.01 mm/day at 15◦ C, and the highest was 6.20 mm/day at 37◦ C, and the average growth rate comparing to time and temperature was 0.28 mm/day/◦ C. The differences of the growth rates compared between the low temperatures viz.15◦ C, 18◦ C, 21◦ C, 24◦ C, 27◦ C, 30◦ C, 33◦ C and the higher temperatures were in average numbers of 354.2X, 21.1X, 6.9X, 2.9X. 1.7X, 1.4X and 1.1X, respectively (X = times). Conclusion: According to the present study, growth ability of V. gallopava would show at ≥ 15◦ C, the growth rate was dependent to both time and temperature, and the average was 0.28 mm/ day/◦ C. The optimal temperature should be between 37◦ C to 40◦ C. The growth rate profile of the species could lead to hypothesize its growth and pathogenic behaviors as following; 1) The species could thrive in general environment with temperature ranging from 15◦ C to 40◦ C. 2) The species could grow faster in natural hot environments and also inside the bodies of warm-blooded animals. 3) The different temperature between the strain’s niche and body of warm-blooded animal could accelerate the strain’s growth rate and enhance animal tissue invasion leading to finally successful infection. However, these hypotheses should have to be further investigated.

P291 Species identification and delineation of pathogenic Mucorales by matrix-assisted laser desorption ionization-time-offlight mass spectrometry J. Yu, J. Shao, Z. Wan, R. Li Peking University First Hospital, BEIJING, China Objective: This study aimed to validate the effectiveness of matrix-assisted laser desorption ionization-time-of-flight mass spectrometry (MALDI-TOF MS)-based identification of filamentous fungi of the order Mucorales. Methods: A total of 111 clinical strains covering 6 genera preserved at the Research Center for Medical Mycology of Peking University were selected for MALDI-TOF MS analysis. We emphasized the study of 23 strains of Mucor irregularis predominantly isolated from patients in China. We first used the Bruker Filamentous Fungi library v1.0 to identify all 111 isolates. To increase the identification rate, we created a compensatory in-house database, the Beijing Medical University (BMU) database, using 13 reference strains covering 6 species, including M. irregularis, Mucor hiemalis, Mucor racemosus, Cunninghamella bertholletiae, Cunninghamella phaeospora and Cunninghamella echinulata. All 111 isolates were then identified by MALDI-TOF MS using a combination of the Bruker library and BMU database. We also compared phylogenetic trees based on ITS sequence of Rhizopus spp. and Mucor spp. with the MSP dendrograms based on MALDI-TOF MS analysis. Results: MALDI-TOF MS identified 55 (49.5%) and 74 (66.7%) isolates at the species and genus levels, respectively, using the Bruker Filamentous Fungi library v1.0 alone. A combination of the Bruker library and BMU database allowed MALDI-TOF MS to identify 90 (81.1%) and 111 (100%) isolates at the species and genus levels, respectively, with a significantly increased accuracy rate. None of the 23 clinical strains of M. irregularis were reliably identified using only the Bruker library, whereas all isolates were correctly identified at the species level after the Bruker library and BMU database were combined. Phylogeny based on the internal transcribed spacer (ITS) sequences of Rhizopus spp. and Mucor spp. agreed well with main spectrum profile (MSP) dendrograms. Conclusion: MALDI-TOF MS poorly identified Mucorales when the Bruker library was used alone due to its lack of some fungal species. In contrast, this technique perfectly identified M. irregularis after MSPs of relevant reference strains were added to the Bruker library. With an expanded Bruker library, MALDI-TOF MS is an effective tool for the identification of pathogenic Mucorales. Additionally, MSP dendrograms based on MALDI-TOF MS analysis were excellent for species discrimination. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 416718 112e40c5-2e9e-455f-aa5a8c289c20c101.1 .jpg Caption 1: Identification of 111 clinical isolates by the Bruker library and the Bruker library plus BMU database Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 416718 112e40c5-2e9e-455f-aa5a8c289c20c101.jpg Caption 2: Cluster analysis based on the main MSPs of all 111 isolates

Objective: The objective of this study is to understand cell cycle regulation and hpoxic adaptation in the pathogenic yeast Cryptococcus neoformans and the molecular link between them. Methods: We performed in silico simulations and analyses using GENETYX software (version 15). Results: We have reported that the cell cycle behavior of the pathogenic yeast Cryptococcus neoformans (C. neoformans) is different from the cell cycle control exhibited by the model yeast Saccharomyces cerevisiae (S. cerevisiae), and also have reported the molecular characterization and physiological roles of the two main eukaryotic cell cycle genes, C. neoformans cyclin dependent kinase 1 (CnCdk1) and cyclin homologues. Only a single Cdk1-related G1 and G1/S cyclin homologue was found in the genome sequence of C. neoformans and was designated CnCln1. Surprisingly, CnCln1 was not only able to complement the function of the G1 cyclins of S. cerevisiae, such as ScCln3, but also the G1/S cyclins of S. cerevisiae, such as ScCln1 and ScCln2. Our in silico analysis demonstrated that the CnCln1/ScCdk1 complex was more stable than any of S. cerevisiae cyclins (ScCln1, ScCln2, ScCln3) and ScCdk1 complexes. These results are consistent with in vitro analysis that has revealed the flexible functional capacity of CnCln1 as a Cdk1-related G1 and G1/S cyclin of S. cerevisiae. On the other hand, in S. cerevisiae, Cln1 and Cln2, G1/S cyclins of S. cerevisiae, oscillate during the cell cycle, rising in late G1 and falling in early S phase. We have been trying to elucidate the structure basis of the functional distinction between Cln1 and Cln2. We investigated the cell cycle control mechanism between Cln1 and Cln2 from a point of view of their structure-function relationships in S. cerevisiae. In the obligate aerobic pathogenic yeast C. neoformans, limited aeration has been demonstrated to cause slowdown in proliferation and delayed budding, resulting eventually in a unique unbudded G2-arrest. The ability to adapt to decreased oxygen levels during pathogenesis has been identified as a virulence factor in C. neoformans. We have identified and characterized the gene that is necessary for the proliferation slowdown and G2-arrest caused by limited aeration. This gene was also identified in a parallel studies as homologous both to calcineurin responsive (Crz1) and PKC1-dependent (SP1-like) transcription factors. We have confirmed the role of the cryptococcal homologue of CRZ1/SP1-like transcription factor in cell integrity, and newly demonstrated its role in slowdown of proliferation and survival under reduced aeration, in biofilm formation and in susceptibility to fluconazole. Our data also demonstrate a tight molecular link between slowdown of proliferation during hypoxic adaptation and maintenance of cell integrity in C. neoformans and present a role for the CRZ1 family of transcription factors in fungi. Conclusion: Our study revealed the flexible functional capacity of CnCl1 (only a single cyclin in C. neoformans) as a Cdk1related G1 and G1/S cyclin (ScCln1, ScCln2, and ScCln3) of S. cerevisiae, and also demonstrate a tight molecular link between cell cycle regulation and hypoxic adaptation in C. neoformans.

P294 Biofilm formation by Pseudallescheria/Scedosporium complex: a comparison study R. Rollin-Pinheiro, JV Meirelles, Tvm Vila, BB Fonseca, V Alves, S Frases, S Rozental, E Barreto-Bergter Universidade Federal do Rio de Janeiro, RIO DE JANEIRO, Brazil Objective: This study aimed to report the ability of nine different strains from Pseudallescheria/Scedosporium complex to form biofilm structures and the influence of fungal growth and biofilm formation in virulence and susceptibility to antifungals. Methods: To evaluate biofilm formation, staining techniques were used, such as violet crystal, concanavalin A, calcofluor white and XTT-reduction assay. Also, confocal and scanning electron microscopy was performed to analyze biofilm structures. Galleria mellonella model of infection was performed for virulence analysis, and susceptibility assay was realized to test antifungal resistance. Results: It was observed that all strains from Scedosporium aurantiacum formed biofilms faster than Pseudallescheria species, indicating that it could be a reason why S. aurantiacum emerges as more virulent species from the complex. In addition, the clinical strains presented a more robust biofilm and more virulence in G. mellonella model comparing to environmental strains, suggesting that biofilms could be an important structure for Pseudallescheria/Scedosporium pathogenesis. Moreover, biofilms displayed significantly more resistance to different antifungal agents than planktonic cells. Conclusion: Growth speed and biofilm formation are related to fungal virulence and susceptibility to antifungal drugs. Also, clinical isolates tend to grow faster and form a more robust biofilm than the environmental strains. We believe that this study helps the understanding of pseudallescheriosis/scedosporiosis and opens a new field of researches for this fungal complex.

P292 Antibiofilm effects of human neutrophils in combination with amphotericin B formulations or voriconazole against Scedosporium apiospermum

P295 Molecular Study of L-Rhamnose Synthesis in Sporothrix schenckii and its Role in the Interaction with the Immune Innate System

A. Vikelouda1 , M Simitsopoulou1 , C Antachopoulos1 , L Skoura1 , A Chatzimoschou1 , I Stamouli1 , T.J. Walsh2 , E Roilides1 1 Aristotle University of Thessaloniki, THESSALONIKI, Greece 2 Cornell University, NEW YORK, USA

A. K. Tamez-Castrellon, L.A. Lopez-Ramirez, H.M. Mora-Montes Universidad de Guanajuato, GUANAJUATO, Mexico

Objective: Scedosporium apiospermum can cause a wide range of invasive mycoses and is the second most frequent filamentous fungus found in cystic fibrosis. Scedosporium spp can grow in biofilms on lung epithelial tissue. Biofilms are resistant to innate mechanisms of defense. We assessed the antifungal activity of human polymorphonuclear neutrophils(PMN) against S.apiospermum planktonic cells(PL) and biofilms(BF) alone or in combination with deoxycholate amphotericin-B(D-AMB), liposomal amphotericinB(LAMB) and voriconazole(VRC). Methods: 105 cfu/ml of a S. apiospermum BF-producing strain isolated from bronchial secretions were incubated in RPMI at 37◦ C for 48 h. PMN were isolated from healthy volunteers. BF and PL (2 × 105 cfu/ml) were incubated with PMN at effector-totarget ratios 5:1 or 2:1 alone or in combination with D-AMB, L-AMB or VRC at 37oC/5%CO2 for 24 h. Specific concentrations/drug were used: D-AMB-PL:0.03/0.25/1 mg/l, D-AMB-BF:0.125/1/16 mg/l, L-AMB-PL:0.06/0.5/2 mg/l, L-AMB-BF:0.25/1/16 mg/l, VRCPL:0.015/0.125 mg/l, VRC-BF:0.5/32 mg/ml. Antifungal activity was assessed by XTT reduction assay of metabolic activity. MIC50 was determined as ≥50%BF damage. The % damage of the PMN+drug treatment was compared to that of PMN or drug alone by ANOVA (n = 8, P < P < 0.05). Synergism(SYN) was defined as significantly greater damage by the combination than by PMN plus drug alone. Additivity(ADD) was defined as significantly greater damage by the combination than by either PMNs or drug alone. Results: D-AMB, L-AMB and VRC MIC50 were 0.25, 0.5, 0.125 mg/l for PL and 1, 2, 32 mg/l for BF, respectively. PMNmediated damage was greater against PL (55.0 ± 5%) than BF (12±2%; P < 0.05). An additive effect was observed between all combined treatments and either one of the other two components against PL: D-AMB+PMN:58.5±4%-74±5% vs D-AMB:4±11%42±6.5%; L-AMB+PMN:55±2%-67.4±6% vs L-AMB:2±8%-24±7%; VRC+PMN:66±5%-82±4.6% vs VRC:11±10%50±5.5% or PMN: 55.02±5%; P < 0.01). In contrast, additivity against BF damage was found for selective combinational treatments with L-AMB and VRC: L-AMB 0.25 mg/l+PMN:15±3.5% vs L-AMB:5.5±7% and VRC32mg/l+PMN:69.5±3% vs VRC:61±4% or PMN:12±2%. Synergism against BF damage was demonstrated between the combined treatment of D-AMB 0.125 mg/l+PMN:31±5% vs D-AMB:5±8.5% or PMN:12±2%. Conclusion: BF of S.apiospermum are more resistant to VRC than D-AMB or L-AMB. The combined treatment of PMN with D-AMB or L-AMB shows synergistic or additive activities at low concentrations compared to VRC against BF, having potential implications in clinical practice.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Objective: To elucidate the role of L-Rhamnose of the peptidorhamnomannan present in the cell wall of S. schenckii on the interaction with the host immune system. To achieve this, we have three particular objectives: to silence the S. schenckii rmlD gene, to characterize the rmlD mutants and to determine the interaction of the S. schenckii mutant cells with the host. Methods: To silence the rmlD gene we generated the construction in the p-Silent vector, this vector was transferred to a plasmid derived from p-Cambia to use it in the Agrobacterium tumefaciens mediated transformation of S. schenckii. To corroborate the silencing of the gene, a Real-Time PCR was performed to assess the degree of rmlD expression in the transformants. Once we corroborated the mutant phenotype, the strains were subjected to a characterization of the cell wall by HPAEC to determine the carbohydrate contents, binding to several dyes to assess the cell wall organization and growth curves were generated to estimate the growth rate. In addition, a heterologous expression of rmlD gene was carried out in a mutant of Streptococcus mutans lacking this gene. Finally, we will make the interaction assays with human PMNCs to assess the ability to induce pro-inflammatory cytokines and larvae of Galleria mellonella will be used to establish the virulence of these mutant strains. Results: The ATMT used in our work group was proved to be an efficient transformation method to use in members of the Sporothrix complex. Using this transformation method, we have obtained six transformants with the silencing construction for rmlD gene corroborated by PCR. The results of the Real-Time PCR showed a clear reduction in the expression levels of the gene in at least two transformants. The heterologous expression of the rmlD gene in a mutant of S. mutans that lacks this gene showed that S. schenckii rmlD gene is indeed involved in the last step of L-Rhamnose synthesis, restoring the mutant phenotype to the wild-type levels. Conclusion: It is known that the peptidorhamnomannan present in the cell wall of S. schenckii is recognized by IgG and cellular receptors from the host. To elucidate whether the L-Rhamnose is a PAMP and its role in fungal virulence, we silenced the rmlD gene of S. schenckii. The RmlD protein is involved in the last step of the L-Rhamnose synthesis. Further work to characterize the mutants is ongoing.

S124

Medical Mycology, 2018, Vol. 56, No. S2

P296 A monothiol glutaredoxin is required for iron homeostasis and virulence in the AIDS-associated pathogen Cryptococcus neoformans

P299 Scanning electron microscopic study of invasion process of T. mentagrophytes into human nail using in vitro tinea unguium model

GUANGGAN Hu1 , RODGOUN Attarian1 , EUNSOO Do2 , DANIEL Croll3 , MELISSA Caza1 , HORACIO Bach1 , TRICIA A. Missall4 , JENNIFER Lodge5 , WON HEE Jung2 , JAMES W. Kronstad1 1 University of British Columbia, VANCOUVER, Canada 2 Chung-Ang University, ANSEONG, South Korea 3 ˆ ˆ University of Neuchatel, NEUCHATEL, Switzerland 4 Saint Louis University School of Medicine, ST. LOUIS, USA 5 Washington University School of Medicine, ST. LOUIS, USA

Yayoi Nishiyama, TSUYOSHI Yamada, S. Abe Teikyo University Institute of Medical Mycology, HACHIOJI, Japan

Objective: The acquisition of iron and the maintenance of iron homeostasis are important aspects of the virulence the pathogenic fungus Cryptococcus neoformans. Monothiol glutaredoxins are important regulators of iron homeostasis because of their conserved roles in Fe-S cluster assembly and sensing. In this study, we examined the role of the monothiol glutaredoxin Grx4 as an iron sensor and as a binding partner of Cir1, the master regulator of iron-responsive genes and virulence factor elaboration in C. neoformans. Methods: We employed yeast two hybrid analysis and protein-protein interaction assays with Grx4 and Cir1 produced in bacteria to confirm that Grx4 binds Cir1. We also constructed Grx4-mCherry and Cir1-GFP fusion proteins to characterize the subcellular locations of the proteins in response to iron deprivation and repletion. In addition, we made use of a deletion mutant lacking Grx4 and a complemented strain to determine the contributions of Grx4 to virulence-related phenotypes. Results: We demonstrated that iron repletion promotes the re-localization of Grx4 from the nucleus to the cytoplasm, and that this process is inhibited by the proteasome inhibitor bortezomib. Under low iron conditions, Cir1 appeared to be required for the nuclear localization of Grx4, and Grx4 influenced the abundance of Cir1. Cir1 remains in nuclei in both iron repletion and iron limiting conditions. Additionally, a grx4 mutant displayed iron-related phenotypes similar to those of a cir1 mutant, including sensitivity to high iron levels and increased susceptibility to the iron-dependent antibiotic phleomycin. Importantly we found that a grx4 mutant was avirulent in a mouse model of infection, and this was consistent with our observations that the mutant is defective in the production of the key virulence determinants, capsule and melanin, and that the mutant grows poorly in the iron-depleted conditions and at 37◦ C. A comparative transcriptome analysis of a grx4 mutant and the WT strain H99 in low iron and iron-replete conditions confirmed a central role for Grx4 in iron homeostasis and illustrated shared and distinct regulatory targets with Cir1. Predictions from the transcriptome analysis about the functional impact of Grx4 were confirmed by the identification of phenotypes related to oxidative stress and mitochondrial function. Conclusion: Overall, the phenotypes of the grx4 mutant and the RNA-Seq analysis support the hypothesis that Grx4 functions as a sensor of iron levels in partnership with Cir1 to regulate iron uptake functions and virulence.

P297 Inhibition of Pdr5p-like ABC transporter increases azoles activity against Sporothrix spp. Luana P. Borba-Santos1 , Leandro F Reis de Sa´ 1 , Juliene A Ramos2 , Antonio Ferreira-Pereira1 , Sonia Rozental1 1 Universidade Federal do Rio de Janeiro, RIO DE JANEIRO, Brazil 2 ˜ Ciencia ˆ Instituto Federal de Educac¸ao, e Tecnologia, RIO DE JANEIRO, Brazil Objective: Efflux pumps present in the fungal plasma membrane are able to carry antifungal drugs outside to the cell, decreasing their activity. Among these proteins, the ABC (“ATP-binding cassette”) transporters of the PDR subfamily stand out and different pathogenic fungi exhibited homologous proteins to Pdr5p (the most studied efflux pump of Saccharomyces cerevisiae) that are related to azole resistance. Inhibition of Pdr5p-like proteins by tacrolimus is able to enhance the antifungal activity of azole against different fungi. Thus, the main objective of our study was to evaluate the effect of tacrolimus combined with itraconazole or fluconazole against yeasts of Sporothrix brasiliensis and Sporothrix schenckii, and correlate their activity to the expression of a Pdr5p-like ABC transporter. Methods: Yeasts of S. brasiliensis and S. schenckii were incubated with sub-inhibitory concentration of tacrolimus (0.5 μg/ml) and crescent concentrations of itraconazol (0.01 to 0.25 μg/ml) or fluconazole (1 to 16 μg/ml). After 48 h, yeast growth was quantified by spectrophotometric readings. To search homologues of Pdr5p in S. brasiliensis and S. schenckii genome, the BLASTp were performed at NCBI using default parameters. We found that amino acid sequence of CDR4 gene of Sporothrix spp. share high similarity with ABC transporters of PDR subfamily. Then, the CDR4 specific primer pairs were designed and used for quantitative real-time RT-PCR assay. Additionally, the expression of Cdr4 in plasma membrane was also evaluated by western blotting. Plasma membranes isolated from two Saccharomyces cerevisiae mutants (strain that overexpression Pdr5p efflux pump and strain that Pdr5p transporter was deleted) were used as controls. Results: Sporothrix brasiliensis yeasts were slightly more susceptible than S. schenckii to itraconazole or fluconazole in monotherapy (Fig. 1A and B). Tacrolimus potentiate the inhibitory effect of azoles mainly against S. schenckii, that showed higher inhibition of growth than S. brasiliensis (Fig. 1A and B). The transcriptional levels of the Pdr5p-like ABC transporter CDR4 were determine and demonstrated that S. brasiliensis showed lower levels of mRNA than S. schenckii (Fig. 1C). S. brasiliensis also exhibited smaller amounts of this protein in its plasma membrane than S. schenckii (Fig. 1D). Conclusion: The susceptibility of S. brasiliensis and S. schenckii for itraconazole and fluconazole could be, in part, related to the expression of a Pdr5p-like ABC transporter, possible the Cdr4, and its inhibition by tacrolimus enhanced the inhibitory effect of azoles. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 417861 5adcbafb-8880-4c2f-a83a71385f93779b.jpg Caption 1: Fig.1

P298 Regulation of innate IL-17 response to Candia albicans in the oral mucosa F. Sparber1 , S. Mertens1 , P. Stoitzner2 , B. Clausen3 , R. Tussiwand4 , S. LeibundGut-Landmann1 1 University of Zurich, ZURICH, Switzerland 2 Medical University Innsbruck, INNSBRUCK, Austria 3 Johannes Gutenberg University Mainz, MAINZ, Germany 4 University of Basel, BASLE, Switzerland Objective: The opportunistic fungal pathogen Candida albicans frequently causes diseases such as oropharyngeal candidiasis (OPC) in immunocompromised individuals. Although it is well appreciated that the cytokine interleukin 17 (IL-17) is crucial for protective immunity against OPC, the cellular source and the regulation of this cytokine during infection are still a matter of debate. Here, we aimed at identifying the cell types that produce IL-17 at the onset of infection, before adaptive immunity is activated, and to decipher how this innate response is regulated. Methods: We used intracellular cytokine staining and flow cytometry to dissect at a single cell level the cytokine-producing lymphoid and myeloid subsets in the infected tissue of mice that were sublingually infected with C. albicans strain SC5314. Results: For the first time, we directly visualized IL-17 production in the tongue of experimentally infected mice, thereby demonstrating that this key cytokine is expressed by three complementary subsets of CD90+ leukocytes: RAG-dependent αβ and γ δ T cells, as well as RAG-independent ILCs. The presence/existence of these 3 functionally redundant lymphocytes renders the protective IL-17 response against C. albicans highly robust. IL-23, IL-1 and IL-6 contribute in a partially non-redundant manner to the production of IL-17. A careful characterization of the myeloid cell compartment in the murine tongue revealed that the three IL-17-instructive cytokines were provided by multiple overlapping cellular subsets in the infected tongue comprising tissue-resident Zbtb46+ Langerin+ and Zbtb46− Langerin− mononuclear phagocytes as well as infiltrating Ly6G+ CD11b+ neutrophils. Conclusion: Our work identified three distinct sources of innate IL-17 induction and revealed that complementary myeloid subsets cooperate for orchestrating the induction of innate IL-17-dependent antifungal immunity in the oral mucosa via IL-23, IL-1β and IL-6.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Objective: Tinea unguium is an intractable dermatomycosis caused by invasion of dermatophytes into the nail tissues. However, there are many unclear points about the infection mechanism of dermatophytes into human nail. In order to clarify the infection process morphologically, we prepared an in vitro tinea unguium model with human nail pieces on an agar plates and the state of invasion of fungus into the tissue of the nail was observed using scanning electron microscope (SEM). Methods: T. mentagrophytes TIMM2789 was grown on 1/10 until Sabouraud dextrose agar slants at 28 C for 2–3 weeks until conidia were fully mature. Conidia were collected and suspended in saline and adjusted to 2 × 10 8 conidia /ml. The conidia (final concentration of 106 /ml) were then add to no nutrient agar plate composed of 1% agarose, 0.2% K2 HPO4 , 0.005% MgSO4, and 0.005 CaCl2 . Sterilized nail fragment, about 1 × 2 mm in area for healthy human finger-nails or toe-nails were put on the agar plate and cultured at 28 C. After 1 to 4 days, the nail on agar plates was prepared for SEM samples then it was observed by FE-SEM at 1 kV. Results: Healthy human nail surface used for the experiment consisted of a scaly layer plate and a narrow gap, and the back side (nail bed surface) was a rough layer board and a deep groove with a scaly like structure uniformly arranged. In the in vitro tinea unguium model, hyphae germinated in the agar medium adhere to the surface of nail bed, subsequently the extended hyphae cover the surface of nail bed. Some hyphae enter into the inside of the nail from the gap of the nail bed surface. On the other hand, hyphae that crawl up from the marginal part of the nail to the nail surface will further extend the hyphae, and some hyphae invade into the nail from the nail gap. After 3 days, elongated hyphae covered the entire nail plate surface. In addition, a part of the hyphae invaded into the inside the nail tissue from the gap of the nail surface layer. Thus, the model experiments we developed, it was possible to clarify infection process of T. mentagrophytes in to nail tissue. Conclusion: The in vitro tinea unguium model developed by us is thought to be useful for fundamental research such as analysis of infection mechanism, treatment, and development of new antifungal drugs for onychomycosis.

P300 A Novel Mechanism of Voriconazole-Resistance in Aspergillus flavus Yuuta Ukai1 , Miho Kuroiwa2 , Naoko Kurihara2 , Hiroki Naruse2 , Tomoyuki Homma2 , Hideki Maki2 , Akira Naito2 1 SHONOGI, TOYONAKA, Japan 2 SHIONOGI, TOYONAKA, Japan Objective: Aspergillus flavus is the second most common pathogen causing invasive aspergillosis after A. fumigatus. In the tropical and sub-tropical regions of Asia, sino-orbital or cerebral aspergillosis due to invasive Aspergillus sinusitis are emerging diseases and A. flavus is the predominant pathogen in these infections. In invasive aspergillosis, long-term treatment with azole drugs may cause the emergence of azole-resistant A. fumigatus and acquired azole-resistant mechanisms in A. fumigatus have been well studied. On the other hand, most of azole-resistant risks and mechanisms in A. flavus remain to be elucidated. Here, we investigate the risk of acquiring azole-resistance in A. flavus due to long-term exposure to azole drugs in vitro, and the mechanism of azole-resistance in an isolated azole-resistant mutant. Methods: Serial passage cultures (7 days per culture) of A. flavus ATCC204304 conidia were performed under exposure to itraconazole or voriconazole in RPMI-agar medium. The MIC was determined by the broth microdilution method according to the CLSI M38-A2 standard. Whole genome sequencing analysis was performed on the Illumina MiSeq platform and CLC Genomics Workbench. Homologous gene replacement studies were performed with A. flavus A1421. Gene expression levels were determined using RT-qPCR. Results: A mutant with reduced susceptibility to voriconazole with MIC of 16 μg/mL was isolated from the fifth passage culture of A. flavus ATCC204304 in the presence of voriconazole, whereas the MIC of itraconazole was 0.5 μg/mL. This voriconazoleresistant mutant did not have any mutation in the cyp51A gene and its promoter region. Interestingly, we found a mutation in yap1, encoding a bZIP transcription factor well-known as the master regulator of oxidative stress responses, which caused Leu558Trp substitution in the carboxy-terminal cysteine-rich domain of Yap1. This mutation was confirmed to be responsible for the voriconazole-resistant phenotype but not for itraconazole by homologous gene replacement studies. Furthermore, we evaluated transcriptional levels of genes which have putative Yap1 response elements in promoter regions, and the expression levels of atrF, dsba, gst and cyp51A in the yap1 mutant were 62-, 27-, 15- and 4.7-fold higher compared to the parental strain, respectively. Notably, we focused on the marked upregulation of the atrF, encoding an ABC efflux transporter, and then the deletion of atrF in the yap1 mutant almost restored the susceptibility to voriconazole. Conclusion: To the best of our knowledge, this is the first report about a yap1 point mutation and subsequent marked atrF-upregulation causing voriconazole-resistance in A. flavus. These findings provide new insights into azole-resistant mechanisms independent of the cyp51 genes mutations in A. flavus.

P301 Hydrosol prepared from Rosa damascena is a candidate for therapeutic agents against superficial candidiasis Naho Maruyama1 , Shigeru Tansho-Nagakawa2 , Miki Takahashi3 , Chizuru Miyazaki2 , Kazuyuki Shimomura4 , Naoki Shimazaki4 , Yasuo Ono2 , S. Abe3 1 Teikyo Heisei University, TOKYO, Japan 2 Teikyo University School of Medicine, TOKYO, Japan 3 Teikyo University Institute of Medical Mycology, TOKYO, Japan 4 Teikyo University, TOKYO, Japan Objective: Hydrosols, also known as herbal water, floral water, and hydrolate, are aqueous products co-produced during the steam distillation of various plant materials. Hydrosol obtained from the flowers of Rosa damascena (rose water) has pleasant scent and is one of the most popular of these products. It has been traditionally used as skin or mucous conditioners with beneficial activity against troubles such as erythema, itchiness and swelling. One of the causes of these skin or mucous troubles is microbial infection. Among them, superficial candidiasis is a widespread fungal infection, mainly caused by Candida albicans. The treatment for infectious conditions usually focuses on antimicrobial effects. However, inflammatory symptoms accompanying infection are serious under clinical conditions and therefore suppression of inflammation is also very important. Although there are anecdotal evidences regarding the efficacy of rose water, there have been few experimental studies to examine its activities. Here, we investigated its effects on the growth of Candida albicans and the function of neutrophils which play a major role in the regulation of inflammatory reactions. Methods: Candida cells (C. albicans, TIMM1768) were incubated with diluted rose water for 16 h at 37◦ C in a 5% CO2 incubator. The mycelial growth of C. albicans was evaluated by measuring the OD620 of adherent mycelial cells to plastic plates. To assess modulatory activity of rose water on neutrophils, its effects against neutrophil adhesion response were examined. Human peripheral blood neutrophils obtained from healthy volunteers were incubated with stimulants and rose water for 1hr at 37◦ C in a 5% CO2 incubator. Neutrophil adhesion to the plates was evaluated by measuring the OD620 . The study was performed in accordance with the Declaration of Helsinki and was approved by the ethics committee of Teikyo University Review Board. All volunteers gave informed consent to participating in the study. Results: Rose water inhibited mycelial growth of C. albicans at a concentration of ca. 2.2%, and inhibited yeast growth at 50%. Rose water suppressed neutrophil activation induced by bacterial lipopolysaccharide (LPS), tumor necrosis factor alpha (TNF-α), N-formyl-Met-Leu-Phe (fMLP) at 5% – 15%. It also reduced the LPS- and TNF-α-induced cell surface expression of the adhesion-related molecule, cluster of differentiation (CD) 11b, but did not affect the migratory capacity of neutrophils with or without chemoattractant. Conclusion: These results suggest that rose water may reduce the pathogenicity of candida by inhibiting mycelial growth, and attenuate neutrophil stimulation, which is involved in inflammatory responses. These findings suggest that rose water has a potential effect to inhibit skin and mucous inflammation caused by candida infection. We are also evaluating anti-microbial effect against other microbes.

ABSTRACT

P302 Characterization of the Skin Mycobiome in Patients with Atopic Dermatitis S.H. Han, J.Y. Hong, J.H. KIM, J.R. Hong, H.I. Cheon, M.S. Hur, B.G Choi, Y.W. Lee, Y.B. Choe, K.J. Ahn Department of Dermatology, Konkuk University School of Medicine, SEOUL, South Korea

S125

P306 Different host response to C. albicans by human Oral and vaginal epithelial cells Guanzhao Liang1 , Ying Gao1 , Dongmei Li2 , Weida Liu1 Institute of Dermatology, Chinese Academy of Medical Sc, NANJING, China Georgetown University Medical Center, WASHINGTON DC, USA

1 2

Objective: With the recent availability of culture-independent sequencing methods, studies have been conducted to analyze skin microorganisms present in patients with atopic dermatitis (AD). However, the database on the skin fungal communities, “mycobiome,” has been relatively restrictive compared with the bacterial world. This study aimed to comparatively analyze the overall skin mycobiome between patients with AD and healthy individuals in the Korean population. Methods: Skin swab samples from the antecubital fossae of 8 patients with AD and 8 healthy controls were analyzed. Using sequencing method followed by direct DNA extraction and molecular PCR, taxonomic compositions of fungi at stepwise level ranks were analyzed. The phylogenic marker used was internal transcribed spacer 2 regions of DNA. Results: The tendency of higher intra- and inter-personal taxonomic diversity at genus and species levels in AD samples was observed. Non-Malassezia fungal diversity was also noticeable in the patient group compared with healthy controls. Malassezia globosa and Malassezia restricta were prevalent in all samples across both study groups, and some Malassezia species, including Malassezia sloofiae and dermatis characterized AD. Conclusion: This study might provide a new insight into the mycobiome of adult AD, which contributes to building a systemic mycobiome database in AD.

P303 Itraconazole improve macrophage M1 polarization and phagocytic capacity to Candida albicans Xiaoli Zheng1 , Guanzhao Liang2 , Guanzhi Chen1 , Weida Liu2 1 The Affiliated Hospital of Qingdao University, QINGDAO, China 2 Institute of Dermatology, Chinese Academy of Medical Sciences, NANJING, China Objective: The present study was designed to evaluate whether and how itraconazole can affect the macrophage polarization and its reactivity to Candida albicans. Methods: Cell toxicity was measured using CCK-8 assays. Phagocytosis ability was measured by flow cytometry and confocal laser scanning microscopy. Levels of RAW264.7 cells secreted cytokines induced by LPS, IL-4 or C. albicans and treated with itraconazole were measured by Luminex or Cytometric Bead Array and the expressions of INOs and Arg1 were determined by western blot. Results: In comparison to the control, itraconazole significantly inhibited the growth of the cells in both a time- and a dose-dependent manner as confirmed by CCK-8. Significant enhanced phagocytosis ability of RAW264.7 cells were observed following itraconazole treatment. Increased secretion of IL-6 and TNF- α were elevated following LPS-induced RAW264.7 cells with itraconazole treatment. Improved secretion of IL-6, TNF- α and IL-1β at the same time decreased the secretion of IL-10 in IL-4-induced RAW264.7 cells under treating with itraconazole. In C.albicans stimulated RAW264.7 cells, IL-6 and TNF- α were found to be highly expressed, while the expression of IL-4 as well as IL-10 were inhibited by the treatment of itraconazole. In all three activated patterns, itraconazole enhanced the expression of INOs and moderately inhibit the levels of Arg-1 expression. Conclusion: The itraconazole improved the M1 polarization in RAW264.7 and enhanced anti-inflammatory effect, which demonstrated its new efficacy in clinical use.

P304 Analysis of the Microbiome and Mycobiome of Foot Skin in Patients with Diabetes Mellitus Y.W. Lee, J.Y. Hong, J.H. Kim, J.R. Hong, H.I. Cheon, M.S. Hur, B.G. Choi, S.H. Han, Y.B. Choe, K.J. Ahn Department of Dermatology, Konkuk University School of Medicine, SEOUL, South Korea Objective: Diabetes is considered to be one of the most prevalent endocrine diseases worldwide. Chronic wounds are among the most devastating conditions these patients face along with kidney failure and vascular disease. Even small lesions can progress to an infected chronic wound, sometimes leading to amputation or death. Diabetic-related impairments that disturb an adequate immune response against pathogens are known to contribute to the progression of diabetic wounds. However, the database on skin microbial communities in diabetic patients has been lacking. We aimed to comparatively analyze the overall skin micro- and mycobiome between patients with diabetes and healthy individuals. Methods: We obtained skin swab samples from the foot (sole, toe and interdigital space) of 20 diabetic patients (DM) and 20 healthy controls (HC). Using a culture-independent sequencing method followed by direct DNA extraction and molecular PCR, taxonomic compositions of bacteria and fungi at stepwise level ranks were analyzed. The phylogenic markers used were the V3 to V4 regions of 16S rRNA genes and the internal transcribed spacer 2 regions for bacteria and fungi, respectively. Results: The Shannon Diversity Indexes (SDIs) of bacterial communities were 2.48 ± 0.82 and 3.028 ± 0.84 in DM and HC samples, respectively. The SDIs of fungal communities were 3.06 ± 1.09 and 3.93 ± 0.85 in DM and HC samples, respectively. The difference in SDIs between the two groups was statistically significant (P < 0.01 in bacterial analysis and P < 0.05 in fungal analysis). In beta-diversity analyses, samples in different groups showed a tendency to form different clusters. Additionally, HC samples tended to have more differentiated fungal communities than DM samples. Conclusion: We observed lower taxonomic diversity in the foot skin scales of diabetic patients. Further studies are needed to properly interpret these results. Our data provide a new insight into the micro- and mycobiome of diabetic patients, which might contribute to future investigations associated with diabetes-related chronic wounds, especially in the diabetic foot.

P305 Molecular analysis of paranasal fungus ball in Japan using formalin-fixed paraffin-embedded sections Megumi Wakayama1 , Minoru Shinozaki1 , Naobumi Tochigi1 , Sota Sadamoto1 , Yasuhiro Nihonyanagi1 , Kozue Ejima1 , Aki Mitsuda1 , Somey Y Murayama2 , Tetsuo Nemoto1 , Kazutoshi Shibuya1 1 Toho University School of Medicine, TOKYO, Japan 2 Nihon University School of Pharmacy, FUNABASHI, Japan Objective: Non-invasive fungal sinusitis forming fungus balls in the paranasal cavities, is the most common type of the fungal sinusitis. The fungus balls are composed by filamentous fungi mostly, but they may not be identified by culture in many cases. And it is difficult to accurately distinguish between Aspergillus spp. and other filamentous fungi by GMS staining. So we conducted fugus ball using molecular identification to know the epidemiology of non-invasive fungal sinusitis. Methods: It was extracted 72 samples of formalin-fixed paraffin-embedded (FFPE) sections of fungus ball removed from paranasal sinuses at Toho University Omori Medical Center in Tokyo, from 2002 to 2016. All 72 were diagnosed as fungal sinusitis of filamentous fungi by histopathological examination. DNA was detected using a conventional polymerase chain reaction (PCR) method using Panfungal primer targeting the 18S/ITS1 rRNA gene and Aspergillus primer targeting the 28SrRNA gene. And the resulting amplification products were prepared for sequence analysis and BLAST analysis. Results: PCR with Panfungal primer successfully obtained in 39 out of 72 samples (positive ratio: 54.2%). Genes of Aspergillus species were detected in 16 samples, of Basidiomycota (such as Shyzophillum commune) in 11, of Candida glabosa in 6, of Cladosporium spp. in 2, of Malassezia restricta in 1. And PCR products with Aspergillus primer was positive in 41 out of 72 samples (56.9%), and 37 of them were suggested as Aspergillus spp. And as a result of two PCRs, fungal DNA was successfully amplified from 57 out of 72 samples (79.2%), including 39 samples of Aspergillus spp. Conclusion: PCR technique using FFPE sections enabled retrospective study of causative fungi of fungal sinusitis, even in cases which had negative result by culture. In present study, Aspergillus spp. were supposed to be the most common causative fungi of fungal sinusitis. But in some cases, genes of Basidiomycota was identified by panfungal primer, and that might be because of the humid atmosphere in Japan.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Objective: The aim of this study was to evaluate the different host response to C.albicans by human Oral and vaginal epithelial cells. Methods: We investigate the natural protective mechanisms and local cytokine responses of C. albicans-infected oral and vaginal epithelial cells. Human oral mucosal epithelial cell line (Leuk-1) and human vaginal mucosal epithelial cell line (VK2/E6E7) was cultured with C. albicans (SC5314, als3 and ssa1) in indicated ratio, respectively. The morphological changes and colonies of C. albicans was evaluated fugal killing ability of epiphelial cells, also morphological analysis and lactate dehydrogenase (LDH) activity was uesed to examine cell damage. Further, we assess the production of cytokines and chemokines in co-culture supernatants using enzyme-linked immunosorbent assay (ELISA). Results: Our results show the oral and vaginal epithelial cells use different strategies to combat this pathogen. Infected oral epithelial cells are adept at the production of cytokines (GM-CSF, IL-1α and IL-1β) and chemokines (IL-8, MIP-3α and RANTES), and yet vaginal cells are more proficient at direct fungal killing. However, both epithelial cells play only a minor role in adaptive immunity to C. albicans. Further, C.albicans Als3p and Ssa1p gene also participate in local immune response since deletion of ALS3 or SSA1 causes reduction in cytokines and chemokines levels in both oral and vaginal cells. The dramatic decreases in both fungal killing and the secretion of such cytokines as GM-CSF, MIP-3α and RANTES in ssa1-infected oral cells were consistent with a delayed germination process in that mutant. Conclusion: Our study confirmed that human oral and vaginal epithelial cells performed different host response to C.albicans by fugal killing ability or secreting cytokines and chemokines.

P307 Characterization and functional analysis of sterol 14 a-demethylase genes (McCyp51) in Mucor circinelloides 2 ´ ´ 2 , Otto´ Bencsik2 , AndraS ´ Szekeres2 , Sandor ´ ´ olgyi ¨ ´ Juhasz Kocsube´ 2 , Csaba Vagv , Gabor Nagy1 , Csilla Szebenyi2 , Aron ´ Papp1 Tamas 1 MTA-SZTE Momentum Fungal Pathogenicity Mechanisms Research Group, SZEGED, Hungary 2 University of Szeged, SZEGED, Hungary

Objective: Several members of Mucoromycotina are considered as opportunistic human pathogens, which can cause frequently fatal systemic infections in immunocompromised patients. In the recent years, the number of patients with mucormycosis has significantly increased worldwide. In clinics, triazoles are frequently used to treat invasive mycoses. These compounds inhibit the activity of the enzyme, sterol 14 α-demethylase, which participated in the ergosterol biosynthesis. However, Mucoral fungi are generally resistant to the majority of the presently available azoles. The aim of the present study has been the functional characterization of Cyp51 genes encoding sterol 14 α-demethylases in the model organism Mucor circinelloides. Methods: Relative transcript levels of McCyp51 genes were measured under different growth conditions (i.e. different cultivation temperatures and azole treatments) using the qRT-PCR method. A CRISPR-Cas9 system was used to disrupt the two McCyp51 genes of M. circinelloides. The isolated mutants were characterized and their ergosterol content and sensitivity to various azoles were measured. Results: The genes McCyp51a and McCyp51b showed a constitutively high and a moderate transcription level, respectively, under the tested conditions. Fluconazole had no effect on the transcription level of McCyp51 genes while itraconazole and ketoconazole treatment increased the relative transcript level of both genes. Growth rate of the disrupted mutants was similar to the wild type, but their ergosterol content significantly decreased. Conclusion: Our result suggested that both McCyp51 genes play role in the ergosterol biosynthesis of M. circinelloides. Azoles have different effect on the transcription of these genes because ketoconazole and itraconazole treatment resulted higher relative transcript level in McCyp51b gene than in McCyp51a gene. The study was supported by the grants LP2016-8/2016 and GINOP-2.3.2-15-2016-00035.

P308 Lineages within the Trichophyton rubrum complex Ann Packeu1 , Dirk Stubbe1 , Sam Roesems1 , Karine Goens1 , Sybren De Hoog2 , Marijke Hendrickx1 WIV-ISP, BRUSSELS, Belgium Westerdijk Fungal Biodiversity Institute, UTRECHT, Netherlands

1 2

Objective: The major species of the Trichophyton rubrum species complex are T. rubrum, causing skin and nail infections, and T. violaceum which is scalp-associated. The status of a third species, T. soudanense has been under debate. Recent molecular taxonomy synonymized this latter species with T. violaceum despite morphological differences and microsatellite marker studies suggesting a segregation. Methods: With a polyphasic approach, using molecular phylogeny, Maldi-TOF mass spectrometry (using an in-house developed database), physiological and morphological analysis, we re-evaluated the T. rubrum complex. Results: Our results support four main lingeages within the complex. Next to T. rubrum and T. violaceum, T. soudanense is confirmed as a separate group. The data also show T. yaoundei as a phylogenetically and phenotypically distinct lineage closely related to T. violaceum. Conclusion: In conclusion, the data presented in this phylogenetic study provide strong evidence for the delineation of four separate groups: T. rubrum, T. soudanense, T. violaceum and T. yaoundei.

P309 Ultrastructural Patterns of Interactions Between the Murine Lung Macrophages and Cryptococcus neoformans Yeast Cells of Strains with Different Virulence A. A. Stepanova1 , N.V. Vasilyeva1 , M. Yamaguchi2 , H. Chibana2 , I.A. Bosak1 , L.V. Filippova1 1 North-Western State Medical University named after I.I. Mechnikov, SAINT PETERSBURG, Russia 2 Chiba University, CHIBA, Japan Objective: The purpose of the present work is to study the interactions between murine alveolar macrophages and C. neoformans of the strains with different virulence at the seventh post-experimental day in detail using TEM. Methods: We studied six low and high virulent strains of C. neoformans. For TEM, the pieces of lung at the seventh post-experimental day were fixed in 3% glutaraldehyde and 1% osmium tetroxide. Results: When alveolar macrophages ingest intact yeast cells, the fate of yeast cells are assumed to follow three different pathways, partly dependent upon the virulence of organisms: 1) capsular polysaccharide is absorbed followed by the lytic process that may involve cell wall degradation, where usual phagocytosis and phagolysosome dependent digestion play an essential role throughout the yeast cell killing (first scenario of interaction: phagocytosis and successful intracellular killing); 2) if the yeast cell potentially produces abundant capsular substance, the phagocytosis and killing mechanism do not work successfully where excessive capsular substance is spilt over into the macrophages cytoplasm (second scenario of interaction: failure of phagocytosis and intracellular killing). In these two scenarios the nascent and mature yeast cells mainly participate to the host cell interaction. On the other hand, if the electron dense yeast cells appearing like the desiccated form with intact capsule are contained in the macrophages, they behaved as dormant cells (third scenario of interaction). In contrast, if alveolar macrophages engulf the senescent or dead fungal cells, usually remaining encapsulated, the yeast cells’ body gradually lost their capsule and then the cell wall debris were extruded from the macrophages (fourth scenario of interaction). We find that in all cases (excluding the cases of latent condition of yeast cells in macrophages) that during the phagocytosis of the yeast cells the plasma membrane of macrophages developed the systems of the tubules, in which then isolated into the cytosol of macrophages as microvacuoles. In the phagosome, the system of plasma membrane tubules, which surround the yeast cell in the form of “crown”, the process of the capsular polysaccharide elimination continue. Conclusion: The dependence of cell-mediated immunity on the stage of development of ingested C. neoformans cells is revealed. The new mechanism of capsular polysaccharide elimination of C. neoformans cells by murine macrophages is described.

S126

P310 Poly-P Mobilisation in the Pathobiology of Candida albicans Y. Ahmed1 , M.A.C. Ikeh2 , E. Tarrant1 , K.J. Waldron1 , J. Quinn3 1 ICaMB, Newcastle University, NEWCASTLE, United Kingdom 2 Center of Excellence in Oral Biology, NEW ORLEANS, USA 3 ICAMB, Newcastle University, NEWCASTLE, United Kingdom Objective: Building on our recent findings that Pho4-mediated phosphate (Pi) acquisition is essential for metal homeostasis, stress resistance and virulence in Candida albicans, the objective of this work was to investigate the importance of Pi mobilisation from the Pi storage molecule, polyphosphate (polyP), in regualting Pho4 and assocaited phenotypes. Methods: Strains were constructed lacking either or both of the putative polyphosphatases Ppn1 and Ppx1 which are predicted to regulate the mobilisation of vacuolar polyP stores. Confirmation of the role of Ppn1 and Ppx1 in polyP mobilisation was sought using a combination of cell staining and gel electrophoresis approaches. ICP-MS analysis was used to test the impact of inhibiting polyP mobilisation on intracellular phosphate and metal levels. Finally extensive phenotypic characterisiation of ppn1, ppx1 and ppn1/ppx1 strains was undertaken. Results: PolyP analysis in ppn1 and ppx1 strains revealed a level of functional redundancy between these polyphosphatases, as only ppn1/ppx1 cells contained higher polyP levels compared to wild-type cells. Significantly, polyP mobilisation in response to phosphate starvation was dependent on both Ppx1 and Ppn1. Cells lacking these polyphosphatases displayed impaired stress resistance to metal cations, alkaline pH and superoxide stress in Pi limiting conditions- similar to that seen with cells lacking the Pho4 phosphate responsive transcription factor. Intriguingly, cells lacking both Ppn1 and Ppx1 also displayed notable morphological defects. Conclusion: n Pi limiting environments, C. albicans cells rely on Pi mobilisation from polyP to promote stress resistance. Strikingly, Pi mobilisation from polyP also appears to be a pre-requisite for normal cell morphology even in phosphate replete conditions.

P311 Response of neutrophil granulocytes to Curvularia lunata and Bipolaris zeicola 2 ´ olgyi ¨ ´ 1 , M. Tako´ 2 , C. Vagv , T. Papp1 E. J. Toth 1 ¨ HAS-USZ Lendulet Fungal Pathogenicity Mechanisms Research Group, SZEGED, Hungary 2 University of Szeged, Faculty of Science and Informatics, SZEGED, Hungary

Objective: Genera Curvularia and Bipolaris include closely related melanin producing filamentous fungi but while Bipolaris species infect only plants, there are opportunistic human pathogenes among Curvularia species, such as C lunata, C. spicifera or C. hawaiiensis. Infections caused by these species can manifest as local infections (e.g. keratitis, sinusitis and cutaneous lesions) in immunocompetent or invasive mycoses with frequent involvement of the central nervous system in immunocompromised patients. However, there is only little information available about the host response to these fungi. The aim of this study was to investigate the neutrophil granulocytes’ response and killing efficiency to hyphal forms of Curvularia and Bipolaris in comparison with that to the well-characterized Aspergillus fumigatus. Methods: In the present study, C. lunata SZMC 23759 and A. fumigatus SZMC 23245, both isolated from human eye infection, and B. zeicola BRIP 19582b isolated from plant leaf were examined. Release of H2 O2 from neutrophil granulocites were measured in the presence and the absence of the supernatant of germinating conidia and after serum treatment. Activation and survival of neutrophils were checked by measuring the myeloperoxidase and LDH release, respectively. Results: ROS production of neutrophils in interaction with the three fungi were compared. It is already known that Aspergillus species induce ROS production of neutrophils only after serum treatment. Similarly, C. lunata and B. zeicola were also able to induce H2 O2 release only after serum opsonisation. Viability of C. lunata and B. zeicola did not decrease when H2 O2 production was detected. A potential defence mechanism of the fungi is the neutralization of H2 O2 , so relative transcription level of haloperoxidase genes of C. lunata were measured after induction with H2 O2. Conclusion: It seems that recognition of Curvularia and Bipolaris species by neutrophil granulocites is dependent on serum opsonisation, but C. lunata is actively protecting itself from H2 O2 produced by the immune cells. This research was supported by the grants “Lendulet” LP2016-8/2016 and GINOP-2.3.2-15-2016-00035. EJT was granted ¨ by the UNKP-17-3 New National Excellence Program of the Ministry of Human Capacities.

P312 Aspergillus fumigatus β(1-3) Glucanases involved in conidial Cell Wall morphogenesis N. Millet Institut Pasteur, PARIS, France Objective: The fungal cell wall is an outer and robust layer mainly composed of polysaccharides, which protects the fungal cell from its environment, mediates cell-cell interaction, and is responsible for the shape of the cell. The cell wall of the opportunistic pathogen Aspergillus fumigatus is essentially composed of β(1,3)glucan to which the chitin, the galactomannan, and other polymers are covalently attached. The cell wall is a highly dynamic structure, which undergoes constant change during cell division, growth and morphogenesis. β(1,3)Glucan hydrolyzing enzymes are the most abundant cell wall hydrolases in filamentous fungi and remodeling the β(1,3)glucan as the major structural component of the cell wall. However, the role of β(1,3)glucanases on morphogenesis of filamentous fungi is still poorly understood. In the present study, we investigated the role of the A. fumigatus Glycosyl-Hydrolase family 55 (GH55). Methods: This family contains six proteins called Exg5 to Exg10 for exoβ(1,3)glucanase enzymes. The exoβ(1,3)glucanase activity of Exg6 (ExoGI) has been characterized previously by Fontaine et al., (1997) but until now, none of these genes have been functionally characterized. By studying the effect of the single and multiple deletions of all the members of this GH55 family, we showed for the first time that. . . Results: we showed for the first time that . . . β(1,3)glucanases are essential for conidial development and therefore for asexual reproduction. Entire deletion of the GH55 family members specifically blocks the conidial maturation. Using electron microscopy, we showed that conidia are arrested at the first stage of development, which appears just after phialide budding and conidia display a characteristic ovoid-shape. This defect of conidial wall development leads most importantly to a complete abrogation of conidia separation in the air. Furthermore, conidia lacking the GH55 family members have a delayed germination, suggesting that these enzymes are required for germ tube formation. Overall cell wall composition of immature conidia was not altered.Moreover, from the pathological point of views, A. fumigatus deficient for Exgs protein showed also increased exposure of cell wall glucans, which probably results in enhanced binding to the Dectin1-glucan receptor. Consistent with this, our data indicate that dormant conidia lacking Exgs trigger increased pro-inflammatory cytokine production by PBMC and macrophages. Conclusion: A. fumigatus GH55 family members are important in the structural and functional morphology that accompany processes such as cell maturation, separation, and germination. Moreover, the cell wall maturation of A. fumigatus conidia mediated by the GH55 family members is required to prevent an immune response and also for the immunological inertness of the fungal spores.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Medical Mycology, 2018, Vol. 56, No. S2

P313 Molecular characterization of five Metalloproteases (Mep1-5) and one Subtilisin (Sub6) among Microsporum audouinii strains circulating in Belgium I. Aouini1 , R. Sacheli1 , R. Darfouf1 , C. Adjetey1 , S. Rigali2 , P. Melin1 , A. Raies3 , M.P. Hayette1 ` ` University Hospital of Liege, LIEGE, Belgium ` ` University of Liege, LIEGE, Belgium 3 University of Tunis El Manar II, TUNIS, Tunisia 1

2

Objective: Dermatophyte-secreted endoproteases are members of two large protein families, the fungalysins (metalloproteases) and the subtilisins (serine proteases). Microsporum audouinii (M. audouinii) is an anthropophilic dermatophyte responsible for tinea capitis in young children. Infections caused by this species are very contagious and are causing outbreaks in schools and communities. Proteases are produced by dermatophytes to digest tissue keratin and have already been described as potential virulence factors in different zoonotic species such as Trichophyton mentagrophytes and Microsporum canis. In the present study, primers targeting five metalloproteases (Mep1-5) and one chosen subtilisin (Sub6) have been designed to screen a large scale of Microsporum audouinii strains isolated in Belgium. Methods: A total of 103 strains of M.audouinii were included in this study. This concerned 2 reference strains (IHEM 2758 and 2214) and 101 strains isolated from patients referred to the Mycology Laboratory of the University Hospital of Li`ege during the 2013–2016 period. The strains were identified as M. audouinii by microscopy and confirmed by ITS sequencing. Primers were newly designed based on nucleotide sequences of the genes MEP1-5 available in GenBank database for the close related species M. canis and using primer Blast (NCBI-NIH). The selection of the primers targeting Sub6 were available in a recent study targeting Sub6 in M.canis (Mathy et al, 2012). An internal control of amplification (ITS sequence) was also included to exclude a false negative result due to amplification inhibitors. Results: The presence of at least one gene encoding for Mep1-5 was revealed in 93% (96/103) of the strains, with 80% (87/103) being positive for the five Meps (1-5). The percentage of detection was 89% (92/103) for Mep1, 90% (91/103) for Mep2 and Mep 5 and 85% (88/103) for Mep3. Finally, Mep4 was successfully amplified in 92% (95/103) of the isolates. In total, 7% (7/103) of the strains did not express any Mep gene. Concerning the screening of the Sub6 gene, our analysis revealed that among the 103 M.audouinii screened, 87% (90/103) of the isolates were positive for the Sub6 gene, while 13% (13/103) of the strains were negative for the Sub6 gene. This was confirmed by ITS PCR of negative samples to exclude a possible inhibition factor. Conclusion: The presence of the Mep1-5 and Sub6 genes in M. audouinii strains circulating in Belgium was confirmed in this study. Fairly close percentages of expression of these genes let us think that all tested Meps and Sub6 could be implicated in the virulence process of M. audouinii strains. The next step will be the in vitro biochemical characterization of the expression of these proteases in M. audouinii.

P314 Phenotypic and genotypic identification of chitin producing fungi and Study of their Pharmaceutical application K. Muddukrishnaiah1 , V P Shilpa2 , B Samuel Thavamani2 , V Jayaprakash2 , V Dhanapal2 1 Sanjo College of Pharmaceutical studies, PALAKKD, India 2 Sanjo College of Pharmaceutical Studies, PALAKKAD, India Objective: Current days, the production and utilization of natural biodegradable polymers have wide application in pharmaceutical and biological fields. The aim of the present study is to isolate and identify chitin polymer from Aspergillus japonicas SCOPS A1, and to study their role pharmaceutical applications. Methods: Aspergillus japonicas SCOPS - A1 was isolated form Phylanthus neruri plant leaf from Palakkad, Kerala and it was identified by fungal universal primers ITS4 & ITS5 at ITS region of rDNA (NCBI Accession numbers MG833000, MG833001). The chitin was isolated from Aspergillus japonicas SCOPS - A1 by submerged culture using potato dextrose broth. 200 mg/g−1 (milligrams of chitin polymer/gram of dry biomass) of chitin polymer was extracted from 15-days mycelia by alkali - acid treatment. Extracted Chitin was characterized by Fourier transform infrared spectroscopy (FTIR), and X-Ray Diffraction (XRD). Chitin-Almotriptan malate microspheres were prepared by water-in- oil-in–oil double emulsion method. Results: To highlight Chitin pharmaceutical application, Chitin-Almotriptan malate microspheres were prepared by water-inoil-in–oil double emulsion method which is used for migraine treatment. Differential scanning calorimetric and infrared spectroscopy analysis conform the absence of drug and polymer interaction. Conclusion: In this study we conclude that Aspergillus japonicas SCOPS - A1 produces Chitin and it can be used as the choice of polymer for Pharmaceutical formulation. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 418785 78cb7d04-8045-4184-8bbd-8d 6106f633d8.jpg Caption 1: Aspergillus japonicas SCOPS - A1 Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 418785 78cb7d04-8045-4184-8bbd-8d 6106f633d8.jpg Caption 2: Chlamydospores

P315 The Cst20 and Ptk2 kinases are involved in hyphal steering and thigmotropic responses in Candida albicans Angela M. Lopez Garcia, Mariana C Almeida, Tina Bedekovic, Alexandra Brand University of Aberdeen, ABERDEEN, United Kingdom Objective: Deletion of Ptk2 or mutation of Cst20 in Candida albicans result in contrasting hyphal phenotypes. Our hypothesis is that they function antagonistically during directional hyphal growth. Our objective is to elucidate the functions of these protein kinases in the development and directional growth of Candida albicans hyphae. Methods: Using the CRISPR-Cas9 gene editing system, deletion mutants, ptk2 and cst20, were generated. The kinase domain was eliminated in Cst20 (Cst201-549 ), which retained the CRIB domain. Yeast cells were spotted on rich YPD agar medium supplemented with cell-stressing compounds: calcofluor white (100 μg/ml), Congo red (150 μg/ml), SDS (0.03%), NaCl (1.5 M) or Hygromycin B (400 μg/ml). Hyphal morphology was evaluated in RPMI containing L-glutamine, 20% fetal bovine serum +/glucose (2%) or Modified Soll’s Medium at 37◦ C. Microfabricated chambers with topological features were used to investigate the hyphal response to thigmotropic cues. Hyphae were induced in 20% serum, 2% glucose for 2 h. To visualise interactions with human cells, epithelial cells were co-incubated with C. albicans wild-type or mutant strains for 3 h at 37 ◦ C in 5% CO2 and analysed using a spinning disk microscope. Results: Disruption of PTK2, CST20 or the Cst20 kinase domain did not affect hypha formation under our tested conditions. Cells lacking Ptk2 were sensitive to SDS but resistant to high concentrations of Hygromycin B (400 μg/ml) compared to wild-type cells. In contrast, the cst20 mutant was sensitive to Hygromycin B. Calcofluor white, NaCl or Congo red did not affect cell growth at 30 ◦ C. Deletion of PTK2 produced kinked hyphae with partial loss of contact-dependent (thigmotropic) steering responses. Truncation of the kinase domain of Cst20 resulted in straight hyphae that were unresponsive to all directional cues tested, including an inability to alter trajectory and follow contours during growth on host cells. Conclusion: Our results tentatively support the view that the Cst20 and Ptk2 kinases operate antagonistically in the C. albicans hyphal steering system that influences the Cdc42-based cell polarity machinery. We hypothesise that the N-terminal CRIB domain of Cst201-549 sequesters a small GTPase whose cycling is required for hyphae to adjust their direction of cell growth. This interaction may result in the completely straight growth phenotype of this mutant.

ABSTRACT

S127

P316 β-1,6-linked Galactofuranose-rich Peptidogalactomannan of Fusarium oxysporum is Important in the Activation of Macrophage Mechanisms and as a Potential Diagnostic Antigen

P319 Enhancement of Paracoccidioides brasiliensis infected-dendritic cells activity upon pattern recognition receptors stimulation

MIDS Xisto1 , N.F De Oliveira1 , G.R.C. Santos1 , G.M.P. Santos1 , M.C. Bernardino1 , C.B. Montebianco1 , M Nucii1 , R.M.T. Haido2 , E Barreto-Bergter1 1 Universidade Federal do Rio de Janeiro, RIO DE JANEIRO, Brazil 2 Universidade Federal do Estado o Rio de Janeiro, RIO DE JANEIRO, Brazil

A.H. Tavares, G.S. Silva, D.A. Silva, M.R Cardoso, A.L. Bocca University of Brasilia, BRASILIA, Brazil

Objective: Our present study aimed to analyze the major glycoconjugate present on the F. oxysporum cell surface by a combination of chemical and spectroscopic methods, including one and two-dimensional nuclear magnetic resonance (1D and 2D NMR) spectroscopic analysis and how the glycosylation of F. oxysporum glycoconjugate influences the recognition and uptake of F. oxysporum by macrophages as well as its role in the production of proinflammatory cytokines. The reactivity of the glycoconjugate was evaluated by ELISA using sera from patients with invasive fusariosis and invasive aspergillosis. Methods: F.oxysporum glycocojungate was extracted with 0.05 M phosphate buffer, pH 7.2 at 100-C for 2 h. Monosacharide composition in PGM was determined based on the chemical analysis and GC-MS analyses. A combination of chemical and spectroscopic methods, including 1D and 2D NMR were made to obtain a structural characterization of a PGM from F. oxysporum. The reactivate of human sera from the Mycology Laboratory of the University Hospital (Federal University of Rio de Janeiro) against PGM were tested by ELISA. The macrophage effector functions were evaluated by phagocytic and cytokine assay. Results: The galactomannan component consists of a main chain containing (1→6)-linked β-D-galactofuranose residues with side chains containing (1→2)-linked α-D-Glcp, (1→2)-linked -β-D-Manp (1→2) and β-D-Manp terminal nonreducing end units and differs from that of Aspergillus fumigatus and Cladosporium resinae A strong decrease in reactivity was also observed with de-O-glycosylated PGM. In addition, de-O-glycosylated PGM was not able to inhibit F. oxysporum phagocytosis, suggesting that macrophages recognize and internalize F. oxysporum via PGM. F. oxysporum PGM triggered TNF-α release by macrophages. Chemical removal of O-linked oligosaccharides from PGM led to a significant increase of TNF-α cytokine levels, suggesting that their removal could exposure another PGM motifs able to induce a higher secretion of TNF-α levels. Interestingly, F. oxysporum conidia, intact and de-O-linked PGM were not able to induce IL-10 cytokine release. The difference in patient serum reativity using a PGM from F. oxysporum characterized in the present study as compared with a PGM from C. resinae, that presents the same epitopes recognized by serum from patients with aspergillosis. Conclusion: The outcome of invasive aspergillosis has improved in the last decade, and one of the reasons is the early diagnosis of the disease, achieved after the introduction of serum galactomannan testing. With this regard, a test that is sensitive and specific, and appears in the serum before the clinical manifestations of invasive fusariosis may have an impact in decreasing the mortality of this devastating disease. The PGM characterized in the present study may be a candidate, and should be tested with more sera.

Objective: A key component of the innate immune response is dendritic cells (DCs), which are able to recognize, via pattern recognition receptors (PRR), pathogen associated molecules and activate adaptive T-helper (Th) cell responses. It is known that Paracoccidioides brasiliensis (Pb) down-regulates DCs activities. In this context, we evaluated if Pb infected-dendritc cells treated with ligands of PRRs would have a functional enhancement in terms of cytokine production, maturation and activating of T cell responses. Methods: Fungus: The yeast form of Pb was grown on Fava-Netto medium. Generation, infection and treatment of BMDCs: bone marrow cells were seeded and cultured for 8 days in RPMI-1640 medium containing GM-CSF to obtain BMDCs. On day 8, BMDCs were harvested and infected with P. brasiliensis for 24 h for cytokine quantification. The cells were treated with PRR ligands PAM3CSK4 or zymosan. Splenocytes-BMDCs co-cultivation: After spleen disruption, T cells were obtained and co-cultured with BMDC infected and/or treated with PRRs agonists for the evaluation of Th1, Th2, and Th17 characteristic cytokines. Cytokine quantification: The cell-free supernatants of BMDC cultures were harvested for the determination of several cytokines concentrations using ELISA. Results: DCs infected with Pb were treated with PRRs agonists. IL-1β, TNF-α and IL-6 were produced in response to the fungal infection and an amplified secretion was observed when agonists were added. In contrast, IL-12p70 were not produced by both infected and infected plus agonist treated-DCs, despite the fact that agonists alone induced IL-12 secretion. Further, Pb reduced the production of IL-12p70 induced by LPS. Fungal induced inhibition was not observed for the p40 subunit of IL-12, suggesting that Pb inhibits the specific p35 IL-12 subunit. In fact, Pb in LPS-treated cells inhibited mRNA IL-12p35 transcription. Also, using transwell system we found that direct contact of DCs and Pb was necessary for the inhibition of IL-12p70. Considering this result we used DCs treated with blocking Ab against Mincle or DCs from mice lacking dectin-1, -2, -3, TLR-2 or -4 to assess IL-12p70 production. None of these PRR was associated with the inhibition of IL-12 production. Regarding maturation, the treatment with the PRRs ligands induced significant DCs maturation as assessed by the expression of CD80 and CD86. Finally, It has been shown DCs infected with Pb fail to activate a Th1 response. Similarly, we found significant production of IL-13 (Th2) when compared with the IFN-y (Th1) by T cells co-cultured with Pb-infected DCs. Only with the addition of PRR ligands Th cells polarization is reversed, despite the fact of impaired IL-12P70 production, the major inducer of Th1 differentiation. This fact may be explained by the increase of IL-18 and IL-27 production by DCs treated with the PRR ligands. These cytokines are related with Th1 differentiation induction and Th2 inhibition, respectively. Conclusion: Our preliminary results show that PRR agonists may serve to induce a potential protective response of DCs infected with Pb.

P317 Candida auris and C. haemulonii identification and discrimination by high resolution mass spectrometry A. Kolecka1 , I. Moser1 , A. Jamalian2 , J.B. Stielow2 , S. De Hoog1 , J. Freeke2 1 Westerdijk Fungal Biodiversity Institute, UTRECHT, Netherlands Thermo Fisher Scientific, VANTAA, Finland

2

P320 Multiple regulators contribute to the transcriptional control of the Candidalysin encoding gene ECE1 Ronny Martin1 , Sophia Ruben2 , Enrico Garbe2 , Oliver Kurzai1 University of Wuerzburg, WUERZBURG, Germany 2 Leibniz Institute for Natural Product Research and Infection Biology, JENA, Germany 1

Objective: Candida auris is an emerging, multi-drug resistant yeast pathogen. Determining C. auris from other Candida species is of great importance, especially in patients that have been persistently colonized with this yeast. Infection or colonization by C. auris raises a risk of difficult treatment and increases the mortality rate in patients, particularly in those with invasive infections. Most C. auris isolates have been recognized as resistant to at least one antifungal agent (e.g. fluconazole and amphotericin B) rendering echinocandins the treatment of choice. Resistance to echinocandins can be acquired during treatment, causing therapeutic and patient management challenges. Thus, quick and reliable identification is needed in clinical routine. The high resolution mass spectrometry approach employing nano-liquid chromatography and OrbitrapTM mass analyzer was investigated to establish the discriminatory power of the system for C. auris and the members of C. haemulonii species complex. Methods: High resolution accurate mass mass spectrometry (HRAM MS) was applied to type and reference strains of the C. haemulonii species complex, namely C. auris, C. haemulonii, C. pseudohaemulonii, and C. duobushaemulonii from the Westerdijk Fungal Biodiversity Institute (CBS-KNAW biobank). All strains were characterised using fungal ribosomal DNA barcodes. The protein extracts from each species were introduced to the mass spectrometer using electrospray ionisation (ESI). Mass spectra were evaluated for the individual protein masses detected. Different species identification approaches were compared. Results: With the described method masses of multiple protein classes, including ribosomal proteins, were detected. Across different strains of the same species the variation in the presence of proteins enabled searching for species specific protein masses that were used to delimit all tested species. HRAM MS species separation was in accordance with the phylogenetic classification from Sanger DNA sequencing data. Conclusion: This highly promising technique (HRAM MS) was able to identify C. auris from other pathogenic yeast species including sister taxa of C. haemulonii species complex, in a time efficient and effective manner.

P318 Identification of Proteins Putatively Secreted by the Yeast Phase of Talaromyces marneffei V.H. Silvis, S.L. Eisnaugle, C.P. McKenry, J.A. Engle, R.M. D’Auria, J.E. Budde, X. Min, C.R. Cooper Youngstown State University, YOUNGSTOWN, USA Objective: Talaromyces marneffei, a pathogenic fungus endemic to Southeast Asia, typically infects individuals with HIV and occasionally other immunocompromised individuals. Without appropriate treatment, the outcome of such infections by T. marneffei is usually fatal. The virulence of this fungus is associated with its thermally dimorphic nature. At 25◦ C, T. marneffei grows filamentously producing airborne conidia. When incubated at 37◦ C (body temperature), however, this fungus grows as a yeast that divides by schizogony. Moreover, the yeast phase of T. marneffei thrives in the intracellular milieu of host macrophages. This ability to survive within a normally harsh environment prompted us to hypothesize that this pathogenic fungus may secrete proteinaceous factors which hinder the normal defensive response of the host macrophage. Methods: To assess this hypothesis, we sought to initially identify those proteins exclusively secreted by the yeast phase of T. marneffei. The Fungal Secretome KnowledgeBase (FunSecKB) was employed to identify putatively secreted T. marneffei proteins. Using the NCBI RefSeq database, FunSecKB identified 538 secreted proteins. Based upon their respective gene sequences, DNA primers were designed to a selected number of these proteins. The functionality of each pair of primers was confirmed in a polymerase chain reaction (PCR) using T. marneffei genomic DNA to generate an appropriately sized amplification product. Functionally confirmed primers were then used to assess gene expression by both the mycelial and yeast phases of T. marneffei. Specifically, RNA was collected from T. marneffei cultures incubated for 24–96 hours at either 25◦ C or 37◦ C, then employed in a reverse transcription PCR (RT-PCR) in conjunction with a specific pair of primers. Those RT-PCR results indicating exclusive or increased gene expression by the yeast phase were further subjected to quantitative RT-PCR (qRT-PCR) analysis. Results: We initially screened 73 primer pairs, of which 24 produced results that warranted further examination of gene expression. RT-PCR analysis employing different primer pairs demonstrated that three distinct genes were preferentially expressed during yeast-phase growth of T. marneffei. These genes encode a multicopper oxidase, a catalase, and an unknown cell-wall protein. Subsequent qRT-PCR analysis revealed that each of these genes exhibited statistically significant increased expression in the yeast phase of T. marneffei as compared to the mycelial phase. Conclusion: We have developed a strategy to screen for putatively secreted proteins that may play a role in the virulence of T. marneffei. Specifically, we identified the increased yeast-phase expression of genes encoding a multicopper oxidase, a catalase, and an unknown cell-wall protein. Multicopper oxidases are known to be associated with virulence in Candida albicans and Cryptococcus neoformans, whereas catalase and like proteins have been shown previously to be highly expressed by the T. marneffei yeast phase as a possible response to host defenses. In addition, cell-wall changes are known to be associated with dimorphism as well as virulence. We anticipate discovering additional genes encoding putatively secreted yeast-phase proteins of T. marneffei. Further efforts shall be directed towards demonstrating the relationship of these yeast-phase specific proteins to virulence.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Objective: Candida albicans hyphae are major contributors to fungal virulence. Not only do they mediate adherence to host cells as well as consequent invasion, but they are also crucial for further dissemination and nutrient acquisition in infected tissue. Recently, it was shown that hyphae secrete a toxic peptide called Candidalysin which is essential for host cell membrane destruction. This peptide derives from a heavily processed precursor protein which is encoded by the ECE1 gene. For many years, it is known that ECE1 is one of the most abundant transcripts in hyphae, but barely detectable in C. albicans yeast cells. Due to its importance for fungal virulence, we analyzed the mechanisms which control the efficient activation of the gene after the initiation of hyphal growth. Methods: A GFP reporter system for ECE1 was used to study the expression of the gene by fluorescence microscopy. The construct was transformed into wild type and strains lacking putative regulators. The resulting mutants were then examined under yeast promoting conditions (minimal medium at 37◦ C). Hyphal growth was induced by the addition of 10% human serum. We also analyzed the consequences of the overexpression of selected transcription factors on ECE1 transcription. Aside the GFP reporter system, expression of ECE1 was also examined by quantitative RT PCR. Results: At first, we used the GFP reporter system to screen mutants lacking either putative negative or positive regulators. This screening revealed a much more complex role for the global repressor Tup1 than initially thought. Under yeast growth conditions, it contributed clearly to repression of ECE1. In hyphae promoting media however, it is also involved in the activation of the gene. In this context, we also noticed that a certain threshold of expression must be passed to produce enough GFP for bright signals. We further identified the transcription factor Ahr1 as a crucial regulator of ECE1 transcription which is required for a full expression of the gene. Interestingly, a hyperactive version of AHR1 was able to induce high levels of ECE1 transcription without additional environmental stimuli and even bypassed the absence of such transcriptional activators like Cph1, Efg1, Tec1 and Ume6. Interestingly, it could not bypass the absence of the transcriptional regulator Tup1. Conclusion: Our data suggest that several regulators contribute to the transcriptional control of ECE1. This complex mode of regulation enables C. albicans to rapidly activate or repress the gene’s expression depending on the environmental conditions. Our study also revealed new functions for the transcriptional regulators Ahr1 and Tup1 in the control of ECE1 transcription.

S128

Medical Mycology, 2018, Vol. 56, No. S2

P321 Candida associated denture-stomatitis diagnosed by scanning electron microscopic and culture

P324 Verification of species boundaries in clinically relevant Arthroderma species by using a multidisciplinary approach

A. H. Damasceno-Escoura1 , G. A. Borges2 , P. R. Henrique2 , M.L. Silva-Vergara3 , D.J. Mora3 1 ˆ Triangulo Mineiro Federal university, UBERABA, Brazil 2 University of Uberaba, UBERABA, Brazil 3 ˆ Triangulo Mineiro Federal University, UBERABA, Brazil

I. Mikova, V. Hubka Charles University, PRAGUE, Czech Republic

Objective: Denture-related stomatitis is a common oral mucosal lesion in denture wearing, mainly old people.The etiology of this lesion is multifactorial and Candida spp. infection is commonly associated. The adherence of microorganisms over the surface of denture materials is required to form biofilm, which can be related to invasive fungal infection and antifungal resistance. The scanning electron microscopy (SEM) is useful tool used to investigate the structures related to denture biofilm. Objective: To evaluate the clinical and laboratorial aspects of Candida biofilm and its role in the etiology of denture stomatitis. Methods: From September 2014 to December 2015, oral samples of edentulous patients wearing denture with clinical evidence of stomatitis at the Faculty of Dentistry in Uberaba, Minas Gerais, Brazil were collected. A clinical history was registered and intraoral examination was performed. The yeasts recovered were identified by carbon and nitrogen assimilation assays, sugar fermentation, germ tube test, urease activity, morphology on cornmeal agar tween-80 and CHROMagar-Candida medium. Specimen of one patient was selected for SEM analysis were fixated in Karnovsky solution, washed three times using a 0.05 M sodium cacodilate buffer solution (pH 7.4) and then cut. Cuts were dehydrated and the dry fragments were mounted on aluminum stubs and putter coated with gold. Observations were carried out in LEO 435 VP microscope at 1,500x in a high-vacuum mode at 20 kV. Results: Of the 39 patients with clinical evidence of denture-related stomatitis, 32 (82%) had at least one positive Candida sp. culture. Of these, 23 (71.8%) were female, median age of 56.8 ± 14.7 years. Twenty nine (90.6%) wore complete dentures of whom 25 (86.2%) used it for more than six years. The palate site was the most affected in 26 (81.25%) of the cases followed by the alveolar region in six (18.75%). Pain and local bleeding were reported by 15 (46.8%) and four (12.5%) cases, respectively. Poor oral hygiene, tobacco use, hyposalivation, uncontrolled diabetes mellitus and hypertension were evidenced in 25 (78.1%), 15 (46.8%), 11 (34.3%), nine (28.1%) and seven (21.8%) cases, respectively. A total of 57 isolates were recovered from 32 patients of whom 14 (43.75%) had multiple Candida spp. isolates. C. albicans was recovered in 27 (47.3%), C. glabrata in 12 (21%), C. tropicalis in 8 (14%), C. parapsilosis in 7 (12.4%) and C. krusei in 3 (5.3%) cases, alone or in combinated way. Candida albicans biofilm of one case was visualized by SEM directly from denture samples. It was evidenced the propensity of biofilm to adhere along cracks and imperfections of the denture acrylic material (figure 1). Conclusion: The pathogenesis of denture-related stomatitis is associated to several predisposing conditions such as: poor oral hygiene, continuous use of dentures and the presence of Candida sp. in the oral environment. Candida species are frequently recovered from denture surfaces of both upper partial and complete dentures acting as reservoir of infection as evidenced by the SEM. Due to this fact, the denture must be replaced. Candida albicans is considered the predominat species, although non-albicans species can be also involved. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 419217 d2e4209e-b654-4527-92ddd6aae1e6286e.jpg Caption 1: Figure 1. Scanning electron micrograph images of pieces of denture retrieved from patients with denture stomatitis

P322 PRP8 intein applied to phylogeny and species identification of dermatophytes HANS Garcia Garces1 , RAQUEL C Theodoro2 , EDUARDO Bagagli1 1 Institute of Biosciences of Botucatu, BOTUCATU, Brazil 2 Medicine Tropical Institute of Rio Grande do Norte, RIO GRANDE DO NORTE, Brazil Objective: Inteins are self-splicing protein elements inserted in housekeeping genes important for cell survival. They can be found as a full-length intein when they have a splicing and a homing endonuclease (HE) domains or as a mini-intein when only the splicing domain is present. The PRP8 intein is inserted into the PRP8 protein, a core protein of the spliceosome complex responsible for removing introns during the nuclear transcription process. It was observed that variations in the nucleotide sequences of the PRP8 intein reflects the phylogenetic relationships of fungal species and its length polymorphism enables a proper molecular identification by electrophoresis techniques. We have been studying the PRP8 intein profiles in dermatophytes both in order to clarify their phylogenetic relationship and also to develop practical procedures to differentiate some of the clinically important Microsporum and Nannizzia species by the amplification of the supposed species specific polymorphic regions of HE domains, with no need of sequencing. Methods: Forty strains of 11 dermatophytes species were previously identified by Internal Transcribed Spacers (ITS) and D1/D2 rDNA sequencing and the complete sequences of their PRP8 inteins also determined. Nucleotide PRP8 sequences were analyzed and employed for phylogenetic studies by using the software MEGA v 6.0. For electrophoretic molecular identification two sets of primers that amplified a size variable polymorphic region of the HE domain were designed and amplification trough PCR and visualization in agarose gel were performed. Results: The phylogenetic trees obtained by using the PRP8 nucleotide and amino acid sequences were concordant with other phylogenetic constructions that use other genetic regions (ITS and D1/D2). Arthroderma uncinatum was grouped within the Microsporum Clade (M. audouinii and M. canis). E. floccosum clustered within the Nannizzia genus clade, that encompassed the N. incurvata, N. gypsea, N. persicolor and N. fulva species. All Trichophyton species clustered as a separated clade, with a clear resolution within the T. rubrum and T. interdigitale strains. A simple molecular procedure employing DNA amplification and visualization by agarose gel electrophoresis enabled the identification of herein studied Microsporum and Nannizzia species. Primers HE1F (5´TTC CTK GGR CTY TGG CTT GG 3´) and HE2R (5´ADY AAA CCD GCR AGG ACG G3´) allowed to identify Microsporum species (M. audouinii and M. canis), which present the larger amplicon with 938 bp, while Trichophyton species (T. rubrum and T. interdigitale) and Nannizia species were separated from Microsporum species with amplicons ranging from 620 to 680 bp. The specific primers HE1F and HE3R (5´GTC CAG ATC RYC CWC TTT SG 3´) made possible to distinguish species within the Nannizzia genus. N. fulva and N. persicolor present a 350 bp band amplicon, while N. gypsea has 327 bp and N. incurvata 300 bp. Conclusion: We concluded that the nuclear region of the PRP8 intein is a suitable genetic marker for classifying and identifying dermatophytes.

P323 In vitro antifungal activity of essential oils against fluconazole-susceptible and-resistant Candida albicans F. Katiraee, S. Ahmadi Afshar, S.F. Rahimi Pirmahaleh University of Tabriz, TABRIZ, Iran Objective: Candida albicans is the most common cause of candidal infections. Various studies have shown drug resistance among C. albicans isolates; thus, it is necessary to discover replacement treatments for Candida infections. In this study, we aimed to compare the effects of different essential oils against azoles-resistant and azoles-susceptible isolates. Methods: Twenty fluconazole-resistant and 20 susceptible C. albicans isolates obtained from oral, vaginal, and cutaneous tissues of patients with candidiasis were evaluated. The efficacy and minimum inhibitory concentrations (MICs) of Zataria multiflora, Geranium herbarum, Lavendula officinalis, Cuminum, cyminum, Allium heamanthoides, and Artemisia sieberi essential oils against C. albicans were determined on the basis of a reference method for broth microdilution susceptibility testing of yeasts as suggested by Clinical and Laboratory Standards Institute (CLSI, M27-S4). After inoculation, incubation, and subculturation, the MICs were determined through comparison with the control. Results: The obtained MICs for Zataria multiflora, Geranium herbarum, Artemisia sieberi, Allium heamanthoides, Cumminum cyminum, and Lavendula officinalis were 0.1-0.25 μl/ml (mean: 0.155 μl/ml), 0.625-1.66 μl/ml (mean: 0.93 μl/ml) 0.833-2.0 μl/ml (mean: 1.21 μl/ml), 0.1-0.25 μl/ml (mean: 0.155 μl/ml), 2–4 μl/ml (mean: 3.1 μl/ml), and 1.5-3.0 μl/ml (mean: 2.4 μl/ml), respectively. The results showed that Zataria multiflora and Allium heamanthoides essential oils were more efficient than other essential oils against Candida species. There were no significant differences between various Candida strains in terms of susceptibility to the essential oils. In addition, there were no significant differences in the MICs of these essential oils against the azoles-resistant and azoles-susceptible isolates. Conclusion: In this study, the anti-Candida effects of six essential oils against both azoles-resistant and azoles-susceptible isolates were similar. Given the documented resistance of different Candida species to synthetic and chemical antifungals, these essential oils are effective replacement treatments for cutaneous and mucosal Candida infections, especially in resistant or recurrent cases.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Objective: Geophilic dermatophytes are a speciose ecological group within Arthrodermataceae naturally occurring in soil, especially around burrows and nests of terrestrial vertebrates and birds. They act as relatively uncommon causal agents of infections in human and animals (1–5% of all dermatophytoses worlwide) without significant contagious potential. The taxonomy of geophilic dermatophytes has been insufficiently studied compared to their better known relatives from among anthropophilic and zoophilic species. Consequently, significant number of species still await discovery. The aim of this study was to revise species boundaries in the geophilic genus Arthroderma with focus on species occurring in clinical samples. Methods: The examined Arthroderma strains from clinical samples and environment were analysed using DNA sequence data (ITS rDNA region, β-tubulin and translation elongation factor 1-α genes) and by means of morphological and physiological methods. The agreement between phylogenetic/morphological and biological species concept was studies by using in vitro mating experiments. The morphology of ascospores was examined by scanning electron microscopy and viability of ascospores was determined by flow cytometry. Results: The phylogenetic analysis showed that clinical isolates from the former Trichophyton terrestre complex cluster predominantly in A. quadrifidum, A. insingulare and A. onychocola. In addition, this complex harbours several undescribed soilborne and cave-dwelling species supported by phylogenetic analysis, mating experiment data and morphology. A neotype designation is needed for Trichophyton terrestre together with name combination in the genus Arthroderma. Conclusion: Several undescribed species were revealed by using multidisciplinary approach in the former Trichophyton terrestre complex. At least three members of this complex are either uncommon agents of infections in human or occur as contaminants in clinical material.

P325 Development of Antifungal Biopharmaceutical Dectin1-Fc L. W. J. Lim1 , S. K. NG1 , K. P. Lam2 1 National University of Singapore, SINGAPORE, Singapore 2 Bioprocessing Technology Institute, SINGAPORE, Singapore Objective: Invasive fungal infections are a neglected category of disease that has a high mortality and implicated in immunocompromised patients. Dectin-1 (CLEC7A) is a type II transmembrane C-type lectin pattern recognition receptor expressed on cells of the innate immune system like macrophages, monocytes and neutrophils that recognizes β-glucans through its single C-type lectin-like domain at its extracellular region. It functions by binding to cell walls of different fungal species, such as Saccharomyces cerevisiae, Candida albicans, Pneumocystis carinii, Coccidioides posadasii, and Aspergillus fumigatus; triggering intracellular responses like phagocytosis and cytokine production. The absence of β-glucans in human cells presents the opportunity to exploit Dectin-1 as therapeutic vehicle to enhance immune response during a fungal infection. We aim to develop a recombinant Dectin1Immunoglobulin G1 Fc fragment fusion protein as a potential biopharmaceutical to aid the innate immune system against fungal infections and investigate its ability to enhance phagocytic activity of innate immune cells. The fusion protein was expressed in Chinese Hamster Ovarian (CHO) cells and purified via histag affinity and size exclusion chromatography. Immunofluorescence imaging shows the fusion protein capable of binding to Candida albicans both in the unicellular and hyphae morphology. Activity testing of the fusion protein using THP-1 monocytes against unicellular Candida albicans in a 1 hr phagocytosis assay shows a dose response. For the highest dose of 100 μg/ml of fusion protein, a reduction of greater than 50% of surviving Candida albicans cells compared to the untreated control was observed. Further testing with primary immune cells would be appropriate to study the full therapeutic potential. Methods: . Results: . Conclusion: .

P326 Activation of a Ste20/PakA protein kinase occurs in the dermatophyte Trichophyton rubrum through alternative splicing E. V. Gomes, N. S. Mendes, J. C. Bortolossi, P. R. Sanches, N. M. Martinez-Rossi, A. Rossi ˜ PRETO SP, Brazil ˜ Preto Medical School - USP, RIBEIRAO Ribeirao Objective: This present work aims to describe a probable mechanism for activation of a Ste20/PakA protein kinase through intron retention process, modulated by the antifungal agent undecanoic acid (UDA). Ste20/PakA belongs to the Trichophyton rubrum mitogen-activated protein kinase (MAPK) pathway. Methods: For this, approximately 1 × 106 conidia/mL from T. rubrum strain CBS 118892 was inoculated in Sabouraud medium and pre-cultured at 28◦ C for 96 h under constant agitation. For the high-throughput sequencing analysis, the mycelia were aseptically transferred to RPMI 1640 media (Gibco, USA) in the absence or presence of 17.5 μg/mL UDA (Sigma, USA), which corresponds to 70% of its minimum inhibitory concentration (MIC). These cultures were incubated for 3 or 12 h at 28◦ C under constant agitation and the mycelia used for RNA extraction. For the RT – qPCR analyses, after the pre-culture step, the mycelia were aseptically transferred to a fresh Sabouraud medium in the absence or presence of 70% and 100% of its MIC, and then incubated for 3, 12 and 24 h at 28◦ C under constant agitation. The total RNA from all samples was isolated through the TRIzol RNA kit (Invitrogen Life Technologies), and used for the synthesis of cDNA with the TruSeq RNA library Kit (Illumina, USA). The libraries were sequenced on Illumina HiSeq 2000 system (Illumina, USA). Intron retention analysis was performed through ad hoc Perl scripts, being identified in the reference genome, aligned against the sequenced libraries, and analysed for each retained intron. RT-PCR was used to confirm the properties of genes of interest. Gene expression was quantified by qPCR with the StepOnePlus Real-Time PCR system (Applied Biosystems, US). Results: In silico analysis indicated that the ste20/pakA mRNA in T. rubrum encodes for a protein kinase with 970 amino acids, presenting the catalytic domain in the C-terminal region, and an auto-inhibitory domain (Cdc42/Rac interactive binding - CRIB) in the N-terminal. In Saccharomyces cerevisiae, Ste20p is transiently activated by the Rho GTPase Cdc42p, binding to the CRIB domain in response to moderate stress, and also activated by caspase cleavage during apoptotic stress in mammals. Our data suggest that retention of the intron-1generates a premature stop codon in its mRNA, followed by a new start codon and a subsequent sequence encoding for a protein that exhibits the catalytic portion with a high degree of homology with the native one, but free from the CRIB domain. The data also indicated that the retention level was modulated by the presence of UDA. Conclusion: Thus, we hypothesize an alternative mechanism, analogous to the caspase 3 cleavage, for the activation of PakA by intron retention in T. rubrum, which can be modulated by UDA, probably for a faster transcriptional response through the MAPK pathway.

Financial Support: FAPESP, CNPq, CAPES, and FAEPA.

ABSTRACT

S129

P330 Obtainment and phenotypic characterization of a mutant strain for the putative ATL gene in the Cryptococcus neoformans JF289 strain

P327 Undecanoic acid toxicity toward Trichophyton rubrum relies on an oxidative stress status T. A. Bitencourt, N.S. Mendes, P.R. Sanches, A. Rossi, N.M. Martinez-Rossi ˜ PRETO, Brazil ˜ Paulo, RIBEIRAO University of Sao

ˆ 1 , R. Oliveira1 , G. Ianiri3 , L. Fernandes2 , J. Heitman2 , M.J. Poc¸as-Fonseca1 F. F. Fonseca 1 University of Bras´ılia, BRAS´ILIA, Brazil Univesity of Bras´ılia, BRAS´ILIA, Brazil 2 Duke University Medical Center, DUKE, USA

Objective: The fungitoxicity of fatty acids to dermatophytes has long been known. The presence of these compounds in skin and sweat is associated with protection against superficial infections. In this respect, the antidermatophytic activity of undecanoic acid (UDA), a medium-chain saturated fatty acid, is highlighted in the series of C7:0- C18:0 compounds, and it has been used to treat cutaneous mycoses. On the other hand, its mode of action is not entirely understood and seems to be related to non-specific interactions with fungal cell proteins and enzymes as well as fatty acid metabolism. A high throughput assay was previously performed by our research group to unveil key physiological aspects in T. rubrum response to UDA exposure. Among the main pathways involved in UDA detoxification, the response to oxidative stress drew our attention. For this reason, this work aimed to assess the effect of UDA on T. rubrum cellular antioxidant system. Methods: A serial drop dilution assay was carried out to analyze the effect of UDA, menadione, and the association of UDA with menadione on T. rubrum mycelial growth. Different concentrations of a conidia suspension were inoculated on 24 well plates (in a range of 106 to 102 cell/mL), followed by incubation for 96 h at 28◦ C. Further, the gene expression analysis of two encoding enzymes, Glutathione transferase, and Cytochrome c peroxidase, involved in oxidative stress response were evaluated using rpb2 as the normalizer, and 2−Ct method. The relative expression was assessed using T. rubrum grown on Sabouraud (without drugs) as the reference, and the test conditions were menadione (5μM, 10μM, 20μM) or UDA (17.5 μg/mL) for 3 and 12 h of exposure. Results: The sensitive phenotype assay showed a marked growth inhibition by UDA in concentration assayed (12.5 μg/mL), and no growth inhibition in the lower concentration tested (3.125 μg/mL), whereas menadione showed a pronounced colony growth reduction in the highest concentrations assayed (40μM and 20μM), followed by a slight reduction in the lower tested concentrations of 10 μM, and 5μM. In both cases, the growth inhibition was in a dose-dependent manner. The association of menadione (5μM) with UDA (3.125 μg/mL) showed a possible synergism effect, with a reduction in colony growth similar to menadione concentration of 20μM. Besides, the gene modulation of the oxidizing enzymes showed their up-regulation after 3 h of UDA exposure, as well as for menadione exposure. Conclusion: In conclusion, these results may be related to the first line defence employed by T. rubrum to overcome the oxidative stress status, and also hinted the enhance UDA-based antifungal therapy by oxidant agent menadione. Therefore, these data strengthen the cellular antioxidant system as a possible target of UDA. Financial support: FAPESP (Process number: 2015/23435-8 and 2014/03847-7), CAPES, CNPq, FAEPA.

Objective: In this work we aimed to obtain a C. neoformans mutant strain for the putative ATL (Alkyltransferase-like protein) gene in order to characterize its phenotypes and virulence attributes in vitro and to assess the mitotic silencing rate for the URA5 transgene in comparison to the JF289 parental strain. Methods:Bioinformatics analyses (;; and) for the C. neoformans CNAG 02105 sequence suggested that it might encode for an ATL1, a gene function which has not been described for C. neoformans to date. The double-joint PCR technique was employed for the construction of the deletion cassettes aiming the substitution of the ATL1 ORF by the neomycin resistance marker (NEO). Genetic transformation was performed by biolistics and two independent atl1 mutant strains were confirmed by PCR analyses. Virulence phenotypes (thermotolerance, capsule formation, melanin production, active urease secretion) and the sexual cycle development were assayed in vitro. Virulence assessment in the Galleria mellonella larvae system was also performed. Subsequently, the growth properties were compared to the H99 and JF289 strains. Cells were grown on YPD medium containing: KCl, NaCl or D-Sorbitol as osmotic stressors; Congo Red or SDS as cell wall stressors; H2O2 or menadione as oxidative stressors and the alkylating agents methyl methanesulfonate (MMS) or ethyl methanesulfonate (EMS). Resistance to the genotoxic agent hydroxyurea to UV radiation exposure and to culture medium pH variation was also evaluated. Mutant strains URA5 transgene silencing rate analysis by growth on 5-FOA supplemented medium are in progress. Results: The atl1 mutant strains did not present differences in thermotolerance, expansion of the polysaccharide capsule, cell wall melanization, urease production, sexual cycle development and virulence when compared to the control strains. No phenotype alterations were detected for growth under stress conditions either. On the other hand, the mutant strains presented marked hypersensitivity to the EMS alkylating agent, but not to MMS. EMS provokes the guanine O6 position alkylation, thus generating O6-etG, a DNA damage structure that is repaired by the ATL1 protein. Conclusion: Collectively, the bioinformatics and experimental analyses suggest that the CNAG 02105 DNA sequence encodes an ATL1 protein in C. neoformans. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 419661 9a6cfa37-d176-4c93-8d90954833383b14.png

P328 Functional characterization of Urease (ureA) in Fonsecaea pedrosoi, the causative agent of Chromoblastomycosis

P331 Variation in Antigenicity among P. insidiosum Strains in Enzyme-Linked Immunosorbent Assay

1

1

1

1

2

1

1

˜ , R.J.A. Castro , C.S. Florencio , M.S.S. Felipe , J.L. DeMarco , A.L. Bocca , N. V.G Pimentel , F.A.S Brandao L. Fernandes-Matos1 1 University of Brasilia, BRASILIA, Brazil 2 ´ Universidade Catolica de Bras´ılia - UCB, BRASILIA, Brazil Objective: Fonsecaea pedrosoi, the main agent that causes chromoblastomycosis (CBM) in humans, is a filamentous fungus with a worldwide distribution. CBM is prevalent in tropical and subtropical regions, with high incidence in Africa and Latin America. The biology, virulence factors and mechanisms of pathogenesis of F. pedrosoi are still poor understood and for this reason studies involving the mechanisms this fungal pathogen uses to stablish the infection are essential for the improving the knowledge about the disease and potentially develop new antifungal therapies. Recently our group described two genetic transformation methods to facilitate the gene function studies in this fungus. We use biolistic transformation to knock out F. pedrosoi ureA gene (coding for Urease) by homologous recombination and gene replacement.The main objective of this work was to characterize F. pedrosoi urease and evaluate its potential role on virulence of this fungal pathogen. Methods: For deletion of ureA, the cassette for homologous recombination was construct by Double Joint PCR technique and genetically transformed by biolistic transformation on conidia of F. pedrosoi (CBS 271.37 strain - ATCC 18658). Transfomants were selected by Hygromycin B, checked for mitotically stability and the insertion of the selection marker was confirmed by PCR. The ability of ureA to produce urease was evaluated on Christensen’s Urea Agar and by in vitro spectrophotometric assay. We also checked if the mutant could use different nitrogen sources on YNB agar. Other phenotypes were tested as the growth at high temperature, at acid and alkali- pH, in osmotic, oxidative, nitrosative and cell wall stress conditions. The ureA was tested for virulence in vitro using primary murine macrophage (C57BL/6,). The phagocytosis index and killing by macrophage are under evaluation by microscopy and CFU count on Sabouraud agar plates. Results: This work describes, for the first time, the literature to date, the construction and obtaining of a F. pedrosoi mutant by homologous recombination and gene deletion. The gene encoding the enzyme urease is well characterized in other fungi such as Cryptococcus sp. and Coccidioides posadasii as a factor of fungal virulence. In F. pedrosoi the absence of the ureA gene was confirmed by the inability of the mutant ureA to produce urease in Christensen’s Urea Agar. The mutant was able to grow in culture medium with different nitrogen sources but showed a growth defect when urea was the only source of nitrogen. No growth defects were observed in the stress conditions evaluated. In vitro virulence experiments are underway to date. Conclusion: For the first time in literature to date, a knock out mutant was constructed in F. pedrosoi, which is one of the main causative agent of CBM. The ureA is under phenotypic characterization and the data generated by this work will potential identify the role of urease on F. pedrosoi virulence traits. This work opens new perspectives for fungal pathogenesis studies by gene deletion in this organism. Financial support: Fundac¸ao ˜ de Apoio a` Pesquisa do Distrito Federal – FAP-DF, Brazil.

P329 Comprehensive Analysis of the Microbiome of the Horny Plug, and Interaction of Malassezia Species and Propionibacterium acnes in Keratinocytes OTOMI Cho, UNNO Mizuki, TAKASHI Sugita Meiji Pharmaceutical University, KIYOSE, Japan Objective: Malassezia and Propionibacterium acnes co-exist in the horny plug, and overgrowth of these microorganisms can result in inflammation. Therefore, determination of the composition of the microbiome of the horny plug would enhance our understanding of the pathology of Malassezia and P. acnes. P. acnes also induces the production of proinflammatory cytokines by keratinocytes in vitro; however, the regulatory mechanisms of the P. acnes-induced inflammatory responses are unclear. In this study, the microbiome of the horny plug was analyzed comprehensively. Moreover, the effect of Malassezia species and P. acnes on cytokine production by keratinocytes (NHEK) was investigated. Methods: A total of 100 horny plug samples were collected from 10 healthy Japanese subjects (6 males and 4 females). The V1–V3 regions of bacterial 16S rRNA and the D1/D2 regions of fungal 26S rDNA were sequenced on the Illumina MiSeq platform. Malassezia species and P. acnes were cultured with or without NHEK, and the production of IL-6, IL-1α, IL-8, and TNF-α by the keratinocytes was examined. Results: M. restricta predominated in the fungal microbiota, followed by M. globosa. P. acnes predominated in the bacterial microbiota, followed by Bifidobacterium and Staphylococcus. In the presence of P. acnes, M. restricta induced the production of IL-6, IL-8, and IL-1α. Conclusion: Both Malassezia species and P. acnes interact.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

2

NAVAPORN Worasilchai1 , NITIPONG Permpalung2 , ARSA Thammahong1 , ARIYA Chindamporn1 1 Chulalongkorn University, BANGKOK, Thailand 2 Duke University Medical Center, DURHAM, USA Objective: To compare antigenicity of different P. insidiosum strains as antigens in Enzyme-Linked Immunosorbent assay (ELISA). Methods: Crude antigens were extracted from six P. insidiosum strains: reference strain (n = 1; ATCC 58643TM , USA) and clinical strains from patients (n = 5; No. 1–5, Thailand). The antigenicity was examined by using in-house ELISA, established by Mycology Unit, King Chulalongkorn Memorial Hospital (KCMH), against 3 groups of serum samples: 1) proven pythiosis cases (n = 40), 2) fungal and higher bacterial infection patients (n = 30; 5 samples each disease including candidiasis, cryptococcosis, aspergillosis, talaromycosis, histoplasmosis and nocardiasis), 3) healthy donors (n = 20). To standardize the ELISA results for each testing batch, the OD490 values representing antigenicity of each antigen were normalized to ELISA values (EVs) according to the following formula: EV = (ODsample – ODbackground ) / (ODcontrol – ODbackground ). Results: Thai clinical strains had significantly higher mean of EVs compared to the reference strain (7.3±0.4 vs 5.6±0.1 respectively; P < 0.0001). In non-pythiosis serum samples, there was no significant difference in means of EVs among Thai clinical strains and reference strain (P > 0.05) (figure 1). Conclusion: In this study, there is different antigenicity among Thai clinical strains and reference strain (figure 1). The results indicate that different P. insidiosum strains in ELISA assay affect EVs. It is very crucial to standardize ELISA assays among different institutions in Thailand particularly when EVs are used for disease monitoring. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 419775 c55ae736-ffe0-49c4-8d94-83a 9b447eccf.GIF Caption 1: Figure 1

P332 Fingerprinting of bloodstream isolates of Candida parapsilosis suggests horizontal transmission of infections among neonatal intensive care unit patients in Kuwait S. Ahmad1 , M. Asadzadeh1 , N. Al-Sweih1 , Z. Khan1 , F. Hagen2 , J.F. Meis3 1 Kuwait University Faculty of Medicine, SAFAT, Kuwait 2 Westerdijk Fungal Biodiver. Inst. & Canisius Wilhelmina Hospital, UTRECHT & NIJMEGEN, Netherlands 3 Canisius Wilhelmina Hospital & Radboudumc, NIJMEGEN, Netherlands Objective: Candida parapsilosis is an opportunistic pathogen and is increasingly being associated with invasive candidiasis in critically ill patients. C. parapsilosis is also a commonly isolated species from neonatal intensive care units, causing ∼35% of all candidemia cases in neonates. Nosocomial outbreaks are facilitated by spread of C. parapsilosis from health care workers (HCWs) to susceptible patients via hand carriage, its affinity for glucose-containing parenteral nutrition and ability to form biofilms on intravascular devices. This study determined genotypic heterogeneity among C. parapsilosis isolates from candidemia patients in neonatal intensive care units (NICUs) of Maternity Hospital (MH), Kuwait. Isolates from two other hospitals were also included for comparison purposes. Methods: A total of 71 C. parapsilosis isolates, including 49 bloodstream, three duplicate bloodstream and seven surveillance cultures from other body sites of 49 NICU-MH patients, 10 surveillance cultures from nine non-candidemia NICU-MH patients and two surveillance cultures from hands of two HCWs collected in MH during January, 2010 to August, 2014 were used. Additionally, 18 bloodstream isolates from 18 adult candidemia patients from two other hospitals were used. All isolates were tested by Vitek 2 and a multiplex PCR assay developed recently. Molecular fingerprinting was performed by using six highly discriminatory short tandem repeat microsatellite markers and isolates were assigned a numerical microsatellite genotype (MSG). Phylogenetic relationship among the isolates was determined by constructing a minimum spanning tree and the dendrogram was generated with bootstrapping by using unweighted pair group method with arithmetic mean (UPGMA) settings. Results: Sixty-one C. parapsilosis candidemia cases were treated at NICU-MH during the study period. Isolates from 49 patients were available for fingerprinting. All patients were pre-term low birth-weight neonates on total parenteral nutrition. All 89 isolates used in this study were identified as C. parapsilosis sensu stricto by Vitek 2 and multiplex PCR. Forty-three MSGs were identified among 71 isolates from MH with 30 isolates belonging to 30 unique MSGs and 41 isolates clustering in 13 MSGs. MSG17, MSG-25 and MSG-5 were shared by seven, seven and four isolates, respectively. Three MSGs were shared by three isolates each and 7 MSGs were shared by two isolates each. Surveillance isolates from five of seven candidemia patients yielded the same MSG as bloodstream isolate. Ten isolates from nine non-candidemia patients yielded eight MSGs with three isolates from two patients forming a single cluster (MSG-9). MSGs of five non-candidemia patients were identical to bloodstream isolates from some candidemia patients. Most cluster isolates were from patients admitted in NICU-1. Isolates from hands of HCWs and all isolates from the other two hospitals belonged to unique MSGs. Conclusion: The six microsatellite loci-based approach yielded high-resolution fingerprinting data for 89 C. parapsilosis isolates from 78 patients and HCWs in Kuwait as 48 isolates belonged to a unique MSG while 41 isolates were found in clusters. All cluster isolates were from NICU-MH patients, particularly from NICU-1. Our data suggest the presence and spreading of endemic genotypes to other patients in NICU-1 and other nearby NICUs in MH. Supported by grant YM10/11.

S130

P333 Insight into the mechanism of antifungal resistance of Candida auris M.M. Alshahni, T. Tamura, K. Makimura Teikyo University, ITABASHI, TOKYO, Japan

Medical Mycology, 2018, Vol. 56, No. S2

P336 Pneumocystis interactions with platelets and impact on the neutrophil response 1 ´ E. Frealle , M. Pichavant1 , A. Lesaffre1 , C. Zawadzki2 , E. Dei-Cas1 , E.M. Aliouat1 , P. Gosset1 1 Center for Infection and Immunity of Lille (CIIL), Pasteur Institute of Lille, LILLE, France ´ CHU Lille, Laboratoire d’Hematologie, LILLE, France

2

Objective: Evaluating roles of ABC-type efflux transporters in the resistance of Candida auris resistance against common antifungal agents. Methods: A wild-type C. auris strain and its antifungal resistant derivative strain that is generated through induction by antifungal agents were used in this study. The strains were cultured onto media containing beauvericin alone or in combination with azole agents. Moreover, expression levels of four ABC-type transporter’s homologs in those strains were analyzed by real time PCR with or without antifungal stress by fluconazole or voriconazole. Results: Addition of beauvericin helped to partially restore the susceptibility of the resistant strain against fluconazole, suggesting participation of ABC-type transporters in the resistance mechanism. Real time PCR results showed that mRNA levels of three out of the four analyzed transporters in the resistant strain were more than 2-fold higher than their counterparts in the wild-type strain under negative control and antifungal agent-containing conditions. Conclusion: C. auris is an emerging multidrug-resistant pathogen causing human mortality worldwide. Providing effective treatment has been hampered by the resistance to antifungal drugs, demanding understanding the resistance mechanism in order to devise new therapeutic strategies. Our data suggest a partial contribution of ABC-type transporters to the resistance of this pathogen.

P334 In vitro coagulation triggers anti-Aspergillus fumigatus neutrophil response 1 ´ , P. Gosset1 , S. Leroy2 , C. Delattre3 , A. Wacrenier3 , C. Zenzmaier4 , C. Zawadzki5 , E.M. Aliouat1 , S. Perkhofer4 E. Frealle 1 Center for Infection and Immunity of Lille (CIIL), Pasteur Institute of Lille, LILLE, France 2 CHU Lille, Laboratoire de Parasitologie - Mycologie, LILLE, France 3 CHU Lille, Laboratoire d’Anatomopathologie, LILLE, France 4 University of Applied Sciences, Tyrol, INNSBRUCK, Austria 5 ´ CHU Lille, Laboratoire d’Hematologie, LILLE, France

Objective: In vitro aggregation of platelets by Aspergillus fumigatus and the frequency of disseminated intravascular coagulation in disseminated aspergillosis indicate platelets could play a role in aspergillosis pathophysiology by triggering coagulopathy. This study aims to have a better understanding of Aspergillus interactions with platelets in the blood, especially during clot formation. Methods: Aspergillus fumigatus resting or swollen conidia, germlings or hyphae from CBS 144.89 or ATCC 204305 strains were inoculated into human blood sampled in tubes with anticoagulant (including EDTA and citrate) or with no additive, yielding the following blood compartments: platelet rich plasma (PRP) and PRP pellet (prepared from the citrated sample), serum and blood clot (obtained from samples without additive), and whole blood (obtained from the EDTA sample). Interactions with blood cells were explored at the anatomopathological level or on thin smears, using light microscopy, and at the ultrastructural level, using transmission electron microscopy (TEM). Concentrations of CXCL8, CXCL4 (PF4), CXCL1 and CCL5 (RANTES) chemokines and the number of viable conidia were further determined. Results: Interactions with platelets and neutrophils were observed in most compartments. In the clot, anatomopathological examination revealed resting or swollen conidia and germlings co-localization with platelet aggregates, associated with neutrophil recruitment around aggregates. TEM showed fungal conidia and hyphae surrounded by neutrophils. Thin smears of residual blood clot resulting from samples inoculated with Aspergillus conidia showed conidia phagocytosed by neutrophils. Activation with conidia or germlings but not hyphae increased CCL5 and CXCL4 concentrations, suggesting that these chemokines are involved in the recruitment of neutrophils, whereas release of CXCL1 could rather be involved in hyphae-induced response. Conclusion: These data suggest that the interaction of platelets with Aspergillus fumigatus during clot formation triggers neutrophil recruitment and activation, thus establishing a link between inflammation and coagulation. A more systematic investigation of coagulation disorders would be needed to assess the role of this phenomenon during aspergillosis.

P335 Chitin oligosaccharides (oligomer of GlcNAc) protect mycelial growth of Candida albicans in vitro and in vivo. S. A. Ishijima1 , T. Fukamizo2 , K. Satoh3 , T. Noguchi3 , Y. Guo1 , T. Yamada1 , S. Abe1 Teikyo University Institute of Medical Mycology, TOKYO, Japan Kindai University, Faculty of Agriculture, NARA, Japan 3 Koyo Chemical Co., LTD., OSAKA, Japan 1

2

Objective: The amino sugar N-acetylglucosamine (GlcNAc) is well known to induce the mycelial growth of Candida albicans. We had reported that GlcNAc aggravated murine oral and gastrointestinal candidiasis1, 2 , and C. albicans adheres to chitin, polymer of GlcNAc3 . Here we investigated the effect of chitin oligosaccharides, the oligomer of GlcNAc, on mycelial growth of C. albicans and murine oral candidiasis. Methods: C. albicans strain TIMM1768, TIMM2640 and TIMM3136 recovered from patients with candidiasis were used. Chitin oligosaccharides (GlcNAc) n (n = 1–6) were produced by partial hydrolysis of crab chitin by the method of Rupley4 . One hundred microliters of C. albicans cell suspension were aliquoted into 96-well microtiter plates (1 × 104 cfu/well for germ-tube formation, 1 × 103 cfu/well for mycelial growth analysis), 100-μl serial dilutions of chitin oligosaccharides (GlcNAc, (GlcNAc)3 or (GlcNAc)4 ) were then added the wells which made final concentration of 50 mM/ml to 3.13 mM/ml and incubated at 37’ in 5% CO2 in air for 2 h or 4 h for germ-tube formation, for 20 h for mycelial growth analysis. Animal experiments were performed according to the guidelines for the care and use of animals approved by Teikyo University (approval number 15–026). The experimental procedures for oral candidiasis model in mice were according to Takakura N et al5 . Results: Chitin oligosaccharides inhibited mycelial growth of C. albicans in vitro. Inhibition of mycelial growth detected by the length of hyphae from 4h-culture of C. albicans; hyphae length elongation of C. albicans cells in the control culture, 25 mM GlcNAc-, 25 mM (GlcNAc)3 - and 25 mM (GlcNAc)4 -supplemented culture were 89.77±20.38, 86.1±22.7, 67.18±27.96, and 42.25±22.4 μm, respectively. Average length of the elongated hyphae in the case of (GlcNAc)3 or (GlcNAc)4 were significantly less than control or monomer (P < 0.01). After 20 h culture, each volumes of hyphae attached to the bottom of the culture plates were measured by crystal violet staining method. The hyphal volume of C. albicans after 20h-culture were decreased by the presence of the oligomer of GlcNAc (degree of polymerization = 2 to 6). The inhibitory effect of mycelial growth were observed in the case of three strains of C. albicans, TIMM1768, TIMM2640 and TIMM3163 (having fluconazole-resistant phenotype). To clarify the effect of chitin oligosaccharides in vivo, their effects on experimental murine oral candidiasis were examined. The mice infected with C. albicans were administrated 50μL of 12.5 mM (GlcNAc)1-4 four times (5 min, 3 h, 24 h, 27 h). Although mice given GlcNAc showed significant aggravation of oral symptoms of candidiasis after two days (P < 0.01), mice given (GlcNAc)2-4 showed significant improvement when compared with those of GlcNAc in oral symptoms (P < 0.01). Conclusion: Application of chitin oligosaccharide as a nutritional supplement may have a better effect on oral health in people susceptible to oral or gastrointestinal candidiasis. Reference 1. Ishijima SA et al. Med Mycol, 50; 252–258 (2012) 2. Ishijima SA et al. Med Mycol, 56E; E31-E39 (2015) 3. Ishijima SA et al. Med Mycol J, 58E;E15-E21 (2017) 4. Rupley JA. Biochem Biophys Acta, 83; 245–255 (1964) 5. Takakura N et al. Microbiol Immunol 47: 321–326 (2003)

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Objective: Platelets are now well-recognized mediators of the immune response against bacteria or virus. Their role in the antifungal response has also been explored for some organisms such as Candida albicans or Aspergillus fumigatus. However, although significantly higher platelet counts in HIV-infected infants with Pneumocystis pneumonia survivors had than nonsurvivors suggest these cells could also play a role during Pneumocystis infection, their role in the anti-Pneumocystis response has not been studied so far. Methods: Aggregation of human platelets by Pneumocystis carinii was measured using an aggregometer. Pneumocystis binding to platelets within aggregates and within the blood clot was observed using TEM. The release of the platelet markers CXCL4 (PF4), CD40L and P-selectin, and the expression of Pneumocystis stress markers, including HSP70, MnSOD and Thioredoxin reductase, were measured by ELISA and RT-qPCR, respectively. Furthermore, the role of NF-kB and GpIIb-IIIa in the effect of Pneumocystis was explored using BAY11-7082 and tirofiban, respectively. Lastly, chemotaxis assays were performed in Boyden chamber to evaluate the migration of neutrophils in response to platelet mediators release, and the concentrations of CXCL1, CXCL4, CXCL8 and CCL5 (RANTES) chemokines were determined. Results: Pneumocystis markedly induced platelet aggregation. Tight Pneumocystis-platelets interactions were observed within the aggregates and the clot. Association between Pneumocystis, platelets and neutrophils also occurred within the clot. Levels of all platelet markers were increased, whereas there was no evidence of stress in Pneumocystis. GpIIb-IIIa was shown to be involved in the crosstalk between Pneumocystis and platelets, since CD40L and P-selectin production was decreased by tirofiban. But no variation in platelet markers level was observed with BAY11-7082. Activation of platelets by Pneumocystis increased neutrophil migration, a result associated with enhanced secretion of CXCL1, CXCL4, CCL5 but not of CXCL8. Conclusion: Altogether, our data indicate that Pneumocystis is able to activate platelets. Platelet interaction with Pneumocystis implicates the integrin GPIIb-IIIa and leads to the recruitment of neutrophils. Further experiments are needed to assess the impact of platelet activation on other immune cells, and their role in the anti-Pneumocystis response.

P337 Cellular and molecular insights on pro-inflammatory immune response regulation during acute Aspergillosis in chicken and turkey poults V. Risco-Castillo1 , P. Arne2 , D. Jenot2 , F. Botterel3 , J. Guillot1 , E. Melloul3 , R. Guabiraba4 , MJ. Guibert5 1 ´ erinaire ´ Ecole Nationale Vet d’Alfort, Dynamyc research group EA 7380, MAISONS-ALFORT, 94700, France ´ erinaire ´ Ecole Nationale Vet d’Alfort, Dynamyc research group EA 7380, MAISONS-ALFORT, France 3 ´ UPEC, Dynamyc research group EA 7380, CRETEIL, France 4 ´ UPEC, Dynamyc research groupe EA7380, CRETEIL, France 4 ISP, INRA, Universite´ Franc¸ois Rabelais de Tours, NOUZILLY, France 5 Lohmann France, SAINT-FULGENT, France 2

Objective: Avian aspergillosis produced by Aspergillus fumigatus is a global threat in terms of animal health and husbandry. Susceptibility to this fungal infection varies among animal species, especially poultry such as turkey poults, where high morbidity and mortality rates are often described associated with the ability of A. fumigatus conidia to colonize the lower respiratory tract (lungs and air sacs). However, little is known regarding the features of avian immune response after inhalation of Aspergillus conidia and no information regarding the role of a pro-inflammatory immune response has been so far described. The objective of this study was to improve the understanding of the interactions between A. fumigatus and local immune cells and the Th1-like immune response by comparing two avian models of acute aspergillosis. Methods: We standardized a protocol for immune cells analysis by flow cytometry in turkey leucocytes purified from blood and lung lavages. Then, we inoculated 7 days-old chicken and turkey poults by intratracheal aerosolization with a 2 × 107 conidia suspension of A. fumigatus (CBS 144.89 strain). Fungal culture of lung samples and observation of tissue lesions and fungal elements by histopathology (hematoxylin-eosin and PAS staining) was followed on days 1, 2, 3 and 7 days post-inoculation. Along with it, CD45+ leucocytes, CD41/CD61+ thrombocytes, monocytes-macrophages, CD4+ lymphocytes and CD8+ lymphocytes were studied by flow cytometry analysis of lung lavage samples, while transcription of pro-inflammatory cytokines IFNγ , IL-2 and IL-6 was assessed by RT-qPCR using the ddCT method. Results: Our results confirmed the higher susceptibility of turkey poults to A. fumigatus infection both in terms of lung lesions (swelling, granuloma formation) and mortality (Kruskal-Wallis test, P = 0.013). Flow cytometry analysis showed that chicken lung environment displayed an early (1 day post-inoculation) but transitory pulmonary recruitment of CD45+ and CD8+ cell populations (P < 0.05), while turkey poults showed a slower but steady increase of CD8+ cells. These results coincided with early cytokine expression of IFNγ and IL-2 in chicken (day 2 post-inoculation), while transcription increase of turkey IFNγ , IL-2 and IL-6 was not observed until day 7 post-inoculation. Conclusion: The inoculation technique standardized by our research group ensures exposure as for natural infection. Despite the natural low burden of immune cells on avian lung lavages, and the specificity of commercial antibodies to chicken leucocyte subpopulations, we were able to standardize a flow cytometry protocol to efficiently quantify CD45+, CD4+ and CD8+ cells in turkeys. Our avian infection models suggest a major role of a pro-inflammatory response very early during infection in chicken, while a later activation of IFNγ , IL-2 and IL-6 cytokines in turkey may indicate a deficit on cellular recruitment that would allow conidia germination and an easier colonization of lung parenchyma and air sacs. All these results highlight the need to further study the mechanisms that would trigger early pathogen recognition in birds.

P338 Mixed biofilm of Aspergillus fumigatus and Stenotrophomonas maltophilia: a strategy of protection against antimicrobial treatment? L. Roisin1 , E. Melloul1 , P.L. Woerther2 , J.W. Decousser2 , J. Guillot3 , E. Dannaoui4 , F. Botterel2 1 ´ ´ ´ EA Dynamyc 7380 UPEC, EnvA, Faculte´ de Medecine de Creteil, CRETEIL, France 2 ´ ´ ˆ Departement de Microbiologie, DHU VIC, Hopital Henri Mondor, AP-HP, CRETEIL, France 3 4

´ erinaire ´ Ecole nationale vet d’Alfort, MAISONS-ALFORT, France ´ ˆ ´ Departement de Microbiologie, Hopital Europeen Georges Pompidou AP-HP, PARIS, France

Objective: Aspergillus fumigatus (Af), a fungal opportunistic pathogen, and Stenotrophomonas maltophilia (Sm), a gramnegative bacillus, can form biofilms, especially in the respiratory tract of immunocompromised patients or in chronic respiratory diseases. In biofilms, microorganisms are embedded in an extracellular matrix, which may confer protection against antimicrobial treatment. Few data are available on biofilm susceptibility to antimicrobial treatment. We recently developed an in vitro mixed biofilm associating Af and Sm (Melloul et al., 2016) to analyze interactions between different antimicrobial agents against this mixed biofilm. The aim of the present study was to test two antifungal agents and two antibiotics on an Af-Sm mixed biofilms. Methods: Development of in vitro 24h-old mixed biofilm was performed by simultaneous static co-cultures of Af (ATCC 13073-GFP) and Sm (ATCC 13637) in 96-well plates at 37◦ C. Two antifungal (amphotericin B and itraconazole) and two antibacterial (levofloxacin and rifampicin) agents were chosen to explore their action on single and mixed 24h-old biofilms. Microscopic (CLSM, SEM), spectrophotometric (metabolic activity with XTT assay) analyses, cell viability (CFU/mL) and qPCR analyses were used to test the activity of antifungal (from 0.25 to 256 μg/mL) and antibacterial (from 0.03 to 32 μg/mL) agents on 24h-old biofilms. Results: For amphotericin B, the Af biofilm metabolism was altered at 256 μg/mL and we showed an inhibition of fungal growth of 95% at 32 μg/mL in single and mixed biofilms. Furthermore, the hyphae were lysed in single and mixed biofilms after treatment with 64 μg/mL of amphotericin B. For itraconazole, there was no effect on Af in single and mixed biofilms until 256 μg/mL. In Sm single biofilm, levofloxacin and rifampicin had no effect on Sm if the concentration was 0.05) (Fig1G). In case of C. parapsilosis, fluconazole did not result significant fungal damage at tested concentrations. However, enhanced activity was observed in 50% serum at concentrations from ≥0.03 mg/L (59.0%±7.24% to 99.63%±0.26%). Therefore, all isolates were more susceptible at concentrations ranging from 0.015 to 512 mg/L in 50% serum as compared to susceptibility in RPMI-1640 (P < 0.01) (Fig1B). For amphotericin B, significant differences in metabolic activity were observed between RPMI-1640 and RPMI-1640 with 50% serum at concentrations between 0.015 and 1 mg/L (P < 0.01) (Fig1D). The echinocandins showed high activity against C. parapsilosis biofilms in 50% serum, where significant metabolic activity decrease was observed at ≥0.015 mg/L (69.38%±11.53% to 99.38%±0.63% for caspofungin and 67.63%±11.37% to 99.63%±0.26% for micafungin, respectively) (P < 0.01-0.05) (Fig1F, H). Conclusion: Though a better anti-biofilm activity is expected with echinocandins or amphotericin B, this is diminished by high protein binding. In contrast, the expectedly poorer activity of fluconazole on biofilms is enhanced by the inhibitory effect of serum on biofilm formation, which in turn does not decrease the effective fluconazole concentration markedly. Additionally, the significant biofilm mass decrease triggered by serum enhance the effect of fluconazole. The high antifungal activity of fluconazole in the presence of 50% serum both against C. albicans and C. parapsilosis biofilms support the usage of fluconazole as prophylaxis, which may reduce incidence of catheter-associated fungal infections especially in case of C. parapsilosis. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 420219 2c8cade3-5030-489e-9cadb48974380846.jpg

Objective: The antifungal agent amphotericin B is available in two forms, Fungizone that is dissolved in sodium deoxycholate and the liposomal form Ambisome. Both drugs have same mechanism of action, targeting fungal ergosterol because their active ingredient is amphotericin B. However, several studies have reported that the range of minimal inhibitory concentration (MIC) of Fungizone is 0.5 – 2 μg/mL but for Ambisome is wider with lower values, especially for Cryptococcus gattii. The aim of this study was to evaluate the effect of freeze-thaw preparation on the activity of Ambisome against C. gattii. Methods: A total of 22 fungal strains, C. neoformans (n = 10), C. gattii (n = 12) and two quality control stains Candida krusei ATCC 6258 and Candida parapsilosis ATCC 22019 was used. MICs of Fungizone and Ambisome prepared freshly or frozen/thawed for one round, were assessed. Both medicines were dissolved according to the manufacturer’s instructions. Susceptibility tests were conducted following the M27-A3 protocol of CLSI; serial twofold dilutions were prepared with RPMI1640 medium. Results: The MIC range of freshly prepared Ambisome was 0.25 – 1 μg/mL, while it was 0.05 – 0.5 μg/mL after freeze/thaw preparation. Moreover, the MIC of frozen plates of Fungizone was 1 – 2 μg/mL. In addition, there was a tendency to show lower MIC values especially in C. gattii with thick capsule. On the contrast, for strains of C. neoformans or C. gattii with thin capsules, MIC values did not influenced by the freeze/thaw preparation. Conclusion: Lower MIC values of Ambisome could be attributed to both liposome components and capsule thickness, as the thicker the capsule of fungus, the lower the MIC values. Moreover, the influence of the liposomal medicine’s other ingredients, phosphatidylcholine, the phosphatidylglycerol and the cholesterol, has not been explored yet as they are insoluble in the culture medium. Our future studies will consider the effect of structural change due freezing of liposome and the adsorption through the capsule.

P341 Epidemiological Study of Fusarium Species Causing Invasive and Superficial Fusariosis in Japan Y. Muraosa, M. Oguchi, M. Yahiro, A. Watanabe, T. Yaguchi, K. Kamei Medical Mycology Research Center, Chiba University, CHIBA, Japan Objective: In Japan, Fusarium species are known etiological agents of human fungal infection; however, there has been no report of a large-scale epidemiological study on the etiological agents of fusariosis. Methods: A total of 73 Fusarium isolates from patients with invasive fusariosis (IF, n = 36) or superficial fusariosis (SF, n = 37), which were obtained at hospitals located in 28 prefectures in Japan between 1998 and 2015, were used for this study. Fusarium isolates were identified using Fusarium- and Fusarium solani species complex (FSSC) -specific real-time PCR and partial DNA sequences of the elongation factor-1 alpha (EF-1α) gene and the nuclear ribosomal internal transcribed spacer (ITS) region. Results: FSSC was predominately isolated from both patients with IF and SF (IF, 77.8% and SF, 67.6%). Distribution of the phylogenetic species of FSSC isolates from patients with IF and SF exhibited different spectra; specifically, F. keratoplasticum (FSSC 2) (25.0%) was the most frequent isolate from patients with IF, whereas F. falciforme (FSSC 3+4) (32.4%) was the most frequent isolate from patients with SF. Fusarium sp. (FSSC 5) was the second most frequent isolate from both patients with IF and SF (IF, 22.2% and SF, 24.3%). Notably, F. petroliphilum (FSSC 1) was isolated only from patients with IF. Each species was isolated from a broad geographic area, and an epidemic was not observed. Conclusion: This is the first epidemiological study of Fusarium species causing IF and SF in Japan.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

P345 Immunomodulation against Paracoccidioides brasiliensis: action of human monocytes stimulated with extract of Plinia jaboticaba leaves in vitro K.Z.S. Batista, M.C. Souza, T. Costa, H.H. Silva Filho, M.D. Alberton Universidade Regional de Blumenau - FURB, BLUMENAU, Brazil Objective: To evaluate the immunomodulatory action of extract from Plinia jaboticaba leaf on culture of human monocytes, as well as the viability of the monocytes stimulated and challenged in vitro with the fungus Paracoccidioides brasiliensis. Methods: A human monocyte culture of 17 healthy volunteers was used to evaluate the effects of the concentrations of 100 mg/ml, 50 mg/ml, 25 mg/ml and 12.5 mg/ml of P. jaboticaba. To quantify levels of nitric oxide production by the monocytes, the concentration of NO is evaluated indirectly after enzymatic reduction of nitrate (NO3 − ) to nitrite (NO2 − ) by nitrate reductase, using the Griess Colorimetric Reaction. After incubation, the absorbance (570 nM) was determined and the results expressed in nM. The cytotoxicity of the extract was verified by uptake and reduction of the MTT salt by viable monocytes. To obtain the monocyte cell viability rate, a specific formula was used [cell viability = (Absorbance of sample cells - Absorbance of white well) / (Control cell Absorbance - White well Absorbance) X 100]. To verify the normality of the data, the results were submitted to the Shapiro-Wilk Test, and then submitted to the Tukey test, for multiple comparison between concentrations. The level of significance was 95%. Results: Each cell culture was analyzed individually and tested against the fungal stimulus and with the different concentrations of the plant extract of Plinia jaboticaba leaves. The results showed that the cellular stimulus occurred from the cultures with fungus and extract at concentrations of 50 mg/ml and 100 mg/ml, where in these concentrations the production of nitric oxide (NO) was 0.088 μM and 0.096 μM, respectively. It is important to note that none NO production was observed in the cultures stimulated only with the P. brasiliensis fungal suspension. This fact demonstrates that the NO production verified was effectively stimulated by the plant extract. Regarding the cell viability experiments, in all concentrations there is no cytotoxicity when compared to the control group. In addition, at all concentrations evaluated, after 24-hour sensitization, an increase in cell proliferation was observed in a dose-dependent manner (the higher the concentration, the greater the cell proliferation). The significant concentration that presented the highest growth, was 100 mg/ml, with 176.01% of cell proliferation. Conclusion: The use of different concentrations of P. jaboticaba leaf extract for the activation of human monocytes in vitro showed that, at 50 mg/ml and 100 mg/ml concentrations, the extract stimulated NO cell production to assist in the oxidative capacity against P. brasiliensis. Considering the absence of cytotoxicity and extract concentrations necessary for induction of cell proliferation, it is suggested that Plinia jaboticaba extract has an important potential in the therapeutic use.

S132

P346 The role of C. neoformans Cys-3 transcription factor in sulfur uptake RC Pascon, AK Tashima, MA Vallim, AT Melo ˜ Paulo, DIADEMA, Brazil Federal University of Sao

Medical Mycology, 2018, Vol. 56, No. S2

P349 Candida albicans quorum sensing molecule Farnesol modulates human dendritic cells function by nuclear receptors activation W. Vivas1 , I. Leonhardt2 , O. Kurzai3 Lebniz Institute for Natural Product Research and Infection Biology - HKI, JENA, Germany Leibniz Institute for Natural Product Research and Infection Biology - HKI, JENA, Germany 3 ¨ ¨ Institute for Hygiene and Microbiology, University of Wurzburg, WURZBURG, Germany 1

Objective: Invasive fungal infections (IFIs) are important causes of morbidity and mortality, especially in immunocompromised patients. Cryptococcosis is one of these major fungal diseases and it is caused by Cryptococcus neoformans. In order to adapt and survive in diverse ecological niches, such as the animal host and environment, this opportunistic pathogen relies on its ability to uptake nutritional elements, such as carbon, nitrogen, iron, phosphate, sulfur, amino acids, etc. Genetic circuits play a role in responding to environmental cues by activating genes, which will adapt the microbial metabolism to the nutrients available favoring the best energy usage and survival. We studied the sulfur assimilation and its implications on C. neoformans biology. Methods: The gene CNAG 04798 annotated in the genome of C. neoformans as CYS3, encodes a putative classic Bzip transcriptional factor, which elsewhere has been considered an essential gene in C. neoformans. However, we showed that Cys-3 is not essential; in fact, its knockout led to sulfur amino acids double auxotroph, which can be partially satisfied by removing the nitrogen catabolite repression (NCR) with proline as sole nitrogen source and addition of cysteine and methionine to the medium. Our data indicates that Cys-3 is required in order to mobilize sulfur to the cells in the form of sulfate; however, in its absence, secondary sulfur source (cysteine and methionine) must be acquired from the substrate. Deletion mutants (Dcys-3::NeoR) have a poor growth rate in synthetic medium supplemented with the 3 amino acids (Pro, Cys and Met) and a completely loss of growth in rich medium (YEPD). Results: Fluorescent microscopy showed that a GFP-Cys-3 co-localizes with DAPI staining to the nucleus during growth in rich medium (80 ± 3%), co-localization drops down in synthetic medium (10 ± 4%) and at higher temperature (1 ± 0.5%) growth (37 ◦ C). Also, western blot analysis showed that phosphorilation status of the protein varies according to the nutritional condition. Moreover, GFP-Cys3 was co-immunoprecipitated and protein complexes were analyzed by MALDI-TOF and LC/MS and we uncover three interacting phosphatases (CNAG 01744 GPP2, CNAG 04796 calcineurin-CNA1 and CNAG 03370 CNB2) in a nutrient deprivation condition. Protein extracts from the same strain grown in rich medium were also subjected to immunoprecipitation, and, in this case, we identified Met3, a double function protein (ATP sulfurilase and a protein kinase) encoded by CNAG 04215. Two-hybrid assays and gene deletion experiments are underway to confirm the protein interactions found. Conclusion: The literature and also our published data have shown how relevant amino acid biosynthesis and uptake are for C. neoformans biology. In this work we have broaden this research field by showing that sulfur assimilation is important and is an interesting pathway to the yeast cell survival. The knowledge of this process and its impact on virulence can bring significant advances in the treatment of invasive fungal infections.

P347 Role of MFS Transporter QDR2 in a Pathogen Candida glabrata T. W. Widiyanto1 , X. Chen1 , S. Iwatani1 , H. Chibana2 , S. Kajiwara1 1 Tokyo Institute of Technology, YOKOHAMA, Japan 2 Chiba University, CHIBA, Japan Objective: Candida glabrata is one of the commensal fungal species in human. In immune compromised individuals, it becomes one of the second major causes of candidiasis in mucosal, blood stream, and genito-urinary tract. The high incidences of C. glabrata infections have increased significantly in the last two decades, mainly due to its ability to resist various antifungal drugs (MDR) and form biofilm. The ability of transmembrane transport to actively efflux the drug out of the cell is mediated mainly by ATPBinding Cassette (ABC) and MFS (Major Facilitator Superfamily) transporter proteins. In this study, we focus on one of C. glabrata genes belong to MFS-DHA1 family, namely C. glabrata QDR2. This gene was identified from more than 100 C. glabrata gene disruptants, encoding proteins that include transmembrane domain or signal peptide, as the gene related with the biofilm formation in the previous study. The C. glabrata biofilm is a group of yeast cells with complex interconnected system, embedded within an extracellular matrix (ECM) on hosts’ epithelial surface as well as on inert surfaces such as implanted medical devices. By forming the biofilm, C. glabrata limits drug penetration and further cause drug resistance with persistent infection. In an attempt to clarify the mechanism of C. glabrata biofilm formation, we investigated the role of CgQDR2 in the virulence traits of C. glabrata. Methods: The difference of biofilm formation between C. glabrata qdr2 mutant and its wild type strain (CBS138) was found out by XTT and crystal violet assay on the surface of 96-well polystyrene plate. The biofilm cells were further examined under SEM and also several gene expressions were checked by qRT-PCR. In addition, we used antifungal drug fluconazole to determine MIC of C. glabrata qdr2 mutant. To detect the adherent cells during the initial step of biofilm formation, we used CFDA-SE as a fluorescent dye that only label viable cells. Furthermore, we analyzed C. glabrata qdr2 growth under different pH conditions. Results: There was a significant difference of the biofilm formation between C. glabrata qdr2 mutant and the wild type strain (CBS138). We found that the relative qdr2 mRNA expression level during biofilm phase of the wild type increased approximately 36fold as compared to the free-floating (planktonic) cells. Moreover, QDR2 deletion affected C. glabrata susceptibility to fluconazole that might interrupt the drug efflux mechanism in C. glabrata biofilm. In further examination, we discovered a decrease in the adherent cells of the qdr2 mutant at the initial step (90 minutes) of the biofilm formation process. Additionally, CgRIM101 (CAGL0E03762g), a pH responsive transcription factor, was upregulated in the mutant during planktonic phase and the qdr2 mutant was unable to grow vigorously under neutral pH conditions compared to the wild type. Conclusion: Based on our results, we suggested that QDR2 deletion might cause an impaired ability of C. glabrata to maintain pH homeostasis, then might lead to the reduction of cell growth, adherent cells numbers, the amount of biofilm formed, and eventually affect C. glabrata biofilm susceptibility and drug efflux towards antifungal drugs.

P348 K577 in intracellular loop 1 of C. albicans ABC transporter Cdr1 plays a critical role in drug transport K. Niimi1 , E. Lamping1 , W. Watanasrisin2 , C. Yurayart2 , S. Saiwan2 , A. Chindamporn2 , R.D. Cannon1 , M. Niimi2 University of Otago Faculty of Dentistry, DUNEDIN, New Zealand 2 Chulalongkorn University, BANGKOK, Thailand 1

Objective: Over-expression of the multidrug efflux pump Cdr1 is the main mechanism of azole resistance in the opportunistic fungal pathogen Candida albicans. Cdr1 belongs to the full-size pleiotropic drug resistance (PDR) family of ATP-binding cassette (ABC) transporters and consists of two nucleotide binding domains (NBDs) and two transmembrane domains (TMDs) with a [NBD-TMD]2 domain arrangement. TMD1 and TMD2 each consist of six transmembrane segments (TMSs), and together have six extracellular (EL1-6) and four intracellular loops (IL1-4) between adjacent TMSs. The structure and function of PDR transporters, however, is not well understood, and further knowledge is required to develop effective efflux pump inhibitors that can overcome clinically important resistance. The objective of this study was to identify Cdr1 amino acids that play key roles in drug transport. Methods: Using a Saccharomyces cerevisiae strain overexpressing Cdr1 we employed PCR-based site-directed mutagenesis to substitute two positively charged Cdr1 amino acids, which were conserved among 244 fungal PDR sequences, with negatively charged amino acids. The drug susceptibilities of the mutants were determined by measuring the minimum growth inhibitory concentrations (MICs) of Cdr1 pump substrates, and the ATPase and rhodamine 6 G efflux activities of the mutated Cdr1 pumps were also determined. GFP-tagged Cdr1 was visualized using confocal microscopy to determine protein localization within yeast cells. Spontaneous azole-resistant suppressor mutants were obtained after growing mutant cells on YPD agar plates containing itraconazole, rhodamine 6 G or cycloheximide at ∼4-10 times their MICs. A 3D homology model visualizing the spatial arrangement of Cdr1 mutations was constructed using PyMOL. Results: K577E (IL1) substitution in the N-terminal half of Cdr1 severely affected drug efflux activity and proper localization to the plasma membrane. In contrast, the R1260E (IL3) substitution of the equivalent amino acid in the C-terminal half of Cdr1 caused only minor effects on pump activity. Spontaneous drug-resistant suppressor mutations of Cdr1-K577E included amino acid reversion (Cdr1-E577K), but also the additional mutations: W1038S, Q1253K and G500C. The suppressants had either partial (W1038S and Q1253K) or completely restored (G500C) drug transport function and ATPase activity. The single mutations W1038S, Q1253K or G500C alone, however, did not affect the transport function of Cdr1. A 3D homology model of Cdr1 based on the human ABCG5/ABCG8 transporter revealed that K577 is in close proximity to G500 which is part of the coupling helix CH1 just N-terminal of TMS1 suggesting a direct interaction between the residues. The model also implied that the reversal of the K577E phenotype by the W1038S or Q1253K suppressor mutations involves long-distance indirect communication with K577E, which might explain the only partial recovery of pump function. Conclusion: Substitution of the conserved amino acid K577E in IL1 conferred a more drastic effect than replacement of the equivalent amino acid in IL3 indicating asymmetric functions for the two halves of Cdr1. These results demonstrate the importance of K577 and G500 in coupling ATP-hydrolysis at the NBDs to asymmetric conformational changes at the TMDs necessary for Cdr1 drug transport.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

2

Objective: Farnesol, the first quorum sensing molecule described in eukaryotes, is produced by Candida albicans and controls filamentation in these fungi. The mechanism of how farnesol blocks the C. albicans yeast to hyphae transition is well known; however, the impact of farnesol on host cells is poorly understood, especially on dendritic cells (DCs) which are key regulators of immunity against C. albicans. The aim of this study is to evaluate the effect of farnesol on dendritic cell differentiation and maturation by analyzing the phenotype, transcriptional profile and functionality. Methods: Monocytes were differentiated into DCs in presence or absence of farnesol, PPARγ and RARα agonist and antagonist. Transcriptional analysis of DCs in response to farnesol was performed by a microarray assay. DCs immunophenotype was addressed by flow cytometry. PPARγ and RARα activation was measured by qRT-PCR. Results: Farnesol treatment impaired surface expression of key markers for maturation and antigen presentation (HLA-DR, CD40, CD86 and CD80). Furthermore, farnesol modulates the displacement of CD1 molecules. While CD1a showed reduced expression; CD1d, a molecule involved in invariant Natural Killer T (iNKT) cell activation, was increased on DCs generated in the presence of farnesol. The microarray analysis showed a high number of differentially regulated genes included in the PPARγ pathway. Interestingly, we found an elevated activation of PPARγ and RARα, and the use of antagonists for these nuclear receptors blocked the impact of farnesol on the expression of CD1 and costimulatory molecules. Conclusion: Our results suggest that farnesol regulates DCs phenotype and induce transcriptional rewiring in these cells. This quorum sensing molecule affects costimulatory and CD1 molecules expression by PPARγ and RARα activation. Further experiments will be performed in order to elucidate the functional properties of CD1d upregulation by farnesol.

P350 Characterization of Acyl-CoA Synthetase Faa1p Involved in Fatty Acid Utilization of Malassezia spp. Tenagy, M. Ishiai, S. Iwatani, S. Kajiwara Tokyo Institute of Technology, YOKOHAMA, Japan Objective: Malassezia spp. are opportunistic fungal pathogens causing dandruff, pityriasis versicolor, seborrheic dermatitis, atopic dermatitis, and other skin diseases. This fungus can not synthesize fatty acids de novo due to the lack of the gene encoding fatty acid synthase (FAS). Thus, Malassezia spp. commensally grow in a lipid-rich environment such as skin, scalp and other sebaceous areas of human and homothermic animals. One of the pathogenicity traits of Malassezia spp. is the lipase secretion for lipid degradation into fatty acids, which then cause irritation of the host’s skin. Some fatty acids will also be consumed and utilized for the growth of this fungus. Before a fatty acid can be metabolized in any metabolic pathways, it has to be activated into the acyl-CoA ester by acyl-CoA synthetases (ACSs). However, how fatty acid is activated and utilized in Malassezia spp. remains unclear. Here, we observed the characteristics of Faa1p, one of the major fatty acid activators, in M. globosa, M. pachydermatis, and M. sympodialis. Methods: Orthologs of Saccharomyces cerevisae ACSs in Malassezia spp. were searched using protein BLAST analysis from NCBI. Transcriptional expression of Malassezia ACS genes in various medium containing fatty acid was analyzed by qRT-PCR. The candidate FAA1 genes of M. globosa CBS7966T, M. pachydermatis CBS 1879NT, and M. sympodialis CBS 7222T were expressed in S. cerevisiae faa1faa4, then analyzed for their growth at 30◦ C in the medium containing 5 μg/ml cerulenin (a FAS inhibitor) and 0.5 mM long-chain fatty acids. Minimum inhibitory concentration (MIC) of triacsin C, as an ACS inhibitor, was analyzed to figure out its effect to Malassezia. To know whether this drug can block the function of Malassezia Faa1p inS. cerevisiae mutant, triacsin C was also supplemented in cerulenin and fatty acid-containing medium. Results: We found the orthologs of S. cerevisiae Faa1p in the genome of M. globosa (MGL 3626), M. pachydermatis (Malapachy 0054), and M. sympodialis (MSY001 1358), each with query cover more than 85% and identity more than 35%. Transcript level of these genes was induced by the presence of fatty acids. The expression of these Malassezia FAA1 genes restored the growth of S.cerevisiae faa1faa4 on medium containing cerulenin supplemented with myristic acid (C14:0), palmitic acid (C16:0), and oleic acid (C18:1). Surprisingly, the S. cerevisiae mutant expressed with M. globosa and M. pachydermatis FAA1 could grow better than the wild-type on cerulenin medium containing lauric acid (C12:0). Supplementation of triacsin C inhibited the growth of M. pachydermatis in YPD medium at 5 μM. This drug also blocked the rescue of M. globosa, M. pachydermatis, and M. sympodialis Faa1p in S. cerevisiae faa1faa4. Conclusion: Faa1p candidates of M. globosa, M. pachydermatis, and M. sympodialis have similar function with that of S. cerevisiae for utilization of myristic acid, palmitic acid, and oleic acid. The ability to utilize lauric acid and susceptibility to triacsin C were revealed as the additional characteristics of Malassezia Faa1p unlike S. cerevisiae Faa1p.

P351 The evaluation of synthetically prepared β-(1→3)-nonaglucoside as an anti-Candida immune response modifier ˇ a´ 1 , D.V. Yashunsky2 , A.A. Karelin2 , Y.E. Tsvetkov2 , N.E. Nifantiev2 E. Paulovicova´ 1 , L. Paulovicova´ 1 , R. Pilisiov 1 Center for Glycomics, Institute of Chemistry, Slovak Academy of Sciences, BRATISLAVA, Slovak Republic N.D. Zelinsky Institute of Organic Chemistry, Russian Academy of Sciences, MOSCOW, Russia

2

Objective: Candida albicans forms part of the commensal microbial flora of mucosal surfaces and alimentary tract in humans. However, this fungus is able to cause severe mucosal and life-threatening systemic infections in immunocompromised patients. The host response to the fungal infection depends on the antigenic determinants recognition and on effector immunocompetent cells activation. The majority of fungi is detected within hours by innate defence mechanisms. Adaptive immunity is mediated by production of chemokines and cytokines by most cells of the innate immune system. They are able to activate T cells through expression of co-stimulatory molecules and produce cytokines that will regulate the adaptive immune response. C. albicans cell wall represents the important host-pathogen interface. Immunologically most active cell wall polysaccharides, β-D-glucans and mannans, represent pathogen-associated molecular patterns. Several synthetically prepared linear and branched glycooligosaccharides, representing fungal cell wall antigenic structures, were analysed as molecular probes to study host-fungal interrelationships for immunotherapy interventions and vaccine development. To identify relevant antigenic structure of Candida cell wall immunogenic components, it is appropriate to analyse their properties on the different levels of humoral and cellular immune responses. We analysed immunomodulatory properties of synthetically prepared linear β-(1→3)-nonaglucoside ligand (G9) bovine serum albumin (BSA) conjugate (G9-BSA). Methods: Balb/c mice (6–8 w old) were used for sequential immunizations (Fig. 1) with synthetically prepared G9–BSA conjugate (100 μl per dose, 6 μg of β-(1→3)-nonaglucoside ligand). ELISA and ELISPOT were used to follow up specific humoral response and Th1/Th2/Th17 polarization. Experimental infection was induced with azole-resistant clinical C. albicans strain (CCY 29-3-164, CCY, IC SAS, Slovakia). Results: Antigen-specific IgG response following 2nd s.c. boost immunisation was dominant (45-times increase vs pre-immune) and persisted post-immunisation. Contrary to the slight increase of C. albicans yeast morphoform-specific antibody levels, G9–BSA immunization significantly increased hyphae - specific IgG levels. IFNμ (Th1 cytokine) production overcame IL-4 (Th2 cytokine). In G9-BSA immunized mice C. albicans organs dissemination was reduced compared to the control and experimental infection reveals differences based on the route of vaccine administration, reduction were apparently higher for intraperitoneal boost application. Conclusion: Synthetically prepared nonaglucosaccharide mimicking Candida derived structure moiety represents immunological tool in Candida subcellular vaccine design and prospectively for follow-up of targeted antifungal therapy. This work was supported by the Scientific Grant Agency of the Slovak Republic VEGA (project 2/0098/17) and by the Slovak Research and Development Agency under the contract No. APVV-15-0161. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 420684 2f7fe479-272e-4312-b9cd25fdde2a4064.gif Caption 1: G9-BSA sequential immunization and sapling schedule.

ABSTRACT

S133

P352 Involvement of Candida albicans Bgl2p, Ecm33p and Als1p in adherence to saliva-coated surfaces

P355 In vitro activity of citral combined with fluconazole against Candida planktonic and sessile cells

Hoa T. Nguyen1 , Naoki Inokawa1 , Ruoyu Zhang1 , Shun Iwatani1 , Ann R. Holmes2 , Richard D Cannon2 , Susumu Kajiwara1 1 Tokyo Institute of Technology, Yokohama, Japan 2 University of Otago School of Dentistry, DUNEDIN, New Zealand

´ K. Miranda-Cadena, A Perez-Rodriguez, C Marcos-Arias, E Mateo, E Eraso, G Quindos Universidad del Pa´ıs Vasco/Euskal Herriko Unibertsitatea (UPV/EHU), BILBAO, Spain

Objective: Candida albicans is an opportunistic human pathogen that causes oral candidiasis. The adhesion of this yeast to saliva-coated surfaces is an important early step in the infection process. Previous studies have shown that two C. albicans cell wall proteins, Bgl2p and Ecm33p, may mediate the interaction between the yeast and hydroxyapatite via saliva. This interaction is an initial event in the colonization of the oral cavity, which leads to oral diseases such as candidiasis and denture stomatitis. The aim of this research was to investigate the roles of these two cell wall proteins in the adherence of C. albicans to saliva-coated hydroxyapatite (SHA – a model for the tooth surface). Methods: Null mutants of the three genes BGL2, ECM33 and ALS1, the three double mutants, and the triple mutant, were generated in wild-type C. albicans strain (SC5314) using SAT1-flipper gene disruption method. A novel method for measuring yeast adherence, based on labeling the yeast with the fluorogenic compound Nile Red, was used to investigate the adherence of C. albicans strains. SHA beads were incubated with the wild-type or mutant strains to determine the interaction between the yeast cells and the beads. After incubation, loosely adherent C. albicans cells were removed by washing the beads twice with buffer, and then yeast cells attached and unattached to SHA beads were stained with Nile Red. The fluorescence was measured by Variouskan LUX Microplate Reader to quantify the yeast adhesion. Results: The adhesion of the bgl2 and ecm33 homozygous mutants to SHA beads was 93.2 ± 2.3% and 64.0 ± 10.8% that of the wild-type strain, respectively. Interestingly, the adhesion of the bgl2/ecm33 mutant (81.2 ± 10.6%) was higher than that of ecm33 mutant. qRT PCR verified that ALS1 gene was over-expressed in the bgl2/ecm33 strain. This result suggested that the double mutant had developed a compensatory response to the reduced cell wall integrity caused by BLG2 and ECM33 deletion. Therefore, we disrupted all three gene (bgl2/ ecm33/als1) in order to investigate this hypothesis. The null mutant deleted in all three genes showed a significantly reduced adherence to SHA beads down to 57.1 ± 6.1% that of the wild-type strain. Conclusion: In conclusion, this study has demonstrated that the fluorescent compound Nile Red can be used to measure the adhesion of C. albicans strains to saliva-coated surfaces. These results indicated that the two cell wall proteins Bgl2p, Ecm33p contribute to interaction between C. albicans and saliva-coated surfaces. We propose that the deletion of these two genes triggered compensatory responses in the yeast cells. In particular, we observed that the ALS1 gene was overexpressed in the bgl2/ecm33 mutant strain, and deletion of all three genes caused a significant decrease in the adhesion of C. albicans to saliva-coated hydroxyapatite beads.

P353 The histone acetyltransferase GcnE regulates development and adherence in the human fungal pathogen Aspergillus fumigatus CJ Lin, YL Chen National Taiwan University, TAIPEI, Taiwan Objective: Pathogens can rapidly adapt to different environments via a fine tuned transcriptional network. Histone modifications including methylation, acetylation and phosphorylation play a crucial role in gene regulations in eukaryotes. The acetylation module of SAGA complex comprises of an acetyltransferase GcnE and two adaptor proteins AdaB and AdaC, and is involved in the acetylation of histone H3. In Aspergillus, GcnE has been shown to regulate asexual development and secondary metabolism in A. nidulans and A. flavus; however, it’s function in the human pathogenic fungus A. fumigatus is poorly understood. Methods: We identified the components of histone acetylation module using blast analysis and characterized gene functions by disruption and complementation. General phenotypic analysis such as fungal growth, stress response and asexual development were performed. In addition, histone acetylation activity and biofilm formation were determined by western blot and crystal violet assay, respectively. Results: We showed that the gcnE mutant exhibits a slight impact on growth rate but a severe effect on conidiation. Levels of acetylation in histone H3 was reduced in the gcnE mutant compared with the wild type. Furthermore, loss of gcnE resulted in a defect of biofilm formation and fungal adherence to plastic surface. Levels of genes involving conidiation and adherence were down regulated in the gcnE mutant. Conclusion: GcnE is involved in histone H3 acetylation and plays a role in fungal growth, asexual development and adherence in the human pathogen A. fumigatus.

P354 Development and validation of in vitro microtiter-based viability assay incorporating resazurin for drug discovery and susceptibility testing against Madurella mycetomatis S. O. Abd Algaffar1 , S.A. Khalid2 , W.J. Van de Sande3 Faculty of Pharmacy, University of Science & Technology, Omdurman, Sudan, OMDURMAN, Sudan Faculty of Pharmacy, University of Science & Technology, OMDURMAN, Sudan 3 Erasmus MC, Department of Medical Microbiology, ROTTERDAM, Netherlands

Objective: To evaluate in vitro activity of citral in combination with fluconazole against azole resistant-Candida planktonic and sessile cells. Methods: The antifungal activity of citral in combination with fluconazole against planktonic cells was evaluated by checkerboard assay. Six oral fluconazole-resistant isolates of Candida; including one isolate of Candida albicans and Candida dubliniensis, two of Candida glabrata and Candida krusei; and one azole-susceptible Candida tropicalis were tested. Candida albicans ATCC MYA-2876, Candida krusei ATCC 6258, Candida parapsilosis ATCC 22019 and the hypha-deficient Candida albicans Ca2 strain were used as controls. The final concentrations of citral and fluconazole used against planktonic cells were 2–1024 mg/L and 0.125-64 mg/L, respectively. For the evaluation of the antifungal activity against sessile cells of mature biofilms previously developed for 24 h, the final concentrations of citral and fluconazole ranged from 8–512 mg/L and 0.25-64 mg/L, respectively. The minimum inhibitory concentration, defined as the antifungal concentration yielding a 50% reduction in the cell growth or metabolic activity respect to control well; MIC, was determined by optical density reading, while the MIC of sessile cells (SMIC) was estimated through biomass reduction quantification and metabolic activity determination. Fractional inhibitory concentration index (FICI) was calculated and the in vitro interaction of the antifungal combination was interpreted as follows: FICI ≤0.5, synergistic; FICI > 0.5 but ≤ 1, additive; FICI >1 indifferent and FICI >4 antagonistic. Moreover, the killing activity of the antifungal combination was assessed by the analysis of the time-kill curves with 8, 4 and 16 mg/L of fluconazole and 128 and 256 mg/L for citral. The number of CFU/mL was determined at 0, 2, 4, 6, 24 and 48 h. Synergism was defined as a decrease in CFU/mL of ≥ 2 log10 compared to the most active drug; indifference as a decrease in CFU/mL < 2 log10 and antagonism as an increase in CFU/mL ≥ 2 log10 . Results: The citral and fluconazole combinations were active against planktonic cells of fluconazole-resistant Candida species showing a synergistic effect; while against Candida krusei isolates, this effect was additive (Table 1). In contrast, time-kill analysis did not show synergism compared to the activity of fluconazole alone. However, the highest decrease in CFU/mL was observed for the combination of 256 mg/L of citral with 8 mg/L of fluconazole against azole-resistant Candida isolates at 24 h. The synergism between citral and fluconazole against sessile cells was established at 0.25 mg/L and 256 mg/L, respectively (FICI 0.5). In addition, this combination reduced the metabolic activity of mature biofilms of azole-resistant Candida isolates but not their biomass. Conclusion: Citral combined with fluconazole showed an excellent antifungal activity against planktonic cells of fluconazoleresistant Candida and reduced the metabolic activity of azole-resistant Candida biofilms.

´ ONCE “Oportunidad al Talento” and Fondo Social Europeo, Funding: This study was partially financed by Fundacion GIC15/78 IT-990-16 (Gobierno Vasco-Eusko Jaurlaritza) and UFI 11/25 (UPV/EHU). Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 420870 622a75b6-4520-43d0-aeaa12b4b087c32f.jpg

P356 Aspergillus fumigatus targets flotillin-dependent lipid rafts of phagolysosome membrane T. Heinekamp1 , F Schmidt1 , H. Schmidt1 , A. Thywissen1 , M. Roecker1 , S.G. Filler2 , A.A. Brakhage1 1 Leibniz Institute for Natural Product Research and Infection Biology, JENA, Germany 2 Los Angeles Biomedical Research Institute at Harbor-UCLA Medical Center, TORRANCE, USA Objective: Human-pathogenic microorganisms have evolved diverse strategies for establishing a pathogenic life style inside phagocytic host cells. Here, we report the discovery of an unprecedented molecular mechanism by which dihydroxynaphthalene (DHN) melanin of conidia of the most important airborne fungal pathogen, Aspergillus fumigatus, disrupts flotillin-dependent lipid-raft microdomains in the phagolysosome membrane. Methods: By using cholera toxin subunit B to visualize GM1 sphingolipids as a marker for lipid rafts, we demonstrated that only DHN-melanin free conidia of the pksP mutant residing in acidified phagolysosomes were surrounded by membranes containing GM1. To proof the role of flotillins, bone marrow derived macrophages (BMDMs) of flotillin-1/2 knockout mice were compared to C57BL7/6 wild-type murine cells. BMDMs were co-incubated with wild-type conidia containing DHN-melanized as well as pigmentless pksP conidia. Results: In contrast to pksP mutant conidia, melanized wild-type conidia reduced phagolysosomal acidification, the assembly of vATPase and NADPH oxidase and the formation of lipid-raft microdomains on the phagolysosome membrane. Compared to wild-type mouse cells, bone marrow-derived macrophages of a double knockout of the two lipid-raft chaperons flotillin 1 and flotillin 2 showed impaired acidification of phagolysosomes, assembly of both vATPase and NADPH oxidase on the membrane and reduced phagocytosis, also when non-melanized pksP conidia were phagocytosed. Conclusion: Flotillin-dependent lipid rafts contribute as a signaling platform to the formation of functional phagolysosomes and represent a target for fungal virulence determinants.

1

2

Objective: Madurella mycetomatis is the major causative agent of mycetoma, one of the most neglected tropical diseases. The lack of a therapeutically effective drug against M. mycetomatis coupled with the rise of resistance against azole antifungal agents in general prompted us to develop a rapid, reproducible, and inexpensive in vitro viability assay for drug susceptibility testing for M. mycetomatis. This assay will be an indispensable tool in the drug discovery of novel bioactive agents against this disfiguring infectious disease.1 For this assay, we aimed to use resazurin (Alamar blue) as a read-out system, as it offers a simple and affordable method especially in resource-limited settings along the “mycetoma endemic belt”. The mechanism of the resazurin method is based on targeting the mitochondrial enzymes in the live cells that convert resazurin to resorufin proportionally to the number of metabolically active viable cells. Methods: The in vitro susceptibility of nine genetically identified clinical isolates of M. mycetomatis2 towards seven standard antifungal agents (Amphotericin B, Caspofungin, Fluconazole, Itraconazole, Ketoconazole, Voriconazole and Terbinafine) was determined with the resazurin assay and XTT assay.3 In short, a fungal inoculum ranging between 0.4 × 104 to 5 × 104 CFU/ml with 68–72% transmission was exposed to different concentrations of the antifungal agents. When resazurin was used as a read-out system, it was added on the first day of incubation at a final concentration of 0.15 mg/ml with distinctive colour on the 2–7th day of its incubation at 37 oC degree. When XTT was used as a read-out system, the dye was added at the end of incubation period. Results: A sharp, reproducible end-point was detected resulting from the conversion of resazurin to resorufin. Visual detection of MIC provided quantitatively identical absorbance measurements in resazurin assay. Comparison of the overall MIC values of resazurin assay with its counterpart XTT assay generated comparable MIC values. The MIC of Amphotericin B ranges between 64-0.5ug/ml while the azoles except for Fluconazole, exhibited varying inhibitory effect on different isolates. Itraconazole and Posaconazole exhibited the lowest MIC value (>8-0.125ug/ml). Caspofungin and Terbinafine, however, showed weak inhibition on most of the isolates examined (MIC >256ug/ml). Conclusion: A simple, reproducible resazurin-based in vitro assay was optimized for susceptibility testing of M. mycetomatis. The major advantages of the resazurin reduction assay are inherent in its more sensitivity in comparison with tetrazolium assays besides its limited variability across linear range, whiles much larger variations were observed for the XTT assays.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

P357 NK cell stimulation induced by Dendritic cell-derived cytokines during Candida infection 1 ¨ , O. Kurzai3 A. Marolda1 , K. Hunniger Leibniz Institute for Natural Product Research and Infection Biology, HKI, JENA, Germany 2 Leibniz Institute for Natural Product Research and Infection Biology,HKI, JENA, Germany 2 ¨ ¨ University of Wurzburg, WURZBURG, Germany 1

Objective: Candida albicans and Candida glabrata are the two most prevalent pathogens in the genus Candida and account for the majority of candidiasis cases worldwide. However, there is evidence that the interplay of C. albicans and C. glabrata with the human immune system differs considerably. In order to get further insights into immune cell interactions in response to Candida infection, we are interested in stimuli that lead to different levels of NK cell activation during whole-blood infection with both fungal species. Methods: In previous experiments, we investigated NK cell activation during ex vivo whole-blood infection compared with those of isolated NK cells and found differences in the stimulation of NK cells dependent on the milieu and Candida ssp. To identify the specific stimulus that mediates NK cell activation during whole-blood infection we are currently using a transwell system to investigate the crosstalk between monocyte-derived dendritic cells (moDC) and NK cells in the presence of either C. albicans or C. glabrata. The transwell system is designed to allow the flux of cytokines produced by moDC during Candida infection in the upper part to NK cells in the lower part. Results: Interestingly, we found that confrontation with C. glabrata induced a markedly stronger activation of blood NK cells and NK cells in the presence of moDC than C. albicans, which is characterized by an up-regulated surface exposure of the early activation marker CD69 and proteins of the death receptor pathway (e.g. TRAIL). In contrast, primary NK cells are stronger stimulated during C. albicans infection, leading to an increased surface exposure of degranulation marker CD107a and decreased CD16 expression. These data suggested that the cytotoxic cells in vivo are activated indirectly by signals from other immune cells, resulting also in different effector mechanisms compared to primary NK cells, which are directly stimulated by fungal cells. In line with this, the comparison of moDC activation induced by C. albicans and C. glabrata showed different levels of cytokine secretion that consequently influence NK cell activation. Among all measured cytokines, IL-12p70 represents the most interesting difference in the moDC supernatants after confrontation with both species with a significantly higher release during C. glabrata infection. To verify the regulatory function of moDC-derived IL-12p70 in NK cell activation, we are currently performing experiments in the presence of a neutralizing anti-IL-12p70 antibody. Conclusion: These results demonstrate distinct patterns of NK cell activation dependent on the differential induced cytokine secretion by moDC and in human blood after contact with the two Candida species C. albicans and C. glabrata.

S134

Medical Mycology, 2018, Vol. 56, No. S2

P358 Prodrug nanoparticles as treatment for Aspergillus fumigatus conidia residing in macrophages

P361 Mitochondrial genome of the newly emerging multidrug resistant yeast Candida auris

2 ´ K. Gonzalez Rojas1 , G. Gangapurwala2 , A. Vollrath2 , T. Heinekamp3 , C. Guerrero Sanchez , U.S. Schubert2 , A. A. Brakhage4 1 ¨ Institute, JENA, Germany Hans Knoll 2 Friedrich Schiller University Jena, Jena, Germany 3 Leibniz Institute for Natural Product Research and Infection Biology, JENA, Germany 4 Leibniz-Institute for Natural Product Research and Infection Biology, JENA, Germany

˜ 5 , Anastasia Litvintseva2 , Juan G. Elizabeth Misas1 , Nancy Chow2 , Oscar M. Gomez3 , Juan E. Gallo4 , Jose F. Munoz McEwen3 , Oliver K. Clay6 1 ´ para Investigaciones Biologicas, ´ Corporacion MEDELLIN, Colombia 2 Centers for Disease Control and Prevention, ATLANTA, USA 3 Universidad de Antioquia, MEDELL´IN, Colombia 4 Universidad CES, MEDELL´IN, Colombia 5 Broad Institute of MIT and Harvard, CAMBRIDGE, USA 6 Universidad del Rosario, MEDELL´IN, Colombia

Objective: Aspergillus fumigatus is the most important airborne fungal pathogen that infects immunocompromised patients. Several virulence factors are present in this fungus, which, in particular allow its conidia to survive inside macrophages. A combination of caspofungin and humidimycin has been proposed as a new potential drug combination against aspergillosis. Humidimycin prevents the caspofungin paradoxical effect by inhibiting the salvage pathway enabling A. fumigatus to resist a high dose of caspofungin. Methods: We generated polymer based nanoparticles with a size range from 200 to 800 nm. Our main target are conidia residing in macrophages, therefore we decorated the nanoparticles with mannose moieties. The mannose facilitates the nanoparticles entering cells by mannose receptor-mediated endocytosis. The macrophage cell line RAW 264.7 was treated with a variety of nanoparticle formulations and confocal laser scanning microscopy was performed to monitor endocytosis. The uptake mechanism was determined by inhibition of different endocytic pathways and immunofluorescence. Additionally, the cytotoxicity of the nanoparticles was tested by resazurin assay. Results: Preliminary results showed an uptake of mannose-functionalized nanoparticles containing Nile Red as cargo. Also, it was observed how nanoparticles containing Nile Red co-localized at the conidium-phagolysosome compartment. Conclusion: By investigating the efficacy of nanoparticles containing antifungal drugs we aim to develop improved treatment options to fight A. fumigatus conidia inside macrophages.

P359 Isolation and characterization of Cryptococcus neoformans urease complex N.F. Omar, S. Iwatani, S. Kajiwara Tokyo Institute of Technology, YOKOHAMA, Japan Objective: Cryptococcus neoformans is one of the significant fungal opportunistic pathogens, which usually manifested as meningitis or meningoencephalitis in immunocompromised individuals. It has high predilection towards central nervous system (CNS) due to its ability to pass through human blood brain barrier (BBB). Studies by other groups revealed the involvement of urease activity in assisting C. neoformans transmigration across BBB. Even so, how urease activity assists in C. neoformans invasion across BBB is still unclear. Determining the biochemical properties of this urease enzyme might provide significant information about its activity. In addition, urease activity was abolished when VPH1 gene, an isoform of subunit ‘a’ of V0 portion of V-ATPase was disrupted, triggering curiosity to further study this phenomenon deeply and obtaining more information about urease activity coordination as well as mechanism for urease complex formation in C. neoformans. This is due to the fact that V-ATPase is involves in acidification of vesicle organelles essential for protein secretion, metal cofactor insertion, glycosylation and pH stability. Methods: 3XFLAG tag was fused to either C- or N-terminal of urease protein, Ure1 and to C-terminal of one of the urease accessory proteins, Ure7 by homologous recombination to assists in urease complex purification by co-immunoprecipitation. For analysis of VPH1 involvement in urease activity coordination, vph1 strain was used. Results: Tagging of either C- or N-terminal of Ure1 protein with 3XFLAG, resulted in genetically modified strains, named URE13XFLAG and 3XFLAGURE1 respectively but these strains unable to retain urease activity. Ure7 fused with 3XFLAG tag at the C-terminal was also expressed in C. neoformans (the obtained strain name is URE73XFLAG) and this strain was able to retain urease activity. Urease complex was attempted to be purified from URE73XFLAG protein lysates. This experiment is still ongoing. On the other hand, for analysis of VPH1 involvement in urease activity coordination, until now we found out that loss of VPH1 resulted in dependency of growth on copper and iron as concentration as low as 5 μM and 250 μM, respectively. Besides, pH of medium seems not influencing its growth. In present, we still elucidate the reasons behind growth dependency on selected metals. Conclusion: Tagging one of the urease accessory proteins for the purification of urease protein complex seems working well and promise good yield with several optimizations. Besides, by further analysis of vph1 strain function, we hope to find figure out urease activity coordination or urease complex formation mechanism.

P360 Role of Pep4 protein in Cryptococcus neoformans cell survival and virulence factors Marcelo A Vallim, Gabrielle Felizardo, Renata C. Pascon UNIFESP, DIADEMA, Brazil Objective: Cryptococcosis is a systemic mycosis of great clinical importance which mainly affects immune suppressed patients. Currently, two distinct species stand out as human pathogens, Cryptococcus neoformans and C. gattii. In Brazil, the species C. neoformans is the most prevalent and it is present in all geographic regions. This species, with worldwide distribution is responsible for high rates of morbidity and mortality. The treatment is limited to few drugs and some resistance to them has been reported elsewhere. Therefore, new research must be carried out to broad the knowledge regarding this yeast biology aiming at traits that could be new targets for antifungal drugs. Recently, our laboratory has characterized the APE4 gene of C. neoformans, which in S. cerevisiae, is involved in autophagy. The mutation of this gene resulted in an avirulent strain of C. neoformans in animal model. Therefore, this project aims to expand the knowledge of the autophagy process in this pathogenic yeast. The mechanism of autophagy is a conserved process, responsible for the cell’s survival in the face of adverse conditions of nutritional deprivation (carbon and nitrogen source) and environmental stresses. We choose to evaluate the role of Pep4, a protease (Protease A), which in baker’s yeast is responsible for maturation and activation of vacuolar hydrolases. These enzymes are involved in providing nitrogen under nutritional stress and maintaining homeostasis by recycling of cell proteins after exposure to oxidative stress. Pep4 protein acts in the autophagic vesicle. Methods: PEP4 gene was deleted by replacing the coding region by a cassette bearing the hygromycin resistance maker. NaNO2 and H2O2 were added to yeast extract, peptone and dextrose medium. Incubation were carried out at 30◦ C and 37◦ C for up to 48 hours. For capsule production, yeast cells grown were liquid medium were stained with India Ink and observed under light microscope. Total-RNA was extract with Trizol and subject to first strand synthesis, then subject to qPCR using SYBGreen. Results: We assess the impact of C. neoformans PEP4 mutation has on the virulence factors (growth in different pHs, high temperature (37◦ C), production of phospholipase; melanin; and urease), as well as the response of yeast cell to stresses (saline, oxidative and nitrosative). Also the gene expression pattern associated with thermal, nitrosative stress and nutritional deprivation was evaluated. Our results shows that the pep4 mutant of C. neoformans produces significantly more capsule than the wild type strain (KN99α) at 30◦ C and 37◦ C, is sensitive to hydrogen peroxide and sodium nitrite under nutritional deprivation conditions. Moreover, the PEP4 gene expression is modulated by the combination of absence of carbon source, temperature and NaNO2 . Conclusion: C. neoformans Pep4 protein is important for the yeast cell survival after exposure to sodium nitrite suggesting that in this pathogenic yeast, as in S. cerevisiae, this protein is involved in recycling damage proteins after nitrosactive stress. Sponsors: FAPESP 2015/04400-9, 2016/14542-8 and CNPq.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Objective: Candida auris is a multidrug-resistant yeast capable of causing invasive infections in humans. C. auris has a global distribution and has been documented in numerous countries on 5 continents in the past 7 years. Furthermore the clinical diagnosis of this emerging pathogen is a challenge, and commercial automated systems routinely fail to identify C. auris correctly. This work aims to present the first assembly and annotation for the mitochondrial genome of the newly emerging multidrugresistant yeast C. auris. Methods: C. auris strain B8441 was sequenced using PacBio and Illumina Hiseq2500, the complete genome was assembled de novo using Canu v-1.5, and subsequently the contig corresponding to the mitochondrial sequence was identified. It was separated from the rest of the assembly and used as a reference to map the Illumina reads with BWA v-0.6.1. The sequence was then corrected using Pilon v-1.6. The annotation of the mitochondrial genome assembly was achieved using a combined strategy, a homology inference approach that involved the available annotations for Candida lusitaniae and Candida albicans and the MITOS web server, as well as ab initio prediction using programs including FGENESH and GLIMMER3. In all cases the appropriate genetic code was used. The resulting annotation will be manually curated. Results: The PacBio sequencing for the total DNA of C. auris strain B8441 produced 183245 reads. The Illumina HiSeq2500 paired-end read sequencing produced 7.8 million read pairs with a length of 251 bp. A single contig with a length of 34.8 kb corresponding to the mitochondrial genome sequence was identified in the assembly achieved with Canu. The Illumina reads were mapped to the mitochondrial contig using BWA. The reference assembly showed an average coverage of 3420X. The Pilon program corrected six errors that were two single nucleotide errors and four small insertions. The preliminary results of the annotation of the mitochondrial genome assembly of C. auris were: 38 ORFs found with Glimmer, 11 genes found with FGENESH. The homology annotation allowed us to identify the core genes coding for the subunits of the ATP synthase (atp6 and atp9), subunits of the reduced nicotinamide adenine dinucleotide ubiquinone oxidoreductase (nad1, nad2, nad3, nad4, nad4L, nad5 and nad6) and subunits of the cytochrome c oxidase enzyme complex (cox1, cox2 and cox3). The MITOS webserver found duplications of some core genes for a total of 24 genes and 12 tRNAs Conclusion: Several studies have demonstrated that some clinical isolates of C. auris show a high tolerance to the antifungals amphotericin B and fluconazole. The study of the mitochondrial genome of pathogenic fungi could help to identify new target proteins with therapeutic potential. Even the conserved mitochondrial proteins, which are homologous in fungi and humans, differ in the levels of affinity for the same inhibitor or drug. We present here the first report of the mitochondrial genome of C. auris. Colciencias grant 221365842971, Sostenibilidad UdeA 2017–2018 and Programa Beca Doctorado Nacional convocatoria-647 supported this work.

P362 Histological characterization of air pouches from mice infected with Paracoccidioides brasiliensis and treated with Itraconazole and/or low level LASER therapy. E. Burger1 , L.A. Santos1 , J.C. Grisolia1 , A.M. De Oliveira2 , L.M. Verinaud4 1 Federal University of Alfenas (UNIFAL-MG), ALFENAS, Brazil 2 ´ Jose´ do Rosario Vellano University (UNIFENAS), ALFENAS, Brazil 3 ˜ Paulo (UNIFESP), SAO PAULO, Brazil Federal University of Sao 4 State University of Campinas (UNICAMP), CAMPINAS, Brazil

AC.S.C.

Mendes1 ,

Z.P.

De

Camargo3 ,

Objective: Paracoccidioidomycosis is a systemic mycosis, endemic in Latin America, caused by the thermal dimorphic fungus Paracoccidioides brasiliensis (Pb). It is a granulomatous disease; the formation of granulomas can be understood as a mechanism of the body to block and limit the invasiveness of the fungus, once unable to lyse them. Benign forms of paracoccidioidomycosis are characterized by presence of compact granulomas containing few, mostly degenerate fungi. Severe forms present loose granulomatous processes with foci of necrosis and numerous fungi with preserved morphology. Studies in which granulomatous response was compared in resistant and susceptible mouse strains to Pb infection inoculated with the highly virulent Pb18 isolate showed different patterns of injuries related to the type of extracellular matrix components and different cells types in the lesions, with marked presence of polymorphonuclear neutrophils (PMN) even at later stages of the infection, suggesting an important role in the formation and dynamics of the granulomas and thus on the outcome of infection. Previously, the authors showed that in the model of subcutaneous (sc) inoculation in air pouches, which after 15 days yielded highly pure PMN preparations, the number of cells of the resistant strain was five times higher than that of the susceptible strain, thus suggesting that the presence of this cell population correlated with antifungal resistance. In this study we analyzed the histology of air pouches. Methods: Swiss mice were sc infected with Pb18 and treated with one of different doses of the antifungal drug Itraconazole in addition to low level laser therapy (LLLT), applied on alternate days at two points of the hind legs, aiming immature PMN in the bone-marrow. Ten days post-infection, the air pouches were collected, processed for histological analysis, stained with H/E to check tissue architecture. The inflammatory process intensity and quantity of vessels and neovas were assayed by stereology. Results: We found that lesions from the untreated infected mice had a poorly defined stroma, disorganized parenchyma, large areas of inflammatory process consisting of PMN and fibrosis with coagulative and liquefactive necrosis. The infected group treated with LLLT presented the same histological patterns, but without coagulative necrosis. The animals treated with different doses of itraconazole and LLLT had definite stroma and little disorganized parenchyma with some areas of inflammatory process, fibrosis and liquefying necrosis. In the LLLT-treated groups, these lesion areas were smaller than in the groups treated with any Itraconazole concentration. The intensity of the inflammatory process, and of vessels and neovas were decreasing as the drug concentration increased and also in association with treatment with LLLT. Conclusion: Overall, our results demonstrated that Pb infection resulted in a diffuse inflammatory reaction with areas of fibrosis and tissue necrosis. The intensity of the inflammatory process and the number of vessels and neovas were significantly reduced with Itraconazole (50 mg/mL) and associated adjuvant LLLT when compared to the untreated group and groups treated with lower doses of the drug. We conclude that 50 mg/mL itraconazole plus LLLT reduced tissue lesions and damage and severity of the inflammatory process. CNPq 305216/2016-3, FAPEMIG APQ 012941-16 Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 419283 023a2daa-bdc4-4bb1-93e1de4a30388467.jpg Caption 1: Mice were infected with P. brasiliensis and treated with Itraconazole and/or LASER. A-Number of inflammatory cells. B-Surface density of blood vessels Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 419283 023a2daa-bdc4-4bb1-93e1de4a30388467.jpg Caption 2: Representative photomicrograpy of air pouch tissue from mice infected with P. brasiliensis and treated with Itraconazole and/or LASER

ABSTRACT

S135

P363 Identification of positive and negative mediators of fluconazole tolerance in Candida albicans

P366 In vitro echinocandin microevolution of Candida parapsilosis affects stress response and virulence properties

Dominique Sanglard, ERIC Delarze, CLAIRE Pralong University of Lausanne and University Hospital, LAUSANNE, Switzerland

´ olgyi, ¨ ´ CS.G. Papp, K. Kocsis, CS. Vagv A. Gacser University of Szeged, SZEGED, Hungary

Objective: Antifungal tolerance can be defined as the ability of C. albicans cells to survive at high antifungal drug concentrations but without acquiring mutations associated with resistance. The mechanisms mediating drug tolerance are still not well understood and their study may reveal factors contributing to treatment failures and facilitate the design of improved therapies. In this study we aimed to identify mediators of tolerance to fluconazole (FLC). Methods: In order to achieve this goal, we used a collection of 582 tetracycline-inducible overexpression barcoded strains constructed in the background of BWP17 (SC5314 derivative), which were pooled and maintained under FLC pressure for five days of repeated subcultures. This strategy was used to enrich and/or deplete the pool in strains with increased and/or decreased tolerance. After amplification and Myseq sequencing of all barcodes from the cultures, the fractional index of each population was calculated to identify positive (enriched strains) and negative (depleted strains) regulators of tolerance Results: Two potential positive tolerance mediators (the transcription factors CRZ1 and GZF3), when overexpressed, were confirmed by single culture assays in the genetic background of BWP17. This strain background was found not suitable for testing individual negative tolerance mediators due to intrinsic low tolerance levels of BWP17. We therefore challenged potential negative tolerance mediators using the tetracycline-inducible overexpression system in different C. albicans clinical isolates exhibiting intrinsic high FLC tolerance levels. Using this approach, we identified at least 3 potential negative regulators (transcription factors SFL2, CPH1; protein kinase CSK1) that reduced FLC tolerance in these strains when overexpressed. The effect was strain-dependent, suggesting that control of tolerance is mediated by several mechanisms. Conclusion: In conclusion, our approach based on the use of a pool of barcoded strain revealed several mediators of tolerance which are still needing further characterization. Given that only 10% of the ORFome was used in this approach, there are still open opportunities to identify additional tolerance mediators.

Objective: Candida parapsilosis is the second most common cause of candidaemia after Candida albicans worldwide. Previously it has been shown, that in case of C. parapsilosis clinical isolates, higher MIC (minimal inhibitory concentration) values are detected upon interaction with echinocandin type antifungal drugs when compared to C. albicans. However, C. parapsilosis infections are almost 100% curable with caspofungin and other drugs belonging to the same class of antifungals. Therefore, we aimed to reveal the underlying mechanisms of this contradiction. In order to investigate what leads to the in vitro resistance of C. parapsilosis clinical isolates, we aimed to generate strains that are permanently resistant to different types of echinocandins, namely caspofungin, anidulafungin and micafungin, with the purpose of examining alterations in their responses to abiotic stressors and also investigate their virulence. Methods: In this study, Candida parapsilosis CLIB 214 echinocandin sensitive cells were grown in the presence of different echinocandins. During the microevolution experiments, we constantly increased the concentration of each drug at given timeintervals. Abiotic stress tolerance of the generated resistant strains was determined on YPD plates complemented with different osmotic-, and oxidative stressors and cell wall-, or membrane perturbing agents. To investigate the virulence properties of each echinocandin evolved strain in vivo, we used Galleria mellonella larvae. Results: The three echinocandin-evolved strains showed increased MIC values for their corresponding echinocandins, applied for the generation of each mutant strain. The anidulafungin-evolved strain was resistant to all three applied antifungal drugs. The caspofungin-evolved strain was also resistant to micafungin. However no cross-resistance was observed in case of the micafunginevolved mutant. All evolved strains were susceptible to cell wall perturbing agents, especially at 37◦ C and the micafungin-evolved strain was unable to growth in the presence of the cell wall stressor Calcofluor White and Congo Red on both 30◦ C and 37◦ C, respectively when compared to the wild-type. Interestingly, the micafungin-evolved strain became less susceptible to the presence of SDS when compared to all other evolved-strains and the parental strain. According to the survival of Galleria mellonella larvae, we found that the micafungin-evolved strain showed attenuated virulence when compared to any other strain. Conclusion: Our results suggest, that adaptation to an echinocandin type drug might also result in cross-resistance to other drugs derived from the same antifungal drug class depending on the particulate echinocandin, may lead to altered abiotic stress tolerance and could also influence fungal virulence. This research project was supported by NKFIH K123952 and by GINOP-2.3.2-15-2016-00035.

P364 Observation of Candida albians treated with clioquinol monitered under fluorescence and scanning electron microscope ZIMENG You1 , XIN Ran2 , CHAOLIANG Zhang3 , YUPING Ran4 1 West China hosipital, Sichuan University, CHENGDU, China 2 West China hospital, Sichuan University, CHENGDU, China 3 West China Stomatology Hospital, Sichuan University, CHENGDU, China 4 West China Hospital, Sichuan University, CHENGDU, China Objective: To observe the morphologic change of Candida albicans treated with clioquinol under fluorescence microscope and scanning electron microscope. Compare the results with other common antifungal drugs and seek for the possible antifungal target. Methods: Agar dilution method was used to measure the minimum inhibitory concentration (MIC) of active pharmaceutical ingredient (API). Slide culture was made on potato dextrose agar (PDA) with API added at concentration of 0.5 MIC. The observation under fluorescence microscope and scanning electron microscope was conducted after 7 days. Results: MIC of clioquinol for C.albicans standard strain ATCC 10231 was 8 μg/ml, while the MIC of other drug was 64 μg/ml, 512 μg/ml, 512 μg/ml for ketoconazole, naftifine and terbinafine respectively. After treated with clioquinol at 0.5 MIC (4 μg/ml)/0.75 MIC (6 μg/ml) for 7 days, obvious morphologic change was observed under microscope. Fluorescence light was very strong and multiple hyphae formed after 7-day culture in blank control group. Fluorescence intensity weakened and hyphae formation reduced notably compared with blank control under fluorescence microscope. Hyphae formation reduced obviously and the surface of parts of spores depressed were seen under scanning electron microscope (Figure 1). When the concentration of clioquinol increased to 0.75 MIC, no hyphae formed. As for other antifungal drugs, the change of fluorescence intensity and hyphae formation compared with blank control was also observed in ketoconazole and terbinafine at 0.5 MIC. Change of fluorescence intensity was seen in naftifine at 0.5 MIC while there was still obvious hyphae formation observed (Figure 2). Conclusion: Clioquinol was firstly produced in 1934 as antiseptic. The target of antifungal function was unknown though apoptosis, autophagy, cell cycle arrest may be associated with the anti-neurodegenerative diseases and anti-tumor function. We confirmed the antifungal function of clioquinol was strong and broad in former experiment. We tried to find the clue of target through morphologic change after strain treated with clioquinol at 0.5/0.75 MIC for 7 days. The obvious change of fluorescence intensity, hyphae formation, spore surface was observed under fluorescence microscope and scanning electron microscope. The antifungal function of clioquinol may be related to chitin synthesis and hyphae conversion. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 420819 adf40579-a330-4b08-8484-92ce 585a7447.jpg Caption 1: Observation under fluorescence microscope and scanning electron microscope after 7-day culture for ketoconazole, naftifine and terbinafine group. Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 420819 adf40579-a330-4b08-8484-92ce 585a7447.jpg Caption 2: Observation under fluorescence microscope and electron scanning microscope after 7-day culture for clioquinol group.

P365 Fungal virulence regulatory factors revealed following host - Candida parapsilosis interaction 1 1 1 ´ ´ olgyi ¨ ´ ´ 1 , V. Cabral2 , F. Bohner1 , T. Nemeth , CS. Papp1 , CS. Vagv , J.D. Nosanchuk2 , T. Gabaldon3 , A. Gacser R. Toth 1 University of Szeged, SZEGED, Hungary 2 Albert Einstein College of Medicine, NEW YORK, USA 3 Barcelona Institute of Science and Technology, BARCELONA, Spain

Objective: To date, a rich recent literature suggests that transcriptional regulators are potentially effective targets to treat various diseases. Their pleiotropic effects may contribute to disease development and progression in various routes, which makes them particularly appealing as novel drug targets. Due to the emerging resistance of pathogenic species against different antimicrobial drugs, it has also been suggested to target the transcriptional factors (TFs) of parasites and various pathogens as an alternative approach to treat infections. Given the increasing incidence and antifungal resistance of C. parapsilosis, along with the virulence mechanisms and triggered immune responses that are different from those of C. albicans, an extensive examination of this species becomes pressing. Therefore, in this study we aimed to examine changes in whole transcriptomes of C. parapsilosis shortly following host-pathogen interaction in order to identify potential multifunctional fungal regulatory factors for later gene disruption and characterization. After the generation of a small deletion mutant collection, we further aimed to characterize the established mutant strains under conditions that are thought to influence virulence. Our purpose was to search for mutants preferably with multiple defects. Methods: To identify potential C. parapsilosis virulence regulatory genes we performed RNA-sequencing shortly after hostpathogen co-incubation using Illumina-based sequencing. For the generation of the deletion mutant strains a previously described auxotrophy- complementation based, fusion PCR method was applied. Viability of the null mutant strains was tested under various conditions including standard complex, minimal and various stressor-supplemented solid and liquid media. Biofilm forming and adhesive properties, along with possible alterations in morphology, were also examined. For the virulence studies both in vitro and in vivo infection models were applied. Results: According to our results, one-third of the identified hypothetical virulence regulatory ORFs are involved in viability and stress tolerance regulation, seven genes influence the fungi’s adhesive properties and three its biofilm forming abilities. Furthermore, two morphology-determining genes were also identified: one promoting and another inhibiting yeast-to-filamentous growth switch. Out of the characterized mutants, CPAR2 200390/ appeared to form extremely elongated, aggregating pseudohyphae and showed an altered cell wall composition. Cells of the CPAR2 100540/ strain grew poorly on both iron depleted and alternative carbon source containing media, that might be associated with alterred expression of genes involved in the mitochondiral respiratory chain. In contrast, deletion of the CPAR2 303700 ORF resulted in a growth defective phenotype and temperature sensitivity. Furthermore, distruption of all three aforementioned genes also inidicated altered virulence both in vitro and in vivo compared to the wild type reference strain. Conclusion: Taken together, in this study we identified several mutants with a relevant pathogenicity affecting phenotype and one-third of these had multiple defects, suggesting their potential involvement in the regulation of C. parapsilosis virulence. Among the identified regulators, we highlight three novel transcriptional regulators that influence pathogenicity determining mechanisms in distinct ways in C. parapsilosis. During infection, CPAR2 100540 regulates nutrient acquisition, CPAR2 200390 is responsible for the regulation of cell wall assembly and morphology switch and CPAR2 303700 influences fungal viability. This project was supported by NKFIH K123952 and GINOP-2.3.2-15-2016-00035.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

P367 Charaterisation of the immune response induced by Candida parapsilosis: the role of cell wall n-mannan and dectin-1 independent recognition 1 1 ´ olgyi ¨ ´ , A. Gacser K. Csonka1 , B. Schulze2 , ZS. Tasi1 , I. D. Jacobsen2 , CS. Vagv 1 University of Szeged, SZEGED, Hungary 2 ¨ Institute, JENA, Germany Hans Knoll

Objective: Antifungal immunity appears to be mediated primarily by members of the C-type lectin receptor (CLR) family. CLRs play critical roles in host defense against C. albicans infections. Previously, it has been shown that host defense mechanisms vary towards different Candida species. For example, it has been shown that C. albicans and C. parapsilosis trigger different T-cell responses by human PBMCs. Although studies are available about the immune responses induced by these species, our understanding of C. parapsilosis recognition is severely restricted. Therefore, in the present study, we aimed to investigate the role of a CLR in C. parapsilosis recognition. Our purpose was to examine if Dectin-1 contributes to the recognition of this species via sensing the fungal cell wall component N-mannan in vivo. Methods: During the experiments, 2 × 107 /200 μl dose of Candida suspension was used for I.V. infection of C57BL/6 wt and Dectin-1−/− mice. After 1, 3 and 7 days of the infection, fungal burden was determined by counting CFUs from the spleen, kidney, liver and the brain. Fluorescence-activated cell sorting (FACS) was used to determine the amount of and type of immune cells recruited to the sites of infection. Cytokines were measured from tissue homogenates with MultiPlex ELISA. The role of N-linked mannosylation was investigated using the C. parapsilosis och1/ strain, with a severe defect in N-mannan display and elevated β-glucan and chitin levels. Results: The och1/ strain showed significantly reduced fungal loads in the kidney, liver and the spleen of wild-type (wt) mice compared to the CpWT strain. The och1/ mutant strain stimulated more effective recruitment of neutrophils, macrophages and dendritic cells in the kidney compared to the CpWT strain. Lower induction of TNF-a, IL-1b, IL-6, and INF-g was measured from the kidney of wt mice after the och1/-challenge compared to the CpWT strain. Infection with CpWT cells resulted in similar fungal burdens in the kidney, liver, spleen and brain of both wt and Dectin-1−/− mice. No differences were observed in the composition of immune cells in the kidney of wt and Dectin-1−/− mice after the CpWT stimuli. Thereafter, absence of Dectin-1 did not influence fungal clearance in mice after infection with the less virulent och1/ strain. Interestingly, in Dectin-1−/− mice we detected more efficient neutrophil but less effective dendritic cell activation in the kidney upon infection with the och1/ strain. Conclusion: Our results demonstrate that loss of N-linked mannosylation in the cell wall of C. parapsilosis results in significantly decreased virulence. Lack of the N-mannan component enhanced the activation of phagocytes in the infected organs causing effective clearance of yeast cells. Interestingly, Dectin-1 deficiency did not effect organ colonization and immune cell recruitment as observed in case of CpWT. Furthermore, absence of Dectin-1 receptor in mice did not alter the elimination of och1/ cells. Therefore, our study suggests that the C. parapsilosis induced immune response is independent of Dectin-1 recognition during systemic C. parapsilosis infection. This project was funded by NKFIH K123952 and GINOP-2.3.2-15-2016-00015.

P368 How crucial is CLR signalling through Syk and CARD9 in experimental Candida parapsilosis infections? 2 1 2 1 ´ 1 , J.ZS. Csepregi2 , A. Orosz2 , T. Nemeth ´ ´ olgyi ¨ ´ ´ , CS. Vagv , A. Mocsai , A. Gacser E. Zajta1 , K. Csonka1 , A. Toth 1 University of Szeged, SZEGED, Hungary 2 Semmelweis University, BUDAPEST, Hungary

Objective: An important antimicrobial intracellular pathway initiated by C-type lectin receptors leads through Syk and CARD9 signalling. Several major fungal pathogens activate this route. Syk is also important in proper neutrophil migration and adhesion. Candida parapsilosis is a regular cause of candidaemia and threatens especially neonates. Despite its clinical relevance, little is known about the immunological processes during C. parapsilosis infections. Our goal was to examine the role of CARD9 and Syk in experimental C. parapsilosis infections. Methods: We generated bone marrow chimeras with wild type (WT), Syk- or CARD9-deficient hematopoietic systems and also neutropenic mice. Peritoneal macrophages and bone marrow derived macrophages were cultured and infected with C. parapsilosis or C. albicans cells and supernatants were analysed for cytokine content and LDH activity. Phagocytosis of C. parapsilosis by macrophages and fungal survival in co-cultures were assessed. Mice were infected intravenously with C. parapsilosis or C. albicans and fungal burden was determined from organs and blood. PAS (Periodic acid-Schiff) and HE (Hematoxylin and Eosin) stained histological sections from kidneys were prepared and examined for fungal presence and signs of inflammation. Results: The absence of Syk or CARD9 in macrophages led to reduced proinflammatory cytokine and chemokine secretion upon both C. albicans and C. parapsilosis infections. There was no difference in phagocytic activity between WT and CARD9deficient macrophages or in their LDH release. Syk deficient macrophages phagocytosed both yeast species less efficiently than WT cells but this was more evident in the case of C. parapsilosis. Both Syk- and CARD9-deficient mice were highly susceptible to C. albicans. Notably however, Syk- and CARD9-deficient mice were only slightly more sensitive to systemic C. parapsilosis infection thank WT mice. Abundant C. albicans hyphae and lymphocyte infiltrates were detected in the kidneys of C. albicans infected Sykand CARD9-deficient mice. Fungal presence was scarce and inflammation was not seen in sections made from kidneys with all other experimental conditions. Neutropenic mice did not seem to be more susceptible to systemic C. parapsilosis infection than WT animals. Conclusion: Our data suggest that both Syk and CARD9 influence C. parapsilosis induced host responses in vitro. However, unlike in the case of C. albicans, these proteins are not key players in the control of systemic C. parapsilosis infection. This project was funded by NKFIH K123952 and GINOP-2.3.2-15-2016-00015. EZ was also supported by the National ¨ Talent Programme of the Hungarian Ministry of Human Capacities (NTP-NFTO-17-B-0382).

S136

P369 Isolation of Cryptococcus neoformans from a chestnut tree (Castanea sativa), Denizli, Turkey 2 ¨ 1 , MURAT Kutlu1 , AYLIN Dogen ¨ MUSTAFA Sengul , L. Aksoy1 , SERPIL Gonca2 , MACIT Ilkit3 , C¸AGRI Ergin1 1 Pamukkale University, DENIZLI, Turkey 2 Mersin University, MERSIN, Turkey 3 C¸ukurova University, ADANA, Turkey

Objective: Cryptococcus neoformans is a basidiomycetous encapsulated yeast that can cause life-threatening infections in immunosuppressed humans and animals. C. neoformans infections are considered to be acquired via inhalation of aerosolized particles from the environment. Avian guano, decaying tree hollows, and soil are known environmental niches. In recent years, different trees, such as Eucalyptus camaldulensis, Tamarix hispida, Platanus orientalis, and Punica granatum, have been reported to have C. neoformans colonies in different woody environmental regions of Anatolia, Turkey. Methods: In this study, the colonization screening of C. neoformans on chestnut trees (Castanea spp.) from the Aydın¨ Odemis ¸ -Denizli geographical area is presented. This area consists of mountainous terrain between the fertile plain formed by two major rivers. From this area, 214 chestnut trees (Castanea spp.) that had deep fissures or trunk hollows were screened during the mid-summer, 2017. A swabbing technique was used, and all samples were cultured on Staib agar medium containing 0.5% biphenyl and 0.4% chloramphenicol. Results: Candidate yeasts were tested for the presence of Cryptococcus by conventional methods and canavanine-glycinebromothymol agar reactions. Only one (0.47%) strain of C. neoformans was isolated from all 214 screened trees. This strain was confirmed by ITS 1–4 sequencing. We determined the mating type and serotypes by PCR analysis of the STE20 genes using STE20 (Aa), STE20 (Aa), STE20 (Da), and STE20 (Da) primers. The serotype A MATa mating type was observed. Conclusion: Here, the first C. neoformans isolate from a chestnut tree (Castanea sativa) is presented. Further studies of distribution of human pathogenic Cryptococcus in our country will be helpful in determining risk areas that threaten mammalian health.

P370 The role of Candida parapsilosis secreted aspartic proteases in the regulation of inflammation and immune evasion ´ D. K. Singh, CS. Vagvolgyi, A. Gacser University of Szeged, SZEGED, Hungary Objective: Candida parapsilosis is an opportunistic fungal pathogen responsible for approximately 30% of candidaemia episodes in new-borns, and 10%–15% of Candida infections in adults worldwide. Fungal extracellular hydrolytic enzymes, especially secreted aspartyl proteinases (SAP) are important virulence factors of Candida species, that contribute to the development of disseminated candidiasis. SAPs cause significant damage to epithelial cells, promote the escape of fungal cells during host attacks by cleaving host complement proteins and also modulate the secretion of inflammatory cytokines. Although several studies have investigated the role of C. albicans secreted aspartyl proteinases in its virulence, less is known about the precise role of C. parapsilosis secreted aspartyl proteinases (SAPPs) in host invasion, especially during complement evasion. Thus, we aimed to study the function of C. parapsilosis secreted aspartyl proteinases during host attack. Methods: To investigate the role of SAPP genes, a deletion mutant strain (sapp-/-) was generated, lacking all functional CpSAPP ORFs. To examine the effect of complement proteins on the growth of the C. parapsilosis GA1 (wild-type) and sapp-/strains, their growth was measured in YPD and YCB liquid medium supplemented with 20% of either normal human plasma (NHP) or heat-inactivated human plasma (HiP) at 30 and 37◦ C. In order to examine the effect of gene deletion on viability and appearance, we also tested their growth on different complex, minimal and stressor containing media.Virulence properties of the mentioned strains were also tested using an epithelial cell line, the human monocytic cell line THP-1 and human macrophages (PBMC-DMs). The performed assays and methods included the LDH assay, MTT assay, RT-PCR, FACS and ELISA. Protease activity of the wild-type and sapp-/- strains was also examined by SDS-PAGE. In silico analyses were also performed to evaluate efficiencies of HIV protease inhibitors against Sapp’s. Results: Growth rates of the sapp-/- strain were similar to that of the wild-type strain in both YPD and YCB medium regardless of the temperature used, whereas addition of NHP significantly inhibited the growth of the mutant strain only. Deletion of CpSAPPs did not affect biofilm formation, nor the morphological attributes of C. parapsilosis. Although, the sapp-/- strain showed significant differences in its virulence when compared to the wild-type. THP-1 and PBMCDM’s killed and phagocytosed sapp-/- cells more efficiently. Mutant cells also induced less damage to human epithelial cells, THP-1 cells and to PBMC-DMs compared to the wildtype strain. Furthermore, when examining host cytokine responses, the wild-type strain induced higher levels of IL-1β, TNF-α and IL-8 than the sapp-/- mutant strain. In addition, extracellular proteinases derived from the wild-type strain’s supernatants efficiently cleaved bovine serum albumin whereas no such activity was observed in case of the sapp-/- mutant strain. Our in silico data suggested that several HIV proteases could be potential inhibitors of C. parapsilosis extracellular proteinases. Conclusion: Our preliminary data suggest that CpSAPPs do not affect fungal viability, morphology or biofilm formation, however significantly contribute to the virulence of C. parapsilosis in vitro, thus play an important role in C. parapsilosis virulence. This research project was supported by NKFIH K123952

P371 Conidial surface proteome analysis reveals the highly abundant CcpA protein important for virulence of Aspergillus fumigatus Vera Voltersen1 , Sahra Hermann2 , Matthew Blango1 , Thorsten Heinekamp1 , Olaf Kniemeyer1 , 1 5 ¨ ¨ , Petra Bacher3 , Jasmin Lother4 , Kerstin Hunniger , Liu Hong6 , Maria Strassburger1 , Thomas Kruger 4 ¨ ¨ Loffler , Sven Krapmann8 , Sandor Nietzsche9 , Oliver Kurzai10 , Hermann Einsele4 , Scott Alexander Scheffold7 , JUrgen G. Filler11 , UTZ Reichard2 , Axel A. Brakhage1 1 Leibniz Institute for Natural Product Research and Infection Biology (HKI), 07745 JENA, Germany 2 ¨ ¨ University Medical Center Gottingen, GOTTINGEN, Germany 3 Charite´ - University Medicine, Berlin, BERLIN, Germany 4 ¨ ¨ University Clinic Wurzburg, WURZBURG, Germany 5 Septomics Research Center, JENA, Germany 6 Biomedical Research Institute at Harbor-UCLA Medical Center, LOS ANGELES, USA 7 Charite´ - University Medicine, BERLIN, Germany 8 ¨ University Hospital and Friedrich Alexander University of Erlangen-Nurnberg, ERLANGEN, Germany 9 Electron Microscopy Centre, Clinics of the Hospital Jena, JENA, Germany 10 ¨ ¨ Julius Maximilian University of Wurzburg, WURZBURG, Germany 11 Los Angeles Biomedical Research Institute at Harbor-UCLA Medical Center, LOS ANGELES, USA Objective: Aspergillus fumigatus is a common airborne fungal pathogen of humans and a significant source of mortality in immunocompromised individuals. Conidia, the asexually produced spores, are the first form of A. fumigatus to come in contact with lung epithelial and immune cells. Thus, the composition of the conidial surface has the potential to directly influence the outcome of an A. fumigatus infection. The cell wall polysaccharides that form the cell wall of A. fumigatus conidia and the pigmented melanin layer have been extensively studied. Little is known about conidial surface proteins with immune-modulatory functions; apart from the RodA hydrophobin that forms a hydrophobic surface layer on dormant conidia. Here, we aimed to identify additional conidial surface proteins which may play a role during host pathogen interaction. Methods: By either hydrogen flouride-pyridine extraction of condial proteins or “trypsin-shaving” of surface-exposed proteins and subsequent LC-MS/MS analysis we characterised the A. fumigatus spore proteome. Results: We identified 116 proteins in the conidial cell wall. One protein, designated conidial cell wall protein A (CcpA) was nearly as abundant as the hydrophobin layer-forming protein RodA. CcpA peaks in expression during sporulation on resting conidia. Despite a high surface abundance, the cell surface of ccpA resting conidia appeared normal. However, trypsin shaving of ccpA conidia revealed novel surface-exposed proteins normally masked in the wild-type strain, suggesting a role for CcpA as an important structural conidial protein. Interestingly, swollen ccpA conidia led to higher activation of neutrophils and dendritic cells than wild-type conidia, suggesting a role for CcpA in the pathogenicity of A. fumigatus. In addition, virulence was highly attenuated when cortisone-treated mice were infected with ccpA conidia. Although CcpA played an important function in overcoming the innate immune response, recombinant CcpA protein was unremarkable when presented to the adaptive immune response, where it was neither immunosuppressive nor immunologically inert. Conclusion: These data suggest that CcpA is a major structural conidial protein that may hide immunogenic structures of the conidial surface from the host innate immune system.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Medical Mycology, 2018, Vol. 56, No. S2

P372 Identification and functional characterisation of zinc transporters in the human fungal pathogen Candida parapsilosis T. M. Nemeth1 , T. Takacs1 , D. Wilson2 , A. Gacser1 University of Szeged, SZEGED, Hungary University of Aberdeen, ABERDEEN, United Kingdom

1 2

Objective: Zinc is a vital element of living organsims and known as a growth limiting mineral. During host-pathogen interaction it is crucial to keep the available zinc concentration as low as possible to inhibit pathogen growth. To overcome this host defense mechanism, pathogens evolved specific pathways to acquire zinc under growth limiting conditions. In Candida albicans, a secreted soluble protein, Pra1 was discovered, that functions mostly at alkaline pH when zinc acquisition is limited and able to bind zinc ions outside the cell to transfer it to the plasmamembrane associated high affinity zinc transporter, Zrt1. In our model we investigated the zinc transporters of Candida parapsilosis, an important fungal pathogen of neonates, to characterise and examine their role upon interaction with the host. For the identification of such proteins we applied an in silico approach, thus predicted potential zinc transporters based on sequence homology, then generated homozygous mutants that were subjected to phenotypical analyses using various stress conditions (osmotic-, oxidative-, cell-wall stressors, different pH and temperature, zinc limiting conditions etc.). Methods: Target ORFs were predicted based on orthologs of Candida albicans zinc transporters. Gene distruption mutants were generated by auxotrophy complementation of a double auxotrophic parental strain (CLIB 214 /his-/ /leu-) The gateway cloning system was applied to reintroduce wild-type alleles into the established null mutants. Agaric plate assays were performed and viability was examined after two days of incubation. Results: We identified a total of six potential zinc transporter genes in C. parapsilosis in silico, out of which three (CPAR2 210740, CPAR2 806710, CPAR2 806720) showed sequence similarity with C. albicans ZRT2, encoding a low affinity zinc transporter. Furthermore, the ortholog of ZRC1 (a vacuolar importer) is also present in C. parapsilosis which is CPAR2 212100. Additionally CPAR2 212080 and CPAR2 500170 were also identified as potential zinc transporters, that are orthologs of C. albicans ZRT3 and ZRT1, encoding a vacuolar exporter and a high affinity plasmamembrane transporter, respectively. Interestingly no ortholog of Candida albicans PRA1 was found in C. parapsilosis. None of the generated mutants showed any difference in their fitness under the examined stress conditions. However, two mutants had obvious alterations in growth when zinc dependence was investigated compared to the wild-type strain. The viability of /CPAR2 210740 drastically decreased upon exposure to zinc depleted conditions, while /CPAR2 212100 failed to grow at high zinc ion concentrations. Conclusion: Proteins encoded by CPAR2 210740 and CPAR2 212100 possess similar functions as their ortologs in C. albicans. According to our results, C. parapsilosis lacks the zincophor molecule Pra1, suggesting that this species utilises zinc via a route different from that of C. albicans upon interaction with the host. Our results suggest, that the low affinity zinc ion transporter went through an expansion in C. parapsilosis. Although removal of the paralogs did not result in phenotypical defects under any examined conditions compared to the wild-type strain. Lack of the high affinity zinc ion transporter did not lead to decreased viability under low zinc ion concentration. This project was supported by NKFIH K123952 and UNKP-17-4 NEW NATIONAL EXCELLENCE PROGRAM OF THE MINISTRY OF HUMAN CAPACITIES

P373 Identification of Alternaria species and Alt a1 gene in Alternaria species isolated from air of Ahvaz City, Southwest Iran Mahnaz Fatahinia, Ameneh Takesh, Neda Kiasat, Ali Teimoori Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran., AHVAZ, Iran Objective: Today, one of the problems of the world is bronchial asthma and allergic rhinitis. Different studies provide evidence for the important role of fungi in respiratory disease and type I sensitization reactions. The prevalence of fungal allergies range of 4.7-24 Percent has been reported in Iran. Alternaria species has been reported as the most common etiologic factor in allergic asthma patients. Alt a1 is detected in the cytoplasm of mold spores and mycelia that leads to IgE antibody responses in more than 95% of Alternaria-sensitized patients.

Objectives: Our aim was to identify Alternaria species which are present in the outdoors and indoors air and investigation of the molecular diversity and phylogenetic relationships of Alternaria isolates in the Ahvaz City, by sequencing of Alt a 1 gene. Methods: In the present study, 40 Alternaria isolates obtained from the air of five different areas of Ahvaz city and were confirmed based on morphological characteristics (M. B. ELLIS 1971) and amplification of the region of internal transcribed spacer (ITS) by using universal primers ITS1 and ITS4. To detection and Identification of Alt a 1 gene, the genomic DNAs isolated from Alternaria isolates were used as templates. In order to Sequencing, all of the PCR products were sent to Topaz gene Research Company. The resulting nucleotide sequences were edited using the Mega-6 software. The alignment was compared with genomic data of NCBI gene bank. A Phylogenetic tree was drawn based on Alt a 1 gene. Results: In this study, the genus Alternaria were diagnosed by https://www.google.com/url?sa = t&rct = j&q = &esrc = s&source = web&cd = 4&cad = rja&uact = 8&ved = 0ahUKEwiMmePKo4LZAhURYVAKHZMLCrcQFgg5MAM&url = https%3A%2F%2Flink.springer.com%2Farticle%2F10.1007%2FBF00121878&usg = AOvVaw0_waUfFaA6TYI8NetGuKk5 and conidial properties. The species names were assigned according to the closest BLAST search that contains: A. alternate, A. tenuissima, A. infectoria, A. ventricasa, A. arborescens, A. mali, A. brasicolla, A. catharanthicola. BLAST search for similarities using Alternaria sp identification showed that the percentage of similarity of the isolates ranged from 97%-99%. Phylogenetic analysis were obtained using from sequencing gene of Alt a1 data with using MEGA-6 software. Based on the resulting dendrogram, almost 40 isolates were distributed in one cluster and these resided with standard species such as A. alternate, A. arborescens and A. tenuissima in clusters I. Several Alt a1 sequencings recorded in the DNA DataBank of Japan (DDBJ). Conclusion: We cannot exactly differentiate Species of genus Alternaria using ITS region sequencings. Because with each sequence was identified about 3 different species. In our opinion, the ITS sequencing is not as the “Gold Standard” (unlike Hall et al.2003) for the genus Alternaria. But Alt a1 gene sequencings can showed phylogenetic relationships of Alternaria isolates in an area.

ABSTRACT

P374 Increased metastatic activity and TAM receptor expression of oral squamous cell carcinoma cell lines upon microbial treatment 1 1 ´ Veres1 , D. Adamecz1 , D. Kovacs ´ Boros2 , I. Nagy3 , CS. Vagv ´ 1 , E. ´ olgyi ¨ ´ M. Vadovics1 , N. Igaz1 , E. , M. Kiricsi1 , A. Gacser 1 University of Szeged, SZEGED, Hungary 2 Biological Research Centre of the Hungarian Academy, SZEGED, Hungary 3 Biological Research Centre of the Hungarian Academy of Sciences, SZEGED, Hungary

Objective: A large number of commensal microbial species reside in the human body that have co-evolved with the human genome and adopted to the host immune system. Previously it has been shown that defects in regulatory processes or alterations in the composition of microbiome can lead to various diseases, including cancer. Even though the human bacteriota is well investigated, our knowledge is limited about the composition and function of the residential fungal microflora or the mycobiota. The most frequent opportunistic fungal infection in the oral cavity is candidiasis. Previous studies have shown that the number of Candida cells in this particular niche is significantly higher in patients with oral squamous cell carcinoma (OSCC) compared to healthy individuals. It was suggested that tumor-induced immunosuppression could cause fungal overgrowth and contribute to the development of an infection. However, the etiological relationship between oral cancer and Candida infections is still a matter of debate. Our aim is to examine the influence of fungal or bacterial infections on the metastatic activity of cancerous cells. Methods: Cell proliferation and migration activity of HSC-2 and HO-1-N-1 OSCC cells were investigated after fungal and bacterial stimuli. Scratch wound assay was performed to monitor the migration of cancerous cells. The proliferation activity of OSCC cells was examined by BrdU assay. Enzymatic activity of matrix metalloproteinase 2 (MMP-2) and matrix metalloproteinase 9 (MMP-9) was measured by gelatin zymography. To investigate the possible molecular mechanisms underlying the increased metastatic activity of OSCC cells after fungal or bacterial exposure, we examined the expression of various TAM receptors by qPCR and Western blot analysis since they advance cancer cell proliferation, and migration by contributing to epithelial-mesenchymaltransition (EMT). Results: The wound-healing capacity of HO-1-N-1 cells significantly increased after microbial exposure compared to the untreated samples, however no significant differences were observed between stimulated and unstimulated HSC-2 cells. Both cell lines showed increased relative BrdU incorporation upon treatments, which clearly indicates that fungal or bacterial infections can accelerate cancer cell proliferation. MMP-9 and MMP-2 gelatinase activity also increased after microbial stimuli. Furthermore, following microbial treatment, elevated expression of Tyro3, Axl and Mer in OSCC cells were measured by RT-PCR along with elevated levels of the AXL protein detected by Western blot analysis. Conclusion: These findings suggest that the presence of microbes in the oral cavity can promote cancer cell proliferation, increase motility and also the metastatic activity of oral squamous cell carcinoma cells. Our data also suggest that this phenomenon can be the result of TAM receptor induction. This project was funded by NKFIH K123952 and GINOP-2.3.2-15-2016-0001

P375 Atypical Malassezia yeast isolates from captive tapirs 1 1 ˇ ˇ , V. Mojcec Perko1 , LJ. Barbic1 , V. Stevanovic1 , Z. Stritof , J. Habusˇ 1 , S. Hadina1 , J. Boras2 , I. Bata2 , V. Staresina M. Perharic1 , Z. Milas1 , N. Turk1 , LJ. Pinter1 1 Faculty of Veterinary Medicine, The University of Zagreb, ZAGREB, Croatia 2 Zoo Zagreb, ZAGREB, Croatia

Objective: Malassezia yeasts are well known opportunistic microorganisms. However, their transition from the opportunistic to pathogenic yeast stage still remains unknown. This genus colonizes the skin of healthy domestic and wild animals. At present, there is no many data about the prevalence of Malassezia species in wild animals. During the epidemiological study of the colonization of these species of the wild animals kept in zoological park, we isolated Malassezia species from tapirs. The aim of this study was to explore morphological, biochemical and molecular characteristics of Malassezia yeasts isolated from the external auditory canal and skin of four tapirs. Methods: Malassezia colonies were grown on modified Dixon agar for 14 days at 32◦ C and identified based on colony appearance and microscopic features. In order to distinguish their lipid dependency, isolates were subcultured on Sabouraud dextrose agar (SDA). In addition catalase, urease and esculin test were performed. Genomic DNA was isolated using zymolyase enzyme and commercial DNA isolation kit. Molecular characterization was performed amplifying ITS-1 region with 18SF1 and 5.8SR1 primers, while F63 and LR3 primers were used for the amplification of D1/D2 regions of the LSU rRNA gene. Results: Malassezia isolates grew slowly on Dixon agar and did not grow on SDA. All colonies showed similar morphological and biochemical characteristics. They were catalase and urease positive and able to split esculin. By using ITS-1 and LSU primers, the sequences of expected size were amplified; 282 bp and 640 bp, respectively. NCBI BLAST analysis of LSU sequences had 95% identity to M. pachydermatis. Additionally, ITS-1 marker exhibited 79% identity (89% sequence coverage) with M. pachydermatis. Conclusion: These results indicate that isolates could belong to the lipid dependent M. pachydermatis. However, lipid dependency needs to be thoroughly evaluated. Further molecular and phylogenetic analysis will be employed in order to clarify identification of examined isolates.

P376 PCR diagnosis of sporotrichosis based on detection of unique genomic regions of Sporothrix spp O. M. Gomez1 , L.C. Alvarez2 , E. Misas2 , J.E. Gallo3 , I.P. Torres3 , M.P. Jimenez2 , M. Arango2 , O. Hernandez2 , O.K. Clay4 , J.G. McEwen2 1 ´ para Investigaciones Biologicas, ´ Corporacion MEDELL´IN, Colombia 2 Universidad de Antioquia, MEDELL´IN, Colombia 3 Universidad CES, MEDELL´IN, Colombia 4 Universidad del Rosario, BOGOTA, Colombia Objective: Sporothrix schenckii is a thermo-dimorphic fungal pathogen, and is the etiologic agent of sporotrichosis, a subcutaneous mycosis that affects humans and other mammals. The genus Sporothrix includes at least four human-pathogenic species: Sporothrix schenckii sensu stricto, S. brasiliensis, S. globosa, and S. luriei. Traditional diagnosis is based on fungal detection in culture and microscopic detection of Sporothrix yeast cells in clinical samples, however these methods have some limitations, such as time and low sensitivity, respectively. Aim of the work was to develop a molecular diagnostic test based on detection of unique genomic regions of Sporothrix. Methods: To search for DNA regions, we used the genomes of the genus Sporothrix available in the databases and the genomic sequences of two clinical isolates that we had assembled. We compared the genomic fragments (scaffolds/contigs) with phylogenetically related species using Blastn and selected the genomic fragments having size ≥ 400 bp and 0% identity with other species. The candidate sequences were checked manually and we identified the type of genomic element to which they corresponded (genes, CDS, repetitive region). The Geneious program was used for the design of primers and in silico PCR. Candidate primers were evaluated in vitro with conventional and real time PCR using DNA template of Sporothrix isolates and clinical samples. Also, we estimated the detection limit and the specificity of the test. Results: We selected from the candidates a partial CDS sequence of a chitinase gene and designed primers to amplify a fragment of 210 bp. These sequences did not show a significant homology with any other organism. To verify in vitro specificity of the PCR, we tested several DNA samples from other pathogenic microorganisms, including agents of mycoses in mammals. The detection limit was established by 10-fold serial dilutions of a positive control (PCR product cloned into pCR2.1 vector). The limit of DNA detection was 10 fg with conventional PCR and 1 fg with real time PCR (SYBR Green). In addition, we were able to amplify the unique genomic region of Sporothrix in two samples of biopsies of patients with sporotrichosis. Conclusion: PCR-based methods can be a more effective option for the diagnosis of sporotrichosis. The increase in genomic data and new bioinformatic tools allow us to develop a more sensitive and specific diagnostic test for this mycosis. In this work, we propose a PCR assay that detects a unique genomic region of Sporothrix spp as an alternative for the timely diagnosis of sporotrichosis. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 421677 bfc8ae26-47c3-4fbd-9149e680f17f830b.png Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 421677 bfc8ae26-47c3-4fbd-9149e680f17f830b.png

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

S137

P377 Identification of fungal antigens in a mouse model of Invasive Aspergillosis Silke Machata1 , Roland Lehmann2 , Hortense Slevogt2 , Ilse D. Jacobsen1 1 HKI, JENA, Germany Jena University Hospital, JENA, Germany

2

Objective: Aspergillus fumigatus is a saprophytic mold that is responsible for various severe pulmonary fungal diseases including invasive aspergillosis (IA). The major patient groups at risk of developing IA are patients with immune suppressive treatment after organ or stem cell transplantations and with leukocyte deficiencies. The infection is implicated with high mortality and an accurate and early diagnosis of IA is regarded one of the major factors for improving chances of survival. Diagnostic challenges in IA are the unspecific clinical symptoms and insufficient specificity or sensitivity of the tests available to screen for infection with Aspergillus. The development of new diagnostic tools for IA such as the detection of fungal DNA and anti-fungal antibodies is impeded by the fact that a clear differentiation between infection and mere exposition to this ubiquitous fungus is difficult. Also the variety of underlying diseases and subsequent therapeutic interventions in IA patients hamper the search for suitable host-based diagnostic markers. In the present study we took advantage of a well-established mouse model for IA and used bronchoalveolar lavage (BAL) samples from infected, exposed and non-infected mice to determine infection-specific fungal antigens that can serve as potential biomarkers for IA. Methods: Mice were immunocompromised with cyclophosphamide and infected with bioluminescent Aspergillus fumigatus conidia to allow visualization of the lung infection by in vivo imaging. Immunocompromised uninfected mice and immunocompetent infected mice, which do not develop IA upon exposure, served as controls, allowing the identification of infection-specific fungal antigens. Proteome analysis of BAL samples was performed by LC/MS and differential protein levels were compared between the three different groups. Results: Only mice were included in the infection group that showed strong fungal burden in the lungs, measured by in vivo imaging, and/or were positive for galactomannan in BAL samples. Altogether more than 1300 proteins were identified in the individual samples, 80 of which were fungal proteins. Roughly 30 of these fungal proteins were found in IA mice and control groups and can be regarded as false positives. Interestingly, about 30 of the detected proteins were only identified in the infected mouse samples. Among these were proteins involved in pectate lyase activity, cell wall organization, carbohydrate metabolic processes, hydrolase activity and polysaccharide metabolic processes. Some of these infection-specific proteins are known antigens that have previously been described to be secreted by A. fumigatus. However, we also found other proteins that have not been described yet in the fungus and may be promising candidates for biomarker evaluation. Conclusion: The direct measurement of BAL samples from three different animal groups, healthy, exposed and infected, is a suitable method to analyze the proteomic landscape during infection with A. fumigatus and to enable the identification of novel fungal biomarker candidates.

P378 In silico analysis of member of CTR family and copper dependent transcriptions factor in Paracoccidioides spp. G. Petito1 , A. D. C. Petito2 UFG, GOIANIA, Brazil ˆ Uni Anhanguera, GOIANIA, Brazil

1 2

Objective: The aim of this study was to find the sequence homology in Paracoccidioides lutzzi (isolate Pb01) and Paracoccidioides brasiliensis (isolate Pb18) with member of CTR family proteins and copper dependent transcription factor CUF1 as well as ACE1 and MAC1, and make a detailed structural and functional analysis between them. Methods: The study data were obtained by an analysis in silico using tools as BLAST (Basic Local Alignment Search toll), InterPro (Protein Sequence analysis and classification) and I-Tasser from the protein sequences characterized as high affinity copper transporters, members of the CTR family and transcription factors such as CUF1, ACE1 and MAC1. Table and figures were used to show the results, as well as statistics data (e-value, ID, others). Results: In relation to the members of the CTR family, was detected higher homology to the CTR3 from Sacchamomyces cerevisiae in isolate Pb01 (PAAG 05251) and Pb18 (PADG 05084). Both hypothetical proteins of these isolates had the necessary factors compatible with all members of the CTR family, as three transmembrane domain (TMD) (showed by Interpro Database), one methionine 20 aminoacid upstream of the transmembrane domain 01 (TMD1) and one mets motif (methionine motif) on transmembrane domain 02 (TMD2). On the other hand, the mets motif (MxxxM) was detected upstream TMD1, in hypothetical proteins in (PAAG 05251 and PADG 05084), but not in CTR3 of Saccharomyces cerevisiae. Differences on amount of cysteine residues were found. While CTR3 of Saccharomyces cerevisiae presented 11 cysteine “”residues, making up 4.50% of total aa, the hypothetical proteins had only 2.4%. Cysteine “”is an important residue in the uptake of copper. BLAST for CUF1 of Schizosaccharomyces pombe (NP 592923) and ACE1 (NP 011349) and MAC1 (NP 013734) of Saccharomyces cerevisiae showed a higher homology with two hypothetical proteins in isolate Pb01 (PAAG 08210 and PAAG 00516) and one hypothetical protein in isolate Pb18 (PADG 02168). A KGRP consensus sequence present in CUF1 was found in hypothetical protein PAAG 08210, but not in PAAG 00516 and PADG 02168. On the other hand, a cysteine-rich sequence (C-x-C-x3 -C-x-C-x2 -C-x2 -H) present in CUF1 (NP 592923) was found in PAAG 00516 and PADG 02168, but not in PAAG 08210. Analysis by Interpro Database showed the presence of Copper Fist DNA-binding domain superfamily in hypothetical proteins in isolate Pb01 (PAAG 08210 and PAAG 00516) and in isolate Pb18 (PADG 02168) as observed in MAC1 and ACE1 of Saccharomyces cerevisiae (NP 013734 and NP 011349) and Cuf1 of Schizosaccharomyces pombe (NP 592923). All putatives protein (PADG 02168, PAAG 08210 and PAAG 00516), in relation biological process, molecular function and cellular components analysis, were describe having as function regulation of transcription, DNA binding and nucleus component, respectively. I-Tasser analysis showed a higher similarity between structure CTR3 of Saccharomyces cerevisiae and CUF1, ACE1 and MAC1 with hypothetical proteins in Pb01 and Pb18. Conclusion: Putatives sequences proteins were found in both isolates. The sequences of these proteins in Pb01 and Pb18 they had domains and others characteristics necessary to include them as candidate as a member of CTR family (PAAG 05251 and PADG 05084) and as transcription factor (PADG 02168, PAAG 08210 and PAAG 00516) having as function regulation of transcription of copper homeostasis proteins.

P379 Iron homeostasisis in C. glabrata at the transcriptomic level ´ Fairhead1 , Monique Bolotin-Fukuhara1 , Youfang Zhou-li1 , Thomas Denecker2 , Karine Budin2 , CEcile Stephanie Boisnard1 , Gaelle Lelandais2 , Adela Angoulvant1 1 Le Moulon, INRA - Universite´ Paris-Sud - CNRS - AgroParisTech, ORSAY, France 2 Universite´ Paris-Sud - CNRS, ORSAY, France Objective: Invasive fungal infections are still an important cause of high rate of morbidity and mortality despite the availability of new antifungals. It is therefore of interest to improve our understanding of the host–pathogen interaction in order to develop new therapeutic options relying on the disruption of essential metabolic processes such as iron homeostasis. Iron is required for essential processes of cellular life, such as synthesis of DNA or respiration but is also toxic for living organisms because of production of free radicals. Tuning the iron uptake and metabolism is essential for the survival of pathogenic microorganisms in different host environments. However data on iron homeostasis of pathogenic fungal agents, in particular C. glabrata, the second etiologic agent of candidiasis in United States and Europe, are very recent and limited. Methods: To enrich these data, we analyzed the phenotype (growth) and transcriptomic (microarrays) responses of C. glabrata CBS 138 strain and of his aft1 mutant to Fe2+ iron deficient (YPD with 100 μM BPS) and overload conditions (YPD enriched with 500 μM of FeSO4 ) at 30◦ C and 37◦ C. Results: The phenotype of the aft1 mutant strain shows that pH plays an important role in iron homeostasis, with reduced growth in low acidic or alkaline media (pH 6 to 8), in the same way than in Fe2+ deficient conditions. Transcriptomic analysis of C. glabrata of 1033 regulated genes, with respect to S. cerevisiae and C. albicans, confirms some of the results of Gerwein et al. obtained in a Fe3+ deficient condition model. C. glabrata iron homeostasis seems closer to that of S. cerevisiae. This is well illustrated with the major role played in C. glabrata by Aft1, the well-established regulator of S. cerevisiae iron homeostasis. It is particularly striking for FET4, FRE6, MRS3, MRX2, GRX5 genes that are regulated by Aft1. Moreover C. glabrata misses Fe3+ transporters genes as the FIT family but and exhibits interesting regulated genes not described as belonging to the iron regulon of S. cerevisiae or C. albicans Conclusion: Perhaps not surprisingly, the iron regulon of C. glabrata seems more correlated to his phylogenetic position closer to S. cerevisiae than to C. albicans, than to its rank of pathogenicity.

S138

Medical Mycology, 2018, Vol. 56, No. S2

P380 Penicillium digitatum polypeptides detected by MALDI-TOF-mass-spectrometry of cell culture extract

P383 ’Moonlighting’ adhesins at the cell surface of Candida glabrata pathogenic yeasts

I.A. Riabinin, N.V. Vasilyeva North-Western State Medical University named after I.I. Mechnikov, SAINT-PETERSBURG, Russia

A. Kozik, D. Satala, O. Bochenska, J. Karkowska-Kuleta, M. Rapala-Kozik Jagiellonian University, Faculty of Biochemistry, Biophysics and Biotechnology, KRAKOW, Poland

Objective: The aim of this study is to determine the specificity of the polypeptides of the low molecular weight fraction of P. digitatumproteome to different fungal taxa that constitute the systematic position of this species. Methods: Annotations of mass-spectra of P. digitatumstrains isolated from hospital air, contaminated spices and damaged architectural materials were included in the study. The original mass-spectra, the composition of the annotation and search for homologous proteins were made as described previously [Riabinin I.A. et al., 6th Advances Against Aspergillosis, 2014; Riabinin I.A., Vasilyeva N.V., 3rd CRICMID, 2016]. Results: As a result of this work it was found that the mass-spectrum of P. digitatumcell extract in the Mr range from 2 to 20 kDa contains up to 35 peaks that are formed by up to 33 peptides and light proteins. Among the spectra-forming polypeptides 13 of them (39.4%) are unique to the P. digitatum, 10 (30.3%) are specific to the genus Penicillium, 4 (12.1%) are specific for members of Trichocomaceae family, 5 (15.2%) are found in other ascomycetes, 1 (3%) have homologs in fungi of various taxonomic position. In the latter case 1-family “carbohydrate-binding protein module”are found not only in the Ascomycetes, but also in typical representatives of the basidiomycetes from genera Sistotremastrum, Sphaerobolus and Exidia. Many peptides unique for P. digitatum form peaks which were compactly concentrated in the range of m/z 3354 –3780. Among other members of the genus Penicillium homologous peptides were found in P. rubens, P. camambertii, P. chrysogenum, P. italicum, P. roqueforti, P.freii, P. expansum, P. nordicum, P. brasilianum, P. arizonense P. griseofulvumandP. oxalicum. Interestingly, homologs for 11 of P. digitatumpolypeptides that were identified in proteome of other fungi are elements of much larger proteins, but information summaries from UniProt database for original peptides characterized them as separate molecules. Conclusion: P. digitatumis characterized by full accessibility to annotation of the low molecular weight portion of the spectrum, which almost can not be deciphered in Aspergillusspp. Because typical mass-spectra-profiles of P. digitatum in the Fungi Library database (Bruker Daltonik GmbH, Germany) have peaks of ions with Mr> 9 kDa, which could not be detected in this study, further research of the low molecular weight fraction of the P. digitatumproteome will be continued.

Objective: The adhesion of microbial pathogens to the host cells—a critical step for the host infection—depends on an arsenal of proteins, collectively called adhesins that are exposed on the pathogen surface and bind numerous host proteins. Besides typical adhesins, some pathogen proteins are loosely associated with the cell surface and identical with well known intracellular enzymes, involved in the crucial conserved metabolic routes. Secreted via yet unknown mechanism(s), these “moonlighting proteins” perform a new function of adhesins. Candida glabrata is the second, after Candida albicans, most common fungal pathogen of humans that causes various infectious diseases ranging from superficial candidiasis such as oral thrush to life-threatening bloodstream infections. Unlike other species from the Candida genus, C. glabrata is haploid yeast unable to convert into invasive hyphal forms, but still possesses a wide repertoire of virulence attributes, including the presence of adhesive proteins at the fungal cell surface. The present study aimed to identify C. glabrata surface-exposed proteins that can be classified as moonlighting proteins with a putative adhesin activity. Methods: Candida glabrata was cultured in various media, some of them simulating the conditions at the host niches, often infected by this pathogen. The fungal “surfaceome” was analyzed by a rapid method based on the “cell surface shaving” with trypsin, combined with the “shotgun” proteomic approach. Some of the identified yeast surface proteins that appeared identical with enzymes known to normally reside in the cytoplasm, were extracted from the yeast cell wall with 1,6-glucanase, followed by purification by ion-exchange chromatography and gel filtration. Interactions of these purified proteins with human extracellular matrix proteins— fibronectin and vitronectin—were quantitatively characterized using the surface plasmon resonance (SPR) measurements. Results: Under each of the conditions tested, a large number of various surface-exposed proteins were detected, including typical cell wall proteins such as the epithelial adhesin 6 (Epa6) and cell wall mannoprotein Cwp1, several heat shock proteins and a wide variety of moonlighting proteins. Two of the latter—enolase (Eno1) and glyceraldehyde-3-phosphate dehydrogenase (Tdh3)—belonged to the most abundant surface-exposed C. glabrata proteins after growth in all culture media used. After isolation and purification, these glycolytic enzymes were found to bind vitronectin and fibronectin, with the dissociation constants within a 10−8 -10−7 M range, suggesting their adhesin function. Several other moonlighting proteins were also identified at the cell surface of C. glabrata cultured under specific conditions. These included the enzymes that in the cytoplasm are involved in the glycolysis (triosephosphate isomerase, phosphoglycerate mutase, phosphoglucose isomerase, phosphoglycerate kinase and fructose 1,6-bisphosphate aldolase), fermentation (pyruvate decarboxylase and alcohol dehydrogenase) and the pentose phosphate pathway (transaldolase and 6-phosphogluconate dehydrogenase). Conclusion: The presence of numerous diverse moonlighting proteins at the surface of C. glabrata cells suggests their potential collective involvement in the pathogenesis of infections caused by these yeasts. This work was supported in part by the National Science Centre of Poland (grant no. 2016/23/B/NZ6/00089 awarded to A.K.).

P381 Epidemiological and molecular aspects of dermatophytes isolated from HIV-infected patients in a Brazilian Teaching Hospital T. Bragine-Ferreira, L.B. Silva, L.E. Andrade-Silva, B. Siqueira-Prudente, L.S. Lima Junior, M. Soares Ata´ıde, ROMES ˜ D.J. Mora, K. Ferreira-Paim, M.L. SILVA-VERGARA Tristao, ˆ Triangulo Mineiro Federal University, UBERABA, Brazil Objective: Background: Dermatophytoses are worldwide distributed superficial mycoses that affect the skin, nails and hair and are caused by keratinophilic fungi of the genera Trichophyton, Microsporum, and Epidermophyton. HIV-infected patients are more susceptible to several fungal infections including dermatomycosis, which can present a gamut of clinical manifestations including systemic dissemination. Currently, several molecular methods have been applied in order to improve their diagnosis, identify their etiological agents and improve the fungi taxonomy. Objective: To evaluate epidemiological and molecular aspects of dermatophytes isolated from HIV-infected patients at the Teaching Hospital in Uberaba, Minas Gerais State, Brazil. Methods: A total of 306 HIV-infected patients were included from August 2014 to December 2015. Samples of skin, hair and nail were collected from patients with or without cutaneous lesions. As control group, 92 HIV-negative patients with cutaneous lesions were evaluated. The isolated dermatophytes were phenotypically characterized and molecularly identified by RFLP and ITS region sequencing. Results: Of the 306 HIV-infected patients, 153 (50%) presented cutaneous lesions yielded several fungal species of which 22 (14.38%) were phenotypically identified as dermatophytes. From the control group, 19 isolates were also obtained. Trichophyton rubrum was the most common isolate species and the toenails were the body sites most affected in both groups. There was no statistical difference between the frequencies of dermatophytosis in HIV-infected patients with lesions compared to the control group. The phenotypic identification of the isolates presented several limitations. A total of 41 isolates were submitted to molecular characterization. By RFLP technique 28 (68.29%) of dermatophytes were identified at the species level. The profiles obtained were variable among the different species, which allowed the visual differentiation between T. rubrum, Trichophyton interdigitale, Microsporum canis and Trichophyton verrucosum. The obtained patterns optimized the identification of three previously characterized isolates only at the gender level. The RFLP of the ITS region also allowed the correct identification of two T. rubrum isolates previously identified as T. interdigitale. The amplified fragments generated sequences of approximately 630 bp, which allowed to confirm the phenotypic identification in 70% of the ten sequenced isolate. The ITS region, although relatively conserved permited to evidence intraspecific variations among the dermatophytes and the sequences obtained showed high identity with clinical isolates from different geographic regions deposited on GenBank. Multiple sequence alignment demonstrated the presence of two major clusters, corresponding to the complexes of T. mentagrophytes and T. rubrum species. Conclusion: Herein, the RFLP and the ITS sequencing region contributed to improve the identification of dermatophytes at the species level and can be considered a complementary tool since the phenotypic identification with its known limitations, is still considered the classic and available diagnostic method for dermatophytes in most places. Financial support: FAPEMIG

P384 The possible effect of Vitamin D3 on Candida growth and pathogenicity K. Zomorodian, Z. Kherad, S. Yazdanpanah, K. Pakshir, H. Nouraei Shiraz University of Medical Sciences, SHIRAZ, Iran Objective: Vitamin D3 is a substance which the body needs for hemostasis of calcium and healthy bones. Deficiency of this vitamin has been related to many diseases and microbial infections. Recently, researchers have found a positive relationship between vitamin D and Candida infection. As biofilm formation by C. albicans plays an important role in its pathogenicity, we investigated the effect of vitamin D3 on the growth, biofilm formation and expression of genes related to its morphogenesis and pathogenesis. Methods: Antifungal activities of vitamin D3 against Candida species was evaluated by micro-broth dilution method based on CLSI protocol. Inhibition of Candida albicans biofilm formation by different concentration of vitamin D3 was measured using XTT reduction assay. Moreover, expression of adhesion-related gene (ALS1), hyphal cell wall protein gene (HWP1), secreted aspartyl proteinase (SAP6), and morphogenesis pathway regulatory gene (EFG1) were analyzed by RT-PCR in the treated yeast cells with different concentrations of vitamin D3. Results: Vitamin D3 exhibited fungistatic activity on Candida species with minimum inhibitory concentration at a concentration of 1 to 128 μg/ml. Furthermore, vitamin D3 inhibited the formation of C. albicans biofilm in a dose-dependent manner. RT-PCR analysis of RNA extracted from C. albicans indicated that different concentrations of vitamin D3 could change the of expression levels of genes, in a different manner. Conclusion: Based on our results and those of previous studies that found a high prevalence of vitamin D deficiency in patients with candidiasis, this vitamin might be used in treating Candidiasis in addition to antifungal therapy.

P385 Generation and characterization of Candida parapsilosis over-expression mutant strains 1 1 1 ´ ´ olgyi ¨ ´ ´ 1 , T.M. Nemeth , L. Pryszcz2 , T. Gabaldon2 , CS. Vagv , A. Gacser S. E. Pal University of Szeged, SZEGED, Hungary Bioinformatics and Genomics, Centre for Genomic Regulation, BARCELONA, Spain

1 2

P382 Fungal eicosanoids: a potential drug target for cryptococcal infections N. Castro-Lopez, A. Campuzano, F. L. Wormley University of Texas at San Antonio, SAN ANTONIO, USA Objective: Cryptococcosis is an opportunistic fungal disease caused by Cryptococcus neoformans and Cryptococcus gattii, affecting immunocompromised and immunocompetent individuals respectively. The route of infection is typically by inhalation of desiccated spores found in the soil or in pigeon droppings. Fungal lipids have been shown to regulate pathogenesis by modulating the production of virulence factors. Therefore, lipid-signaling pathways are novel candidates for the development of new antifungal drugs. Eicosanoids are oxygenated lipids made by the oxidation of fatty lipids (i.e. arachidonic acid (AA)) resulting in the production of prostaglandins (PG) and leukotrienes (LT) by a variety of microorganisms. Inhibitors of cyclooxygenase (enzyme required to produce PG) do not inhibit the production of prostaglandin E2 (PGE2 ) in Cryptococcus, suggesting a different mechanism for the production of PG in Cryptococcus than in humans. Therefore, we hypothesized that eicosanoids can be used as a potential drug target for cryptococcosis. These studies seek to determine the enzymes involved in the production of eicosanoids in Cryptococcus. Methods: In vitro studies were used to determine the production of PGE2 and Leukotriene B4 (LTB4 ) in C. neoformans H99. C. neoformans was growth in R10 with or without AA for 18 hours at 37◦ C in the presence of CO2 , supernatant was use to determined the amount of PGE2 and LTB4, and the pellet was use to determined the CFUs. Additionally, we perform RNA-seq to determine the pathways involved in the production of eicosanoids. Results: C. neoformans H99 is able to produce PGE2 and LTB4 under simulated host conditions in the presence of AA. Next, we seek to determine the enzymes involved in the production of eicosanoids. RNA-seq data show that when AA is presence is the media, C. neoformans shift its machinery towards process that involved lipids and fatty acid synthesis, and peroxisome transport. Genes involved in b-oxidation and glyoxylate cycle are upregulated in the presence of AA. Furthermore, we seek to determine if statins could block the production of eicosanoids, statins are drugs that lower the lipid production and also know to inhibit cryptococcal growth, but in the presence of statins did not reduced the production of PGE2 or LTB4. Next, we use different C. neoformans KO strains to evaluate their role in the production of eicosanoids. Conclusion: These studies suggest that an excesses production of PGE2 and LTB4 by C. neoformans could lead to the production of other toxic compounds that are detrimental for Cryptococcus growth. Genes involved in b-oxidation and glyoxylate cycle are upregulated in the presence of AA. Gene involved in b-oxidation had been shown to be required for virulence.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Objective: Candida parapsilosis is an opportunistic human fungal pathogen, threatening a wide range of patient group ranging from low birth-weight neonates to the critically ill and severely immune suppressed patients treated at intensive care units. Furthermore, C. parapsilosis infection rates can even exceed the candidaemia episodes caused by C. albicans at certain geographical regions. Therefore, excessive research is now focused on the investigation of C. parapsilosis’ pathogenesis. In order to search for genes potentially influencing the virulence of C. parapsilosis, we aimed to generate and characterize over-expression mutant strains of ORFs that, according to our preliminary experiments, are thought to influence fungal pathogenesis. Methods: To identify such set of genes, transcriptional analysis of fungi co-incubated with THP-1 human monocytes was performed. Differentially expressed kinases and transcriptional factors and additional orthologous genes of C. albicans virulence regulatory ORFs (adherence, biofilm formation, antifungal resistance) were sentenced to over-expression. We used the Thermo Fisher Scientific Gateway cloning technology to create over-expression mutant strains. Transformants were validated by colonyPCR, Southern blot and real-time PCR. The fitness of the verified mutants was monitored in vitro at various temperatures and under conditions that are thought to influence the virulence of C. parapsilosis. These included different pH conditions, minimal and complex media and also solid media supplemented with osmotic, oxidative or cell wall stressors. Fitness under metal iron limiting conditions was also examined. Results: During our work, we successfully generated 36 over-expression mutant strains with 2 parallels and added unique 20-mer nucleotide barcode sequences to each in order to be able to identify them during later co-infection studies. Integration of the over-expression constructs was confirmed by both colony PCR and real-time PCR. To exclude the possibility of ectopic integrations, Southern-blot analysis was also applied. We confirmed that all mutant strains contained only one copy of the integrating constitutive promoter containing over-expression cassette. Thereafter, all available mutant strains’ viability was examined under the aforementioned conditions. During the characterization, altered phenotypes were detected mainly in the presence of SDS, EDTA and Congo Red. Under these conditions, mutants showed growth disabilities when compared to the parental strain. Conclusion: In this study, we successfully generated 36 C. parapsilosis over-expression mutant strains. According to our results, several of these showed a phenotype different from the wild type under conditions that are thought to impact the pathogenicity of this species. In order to supplement this hypothesis we further aim to perform virulence studies including both in vitro and in vivo infection models. This project was funded by NKFIH K123952 and GINOP-2.3.2-15-2016-00015.

ABSTRACT

S139

P386 Action of methylene blue photodynamic therapy on Cryptococcus spp. resistant to conventional antifungals

P389 Search of Virulence Factors in Sporothrix schenckii by Insertional Mutagenesis.

F. O. Nunes1 , L. Bachmann2 , T. Bragine-Ferreira1 , L.E. Andrade-Silva1 , R. Ventresqui1 , M.L. Silva-Vergara1 , D.J. Mora1 1 ˆ Triangulo Mineiro Federal University, UBERABA, Brazil 2 ˜ PRETO, Brazil ˆ ˜ Preto, RIBEIRAO Faculdade de Filosofia, Ciencias e Letras de Ribeirao

˜ Vega, H. M. Mora Montes D. M. Clavijo Giraldo, G. A. Nino Universidad de Guanajuato, GUANAJUATO, Mexico

Objective: Recently, the photodynamic therapy (PDT) has been researched as an alternative tool to photoeradicate bacteria, protozoa, viruses, and fungal infections. It uses a combination of a photosensitive substance activated by a light source in the presence of oxygen. The resulting reaction induces cell death due to the production of toxic oxygen species, such as singlet oxygen and/or free radicals. Objective: To evaluate the effectiveness of methylene blue and light-emitting diode (LED) against Cryptococcus neoformans and C. gattii resistant to antifungal drugs. Methods: A total of 15 (9 clinical and 6 environmental) C. neoformans and two clinical C. gattii isolates resistant to conventional antifungal drugs were selected. Of 9 clinical strains of C. neoformans, 4 (44.4%), 7 (77.7%) and 2 (22.2%) exhibited resistant to amphtotericin B (AMB), itraconazole (ITZ) and fluconazole (FLZ), respectively, whereas 2 (33.3%) and 3 (50%) environmental isolates exhibited resistant to ITZ and FLZ, respectively. The C. gattii clinical isolates were resistant to FLZ, 50% to ITZ and 50% to AMB. The light source to evaluate the PDT was a LED emitting at λ660nm with output power of 6.2 mW/cm2 for 15, 30 and 45 min of irradiation, resulting fluences at 5.6, 11.2 and 16.9 J/cm2 . The methylene blue (MB) was used as photosensitizer at 50 μM, 250 μM e 500 μM. A mixture of MB and fungal suspension (106 CFU ml−1 ) was stored in a dark room at 25 ◦ C for 10 min prior to laser irradiation. All PDT were repeated in triplicate. The CFU counts were made up to 96 h after PDT. The susceptibility to PDT and antifungal drugs were analyzed by nonparametric Friedman and Wilcoxon tests, P value equal to 0.01. Results: The LED or MB alone did not reduce cell viability of strains evaluated. LED energy density of 16.9 J cm−2 together with 250 μM of MB significantly reduced the survival rate of clinical C. neoformans isolates in 3.1 log10 CFU ml−1 (p ≤ 0.01). Clinical C. neoformans isolates were more susceptible to PDT than the environmental ones without statistical significance. Light doses of 16.9 J cm−2 killed both clinical and environmental C. neoformans strains at 250 μM of MB, but only the strains susceptible to AMB showed statistical significance (p ≤ 0.05). The C. gattii strains resistant to FLZ exhibited more tolerance to PDT than the C. neoformans (P = 0.05). Conclusion: Herein, it was observed the photodynamic activity of MB in combination with LED irradiation decreasing the cryptococcal viability of both, clinical and environmental isolates resistant to several antifungal drugs. In vivo tests must be performed to verify the viability of MB and LED as potential therapeutic to inhibit cryptococcal cellular growth in infected sites.

Objective: In this work, we took a step forward by producing libraries of random mutants of S. schenckii sensu stricto, for the search for new virulence factors in this fungus species. Methods: To carry out mutations in S. schenckii, we used Agrobacterium-mediated transformation technique, using the pBgGHg vector. This protocol was recently developed in our laboratory. The insertional events were corroborated by PCR and the mutants were observed under fluorescence microscopy to verify the expression of GFP. As a tool to determine whether there were differences in the virulence of the mutants, we used the alternative infection model Galleria mellonella, an insect that has proved to be an excellent model for reproducing the virulence levels of Sporothrix spp., observed previously in the murine model. Results: We obtained 302 mutants that were molecularly corroborated. Some of these mutants showed different growth phenotypes, deficiencies in the dimorphic transition and differences in melanization. In addition, when the alternative model of infection was evaluated we observed differences in the survival times of larvae, identifying mutant strains with attenuated virulence and mutants with higher virulence when compared to the wild-type strain. Conclusion: Out of the 302 mutants obtained, 102 were selected to be evaluated in G. mellonella. The mutants presented different phenotypic characteristics including traits similar to those displayed by the wild-type strain, and deficiency in the dimorphic transition or difference in the melanization patterns. Although GFP expression was not observed in all of the mutants, the insertional event was present in their genome. We observed that virulence was affected in some of the mutants, generating strains incapable of killing G. mellonella and, on the other hand, some mutants increased their ability to establish the infection, and therefor larvae had shorter survival times. This work was supported by: CONACYT FC-2015-02-834, M´exico, and Universidad de Guanajuato.

P390 Revealing parallel host-pathogen transcriptional dynamics using sorted subpopulations and single Candida albicans infected macrophages ˜ 1 , T. Delorey1 , C.B. Ford1 , B. Li1 , D.A. Thompson1 , R.P. Rao2 , C.A. Cuomo1 J. F. Munoz Broad Institute of MIT and Harvard, CAMBRIDGE, USA Worcester Polytechnic Institute, WORCESTER, USA

1 2

Financial support: FAPEMIG P387 Novel FK506 analog exhibits anti-fungal activity against Cryptococcus neoformans in vitro and in an animal model M. J. Hoy1 , D. Fox2 , J. Wheaton1 , M. Mutz3 , W.J. Steinbach1 , M. Ciofani1 , J. Heitman1 1 Duke University, DURHAM, USA 2 Beryllium Discovery, BAINBRIDGE ISLAND, USA 3 Genentech Inc., SAN FRANCISCO, USA Objective: The development of novel antifungal drugs is critical to continue to treat patients with aggressive fungal infections such as cryptococcal meningitis. One attractive target for antifungal drug development is calcineurin, a serine-threonine phosphatase that is required for several cellular functions including growth at human body temperature. The naturally occurring drug FK506 is a potent calcineurin inhibitor that binds to FK506 binding protein (FKBP12) and docks with calcineurin to inhibit its activity. However, FK506 is not used clinically to treat infections due to its potent immunosuppressive activity through the inhibition of human calcineurin, which is required for T cell activation. This study aims to generate chemical modifications of the FK506 structure that maintain antifungal activity while reducing human immunosuppressive activity. Methods: The FK506 analog, APX879, was tested for both in vitro and in vivo activity against C. neoformans. Additionally, a 3.3 Åcrystal structure of the C. neoformans calcineurin-FK506-FKBP12 ternary complex was solved to provide insight into the orientation and interactions of the drug with the protein complex. Immunosuppressive activity for APX879 was assessed by measuring IL-2 production by murine primary T-cells in the presence of APX879 or FK506. Results: An FK506 analog, APX879, differs from FK506 by a single chemical substitution. We found that APX879 maintains antifungal activity in the context of in vitro assays as well as in a murine inhalation infection model. Moreover, strains of C. neoformans that are resistant to FK506 also display resistance to APX879. The structure of C. neoformans calcineurin-FK506FKBP12 suggests that the residue modified in APX879 will not affect its binding to FKBP12, but instead will change how it interacts with the calcineurin subunits. Additionally, compared to FK506, APX879 exhibits a marked decrease in immunosuppressive activity assessed by IL-2 production in primary T cells. Conclusion: In conclusion, we propose the development of a novel FK506 derivative, APX879, which exhibits decreased immunosuppressive activity while maintaining antifungal activity against a global cause of considerable morbidity and mortality in immunocompromised patients, C. neoformans. Structural data generated in this study has provided insights to the mechanism of this species-specific inhibition of calcineurin. By understanding how APX879 inhibition differs structurally from FK506, additional medicinal chemistry can be conducted to generate different calcineurin inhibitors that improve on this fungal calcineurin specificity. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 422208 74226f24-c7fb-48a8-977ac2b6c6993294.png

P388 A reduced amount of 14-3-3 protein and the implications to Paracoccidioides brasiliensis infection. 1

1

1

1

1

1

1

C. M. Marcos , H. C. Oliveira , P.A. Assato , J.F. Da Silva , L Scorzoni , A.C.A. De Paula e Silva , J.L. Singulani , C.T. Santos1 , R.M. Da Silva1 , R De Almeida1 , C De Andrade2 , A. M. Fusco-Almeida1 , M.J.S. Mendes-Giannini1 1 ˆ Faculdade de Ciencias Farmaceuticas de Araraquara, ARARAQUARA, Brazil 2 Faculdade de Odontologia de Araraquara, ARARAQUARA, Brazil Objective: Paracoccidioidomycosis (PCM), a systemic endemic mycosis with chronic and granulomatous evolution is caused by thermal dimorphic fungi Paracoccidioides brasiliensis and Paracoccidioides lutzii. The infection occurs through the inhalation of conidia derived from the mycelial form present in the natural environment. It can reach the lungs and converted into yeasts producing pulmonary lesions and subsequently spread to others organs. The down-expression of Pb14-3-3 (expression reduced by 55%) previously obtained by antisense technology (aRNA) and Agrobacterium tumefaciens-mediated transformation (ATMT) conferred phenotype modifications to the transformant isolate, Pb14-3-3 aRNA, such as impairment in the dimorphism, reduced number of buds per yeast, decreased interaction with pneumocytes and attenuation of the virulence in Galleria mellonella model demonstrating the importance of this protein in P. brasiliensis and its interaction with the host. Our aim is to evaluate the pathogenic role of 14-3-3 protein of Paracoccidioides brasiliensis in a murine model of infection and the induction of pneumocytes apoptosis. Methods: Experimental paracoccidioidomycosis in mice with fungal transformant, Pb14-3-3 aRNA, PbWT (wild-type strain) and PbEV (empty-vector strain) assessing evidences as number of granulomas and fungi in the lung tissues and measurement of fungal burden after 15 days of infection. TUNEL assay was used to verify host cell apoptosis induction after 5 and 24 hours of interaction. Results: The lungs from mice infected with PbWT and PbEV showed a higher number of granulomas and these had a higher number of yeast cells, when compared with the mice group infected with Pb14-3-3 aRNA. Similarly, the number of CFU/g of organ recovered from the lungs of mice infected with Pb14-3-3 aRNA was approximately 87.7% lower than the number recovered from the mice infected with PbWT and PbEV. When compared to PbWT and PbEV, the silenced strain Pb14-3-3 aRNA induces significantly less apoptosis for 5 and 24 hours. Conclusion: Pb14-3-3 aRNA displays attenuation of the virulence triggering the formation of fewer granulomas with decreased number of yeast cells in the lungs and reduced fungal burden, as well as, less ability to induce host cells apoptosis. Our results showed that 14-3-3 is an important virulence factor in pulmonary infection caused by P. brasiliensis.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Objective: The control of fungal infections depends on interactions with innate immune cells. Phagocytic cells including macrophages are among the first host cell types to respond to pathogens including Candida albicans, a member of the healthy human microbiome and a major fungal pathogen of immunocompromised individuals. Within a population of interacting macrophages and C. albicans, there are distinct host-pathogen subpopulations reflecting cell specific trajectories and infection outcomes. However, little is known about the molecular mechanisms that control these different fates. We aimed to characterize gene expression patterns that correlate with distinct host and fungal pathogen infection fates. Methods: We developed an experimental system to isolate the major host-fungal pathogen subpopulations observed during ex vivo infection using fluorescent markers. We separated subpopulations of macrophages infected with live or dead C. albicans from free cells and traced expression variability using RNA-seq and transcriptional analysis of both host and pathogen for each subpopulation and single infected cells across time. Results: We show that cell sorting can successfully isolate subpopulations of distinct infection outcomes and examined host and pathogen gene expression in parallel, in sorted subpopulations and in single, infected macrophages. In infected cells, we observed a coordinated, time-dependent shift in gene expression for both host and fungus. The early response in macrophages was established upon exposure to C. albicans prior to engulfment and involved up-regulation of pathways and regulatory genes required for cell migration, pathogen recognition, activation of engulfment, and phagocytosis; this pro-inflammatory response declined during later time points in parallel with expression changes in C. albicans. After phagocytosis, the initial response of C. albicans was to upregulate genes related to survival in the nutrient-limited and stressful environment within macrophages; at later time points, gene expression shifted to initiate hyphal growth and escape. In addition, we observed that at the single cell level some genes showed bimodal expression levels in both host and fungal pathogen cells that we could not detect in subpopulation samples; we observed that the time shift in expression is asynchronous across the populations and that expression changes in both the host and pathogen in single cells are tightly coupled. Conclusion: This work highlights that pairing sorted subpopulation and single-cell RNA-sequencing approaches can trace distinct trajectories during host-fungal pathogen interactions. This system will help us to trace different host-pathogen phenotypes and their distinct expression variability driving drug resistance, host adaptation and immune response.

P391 Composition of sterols in azole-resistant Aspergillus fumigatus isolates in basal conditions and under exposition to itraconazole and voriconazole R. A. Lavergne1 , I. Ourliac-Garnier1 , M. Albassier1 , C.A. Alvarez Moreno2 , F. Morio1 , P. Le Pape1 1 EA1155 IICiMed, Institut de Recherche en Sante´ 2, Universite´ de Nantes, NANTES, France 2 ´ Colombia Facultad de Medicina, Universidad Nacional de Colombia, BOGOTA, Objective: The aim of the study was to compare sterol composition of azole-susceptible and azole-resistant Aspergillus fumigatus, bearing environmental mutations, in presence or absence of azole drugs. Methods: Five azole-resistant (TR34 /L98H: n = 2, TR34 /L98H/S297T/F495I: n = 1, TR46 /Y121F/T289A: n = 1, TR53 : n = 1) and one susceptible (ATCC 204305) A. fumigatus isolates were investigated. After a 48 hours culture in Yeast Peptone Dextrose broth at 37◦ C without antifungal agent or with itraconazole or voriconazole (concentration = 0.25xMIC), mycelia were harvested and saponified at 80◦ C for 1h30. Unsaponifiable lipids, i.e. sterols, were extracted using liquid/liquid method. Sterols were analyzed under trimethylsilyl ether derivatives by gas chromatography-tandem mass spectrometry. Sterols were identified by comparing their fragmentation data with published data and results were expressed as percent of the total peak area. Results: For the 6 isolates, basal composition of sterols showed mostly ergosterol (> 85%). A maximum of 14% of 4,4dim´ethylcholesta-8,14,24-trien-3β-ol was detected suggesting blocking in the zymosterol branch and confirming a preferential biosynthesis of fecosterol proceeding from eburicol. When treated with itraconazole or voriconazole, the sterol composition of the susceptible ATCC strain changed with a major decrease in rate of ergosterol, a disappearance of 4,4-dim´ethylcholesta-8,14,24trien-3β-ol together with accumulation of eburicol (from 20 to 34%) coinciding with the appearance of other 14α-methylsterols (obtusifoliol and 14α-methylfecosterol). Concerning azole-resistant isolates, in presence of itraconazole, ergosterol percentage was diminished by only 7 to 20% and persistence of 4,4-dim´ethylcholesta-8,14,24-trien-3β-ol was also observed. At the same time, eburicol appeared (from 5% to 15%) and except for TR34 /L98H/S297T/F495I obtusifoliol built-up. Concerning 14α-methylfecosterol, it was not detected in any azole-resistant isolates. In presence of voriconazole, TR34 /L98H and TR34 /L98H/S297T/F495I isolates behaved as the sensitive strain. For TR46 /Y121F/T289A and TR53 isolates, 4,4-dim´ethylcholesta-8,14,24-trien-3β-ol persisted with accumulation of eburicol and apparition of obtusifoliol with (TR46 /Y121F/T289A) or without (TR53 ) 14α-methylfecosterol. Conclusion: There were no qualitative and quantitative significative differences in basal composition of sterols between resistant and susceptible strains, consistent with a normal ergosterol biosynthesis in azole-resistant A. fumigatus with environmental alterations. In presence of azole drugs, eburicol accumulated with a built-up of obtusifoliol for sensitive and resistant strains except for TR34 /L98H/S297T/F495I when exposed to itraconazole. Interestingly 14α-methylfecosterol was not detected in any resistant isolates when cultivated with itraconazole. Moreover, under azole exposition, no 14α-methylergosta-8,24(28)dien-3β,6α-diol was detected contrary to what can be observed for Candida albicans.

S140

Medical Mycology, 2018, Vol. 56, No. S2

P392 Antifungal activity in vitro and in vivo of essential oils against dermatophytosis agents

P395 Identification of P. Brasiliensis in the heart and evaluation of cardiac involvement of BALB/c MICE in experimental PCM

Resewnde-Stoianoff1 , M.A. Resende-Stoianoff1 , P.H.F. Carmo1 , R.W. Bastos , H.C.S. Carneiro1 , M.C. Costa1 , L.M. Baltazar1 , D.A. Santos1 1 Institute of Biologycal Sciences, Federal University of Minas Gerais, BELO HORIZONTE, MG, Brazil 1 Institute of Biological Sciences, Federal University of Minas Gerais, BELO HORIZONTE, MG, Brazil

Resewnde-Stoianoff1 , J.A.C. Oliveira1 , E.A. Morais1 , E.M. Melo1 , P.S. Cunha1 , C.M. Carneiro1 , L.N. Soares de Sa´ 2 , E.N.M. Martins1 , A.M. Goes1 1 Institute of Biologycal Sciences, Federal University of Minas Gerais, BELO HORIZONTE, MG, Brazil 2 ´ Centro Universitario de Belo Horizonte, BELO HORIZONTE, MG, Brazil

Objective: Fungal infections, such as dermatophytosis, include some of the most common human diseases. Among the etiological agents most prevalent in these infections are the species of the genus Trichophyton, such as Trichophyton interdigitale, responsible, epidemiologically, for cases of onychomycosis and tinea in several countries of the world. Although there are substances for the treatment of these infections, most of the compounds present high toxicity to the patients, which, together with the emergence of antifungal resistance used in clinical practice, makes the search for new antifungal drugs essential. Among the potential targets for the discovery of new antifungal drugs, plants have been extensively studied. Among the potential targets for the discovery of new antifungal drugs, plants have been extensively studied. Among the plants studied, there are those that have been used empirically by the population for years in the treatment of fungal infections. In order to evaluate the in vitro and in vivo antifungal activity of three essential oils (EO1, EO2 and EO3). Methods: The antifungal potential of these essential oils was tested by minimum inhibitory concentration (MIC) against T. interdigitale strains, monotherapy and combination therapy with ketoconazole. In addition, the potential of these extracts was tested for the ability to modulate the fungicidal activity of bone marrow derived macrophages by quantifying the production of nitric oxide, reactive oxygen and nitrogen species, rate of phagocytosis and analysis of the intracellular proliferation profile. The cytotoxic activity of these compounds in macrophage viability was also tested at different concentrations. EO1 and EO2 were further tested for the ability to decrease fungal burden in a murine model of dermatophytosis. Results: The MIC range for the compounds tested was 0,06-0,25% (% v/v) for EO1, 0,12-0,50% (% v/v) for EO2 and 0,50-1,00% (% v/v) for EO3, low values when compared to ketoconazole (0,30-2,00 μg/mL). In combination with ketoconazole, the essential oils presented mostly antagonistic activity and, in some cases, concentration-dependent indifference. It was observed that the compounds tested induce the production of reactive species of oxygen and nitrogen, as well as increase the phagocytic activity. The intracellular proliferation profile, however, showed no dependence on the action of essential oils. Conclusion: In murine model of dermatophytosis, it was observed that the treatment with EO1 and EO2 have the capacity to reduce the fungal burden in infected animals, indicating a promising potential of the use of the essential oils against Trichophyton interdigitale strains.

Objective: Paracoccidioidomycosis is a systemic disease, endemic in Latin America, caused by dimorphic fungi of Paracoccidioides genus. Even though the primary pathway of infection is pulmonary, by inhalation of conidia, several anatomical sites may be affected by lymphoematogenic dissemination, including the heart. Studies demonstrate the complexity of the P. brasiliensis caused disease and reveal a necessity to investigate the infection sites because the involvement may be underdiagnosed. The aim of this work was to identify and characterize fungal colonization in the heart of P. brasiliensis infected mice. Methods: Male BALB/c mice were inoculated with 3 × 105 viable yeast cells of virulent P. brasiliensis. The mice were euthanized (anesthetic overdose), and the heart were aseptically removed 15, 30 and 60 days after infection. The number of viable cells was determined by plating crude and serially diluted homogenates onto BHI agar supplemented with 4% fetal calf serum and 5% P. brasiliensis spent culture medium (Pb18) as growth factors. The CFUs were counted after 20 days of incubation. The results are expressed as the log10/g of tissue of CFUs of viable yeast cells (log10/g). Part of heart was used for histological analyzes with HE) staining to detect inflammatory infiltrate and with Masson’s Trichrome staining to evaluate the presence of collagen fibers around the fungus. Part of heart was homogenized in lysis buffer for quantification of cytokines IL-4, IL-6, IL-10 and TNF-α in the tissue by ELISA method (DuoSet ELISA Development System Mouse kit). Results: Fungal cells recovered from cardiac tissue were viable and virulent. Histological analyzes by HE staining revealed the presence of multifocal granulomas composed of interstitial inflammatory infiltrates with circular birefringent cells with diameter ranging from 6 to 20 μm, which are characteristic of P. brasiliensis. Histological analyzes by Masson’s Trichrome staining showed that granulomatous reactions and fungal cells are surrounded and interspersed by fibrous connective tissue, in addition to the presence of collagen fibers, corroborating the ELISA findings that revealed elevated levels of TNF-α in cardiac tissue. Conclusion: The results reveal that the cardiac tissue present an infection profile similar to those observed in the literature with pulmonary tissue. The fungus has a hematogenous dissemination capacity to the cardiac tissue, colonize and to generate inflammatory responses characteristic of the disease such as a formation of granulomas rich in collagen fibers, which may compromise cardiac function and aggravate the patient’s clinical condition. Thus, a characterization of cardiac tissue infection by P. brasiliensis may better target the diagnosis of cardiac problems associated with PCM and indicate more adequate therapeutic measures for the control and treatment of the disease.

P393 Construction of Cryptococcus neoformans reporter strains containing GFP or mCherry fluorescent proteins for pathogenhost interaction studies ˜ A.L. Bocca, L. Fernandes-Matos R. J.A. De Castro, M.T. Aidar, F.A.S. Brandao, University of Brasilia, BRAS´ILIA, Brazil Objective: Cryptococcus neoformans is the etiological agent of cryptococcosis, one of the major invasive fungal diseases across the world. C. neoformans is known for its remarkable ability to parasitize immune system phagocytic cells, exploiting them as a site for replication, evasion of host immune recognition and response, and even as a vehicle for dissemination from the lungs, the primary site of inoculation, to secondary infection organs such as the brain, promoting cryptococcal meningitis, generally with fatal outcomes. In this context, the improvement of methodologies for the study of the interaction between C. neoformans and phagocytes of the mammalian host are essential for the clarification of the mechanisms of the disease. The aim of this work was to construct and characterize C. neoformans reporter strains containing GFP or mCherry fluorescent proteins directed to the cell nucleus or cytoplasm, to better investigate the dynamics of C. neoformans-host cells interaction both in vitro and in vivo. Methods: We used biolistic-mediated transformation to construct C. neoformans (serotype A type strain H99) reporter strains containing GFP (Green Fluorescent Protein) or mCherry (red fluorescent protein) fused to histone H3 genes (HIS3) to target fluorophores to the cell nucleus, or Poly-A Binding Protein (PABP) to direct fluorophores to the cytoplasm. Empty plasmids which carries only GFP or mCherry genes were used as control. We employed flow cytometry and microscopy analysis for evaluation of fungal fluorescence intensity and intracellular distribution, respectively. We also checked fungal phenotypes including growth at osmotic, oxidative and cell wall stress conditions, matting ability as well as expression of C. neoformans virulence factors such as urease and phospholipase activity, capsule formation and melanin production. Strains were tested for virulence in vitro using murine bone marrow derived-macrophages, and in vivo using a Galleria mellonella infection model. Experiments for the evaluation of fungal phagocytosis by fluorescence microscopy and flow cytometry, as well as cell cycle analysis based on His3 fluorescence are underway to date. Results: Using fluorescence microscopy, we were able to confirm the expected pattern of intracellular distribution of fluorophores in the engineered strains. Flow cytometry analysis indicated that we achieve transformants with significantly greater fluorescence than parent strain (WT), especially GFP transformants, which showed more than 50 fold-increase. Moreover, C. neoformans transformants exhibited similar expression of phenotypes and virulence factors compared to WT strain. Using the G. mellonella infection model, we observed that HIS3-GFP and PABP-mCherry-infected larvae presented a slightly higher survival rate in comparison to WT-infected animals. However, there was no difference in fungal survival among all tested strains in macrophage infection, a more established and suitable model system for evaluation of C. neoformans virulence. Conclusion: For the first time in literature to date, C. neoformans was engineered to express fluorophores-labeled HIS3 and PABP proteins, allowing the targeting of fluorophores to the cell nucleus or cytoplasm, respectively. Furthermore, our results indicates a promising use of engineered C. neoformans HIS3 and PABP fluorescent reporter strains for investigation of pathogen-host interplay. Castro RJA and Aidar MT equally contributed to this work. Financial support: UnB, CNPq, FAPDF and CAPES.

P394 Series of Sporotrichosis Cases in the Northeast Region of Rio Grande do Sul, Brazil ´ S.S. Francisco, T.V. Paim B.C.A. Zoppas, L.W.Y. YUM, J. Dedea, Universidade de Caxias do Sul, CAXIAS DO SUL, Brazil Objective: Sporotrichosis is a subacute or chronic infection characterized by polymorphic lesions of the skin and subcutaneous tissue, which is initiated by inoculation by microscopic trauma of the skin of conidia of Sporothrix spp. The agent has a global distribution with greater prevalence in Latin America and Africa, being the subcutaneous mycosis with greater incidence in the state of Rio Grande do Sul. The objective of this study is to present 32 cases of sporotrichosis, diagnosed in Caxias do Sul, showing epidemiological aspects of mycosis in this region, contributing to a better understanding of the interfaces of this pathology. Methods: A total of 32 patients with Sporotrichosis were studied in two laboratories in the city of Caxias do Sul: Bio-Hematec Clinical Analysis Laboratory and Mycology Laboratory of the University of Caxias do Sul, RS, between 1978 and 2014. Data are presented referring to the genus, age, occupation, location of the lesion, diagnosis and treatment. Statistical analysis was performed R 22.0 software. using IBM SPSS Results: Among the patients diagnosed with Sporotrichosis, males were predominant n = 27 (84.4%); the age ranged from 16 to 70 years, with a mean of 40.8 years (± 12.85); presenting a higher incidence in the fourth decade of life (40-49 years) n = 14 (43.6%); For the diagnosis, direct mycological examination (SMD) and mycological cultural examination (CME) were used. The treatment used varied according to the number and location of the lesions in each patient. The lesions were predominantly located in the upper limbs n = 29 (82.8%), with predominance in the arms n = 15 (42.8%) and in the hands n = 14 (40.0%); ulcers were the most prevalent lesions n = 18 (51.4%); the predominant profession was farmer n = 14 (43.6%). Conclusion: Sporotrichosis is an endemic disease in Rio Grande do Sul. The importance of the present study, despite the low occurrence in Caxias do Sul and region, is due to the high degree of ruralization in the Northeast of Rio Grande do Sul, culminating in a greater possibility occurrence of mycosis. The similarity of lesions with other pathologies may lead to equivocal diagnosis and treatment, and the correct identification of the etiology is extremely important for early and adequate therapy.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

P396 Comparison of the effectiveness of a daily dose of cotrimoxazole, administered once or twice, in the treatment of murine Paracoccidioidomycosis ˜ 2 , SS Batah2 , AT Fabro2 , RP Mendes1 RS Cavalcante1 , L Maza1 , PS Leao 1 ˜ Paulo State University, BOTUCATU, Brazil Botucatu Medical School - Sao ˜ PRETO, Brazil ˜ Preto Medical School - University of Sao ˜ Paulo, RIBEIRAO Ribeirao

2

Objective: Paracoccidioidomycosis (PCM) is systemic mycosis caused by thermodymorphic fungi of the genus Paracoccidioides. Trimethoprim-sulfamethoxazole, also called cotrimoxazole (CMX), is one of the main therapeutic options. In the current treatment of PCM, CMX is used in the dose of 2,400 mg of sulfamethoxazole, which corresponds to six tablets divided into two daily doses, a fact that has led to the patient’s lower adherence to antifungal therapy. Experimental studies have observed that the single daily dose may be sufficient to treat PCM. This study aimed to evaluate the efficacy of murine PCM treatment with CMX administered in one and two daily doses. Methods: One hundred male, isogenic mice of the Balb / c line were randomly assigned to 4 groups: healthy control (G1), infected control (G2) and infected groups receiving CMX once (G3) and twice daily (G4). After 28 days of infection, treatment was started, with evaluation of lung and spleen fungal recovery, histopathological examination of the lungs and serum analysis of specific antibodies anti-P. brasiliensis by double agar gel immunodiffusion (DID) at weeks 8, 12, 16 and 20 after infection. The same animals were evaluated for cumulative survival at 140 days. The Kruskal-Wallis and Mann-Whitney tests were used for comparison of medians, linear regression to analyze the parameters in the successive moments of sacrifice and Kaplan-Meier for the evaluation of survival. P values “”less than 0.05 were considered significant. Results: The two groups treated with CMX (G3 and G4) showed improvement in the appearance and behavior of the animal, a decrease in serum antibody levels by DID (G3: P = 0.005, G4: P = 0.01), reduction of lung fungal load by histopathological examination in the 16th and 20th weeks (P < 0.01) and a lower percentage of collagen fibers per bronichiolar area at the 20th week (P < 0.05). There was no difference in fungal recovery in lung and spleen, fungal load counted by histopathological examination of lung and percentage of collagen fiber per bronchiolar area between G3 and G4 at weeks 8, 12, 16 and 20. However, DID levels tended to be lower in G4 than in G3 at week 8 of treatment (1:4 vs. 1:16, P = 0.08). G4 presented lower fungal recovery of the lungs at the 8th and 12th weeks and in the spleen at weeks 16 and 20 when compared to the infected control. There was no difference in cumulative mortality between G3 and G4 (0.0% vs 4.0%). Conclusion: These findings demonstrate efficacy of the two murine PCM treatment regimens with CMX. Although there were no direct differences between the two CMX treatment regimens, the group receiving two doses per day presented a higher response when compared to the infected control, a fact that did not occur with the single daily dose group. This suggests that differences may exist between the two schemes and that future studies are needed to better understand the efficacy of these therapeutic regimens.

P397 Differential modulation of S-nitrosoproteome of Paracoccidioides brasiliensis by Nitric Oxide: change in S-nitrosylation levels and fungal redox status. ˜ 1 , L.K. Iwai2 , B. Furue1 , I. Casula1 , M. V. Navarro1 , D.G. Castilho1 , A.F.A. Chaves1 , J.C.P. Calado1 , P.M. Conceic¸ao W.L. Batista1 1 ˜ ˜ Paulo, SAO PAULO, Brazil Federal University of Sao 2 ˜ PAULO, Brazil Butantan Institute, SAO Objective: Paracoccidioides brasiliensis and P. lutzii are the causative agents of paracoccidioidomycosis (PCM), a systemic mycosis endemic in Latin America. These fungi are considered facultative intracellular pathogens, able to survive and replicate inside macrophages. After infection, the survival depends on its adaptability to host conditions, such as nitrosative stress caused by nitric oxide (NO) produced by the immune cells. Currently, NO is viewed as a remarkably important signaling molecule, involved in regulating stress responses. Protein S-nitrosylation, characterized by covalent attachment of nitroso group to cysteine thiol, has emerged as a central mechanism of NO-dependent cellular regulation. We have previously reported that low NO concentrations leads to Ras S-nitrosylation and induces cell proliferation in P. brasiliensis. However, others targets of NO in this fungus are unknown. In present study, using a combination of the biotin switch assay and label-free LC-MS/MS analysis, we revealed the S-nitroso-proteome profile of P. brasiliensis isolate 18 (Pb18) under different NO concentration. Methods: Immunobloting and enzymatic assays were performed to assess protein S-nitrosylated profiles and redox profile respectively. In order to determine S-nitrosylated proteins, first it was performed biotinylation assay followed by protein reduction, alkylation, digestion and peptide desalting. Next, samples were injected in Orbitrap Velos mass spectrometry connected to an Easy-nLCII. The MS raw files were processed and searched using MaxQuant software. All validated proteins were submitted to Blast2GO algorithm. Results: Immunoblotting results showed distinct band patterns among samples treated with different NO concentrations were observed. S-nytrosilation levels increased when cells were treated with 0.25 μM NO, suggesting the participation of this post-translational modifications in the fungus growth induced by low concentrations of RNS. Changes in the fungus redox state according with NO concentrations were also observed by enzymatic assays and evaluation of the GSH (reduced glutathione) and GSSG (oxidized glutathione) levels. Using a mass spectrometry-based approach, we mapped 335 S-nitrosylated proteins, where 48 and 6 were exclusively found on the groups treated with 0.25 and 10 μM of NO2 respectively. With this approach, we observed that proteins treated with NO low concentrations presented a proliferative response pattern, with several proteins involved with cellular cycle regulation and growth and would represent, as last analysis, molecules with an important role to fungi virulence. On the other hand, proteins stimulated with NO high concentrations exhibited a survival response pattern. Conclusion: It has been demonstrated that the distinct redox-dependent events (cell proliferation or survival) were promoted by different NO concentrations, which may help us understand RNS antifungal properties and identify potential molecular targets to future development of new drugs.

ABSTRACT

P398 Scedosporium spp Infection in Elderly Patients with Neoplasia - Case Report ´ B. C.A. Zoppas, L.M.R.N. Vieira, A. Schiavenin, J. Dedea Universidade de Caxias do Sul, CAXIAS DO SUL, Brazil Objective: To present the case of an elderly patient with intestinal neoplasia, in whom the disease can cause an opportunistic infection by the fungus Scedosporium spp. Methods: The information contained in this study was obtained by reviewing the medical records and reviewing the literature. Results: A female patient, 88 years old, diagnosed with hypertension and diabetes hospitalized at the Intensive Care Unit for preoperative laparotomy for intestinal subclusion due to neoplasia. Comes in an anesthetic coma and in use of ciprofloxacin and metronidazole. The patient was recently admitted to a small hospital for 8 days. At the beginning of hospitalization, he had clean lungs, more lung re-expansion, absence of pulmonary secretion, and no respiratory effort. On the 11th day of hospitalization, there was worsening in the clinical ward due to a new septic condition and impaired spontaneous ventilation. The hemogram shows leukocytosis and the replacement of the antibiotic with meropenem is performed. There is abdominal distension, worsening of pain and presence of massive bilateral pleural effusion, atelectasis and consolidation foci. On the 12th day of admission, cultural examination of the tracheal aspirate with negative results for bacteria and the scarce growth of filamentous fungi suggestive of Scedosporium spp. This day includes the use of mechanical ventilation, a small amount of mucopurulent secretion, and an ineffective ventilatory pattern. On day 14, the patient started using voriconazole EV 12/12 hours, for 7 days. On the twentieth day of hospitalization, there is a tracheostomy plan, and the patient is still under mechanical ventilation, evolving to a severe condition, indecisive coma and on the 33rd day of hospitalization, progressive worsening of the condition, culminating in the death of the patient. Conclusion: The reported case and the publications raised to light on the discussion of the filamentous fungus Scedosporium spp are an opportunistic fungus and widely found in nature. It can cause asymptomatic colonization, localized or disseminated infection in human organism, both in immunocompetent patients and in immunocompromised patients. It is often isolated in immunocompetent patients after trauma, surgeries and severe infections.

P399 The putative flippase Apt1 is required for intracellular membrane architecture and biosynthesis of polysaccharide and lipids in Cryptococcus neoformans J. Rizzo1 , A.C. Colombo2 , D. Zamith-Miranda3 , V.K.A Silva4 , J.C. Allegood5 , A. Casadevall6 , M. Del Poeta2 , J.D. Nosanchuk3 , J.W. Kronstad7 , M.L Rodrigues4 1 Universidade Federal do Rio de Janeiro, RIO DE JANEIRO, Brazil 2 Stony Brook University, NEW YORK, USA 3 Albert Einstein College of Medicine, NEW YORK, USA 4 ˜ Oswaldo Cruz, RIO DE JANEIRO, Brazil Fundac¸ao 5 Virginia Commonwealth University School of Medicine, RICHMOND, USA 6 Johns Hopkins Bloomberg School of Public Health, BALTIMORE, USA 7 Faculty of Land and Food Systems, The University of British Columbia, VANCOUVER, Canada Objective: Flippases are responsible for the asymmetric distribution of phospholipids in biological membranes. Since this asymmetry is fundamental for both intracellular and plasma membrane architecture, flippases directly impact endocytic and secretory pathways. In the encapsulated fungal pathogen Cryptococcus neoformans, the putative flippase Apt1 is an important regulator of polysaccharide secretion and pathogenesis in mice by unknown mechanisms. In this study, we analyzed the role of C. neoformans Apt1 in intracellular membrane architecture and synthesis of lipids and the major capsular polysaccharide, glucuronoxylomannan (GXM). Methods: The ultrastructural properties of wild type (WT), apt1 (mutant) and apt1::APT1 (complemented) strains after 48 and 72 h of growth were assessed by transmission electron microscopy. The intracellular levels of polysaccharide were analyzed by quantitative immunogold labeling with a monoclonal antibody raised to GXM (mAb18b7). Mass spectrometry analysis was performed to evaluate the levels of phospholipids, glycosphingolipids and sterylglucoside in cellular lipid extracts of WT, apt1 and apt1::APT1. Results: The deletion of APT1 resulted in the formation of irregular compartments, including aberrant vacuoles, which presented distorted membrane and oversized MVB-like structures. The classification of these vacuoles into different morphological groups, according to organelle morphology and electron density, showed that the WT strain had ordinary vacuoles predominated after both 48 and 72 h of growth (80 and 74%, respectively). Aberrant vacuoles (50%) predominated in the apt1 after 48 h of growth and ordinary vacuoles were observed in higher frequency (60%) after 72 h. Marked changes were observed in the frequency of detection of aberrant and oversized, MVB-like vacuoles in apt1 cells after 72 h of cultivation. A 3.8-fold decrease in the frequency of detection was observed in aberrant vacuoles, while detection of the oversized compartments was increased 5-fold. Vacuole quantification in the complemented strain was more heterogeneous, but the morphological profile was similar to that observed in WT cells. Disorganization of vacuolar membranes in apt1 cells was accompanied by a significant increase in the amounts of intra-vacuolar and pigment-containing vesicles in both cultivation times. The immunogold labeling of C. neoformans cells suggested impaired GXM synthesis in apt1 compared to WT cells after 48 h of growth. Similar levels of gold particles were observed in both strains after 72 h of growth. The lipid analysis revealed a general trend of decreased detection of phosphatidylserine and phosphatidylethanolamine in apt1, independently on the time of growth. Among sixty molecular species analyzed, apt1 cells showed reduced detection of phytosphingosine, ceramides, inositolphosphoryl ceramides (IPCs) and glucosylceramide (GlcCer) after 48 h and increased detection of sterylglucoside and C9-unmethylated, C8 saturated GlcCer after 48 and 72 h of cultivation. Conclusion: Our current study suggests that Apt1 is involved in intracellular membrane organization, distribution of pathogenesis-related lipids and GXM synthesis, which apparently impact secretory mechanisms and virulence. These results reveal novel functions of Apt1 and are in agreement with the notion that this putative flippase plays an important role in the physiology of C. neoformans.

P400 Ras-MAPK pathway participates of the nitrosative stress response in pathogenic fungus Paracoccidioides brasiliensis ˜ A.F.A. Chaves, D.G. Castilho, J.C.P. Calado, P. Xander, W.L. Batista M.V. Navarro, P.M. Conceic¸ao, ˜ PAULO, Brazil ˜ Paulo, SAO Federal University of Sao Objective: Paracoccidioides brasiliensis is a temperature-dependent dimorphic fungus that cause paracoccidioidomycosis (PCM). The capacity to evade the innate immune response of the host is due to its ability to respond and to survive the nitrosative stress caused by cells of the immune system. However, the regulation of signal transduction pathways associated to nitrosative stress response are poorly understood. Ras GTPases (Ras1 and Ras2) are well known to regulate antagonistically or cooperatively various cellular events in many fungi. Ras, in its activated form (Ras-GTP), interacts with effector proteins and can initiate a kinase cascade. In lower eukaryotes, Byr2 kinase represents a Ras target. In present study, we investigated the role of Ras GTPase in P. brasiliensis after in vitro stimulus with nitric oxide (NO). Methods: We constructed an expression plasmid containing the Byr2 Ras-binding domain (RBD) fused with GST (RBD-GST probe, which detects the Ras active form). Immunobloting assays were performed to detect the Ras and Hog-1 activation. Ras and Hog-1 interaction were performed by immunoprecipitation assays. Results: We observed that low concentrations of NO induce cell proliferation in P. brasiliensis, while high concentrations promoted decrease in fungal viability. Additionally, we observe that both events (cell proliferation and death) are reversed in the presence of a Nitric Oxide scavenger (carboxy-PTIO). We reported by immunobloting that after stimulation with NO, the Ras active form was observed in fungal extracts. High NO concentrations induces the S-nitrosylation of Ras in P. brasiliensis and, in this conditions, Ras modulates the expression of antioxidant genes in response to nitrosative stress. We also investigated whether Hog-1 would be activated in response to nitrosative stress. Under these conditions we observed that Hog-1 is phosphorylated after NO treatment. In addition, when we used the RBD-GST probe and blotted with anti-Hog-1 antibody we observed that Ras-GTP can interact with MAPK Hog-1 after stimulation with high concentrations of NO. Conclusion: Finally, our data indicate that Ras GTPase and Hog-1 pathways may cross-talk in response to nitrosative stress in P. brasiliensis. S-nitrosylation of Ras probably activates this GTPase, which initiates a signaling cascade involving Ras-Byr2-By1Hog. These responses could help the fungus to survive after their initial contacts with the host immune system, which is crucial for disease establishment.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

S141

P401 Cell surface enolase of Candida species is involved in the interactions with human host and the formation of polymicrobial biofilms M. Rapala-Kozik, J. Karkowska-Kuleta, D. Satala, M. Gogol, D. Bartnicka, M. Zawrotniak, A. Kozik Faculty of Biochemistry, Biophysics and Biotechnology, Jagiellonian University, KRAKOW, Poland Objective: Enolase, a well known cytoplasmic enzyme involved in the glycolytic pathway is also an important and abundant moonlighting protein found at the cell surface of different types of prokaryotic and eukaryotic cells. This protein plays and important role in fungal infections caused by Candida yeasts, which are the part of physiological microflora of more than half of individuals in the human population. However, in immunocompromised individuals as well as numerous patients with implanted medical devices, Candida yeast can cause life-threatening systemic infections. Biofilms, formed on implanted medical devices are resistant to host immune defense or conventional antifungal treatment, making the biofilm-based infections a significant clinical challenge. In the search for new therapeutic targets, a growing interest is aroused by candidal enolases which, via a yet unrecognized mechanism, can be relocated to the cell surface, where they acquire completely new functions, often becoming receptors for a number of important host ligands. Methods: The identification of the cell surface-exposed enolase from different Candida species, grown under conditions, that differed in the source of carbon, amino acids and availability of oxygen, was carried out using the “cell surface shaving” with trypsin and “shotgun” proteomic approach. Similarly, the formation of mixed biofilm between Candida species and aerobic and anaerobic bacteria was analyzed. The interactions between fungal enolases and bacterial cell surfaces were analyzed microscopically. Additionally, the direct interactions with host representative proteins—fibrinogen and plasminogen—were studied using the surface plasmon resonance measurements and microscale thermophoresis. Results: The exposition of enolase on the cell surface of selected Candida species was confirmed under various growth conditions, that mimicked cellular stress, nutrient starvation or invasion of the host at various sites of infection. A significant enrichment with fungal enolase was also detected on the surface of mixed biofilms formed with bacteria at different oxygen access. The growth of Candida species in the presence of human proteins including fibrinogen or plasminogen also correlated with the increased presence of enolase on the surface of fungal cells. Studies on the interaction between plasminogen and the purified native Candida enolase revealed the dissociation constants (KD) for complexes of human plasminogen with fungal enolases in a 10−7 M range that corresponds to the strength of plasminogen binding by human enolase, which shares a high sequence similarity to microbial enolases. However, the enolase from Saccharomyces cerevisiae did not bind plasminogen, pointing to important differences between this protein derived from pathogenic or non-pathogenic yeasts. An attempt was made to identify fragments of candidal enolase molecule, responsible for this interaction. It was found that C-terminal lysine residues might be partly involved in plasminogen binding. The fungal enolase fragments involved in the biofilm formation was also determined. Conclusion: Enolase produced by Candida species during mono- or poly-microbial host infections could serve as a bridging molecule that facilitate the host colonization and the regulation of host response. This work was supported by the National Science Centre of Poland (grant no. 2015/17/B/NZ6/02078) and the Leading National Research Center supported by the Ministry of Science and Higher Education (grant no. 035p/12/2016/9200014).

P402 Regulation of DNA repair machinery in Paracoccidioides brasiliensis during stress induction ˜ BEATRIZ F Castro, A. F.A. Chaves, MARINA V. Navarro, DANIELE G Castilho, JULIANA C Calado, PALLOMA M Conceic¸ao, WAGNER L Batista ˜ Paulo, DIADEMA, Brazil Federal University of Sao Objective: Paracoccidioides brasiliensis is an important systemic mycosis causer in Latin America, especially at the rural environments. This fungus performs the pathogenic switch from mycelium to yeast at 37◦ C what involves a series of transcriptional changes that affect oxidative stress responsive genes. ROS are well known threats to DNA integrity and the capacity of the fungus to cope with the oxidative stress imposed by the immune cells from the host is essential to the disease progression. Homologous recombination (HR) and non-homologous end joining (NHEJ) are the major players in the DNA repair processes. Present communication aims to assess the regulation of the DNA repair machinery from P. brasiliensis under different stress conditions. Methods: We performed quantitative PCR from the P. brasiliensis genes related to HR (RAD51 and RAD52) and NHEJ (PbKU70) pathways under different H2 O2 concentration (0, 0.1, 1 or 10 mM), heat shock (42◦ C for 30 min or 60 min), and osmotic stress (150 mM NaCl). Additionally, we used a NHEJ inhibitor (SCR7 pyrazine) to treat the P. brasiliensis yeast cells. The cells were submitted to microdilution assay with the inhibitor to determine the non-cytotoxic drug concentration and then we performed the inhibition assay under the oxidative and nitrosative stresses. Results: Paracoccidioides brasiliensis fungus is able to cope with the oxidative stress as reported elsewhere. Here we report that this fungus has DNA repair machinery responsive to diverse types of stress. When NHEJ inhibitor was added to the medium and cultures treated with increasing H2 O2 or NO2 concentrations, the fungus shown an unexpected response. After NHEJ inhibition the fungus was able to survive despite the 10 mM H2 O2 or 200 μM NO2 concentration. This effect may guard some relation with the activation of HR-related genes to repair the fungus DNA, while NHEJ would be a secondary player at this event. When the fungus was treated with increasing H2 O2 concentrations we observed a dose dependent up-regulation of the HR and NHEJ related genes. PbKU70 (NHEJ-related gene) increased more than 1,000-fold its expression when 10 mM H2 O2 was added to cultures. At the same condition, RAD51 and RAD52 (HR-related genes) increased 5 and near to 30-fold, respectively. When yeast cells were exposed to 42◦ C during 60 min, we observed a more modest 2-fold increase in PbKU70 expression, suggesting that the DNA repair genes are less sensitive to this type of stress. No differences were observed regarding the cell morphology (mycelium or yeast). Finally, PbKU70 is up-regulated under osmotic stress (150 mM NaCl) what led us to conjecture a role to this NHEJ-related gene in the Hog1 pathway. This relation is currently being object of investigation in our laboratory. Conclusion: Paracoccidioides brasiliensis is a highly complex fungus with an intricate repertoire of responses to the stress imposed by immune cells from the host. It repertoire includes, but is not limited to, a sophisticated DNA repair machinery able to cope with the oxidative stress. PbKU70, RAD51, and RAD52 genes are up-regulated by the oxidative and nitrosative stresses, suggesting that DNA is actually under threatening at these conditions.

P403 Establishment of an invitro 3D respiratory model to study fungal infections PARUL Chandorkar Medical University of Innsbruck, INNSBRUCK, Austria Objective: Pneumonia caused by Aspergillus (A.) fumigatus is the most frequent and life-threatening fungal pulmonary infection in patients with hematological malignancies, solid organ transplant recipients and others. Current studies to better understand the fungal invasion process are primarily performed in animal models and cell lines, both afflicted with drawback. Hence there is need for a ‘true-to-life’ human respiratory model system. Methods: We set up a perfused 3-dimensional in vitro cell culture model with primary, differentiated normal human bronchial epithelial cells (NHBE) or small airway epithelial cells (SAE) and immune cells, i.e. alveolar macrophages or dendritic cells (DCs), important to sense fungal pathogens. The development, differentiation and interactions with A. fumigatus of epithelial - immune cell co-cultures under static or perfused conditions were compared using confocal, scanning electron and live cell microscopy. Cytokine analyses from Aspergillus-exposed tissues and TEER measurements were also performed additionally. Results: Our highly sophisticated cell culture model is suited to study fungal-epithelial-immune interactions at the entry sites of the pathogen. Analysis over time by confocal and live cell microscopy showed that the process of differentiation of the respiratory cells and thereby the process of ciliogenesis was significantly accelerated under perfused compared to static conditions. Upon fungal infection, A.fumigatus conidia were trapped in the muco-ciliary layer up to 3 h before internalization by epithelial cells. In epithelialimmune cell co-cultures, basolaterally added DCs and apically added macrophages were fully functional and able to sense the fungal condia and hyphae in our 3D respiratory model. Conclusion: Our model will provide novel immunologic and mechanistic insights into Aspergillus-infection processes within 3D space. Furthermore, this model provides a vast array of applications with respect to respiratory challenges and diseases and can be exploited in terms of translational goals. Additionally, animal experimentation can be significantly reduced by use of this highly developed human system, thereby contributing to ethical considerations and higher biological relevance in terms of avoiding interspecies differences.

S142

Medical Mycology, 2018, Vol. 56, No. S2

P404 First Draft Genome of Two Candida haemulonii Strains from Pediatric Patients with Candidemia in Brazil

P407 Investigating the impact of attenutation on differential expression of coccidioides posadasii

L. S Rodrigues1 , R.K Gazara2 , H. Passarelli2 , R.F. DE Souza3 , T.M. Venancio2 , L.M. Dalla Costa1 1 Faculdades Pequeno Pr´ıncipe/Instituto de Pesquisa Pele´ Pequeno Pr´ıncipe, CURITIBA - PR, Brazil 2 ˜ de Prote´ınas e Pept´ıdeos (CBB/UENF), CAMPOS DOS GOYTACAZES-RJ, Brazil Lab. de Qu´ımica e Func¸ao 3 ˜ PAULO-SP, Brazil ´ ˜ de Prote´ınas (LEEP) ICB/USP, SAO Laboratorio de Estrutura e Evoluc¸ao

Heather L Mead Northern Arizona University, FLAGSTAFF, USA

Objective: Members of the Candida haemulonii species complex (C. haemulonii, C. duobushaemulonii sp. and C. haemulonii var. vulnera) are emerging yeasts associated to bloodstream and other invasive infections. Regarded as opportunistic pathogens they are phylogenetically related to C. auris, which shares a propensity for multidrug resistance. However, genomic information of C. haemulonii remains scarse. We describe the draft genome sequencing of two C. haemulonii strains isolated from pediatric patients with candidemia at a tertiary pediatric hospital of south of Brazil. R Genomic DNA Purification Kit (Promega) and Nextera XT DNA Methods: Genomic DNAs were extracted using Wizard (Illumina, Inc., San Diego, CA, USA) was used to generate sequencing-ready libraries, which were sequenced using an Illumina MiSeq instrument (paired-end mode, 250 × 2). Trimmomatic (v. 0.32) was used to remove adapters, trim and discard the reads shorter than 50 bp. Draft genomes were assembled de novo using SPAdes (v. 3.5.0) and BUSCO (v. 3.0) was used to evaluate assembly completeness. Repetitive sequences were masked using RepeatMasker (v. 4.0.7) and protein-coding genes were predicted using AUGUSTUS and GeneMark-ES 2.0. Proteins were annotated using BLASTp against reference databases (minimal query coverage and maximum e-value of 40% and 1e-5, respectively). rRNAs and tRNAs were predited with RNAmmer 1.2.1 and ARAGORN, respectively. Results: The draft genomes comprised 352 and 388 scaffolds, with a N50 of 78,004 bp and 75,117 bp, and largest scaffolds with 393,866 bp and 251,044 bp. Total genome sizes were 13,21 Mb and 13,26 Mb, with an average G+C content of 44%. BUSCO analysis (Saccharomycetales dataset as reference, 1,771 genes) indicated that the assemblies are 94.6% and 94.5% complete. The complete genomes of C. haemulonii contain genes for 6 rRNAs, 175 and 173 tRNAs. Local BLASTp resulted in 4,713 and 4,709 proteins that will be use to further genomic studies on the biology and virulence of the strains. Conclusion: This is the first report of C. haemulonii whole genome sequences. The data provided here will constitute a powerful tool not only for fungal pathogenesis studies, but also to better understand of the phylogenetic relationships to other Candida species, such as the emerging pathogen C. auris.

P405 Sporothrix brasiliensis and interaction Acanthamoeba castellanii P.L. Tavares, D. Heidrich, A.C. Ribeiro, M.B. Rott, M.L. Scroferneker Universidade Federal do Rio Grande do Sul, PORTO ALEGRE, Brazil Objective: to analyze the interaction of Sporothrix brasiliensis in the process of encystment of Acanthamoeba castellani. Methods: the trophozoites (105 cells mL-1) were seeded onto the culture plates using Tris buffer as a encystment inducer. After 30 minutes of acclimatization, the amoebas were incubated with conidia of S. brasiliensis in a ratio of 1: 1 at 30◦ C for 96 h. The control was isolated amoebae in the medium of encystment. At the end of the incubation time, the number of trophozoites and cysts were determined in the Fuchs-Rosenthal counting chamber. The experiment was performed in triplicate and repeated once. The data will be expressed as percentage of encystment (number of cysts by total number of amoebas). Results: after the amoeba contact with the conidia of S. brasiliensis cysts were formed in 74.5% and remained as trophozoites 25.5%. The control sample showed 54% of A. castellanii cysts and 46% of trophozoites. Demonstrating a 20.5% increase in cysts formation between the samples with the presence of the fungus compared to amoeba without the fungus in the solution of encystment. Conclusion: the interaction between the fungus and the amoeba resulted in an increase in the population of cysts and in the decrease of the trophozoite form.

P406 C. neoformans Chitin Synthase 3 (Chs3) Plays a Critical Role in Dampening Chitin Induced Host Inflammatory Response C. R. Hole, W.C. Lam, R. Upadhya, J.K Lodge Washington University School of Medicine, ST. LOUIS, USA Objective: Cryptococcus neoformans infections are a significant cause of morbidity and mortality among AIDS patients and the third most common invasive fungal infection in organ transplant recipients. There are an estimated quarter million cases of cryptococcal meningitis each year resulting in ∼200,000 deaths. The cell wall in Cryptococcus is unique in that the chitin is predominantly deacetylated to chitosan. We have previously shown that C. neoformans chitin synthase 3 (Chs3) and chitin synthase regulator (Csr2) are essential for chitin deacetylase mediated formation of chitosan. Chitosan deficient strains of C. neoformans were found to be avirulent and were rapidly cleared from the murine lung. Moreover, infection with a chitosan deficient C. neoformans lacking three chitin deacetylases (cda123) was found to confer protective immunity to a subsequent challenge with a virulent wild type counterpart. Therefore, we wanted to determine the nature of host immune response to an infection with a chitosan deficient caused by the deletion of C. neoformans CHS3 gene. Methods: Mice were given 1 × 107 live or heat-killed chs3, a dose we have previously shown to induce protection with a cda123, and monitored for survival. Results: Mice inoculated with 1 × 107 live or heat-killed chs3 die within 24 hours after installation of the fungal organism. Death is dose dependent as mice given 1 × 106 do not succumb. The rapid on set of morbidity is likely due to an aberrant immune response. However, it is independent of the adapter protein Myeloid differentiation primary response 88 (MyD88) as there was no difference in survival with MyD88 Knockout mice. Conclusion: Chitosan plays a major role in the immune response to C. neoformans. In addition, the response to chitosan deficient C. neoformans seems to depend on the type of genes deleted, as not all chitosan deficient strains induce the same immune response.

Objective: Coccidioides immitis and C. posadasii are soil dwelling fungi found in regions with semi-arid alkaline soil in both North and South America. In a susceptible host, inhalation of aerosolized asexual spores can result in asymptomatic, acute or chronic respiratory infection. The Coccidioides genus possesses the ability to exist as a dimorph having a distinct environmental and parasitic lifecycle. Chitin is a major component of the cell wall in both the saprobic and parasitic lifecycle. The Coccidioides genomes contain genes from each class (I-VII) of chitin synthase with differing expression during each lifecycle. Deletion of two chitinase genes and an acireductone dioxygenase from C. posadasii C735 resulted in a mutant (cts2/ard1/cts3) that does not complete the parasitic lifecycle. This study compared existing transcriptional data from the pathogenic parent strain C. posadasii strain C735 and mutant strain cts2/ard1/cts3 to characterize potential chitin dependent pathways. Methods: Spherule cultures from strain cts2/ard1/ct3 were grown in the same conditions as the previously characterized for the parental strain. Total RNA was extracted using Trisure and mRNA was isolated using NEBNext beads. Paired-end RNA sequencing of the wild type and attenuated strains as well as whole genome sequencing was performed on an Illumina MiSeq platform. Genomic reads were de novo assembled and mRNA reads from both the wild type and the attenuated strain were aligned to the assembled reference genome using TOPHAT2. Additionally, newly generated reads from cts2/ard1/ct3 were randomly fragmented to 33 bp read length to match published experimental data and aligned to the reference genome. Differential expression results for both alignments were compared. Genes related to chitin synthesis were compared for presence or absence between the two strains. Differentially expressed genes of interest will be validated by real-time RT-PCR. Results: The transcriptional landscape of both strains had 98.8% similarity. A scatter plot comparing the genes expressed during the parasitic lifecycle of both strains suggest a high degree of resemblance between expression profiles (Figure 1). C. posadasii wildtype strain C735 matches previously reported results. Chitin related genes, endochitinase 2, chitinase 7, chitinase 5, chitin synthase activator, have increased expression during the parasitic lifecycle. In contrast, endochitnase 1, chitinase 4, and chitinase 3 have increased expression in the saprobic lifecycle. The attenuated cts2/ard1/cts3 shows increased expression endochitinase 2, chitinase 7, and a complement fixation chitnase in the parasitic lifecycle. The saprobic lifecycle had increased expression of chitin synthase 4, chitin synthase D and chitin synthase class V. Future work includes validation of transcript levels with real time RT-PCR and differential expression analysis. Conclusion: The morphological switch to spherule growth, which initiates host infection, is an important part of the infection dynamic for both species of Coccidioides. The comparison of the wild type and attenuated transcription profiles will begin to elucidate pathways crucial to pathogenesis, establishment of infection, and maintenance of the parasitic life-cycle of this important human pathogen Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 422682 d7f78458-9d04-4b2e-b60847bfb9c79864.png Caption 1: FPKM scatter plot comparing spherules of wild type and mutant strain

P408 Biofilm controlling effect of artificial saliva M. B. Petrovic1 , D.P. Srebro1 , S.A. Otasevic2 , V.S. Arsic Arsenijevic1 1 Faculty of Medicine, University of Belgrade, BELGRADE, Serbia 2 ˇ Serbia ˇ NIS, Faculty of Medicine, University of Nis, Objective: Xerostomia, known as dry mouth occurs commonly in elderly patient, including most frequently those with Sjogren ¨ syndrome, diabetes, patients receiving radiation therapy for head and neck cancer, immunosuppressed patients and denture wearers. Xerostomia is associated with reduced salivary flowwhich is often contributing factor for oral candidiasis, especially in denture wearers. Dentures are made of poly methyl methacrylate (PMMA), which are hydrophobic and rough and thus suitable substrate for Candida spp. adhesion and biofilm formation. The most common isolated species on inner denture surface is Candida (C.) albicans, which can easily adhere to the denture surface. The presence of denture reduce salivary flow and interfere with mechanical cleaning contributing biofilm accumulation. Thus, denture act as a reservoir of infection, leading to development of Candidaassociated denture stomatitis, inflammatory reaction of oral mucosa. Therefore, administration of artificial saliva could be choice in suppression of oral candidiasis in denture wearer as well development of Candida associated denture stomatitis. Methods: Samples were made by mixing of commercial acrylic resin Triplex Cold (IvoclarVivadent, Schaan, Liechtenstein) containing powder (polymethylmethacrylate, PMMA) and liquid (methyl methacrylate, MMA), according to the manufacturer’s instructions (in the ratio 13 g PMMA and 10 ml MMA). Samples were made in disc shape in in Teflon molds (Ø 20 mm). Discs were stored in 1 ml of commercial artificial saliva (experimental group) or in the air (control group) for 24 h. After storage, artificial saliva was discarded and discs were left to dry. C. albicans suspensions with density 106 cells/ml was added on the disc surface placed in well plates, incubated for 24 h at 37◦ C. The antifungal efficacy of artificial saliva was assessed with XTT (2.3-bis-(2methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide) reduction assay to study metabolically activeC. albicans cells on the disc surface (biofilm) and in medium above the discs (planktonic cells). Results: The relative percentage ofmetabolically active C. albicans cells in biofilm formed on the surface of the discs stored in artificial saliva and in planktonic cells incubated with the same discs was 1.32% and 16.95%, respectively. Conclusion: Results showedstrong antifungal activity of artificial saliva, which may be an important strategy for prevention of oral candidiasis as well asC. albicans biofilm formation on denture and development of Candida associated denture stomatitis.

P409 Molecular tools for gene deletion in Fonsecaea pedrosoi (Poster) C. S. Florencio1 , N.V.G Pimentel1 , M.S.S Felipe2 , A.L Bocca1 , L. Fernandes-Matos1 1 University of Brasilia, UnB - Brazil, BRAS´ILIA, Brazil 2 ´ Universidade Catolica de Bras´ılia-UCB, BRAS´ILIA, Brazil Objective: Fonsecaea pedrosoi is the main etiological agent of chromoblastomycosis (CBM), a disease with a worldwide distribution but prevalent in tropical and subtropical countries. It is a filamentous fungus with hyphae and conidia pigmented due to the production of melanin. The biology, virulence factors and mechanisms of pathogenesis of F. pedrosoi are not explained, and therefore studies involving molecular tools for genetic deletion are essential to improve knowledge about the disease and potentially to develop new antifungal therapies. One of the most used techniques in fungi for genetic transformation in other fungus is biolistics, a technique widely used to deliver genetic material directly to cells and intact tissues by bombarding particles, which requires optimization of physical parameters. In this study the main objective was to use strains of F. pedrosoi (CBS 271.37) to optimize the particle bombardment and the construction of deletion cassettes using Double Joint PCR. Methods: For the construction of the gene deletion cassettes the double joint PCR technique was used and these were genetically transformed by biobalistc into conidia of F. pedrosoi (strain CBS 271.37 - ATCC 18658). To obtain a better result and also standardization of transformation parameters, purified and plated conidia and conidia germinated in 24 hours were used in the transformation. After transformation the plates were incubated for 24 hours and then the cells were plated in medium containing antibiotics. The transformants were selected by hygromycin B, the stability was verified mitotically and the gene deletion was confirmed by PCR and then Southern blot. Results: This work describes the construction and obtaining of an F. pedrosoi mutant by homologous recombination and deletion of genes using Biobalistica and DJ PCR. After transformation the mutants that were able to grow and remain stable were selected for phenotype tests and also for confirmation by PCR and southern blot, as well as functional characterization of the deleted gene is underway. Conclusion: Deletion of genes using biobalistic and PCR double joint is well characterized in other fungi, such as Aspergillus sp. and Cryptococcus sp. The experiments demonstrated that the use of biobalistic for the genetic transformation of F.pedrosoi through conidia is efficient. Mutants are able to grow in media containing antibiotics and maintain mitotic stability. Particle bombardment is a fast and advantageous method and with this study it is possible to study several genes of Fonsecaea to better understand the pathobiology, since the adjustment of protocols and use of molecular tools for genetic deletion is being described for the first time. Some tests are under way to better describe these deletions.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

ABSTRACT

P410 Post-flood patterns of indoor samples of fumonisin B2 producing black Aspergilli ˇ ˇ Miranda Sertic, ANA Mornar Turk, DOMAGOJ Kifer, BILJANA Nigovic, MAJA Segvic Daniela Jaksic, Klaric University of Zagreb, Faculty of Pharmacy and Biochemistry, ZAGREB, Croatia

S143

P413 Relevance of the protein N-linked glycosylation in the virulence and immune recognition of Sporothrix schenckii N. E. Lozoya1 , H.M. Mora1 Universidadde Guanajuato, GUANAJUATO, Mexico Universidad De Guanajuato, GUANAJUATO, Mexico

1 2

Objective: Black Aspergilli are ubiquitous moulds which contaminate foodstuffs and occur in indoor environments. Recent studies showed that some species from the section produce several fumonisin isomers including FB2 that could contribute to irritant, allergic and toxic effects. Methods: Black Aspergilli were isolated from the airsamples (N = 60) and dust (N = 60) collected during winter and summer of 2016 and 2017 in flood affected area and control area. Identification to the species level was based on the partial calmodulin sequences. FB2 producing abilities were tested by analysing prepared microextracts of an each isolate using LC/MS. Results: In the flood affected area the highest concentration of airborne black Aspergilli was observed in winter period and their concentrations were 50 times higher than in control area (987 ± 1154 CFU/m3). Their concentration in dust was similar in flood affected and control area. 49/85 analysed black Aspergilli was from the samples collected in flood affected area. Conclusion: FB2 was detected in 4 extracted airborne and 11 dustborne black Aspergilli in concentrations 0.617 ± 0.582 μg/ml and 9.237 ± 15.092 μg/ml and thus may contribute to the harmful effects in conditions of increased concentration of black Aspergilli, especially in flood affected area.

Acknowledgements This work has been fully supported by Croatian Science Foundation under the project MycotoxA (IP-09-2014-5982).

P411 Antifungal activity of galectin-3 against black Aspergilli ˇ ˇ Maja Segvic Daniela Jaksic, Klaric, Sanja Dabelic University of Zagreb, Faculty of Pharmacy and Biochemistry, ZAGREB, Croatia Objective: The Aspergillus section Nigri comprises several species widely distributed in the environment. Apart from their use in food production and biotechnology, many species are plant pathogens, mycotoxin (ochratoxin A and fumonisins) producers, and causative agents of respiratory infections in immunocompromised patients as well as otomycosis and keratomycosis in tropical and subtropical regions. Galectin-3 (Gal-3), an animal lectin, is a pleiotropic protein that primarily binds to lactose and it is involved in a variety of cellular processes including interaction with pathogens, immune response and cell death. Several studies indicated the possible antimicrobial action of Gal-3 against bacteria and yeasts but antifungal activity against filamentous fungi such as Aspergilli is not known. The aim of this study was to test antifungal activity of Gal-3 in comparison to amphotericin B (AMB) against A. brasiliensis ATCC 16404 and 5 airborne species of black Aspergilli (A. piperis, A. tubingensis, A. welwitchiae, A. niger, A. luchuensis). Methods: A modified broth dilution method for susceptibility testing against Aspergillus (EUCAST-AST-ASPERGILLUS) was employed in this study. Dilutions of AMB (0.015-16 mg/mL) and Gal-3 (8-520 mg/mL) in RPMI 1640 with 2% glucose inoculated with conidial suspension of black Aspergilli (1-2,5 × 105 CFU/mL) were incubated for 48 h at 35◦ C. Upon incubation, MTS reagent was added and plates were incubated for 3 h at 35◦ C. The absorbance was measured using a microplate reader (Labsystem iEMS, type 1404) at a wavelength of 492 nm. All tests were performed in triplicate and viability of Aspergilli was expressed as a percentage of control (untreated Aspergilli). Results: According to minimum inhibitory concentration (MIC) of AMB, A. brasiliensis ATCC 16404 (1 mg/mL) followed by A. piperis (0.5 mg/mL) were the most resistant black Aspergilli. MIC of AMB for the rest of tested strains was 0.25 mg/mL. Opposite to AMB, Gal-3 was efficient only against A. brasiliensis strain (520 mg/mL). All applied concentrations of Gal-3 decreased the viability of A. piperis by 30%, while other black Aspergilli were resistant to Gal-3. Conclusion: Our preliminary results shows that Gal-3 may have antifungal activity against black Aspergilli that is species related and does not involve binding to ergosterol.

P412 Quantitative analysis of melanin production in Cryptococcus spp clinical isolates from Brazil. ˜ 1 , A.F Silveira1 , H. R Sousa1 , J.L Junior2 , W.F Freitas1 , G Junior1 , C.P Rosa1 , E.M Garcez1 , K.M Gorgonha1 , S.O Frazao L. Trilles3 , M.S.S Felipe4 , M.S Lazera3 , A.F Correia5 , V.L Jr Pinto2 , I Silva-Pereira1 , P. Albuquerque6 , A.M Nicola1 1 UnB, BRASILIA, Brazil 2 Fiocruz-DF, BRASILIA, Brazil 3 Fiocruz-RJ, RIO DE JANEIRO, Brazil 4 UCB, BRASILIA, Brazil 5 Lacen-DF, BRASILIA, Brazil 6 ˆ University of Bras´ılia, Faculty of Ceilandia, BRAS´ILIA, Brazil Objective: Cryptococcosis kills about 180,000 people a year. The therapeutic options for this disease are limited to only three classes of antifungals, so new therapeutic or prophylactic tools are necessary. As virulence factors are frequent antimicrobial targets, our group is systematically measuring multiple virulence factors in a library of Brazilian Cryptococcus spp. clinical isolates in order to better understand the role each one plays in human disease. In this work, our objective is to quantify the rates of melanization for each of these isolates and to correlate them with other measured phenotypes to better understand the role of cell wall melanin in Cryptococcus spp. virulence Methods: Melanization was quantified by measuring multiple images collected from cultures of each isolate in L-DOPA containing medium. Briefly, colonies containing 105 cells for each of sixty Cryptococcus spp. isolates were cultured in minimal medium agar supplemented with 1 mM L- DOPA. The plates were incubated at 37◦ C for 7 days and photographed in equal illumination and exposure conditions every 12 hours. Pixel gray levels were quantified using ImageJ for each colony on each time point, and the resulting data fitted to sigmoidal curves using logistic regression on GraphPad Prism. Results: All strains tested produced melanin, and the melanization curves followed a sigmoidal pattern. The rates of melanization and the final amount of pigment in the colonies varied significantly. The laboratory strains H99 (C. neoformans serotype A) and B3501 (C. neoformans serotype D) melanized faster (steeper Hill Slope) and more intensely (higher value for the sigmoidal curve top) than most clinical isolates. When we correlated the melanization parameters from a subset of isolates with the median survival of Galleria mellonella larvae infected with them, we found a significant correlation as expected for an important virulence factor. We expect that further correlations with other virulence factors our group is measuring and data from the patients from which the isolates were obtained will give us information about Cryptococcus spp. melanin. Conclusion: We have adapted previously described methods to accurately quantify both the kinetics and the total amount of melanin produced by a set of clinical isolates. This method and the information we have gained from it will lead to a better understanding of the pathogenesis of cryptococcal disease. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 422817 0ebea115-11e7-459a-b54a790ce8ae244e.png

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Objective: To Isolate and characterize Sporothrix schenckii OCH1 To silence OCH1 and characterize the phenotype of the transformant cells, with an emphasis in the interaction with human peripheral blood mononuclear cells and the virulence in Galleria mellonella. Methods: We isolated the putative OCH1 encoding region. To determine the function of the gene product, we complemented a Scoch1 null mutant. Strains obtained were used to determine the growth rate, morphology, cell wall phosphomannan content and status of the N-linked mannosylation pathway. We designed and constructed the binary vector for OCH1 silencing, and transformed S. schenckii using Agrobacterium tumefaciens. Real-time PCR was used determine the number of integrative events within the fungal genome. The characterization of the cell wall composition and strength from the selected strains was performed by HPAEC-PAD, alcian blue binding assays, and ability to bind lectins. We also analyzed the virulence of the selected strains using larvae of Galleria mellonella. In addition, the cytokines profiles produced by peripheral mononuclear blood cells and phagocytosis after interaction with the selected strains were determined. Results: The OCH1 gene from S. schenckii was isolated, and the ORF spans 1192 bp and encodes for a membrane protein type II of 398aa, with an estimated molecular weight of 44 kDa. This gene was expressed in a Saccharomyces cerevisiae och1 null mutant. The expression of the heterologous gene restored the cell ability to bind Alcian Blue and the sensistivy to cell wall perturbing agents to wild-type levels, suggesting that this gene could be the functional ortholog of S. cerevisiae OCH1. Next, we obtained 5 S. schenckii transformants: Ssoch1-10, Ssoch1-2.2, Ssoch1-3.4, Ssoch1-3.7 and Ssoch1-3.21, with 86%, 42%, 98.5%, 100% and 100% of OCH1 silencing respectively. The number of copies inserted of the construction was determined: Ssoch1-10 1.94 ± 0.43, Ssoch1-2.2 1.89 ± 0.09, Ssoch1-3.4 2.29 ± 0.04, Ssoch1-3.7 1.97 ± 0.05 and Ssoch1-3.21 1.68 ± 0.44. We observed differences in the amount of rhamnose, glucosamine, and glucose in the cell wall of strains Ssoch1-10, Ssoch1-3.7 and Ssoch1-3.21 when compared to the wild-type (WT) strain. The alcian blue binding assay showed for the WT strain 112.72 ± 4.59 units (μg of dye bound by cells at a DO600nm = 1) and the strains that showed a significant difference were Ssoch1-10 (79.91 ± 5.51 units) and Ssoch1-3.7 (72.94 ± 14.87 units). These results suggest that there is probably a change in the cell wall conformation in these transformants. The silenced strains showed virulence attenuation and a lower ability to stimulate the production of TNFa and IL-6 by human peripheral blood mononuclear cells. The ability to uptake these mutant cells by human macrophages showed to be dependant on the OCH1 expression. Conclusion: The use of molecular and genetic tools, such as genetic transformation systems for silencing and inserting or removing genes, proved to be useful to establish the relevance of OCH1 in the S. schenckii-host interaction. This work was supported by: CONACYT FC-2015-02-834, M´exico, and Universidad de Guanajuato.

P414 Prevalence of Cryptococcus neoformans in avian droppings and tree debris in the North and Northeast, Thailand Khayhan Westerdijk Fungal Biodiversity Institute, UTRECHT, Netherlands Objective: To investigate a prevalence of Cryptococcus neoformans in avian droppings and tree debris in various provinces in the North and Northeast, Thailand during 2014–2016. Methods: The total 149 samples, including 93 samples of avian droppings from pigeon (Columba livia), myna (Acridotheres tristis), red-whiskered bulbul (Pycnonotus jocosus), hill myna (Gracula religiosa), drongo (Dicrurus macrocercus), weaver bird (Ploceus hypoxanthus), parrot (Psittacula eupatria), budgerigar (Melopsittacus undulates) and oriental magpie robin (Copsyhus malabaricus), and 56 samples of tree debris from Eucalyptus tree, golden shower (Cassia fistula), black siris (Albizia odoratissima), cork tree (Millingtonia hortensis), tamarin (Tamarindus indica), cassod tree (Senna siamea Lam), barbados pride (Caesalpinia pulcherrima), sacred tree (Ficus religiosa), frangipani (Plumeria spp.), black wattle (Acacia auriculiformis), khasiya pine (Pinus kesiya), teak (Tectona grandis), sentul (Sandoricum koetjape) and golden fig (Ficus benjamina) from various provinces in the North and Northeast, Thailand were collected to isolate the C. neoformans/C. gattii species complex. Microscopic examination, culture, biochemical tests and singleplex PCR using STR1 primers were used to identify for the C. neoformans/C. gattii species complex. Results: Using culture and biochemical assays, ten isolates (6.71%) of the C. neoformans/C. gattii species complex were recovered from pigeon droppings from Chiang Mai, Thailand. No isolates were found from any samples of tree debris. The STR1 singleplex polymerase chain reaction analysis showed that all ten isolates belonged to C. neoformans. Conclusion: The occurrence of environmental isolates of C. neoformans in the North and Northeast, Thailand is about 6.71%. All isolates were isolated from pigeon droppings, suggesting that pigeon dropping is the common natural habitat of C. neoformans.

P415 Analysis of biomolecular changes in P. insidiosum under exposure to secondary metabolites from P. stutzeri using synchrotron radiation based FTIR K. Wittayapipath1 , C. Prariyachatigul1 , C. Yenjai1 , S. Chio-Srichan2 1 KhonKaen university, KHONKAEN, Thailand 1 KhonKean university, KHONKAEN, Thailand 2 Synchrotron Light Research Institute, NAKHON RATCHASIMA, Thailand Objective: Mechanism of action maybe related with biochemical composition (such as lipid, carbohydrate, protein or nucleic acid) changing in P. insidiosum when this organism exposed to the secondary metabolites from P. stutzeri ST1302 and suspected these biomolecules should play a role in the mechanism of inhibitory activity. Methods: An anti-P. insidiosum substance was extracted from Pseudomonas stutzeri ST1302 by activity guided separation chromatography and confirmed anti-P. insidiosum activity by disc diffusion method. We selected sub-minimal fungicidal concentration (MFC) for testing group, 0.02% (wt/vol) thimerosal as positive control and P. insidiosum mycelia fragments in brain heart infusion broth as negative control. The synchrotron radiation-based fourier transform infrared (FTIR) microspectroscopy was used to investigation the biochemical compositions changing in P. insidiosum for each condition. Results: Crude extract from P. stutzeri ST1302 was separated into 29 fractions by liquid column chromatography. Fraction code number 15 (eluted by 20% MeOH/CH2 Cl2 ) have the best anti-P. insidiosum activity. It showed MFC as 0.625% (wt/vol). For the FTIR measurement, spectra showed significant peak shifts in amide I and amide II regions (1700-1500 cm−1 ) representing alteration of proteins in test groups comparing to control group. Whereas, changes in other biochemical compositions could not be observed. Conclusion: The in vitro testing of crude extract from P. stutzeri ST1302 showed the anti-P. insidiosum activity by changing some proteins in this organism. Furthermore, the study of proteomics analysis should be done for the better understanding about this mechanism of anti-P. insidiosum activity.

S144

Medical Mycology, 2018, Vol. 56, No. S2

P416 The glycobiology of fungal cell wall polysaccharides and its relation in host immune response

P419 The Pro-angiogenic Growth Factor, FGF-2, as a Host-Response Against Invasive Fungal Pathogens

SSW Wong, V. Aimanianda, JP Latge Institut Pasteur, PARIS, France

Sandeep Vellanki, Eun Young Huh, Lee Soo Chan The University of Texas at San Antonio, SAN ANTONIO TEXAS, USA

Objective: Aspergillus fumigatus is a ubiquitous fungal pathogen that can cause a wide range of infections, for example, invasive pulmonary aspergillosis (IPA) and allergic bronchopulmonary aspergillosis (ABPA). IPA was previously observed to mainly occur among immunocompromised populations, however, in recent years, more cases have been observed in otherwise immunocompetent patients. Therefore, it is important to elucidate the relationship between the fungal pathogen and the host immune system. In addition, in ABPA patients, other underlying pulmonary conditions are usually concurrently present, which challenge the normal clearance mechanism of conidia by phagocytes. As a result, the conidia are allowed to swell and germinate. Dormant conidia possess a layer of rodlet and melanin that masks the underneath polysaccharides in the cell wall. As the conidia swell, this outer layer disappears and the cell wall polysaccharides are exposed and are free to interact with the host immune system. Polysaccharides have been considered immunogenic. But the relationship between the glycobiology and host immune response is not well studied. In this study, the aim is to examine the effect of the length, linkage and solubility of galactomannan and alpha-1,3-glucan with the host immune response. Methods: Galactomannan oligosaccharides of different length and linkage and alpha-1,3-glucan oligosaacharides were synthesized. Native polysaccharides of galactomannan and alpha-1,3-glucan are also extracted from the A. fumigatus mycelia. All the oligosaccharides and native polysaccharides were immobilized or directly inoculated to microtite plates with PBMCs isolated from healthy donors. The stimulation was performed in the presence or absence of normal human serum, to investigate the significance of soluble mediators. The supernatant was collected after 24-h incubation and stored at -20C for further analysis of the cytokine induction. Results: The degree of cytokine induction is directly proportional to the length of both galactomannan and alpha-1,3glucan. The short oligosaccharides and the native polysaccharides display several differences. The short oligosaccharides have to be immobilized (that is, insoluble, since free short oligosaccharides are soluble) and provided with serum for stimulation of cytokine production, while the native polysaccharides do not have to be immobilized and serum is not required. Conclusion: The length and solubility of cell wall polysaccharides are important factors in modulation the cytokine induction. Humoral immune factors, such as soluble mediators, may play a significant role in the recognition of short oligosaccharides, but not for the longer counterpart. Taken together, there exists a link between the glycobiology of A. fumigatus cell wall polysaccharides and the host immune response.

Objective: Angioinvasion and tissue injury are hallmarks of infections mediated by Candida albicans (systemic candidiasis) and Mucor circinelloides (mucormycosis). Several studies have shown that pro-angiogenic cytokines primarily Fibroblast Growth Factor2 (FGF-2) is essential for tissue repair. Recently, studies have shown that FGF-2 treatment increased survival rates of murine models of aspergillosis. However, the role of FGF-2 and its regulated angiogenesis is understudied in systemic candidiasis and mucormycosis infections. C. albicans is a dimorphic fungus that exhibits yeast and hyphae morphologies. Our lab was able to generate an M. circinelloides mutant that exhibits yeast morphology in most conditions. We have previously shown that immune cells such as macrophages and lymphoblastoid cell lines overexpress FGF-2 when challenged with either C. albicans or M. circinelloides hyphae, but not yeast. The main objective of the current study is to determine if the FGF-2 response from a non-immune cell line, Human Umbilical Vein Endothelial Cells (HUVECs) is specific to hyphae form of fungal pathogens. Our second goal is to identify the fungal factors that affect host FGF-2 expression. Methods: HUVEC cells were challenged with either C. albicans or M. circinelloides yeast or hyphae strains for 24 hours. PBS was used as a mock control. The supernatants were collected to perform FGF-2 ELISA. To determine if live hyphae are essential for FGF-2 expression, we compared FGF-2 expression in HUVECs by challenging them with either live, heat-killed or PFA treated C. albicans or M. circinelloides hyphae. To determine if secreted or released factors from fungi are linked with host FGF-2 overexpression, we have grown the fungal pathogens overnight in tissue culture medium, and then we used the spent medium to infect HUVECs. Results: Our results show that HUVECs challenged with C. albicans or M. circinelloides hyphae show a significant increase in FGF-2 expression when compared to their yeast counterparts. Moreover, live hyphae and not heat killed or PFA treated hyphae from both pathogens can cause an increase in host FGF-2 expression. We also found that C. albicans strains deficient in Als 3 cannot increase host FGF-2 expression. Our data also show that secreted factors from M. circinelloides hyphae, but not yeast causes an increase in host FGF-2 expression. Conclusion: Host FGF-2 response is specific to hyphae form of fungal pathogens. Our results suggest that invasion of C. albicans hyphae into host cells is essential to provoke an FGF-2 response. Hyphae specific factors from M. circinelloides can increase host FGF-2 response. Our future studies will focus on determining the role of FGF-2 in murine models of Candidiasis and Mucormycosis.

P417 The role of IL-32 in the innate host response against Candida albicans

P420 Effects of Iron on acuK expression in Talaromyces marneffei

HHM Jaeger1 , J.C. Dos Santos1 , B. Heinhuis1 , R. Saar-Gomes2 , M.S. Gresnigt3 , M. Damen1 , F. Ribeiro-Dias2 , M. Johnsson4 , Y. Li5 , V. Kumar5 , C. Dinarello6 , M.G Netea1 , A.B. Joosten1 1 RadboudUMC, NIJMEGEN, Netherlands 2 ˆ ´ GOIANIA, Universidade Federal de Goias, Brazil 3 Radboudumc, NIJMEGEN, Netherlands 4 Duke University School of Medicine, DURHAM, USA 5 UMC Groningen, GRONINGEN, Netherlands 6 University of Colorado, DENVER, USA

Artid Amsri Chiang mai University, CHIANG MAI, Thailand

Objective: Infections with Candida albicans are still a major problem in immunocompromised and hospitalized patients leading to a large number of death and costs for health care systems worldwide. Extensive genetic and population wide studies have identified important components in Candida host response pathways that are dysregulated that are responsible for disease susceptibility. The intracellular interleukin (IL)-32 has recently been described to be important in several bacterial infections but nothing is known about its role in fungal infections. Methods: By performing experiments with primary human cells in vitro as well as murine in vivo experiments, we here for the first time, identified IL-32 as a novel mediator in the host response against C. albicans. This is most likely not through direct antifungal effect of IL-32 on Candida itself but rather an immunomodulatory effect on cells of the innate immune system. Results: A intronic polymorphism in the IL-32 gene strongly influences C. albicans induced IFNg production in human PBMCs in vitro and addition of recombinant human IL-32 g led to increased concentrations of this cytokine as well as an increase in C. albicans phagocytosis whereas other IL-32 isoforms did not. In a large cohort of patients suffering from Candidemia, the TT genotype of the described genetic variant led to strongly diminished serum levels of IFNg whereas other cytokines remained unaffected. In the following we show that C. albicans infected human IL-32 g transgenic mice show an improved 14-day survival compared to wild type mice. Conclusion: In summery these results identify IL32 as a novel component in the immune response against C. albicans. These insights may help to improve existing therapies and will eventually lead to benefits for (immunocompromised) patients suffering from Candida infections.

P418 In vitro activities of the secreted substance from environmental Klebsiella pneumoniae strain against 11 clinical Pythium insidiosum isolates Saline Laolit, Chularut Pariyachatigul Khon kaen university, KHON KAEN, Thailand Objective: To investigate the in vitro activities of crude extract from Klebsiella pneumoniae ST2501 and their fractions against 11 clinical Pythium insidiosum isolates by using different end point methods: disc diffusion assay and broth dilution minimal cidal concentration (MCC) assay. Methods: In our previous study, crude extract from K. pneumoniae ST2501, the bacterial isolated from environmental sources shown promising results in antifungal activities against P. insidiosum. Crude ethyl acetate extract from fluid secretion cell-free filtrates of K. pneumoniae ST2501 was separated by column chromatography and subsequently eluted with a gradient of two solvents (dichloromethane and methanol) by gradually increasing the polarity of the elution solvent system. The eluents were collected and monitored by thin layer chromatography, producing five groups of eluting fractions. The antifungal activity of all fractions against the mycelia form of 11 clinical P. insidiosum isolates were evaluated using disc diffusion assay (0.5 mg/μl; 20 μl/disc). The fraction which shown strong activity was evaluated by using broth dilution minimal cidal concentration (MCC) at the final concentrations ranging from 0.870 to 3.132 mg/ml. Mycelia fragments of 5 mm in diameter of 11 clinical isolates of P. insidiodum were incubated with the fraction which shown strong activity and evaluated for up to seven days to detect the MCC. The experiment was repeated four times. Results: The antimicrobial activities of crude extract and five fractions from K. pneumoniae ST2501 against 11 clinical isolates of P. insidiosum were evaluated by using disc diffusion assay. Crude extract and fraction No. 1 demonstrated strong activity by give the inhibition of 100% of mycelium growth. Fractions No. 1 which eluted by 100% dichloromethane were evaluated antimicrobial activity against 11 clinical isolates of P. insidiosum by using broth dilution MCC assays. Seven out of 11 P. insidiosum isolates were inhibited at 1.566 mg/mL (63.6%); three isolates were inhibited at 1.74 mg/mL (27.3%) while only one isolate was inhibited at 1.914 mg/mL (9.1%). Conclusion: These results suggest that new compounds with potential therapeutic activity against pythiosis may come from microorganism or nature. However, further in vivo studies are needed to validate our findings as well as the acute toxicity testing in animal models and fraction No. 1 might be purification in the near future.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Objective: This study aimed to investigate a role of acuK in control of iron assimilation in T. marneffei. Methods: 1. Growth of Talaromyces marneffei on different levels of iron was investigated by using biomass measurement method. 2. Expression of acuK gene was verified by using quantitative reverse transcription-polymerase chain reaction (qRT-PCR) Results: 1. T. marneffei growth is induced by the higher concentrations of iron in both forms. 2. The acuK exression was down-regulated upon the sequential reduction of irons. Conclusion: The result suggested the negative regulation of acuK on iron assimilation in T. marneffei.

P421 The role of oseltamivir in the host response against aspergillosis IMW Dewi1 , C Cunha2 , L Vanderbeke3 , MS Gresnigt1 , M Jaeger1 , A Resendiz-Sharpe3 , J Wauters3 , A Carvalho2 , FL Van de Veerdonk1 1 Radboud UMC, NIJMEGEN, Netherlands 2 Life and Health Sciences Research Institute, University of Minho, BRAGA, Portugal 3 KU Leuven, LEUVEN, Belgium Objective: Influenza-associated aspergillosis (IAA) is an emerging fungal infection with high mortality and morbidity due to a debilitating respiratory failure that can even occur in immunocompetent individuals despite antiviral therapy, such as osletamivir. The pathogenesis of this disease has not been understood completely. It has been reported that human cells contain endogenous sialidase. Our study aims to determine whether oseltamivir could affect host response against A. fumigatus. Methods: PBMC and polymorphonuclear cells (PMNs) were stimulated with neuraminidase (NA)-treated A. fumigatus conidia or were pre-exposed to NA prior to stimulation with conidia. In a different set of experiments, cells were pre-treated with Oseltamivir carboxylate prior to stimulation. TNFα, IL-1β, IL-6, and IL-1RA were measured from supernatants after 24 hours of incubation at 37˚C. In vivo experiments were performed in corticosteroid-treated C57BL/6 J mice and cyclophosphamide-treated BALBc mice. Survival rate, lung fungal burden, and histopathology were assessed subsequently. Results: Our findings showed that the presence of neuraminidase modulates sialic acid residues on both Aspergillus conidial and host immune cell surface, resulting in increased cytokine production. We did not observe a difference in cytokine production in oseltamivir-treated cells compared to controls in-vitro, which suggests that in our in vitro system endogenous neuraminidase does not play a role in modulation of host-Aspergillus interaction. This was in contrast to experiments performed in vivo where corticosteroid-treated mice pre-treated with oseltamivir exhibited a higher mortality, increased lung fungal burden, and decreased cytokine production. However this effect were not observed in cyclophosphamide-treatment, possibly suggesting an important role of neutrophils in regards to neuraminidase activity. Conclusion: Overall, our current results indicate that neuraminidase activity might influence host-Aspergillus interactions and that treatment of oseltamivir in a setting of corticosteroid use might increase susceptibility to Aspergillus infection. These results warrant further study on the role of neuraminidase and the effects of oseltamivir on susceptibility to invasive pulmonary aspergillosis during active influenza infection.

P422 Design and use of oligonucleotides to identify eight species of Candida in blood samples E. O. Mart´ınez-Herrera1 , E Garc´ıa-Salazar1 , E Rosas-de Paz2 , E. Duarte-Escalante3 , G. Acosta-Altamirano1 , ´ 1 M.R. Reyes-Montes3 , M.G. Fr´ıas De Leon 1 ´ Hospital Regional de Alta Especialidad de Ixtapaluca, ESTADO DE MEXICO, Mexico 2 Universitat Rovira i Virgili, BARCELONA, Spain 3 ´ ´ ´ Universidad Nacional Autonoma de Mexico, MEXICO, Mexico Objective: Design a molecular marker to identify the most frequently isolated Candida species in Mexico, and to evaluate its usefulness in the detection of the fungus in clinical samples. Material and methods: Based on the in silico analysis of sequences from the internal transcribed spacer region (ITS), deposited in GenBank and corresponding to all pathogenic Candida species, a pair of oligonucleotides was designed with the Primaclade program (1). PCR was standardized with the designed oligonucleotides and the specificity was corroborated using DNA from reference strains of different Candida species. The sensitivity was evaluated using different concentrations of DNA (10 ng - 1 fg) of Candida. The oligonucleotides were evaluated to detect Candida in 27 clinical samples (blood), from which the fungus was isolated in culture. Results: Based on the analysis of the ITS sequences of different Candida species, a pair of oligonucleotides (CaR and CaF) were designed, which amplify, by simplex PCR, specie-specific fragments for the eight most isolated Candida species in Mexico: C. albicans, C. glabrata, C. tropicalis, C. parapsilosis, C. krusei, C. guilliermondii, C. lusitaniae and C. dubliniensis. The sensitivity of the PCR was 10 pg of DNA. When the DNA of 27 clinical samples, with positive culture for Candida, was analyzed, we observed that the oligonucleotides detected and identified C. albicans, C. glabrata and C. parapsilopsis. These results were corroborated by the sequencing of the amplicons. Conclusion: The CaR and CaF oligonucleotides are a useful tool for the rapid and sensitive identification of the eight most common Candida pathogens in Mexico.

ABSTRACT

P423 Mycobiome of Bondi Beach Sand D. Terre The University of Sydney, SYDNEY, Australia

S145

P426 Diversity of the Chrisosporium species and relatives in soils of Iran A. Rezaei-Matehkolaei1 , Simin Taghipour2 , Neda Kiasat2 , Ali Zarei Mahmoudabadi1 , Mahnaz Fatahinia1 , Fahimeh Piri2 Ahvaz Jundishapur University of Medical Sciences, AHVAZ, Iran Student Research Committee, Ahvaz Jundishapur University of Medical Sciences, AHVAZ, Iran

1 2

Objective: The Australia coastline consists of numerous beaches, regularly used for recreational activities by locals and tourist alike. The presence of pathogenic fungi in sand could have public health implications but it has not been assessed in Australia so far. Various clinically significant fungi have been found residing in beach sand worldwide, such as, Trichophyton, Microsporum, Cladosporium, Epidermophyton and Candida. Many factors influencing the fungal load in beach sand with the frequency and level of human interaction being a significant contributor. Other features such as the physical environment, biological factors and nutrient availability impact their capacity to transiently persist or thrive in that environment. This study involves six locations at Bondi beach (Sydney), identifying medically relevant fungal species and assessing the beach as a potential reservoir for fungal infection. Focusing on correlations between the abundance of fungal species, characteristics of the beach and other conditions such as seasonality and level of human activity. Different methods were used and compared to characterize the mycobiome of beach sands in Bondi beach. Methods: Beach sand was collected from six areas of Bondi beach, with five samples taken at each of the locations and made into a composite. From each composite 1 g of sand was placed directly onto three types of media – Sabouraud, Sabouraud Dextrose and Mycosel agar and incubated at 27◦ C. For traditional sequence based identification, individual colonies were selected from the agar plates and subcultured on a fresh agar plate. After 24 h, cultures were visually checked for purity and if contaminated, subcultured again. Phenol-chloroform extraction method was used to extract DNA. ITS1–ITS4 primer set was used to amplify the primary fungal barcode (ITS) and Al33F–Al33R or Al34F-Al34R set for the secondary one (TEF1α). All PCR products were sequenced in both the forward and reverse directions by Sanger sequencing. For metabarcoding analyses, total genomic DNA was extracted from sand samples using the PowerMax Soil DNA Isolation kit (MoBio) following manufacturer’s instructions. Fragments were amplified with universal fungal primers, ITS1F and ITS2 targeting R platform from Illumina. Reads were processed using the the ITS1 region. The resulted PCR amplicon were sequenced on MiSeq UNOISE algorithm to obtain error-corrected (denoised) sequences. Each denoised sequence was considered to be an Operational Taxonomic Unit (OTU). Taxonomy was predicted for the OTU sequences using the SINTAX algorithm in usearch v10.0. Results: Many fungal species have been identified by traditional culturing methods and the ITS barcode with Sanger Sequencing. Many environmental species were recovered but some are medically relevant such as Mucor, Rhodotorula, Cladosporium, Penicillium and Alternaria have been recovered. In the first two months of sampling over 150 isolates were recovered from six locations on Bondi beach, with 30 identified at time of writing. Further results, including the metabarcoding analysis of the samples will be available by the conference. Conclusion: This is the first study of the mycobiome of beach sand in Australia. Some of the identified species are of medical relevance and a potential source of human infection. Further research is needed to better understand the implications to public health.

P424 Short fractions of β-1,3 glucans act as a shield for pathogenic yeasts and modulate the activation of platelets S. Jawhara1 , Helene Vancraeyneste2 , Rogatien Charlet2 , Yann Guerardel3 , Laura Choteau2 , Anne Bauters4 , Meryem Tardivel5 , Nadine Francois6 , Laurent Dubuquoy7 , Dmitry Soloviev8 , D. Poulain9 , B. Sendid9 1 LIRIC-INSERM 995/Team2, LILLE, France 2 Inserm U995/Team2, LILLE, France 3 CNRS, UMR 8576, VILLENEUVE D’ASCQ, France 4 ´ ˆ de Pathologie Gen ´ etique, ´ Laboratoire d’Hemostase, Pole LILLE, France 5 ´ Plateforme d’Interaction Moleculaire, IMPRT-IFR114, LILLE, France 6 ´ etique, ´ Service de Parasitologie Mycologie, Pole de Biologie Pathologie Gen LILLE, France 7 Inserm U995, LILLE, France 8 Cleveland Clinic, CLEVELAND, USA 9 LIRIC-Inserm U995/Team2, LILLE, France Objective: Platelets play a crucial role in hemostasis, thrombosis, and pathogen clearance. Many pathogenic fungi can interact with platelets in circulating blood. This interaction between the fungus and the host occurs at the level of the fungal cell wall, which consists mainly of polysaccharides associated with proteins and lipids. Its innermost layers are formed from a dense network of polysaccharides consisting of chitin and β-glucans. Clinically, β-1,3 glucans derived from the fungal cell wall are released in the circulation during infection and their detection allows the early diagnosis of an invasive fungal infection, but the rolef β-1,3 glucans in the modulation of platelet activities and platelet-neutrophil interactions is unknown. We studied the effect of β-1,3 glucan fractions (BGFs) consisting of diglucosides (Glc2), tetraglucosides (Glc4), and pentaglucosides (Glc5) on platelets, and their impact on host defenses. Methods: The effect of BGFs on the coagulation process was determined by measuring thrombin generation. Platelets pretreated with BGFs were analyzed in terms of activation, receptor expression, aggregation and adhesion to neutrophils and to C. albicans. Results: BGFs affected the endogenous thrombin potential in a concentration dependent manner. For the platelet activation, BGFs at a low concentration (2 μmol/L) reduced ATP release and prevented the phosphorylation of protein kinase C. BGFs diminished the expression of P-selectin and the activation of α IIb β 3 . BGFs decreased platelet aggregation and the interaction between thrombinstimulated platelets and neutrophils, fibrinogen, and C. albicans. GLc5 decreased ATP release and TGF-β1 production in response to TLR4 upregulation in thrombin-stimulated platelets, but TLR4 blockage abolished BGFs effects on platelets. Conclusion: Overall, our study offers new insights, showing that these fungal-derived oligoglucosides are not involved exclusively in the protection of C. albicans during infection but also in the coagulation process and in the modulation of platelet activation mediated via TLR4 stimulation. Thus, short fractions of β-1,3 glucans promote fungal escape from the host defense.

P425 ´ de Cepas Authentification of pathogenic filamentous fungi through of ITS regions sequencing from the Coleccion Microbianas y Cultivos Celulares (Mexico). Daniel A. Estrada-Barcenas, Juan C. Estrada-Mora ´ y Estudios Avanzados del I.P.N., MEXICO CITY, Mexico Centro de Investigacion Objective: We authenticate the taxonomic classification of 34 strains of pathogenic (animal or human) filamentous fungi, previously morphologically identified, of the Coleccion ´ Nacional de Cepas Microbianas y Cultivos Celulares of CINVESTAV (Mexico). The fungi species (no. of strains) considered for this analysis were Absidia glauca (1), Aspergillus fumigatus (2), Aspergillus niger (6), Fusarium oxysporum (1), Histoplasma capsulatum (8), Lichteimia ramosa (1), Mucor hiemalis (1) Mucor rouxii (2), Mucor sp (1), Pseudogymnoascus destructans (1), Purpureocillium lilacinum (2), Rhizomucor pusillus (1), Rhizomucor miehei (2), Rhizopus oryzae (3), Trichophyton mentagrophytes (1) and Trichophyton equinum (1). Methods: From the DNA obtained from each strain, a PCR was carried out for the amplification of the ITS regions, with ITS5 and ITS4 primers. The samples were sent to Laboratorio Nacional de. Servicios Experimentales of CINVESTAV for sequencing. The sequences were edited manually, to perform a BLAST search for identification. All the sequences were aligned, with the Clustal W program included within the MEGA 7.0 program to perform a dendogram with the Neighbor-Joining method to observe the robustness of the taxonomic groups and observe the phylogenetic relationships. Results: 97% the strains corresponded to the genus of the phenotypically identified species. Only genus was changed was Absidia glauca for Lichteimia corymbifera. Besides, 26% the species were updated: two strains of Aspergillus niger corresponded to the species Aspergillus brasiliensis; Mucor hiemalis and Mucor rouxii resembled to M. circinelloides; Mucor sp. was Mucor racemosus; one strain of Rhizomucor miehei was Rhizomucor pusillus; and the last change was updated of Trichophyton mentagrophytes species as Trichophyton interdigitale. The dendrogram clearly shows the groups of Zygomecetes separated from the ascomycetes and each genus and species with a BT> 80%. Conclusion: Taxonomic knowledge is always in renewal, and molecular techniques purge phylogenetic diversity. The molecular identification confirmed the taxonomic classification of 25 strains, the ITS regions showed to be an efficient marker to demonstrate the species of filamentous. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 425163 b4b49f5f-af04-4c99-8a5a-b8ee 4be7b357.png Caption 1: Figure 1. Dendogram of 34 strains sequences of pathogenic filamentous fungi of the Coleccion ´ Nacional de Cepas Microbianas y Cultivos Celulares of CIN

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Objective: Chrysosporium species are keratinophilic filamentous fungi normally isolated from soil and plant material and occasionally from skin, hair and nail scrapings of human and animals. In this study we aimed to extend our knowledge about distribution of these molds in soils of Iran. Methods: A total of 900 soil samples were collected from various spots. The keratinophilic fungi were isolated based on the hair-baiting technique and were subjected to sequencing of the nuclear ITS-rDNA regions for identification. Results: Totally, in 108 (12%) soil samples whose PH ranged from 6.3 to 8.6 a Chrisosporium species or relative was isolated. Based on the data from sequencing Aphanoascus verrucosus was the dominant isolate (70; 65%) followed by Aphanoascus terreus (12; 11%), Arthroderma multifidum (10; 9.3%), C. keratinophilum (5; 4.6%), C. pannicola (5; 4.6%), C. indicum (4; 3.7%) and A. fulvescens (2; 1.8%). Conclusion: isolation of Aphanoscus species with the highest rate was the most remarkable finding of the study with public health significance.

P427 Antifungal activity of scorpion-venom derived antimicrobial peptides on Candida albicans and Paracoccidioides brasiliensis cells J.N. Dias1 , A.R. Araujo2 , J.M.T. Souza2 , C.M. De Souza-Silva1 , P. Albuquerque3 , I. Silva-Pereira1 1 Universidade de Bras´ılia, BRAS´ILIA, Brazil 2 Universidade Federal do Piau´ı, PARNA´IBA, Brazil 3 ˆ University of Bras´ılia, Faculty of Ceilandia, BRAS´ILIA, Brazil Objective: The present work aims to determine the antifungal activity of three antimicrobial peptides (AMPs) from scorpion venom against Candida albicans and Paracoccidioides brasiliensis. Methods: The AMPs ToAP1,ToAP2 and NDBP-5.7 were chemically synthesized according to putative AMP cDNA sequences from the venom gland of scorpions Tityus obscurus, T. costatus, Hadrurus gertschi, and Opisthacanthus cayaporum. We determined the Minimum inhibitory concentration (MIC) for each peptide against Candida albicans and Paracoccidioides brasiliensis using the CLSI M27-A3 guidelines with some modifications and the alamar blue cell viability reagent. The time of death of C. albicans after AMPs treatment was evaluated by time-kill curves according with previously described protocols. We also evaluated the possible effects of these peptides on C. albicans filamentation by light microscopy. Synergy of multiple pairwise combinations of AMPs or AMP combinations with fluconazole was evaluated using the microdilution checkerboard test. Finally, we evaluated possible effects of those AMPs on the C. albicans cell structure after 24 hours of treatment by atomic force microscopy (AFM). Results: All tested AMPs were effective in vitro against the tested fungi. ToAP2 was the most effective for both C. albicans (6,25 μM) and P. brasiliensis (12,5 μM). While peptides ToAP1 and NDBP-5.7 showed the lowest antimicrobial activity for both fungal species. MICs values for ToAP1 and NDBP-5.7 were 50 uM and 25 uM respectively for C. albicans and 50 μM for both AMPs in P. brasiliensis. Time-kill assays for C. albicans treated with different AMPs revealed values of 6 h for ToAP2, 8 h for NDBP-5.7 and 12 h for ToAP1. Using non-lethal concentrations, both ToAP2 (12.5 μM) and NDBP-5.7 (25 μM) were able to induce changes on C. albicans germ tube formation. After 4 hours of incubation of C. albicans cells with ToAP2 and NDBP-5.7, there were a decrease of 47 and 24% in the percentage of fungal cells presenting germ tubes. The size of C. albicans filaments was also altered by these two AMPs after 4 and 24 h of the treatment with those AMPs. The checkerboard assay revealed an additive effect of NDBP-5.7 with fluconazol (FICI mean: 0.54) and a synergistic effect of ToAP1 and ToAP2 with fluconazole with FICI means of 0.5. There was also a synergistic effect in the combination of ToAP1 with ToAP2 (FICI mean: 0.39) and an addictive effect of the combination of ToAP2 and NDBP-5.7 (FICI mean: 0.53). AFM imaging demonstrated that NDBP-5.4 treatment induced an increase in the cell size and morphology of C. albicans cells, while treatment with ToAP1 did not induced any noticeable differences in cell size or morphology. Conclusion: Our results showed the antifungal activity of the tested AMPs against C. albicans and P. brasiliensis, and synergy of some of these molecules with known antifungal agents. These results reinforce the potential of these molecules in antifungal therapy and point out to the need of more studies for better characterization of these molecules and their mechanism of action.

P428 ATG genes influence the virulence of Cryptococcus neoformans through contributions beyond core autophagy functions ´ Hao Ding, MELissa Caza, Yifei Dong, Linda C. Horianopoulos, Guanggan Hu, Pauline Johnson, James W. Kronstad University of British Columbia, Vancouver, Canada Objective: The process of autophagy is conserved among all eukaryotes from yeast to humans, and is mainly responsible for bulk degradation of cellular contents and nutrient recycling during starvation. Autophagy has been suggested to play a role in the pathogenesis of the opportunistic human fungal pathogen Cryptococcus neoformans, potentially through a contribution to export virulence factors. The purpose of the study is to define the roles of different C. neoformans autophagy genes in nutritional aspects of amino acid homeostasis, in the secretion of virulence factors, and in virulence in mice. Methods: We examined the functions of four ATG genes representing steps in induction (ATG1), nucleation of the phagophore (ATG9), and expansion of the phagophore (ATG7, ATG8) by generating single gene deletion mutants and their respective complemented strains. Phenotypic characterization of each atg mutant were carried out including in vitro production of melanin and polysaccharide capsule, the ability to grow at body temperature (37◦ C), and intracellular replication in murine macrophage-like cells J774A.1. In addition, a mouse inhalation model of cryptococcosis was used to evaluate the effect of each ATG gene on virulence of C. neoformans. Results: In this study, we showed that deletion of each of the ATG1, ATG7, ATG8, and ATG9 genes in C. neoformans leads to autophagy-related phenotypes including impaired amino acid homeostasis under nitrogen starvation. In addition, the atg mutants were hypersensitive to inhibition of the ubiquitin-proteasome system, a finding consistent with a role in amino acid homeostasis. Although each atg mutant was not markedly impaired in virulence factor production in vitro, we found that ATG7, ATG8, and ATG9 contribute to C. neoformans virulence in a murine inhalation model of cryptococcosis. Interestingly, these mutants displayed significant differences in disease development. A more detailed investigation of virulence for the atg8 mutant revealed that this strain stimulated an exaggerated host immune response, which in turn contributed to disease progression. Conclusion: Our results suggest that different ATG genes are involved in different non-autophagic functions, and contribute to C. neoformans virulence beyond their core functions in autophagy.

S146

P429 TPEN, zinc chelator, inhibits biofilm and hyphae formation by Trichosporon asahii Sanae Kurakado, Takashi Sugita Meiji Pharmaceutical University, TOKYO, Japan Objective: Trichosporon species are the second most common etiological agent in catheter-related fungemia, followed by Candida species. The clinical outcome of disseminated trichosporonosis is poorer than that of disseminated candidiasis, and the mortality rate is over 70%. Trichosporon asahii is the major causative agent of disseminated or deep-seated trichosporonosis. The microorganism can form biofilm on substrates, which can be a cause of fungemia. Assimilation of essential nutrient from their hosts is critical ability for pathogenic microorganisms to proliferate and to form and maintain biofilms.To identify metal cation which affect biofilm formation, we evaluated the effect of cation chelators on biofilm formation in T. asahii. Also T. asahii can change various morphology from yeast to hyphae and arthroconidia. The effect of trace metal on morphology of T. asahii was also investigated. Methods: 1) Biofilm formation assays were performed on cells under incubation with a variety of diavalent cation chelators, named EDTA, Deferoxamine, Triethylenetetramine (TETA) and N, N, N’, N’-Tetrakis(2-pyridylmethyl) ethylenediamine (TPEN) by using XTT reduction assay. 2) Biofilm formation was evaluated in the presence of zinc and TPEN. 3) The effects of zinc and TPEN on cell morphology were assessed by light microscopy. Results: 1) EDTA, TETA and TPEN inhibited biofilm formation in concentration-dependent manner, and TPEN was most effective (90% inhibition; 0.5 μM, TPEN; 0.5 mM, EDTA; 5 mM, TETA). While deferoxamine did not show inhibitory effect on biofilm formation by 50 mM. 2) Adding 0.1 μM zinc complemented the biofilm formation which was inhibited by TPEN. 1 μM of zinc promoted biofilm formation compared with TPEN-free medium control. 3) TPEN decresed hyphae formation. While zinc elongated hyphal form conversely. Conclusion: Our data showed that TPEN, zinc chelator was the most effective for inhibition of biofilm formation by T. asahii. The effect of TPEN on biofilm formation is derived from zinc depletion. TPEN may inhibits biofilm formation through reducing hyphae formation. These results suggest that zinc is essential factor for biofilm formation of T. asahii. Also, the data indicated that hyphal form might be one of the important morphologies for the process of forming biofilms in T. asahii.

P430 Cas9/CRISPR genome editing to prove contribution of Cyp51A G138S to azole resistance in Aspergillus fumigatus. Y. Hayashi1 , T. Umeyama2 , H. Shimosaka1 , T. Inukai2 , S. Yamagoe2 , M. Nagi2 , S. Nakamura2 , K. Ogawa1 , Y. Miyazaki2 1 National Hospital Organization, Higashinagoya National Hospital, NAGOYA, Japan 2 National Institute of Infectious Diseases, TOKYO, Japan 3 National Institue of Infectious Diseases, TOKYO, Japan Objective: Azole resistance in Aspergillus fumigatus is predominantly associated with single nucleotide polymorphisms (SNPs) in the gene cyp51A encoding lanosterol 14α-demethylase or increased expression of Cyp51A, the target enzyme of azole antifungal agents. Although several SNPs possibly linked to low susceptibility have been reported so far in azole resistant isolates, only a few studies have been conducted to prove that the SNPs could contribute to decreased azole susceptibility. Here, we genetically investigated the mutations in the Cyp51A of a clinical isolate from a patient with long-term voriconazole treatment. Methods: A strain was isolated from the sputum of a 74-years-old male receiving long-term voriconazole for CPPA, chronic progressive pulmonary aspergillosis. Molecular identification of the isolate was performed as well as morphological observation by nucleotide sequence of ITS-D1/D2 region and β-tubulin gene. To evaluate the impact of found mutations in clinical isolates, PCRamplified DNA fragments containing cyp51A with or without the mutation of interest and hygromycin marker were introduced simultaneously with Cas9 protein and in-vitro synthesized guide RNA into protoplasts of the azole resistant/susceptible strain. Nucleotide sequencing of the cyp51A gene of recombinant strains were performed to verify mutations. Antifungal susceptibility testing was performed by Etest or CLSI broth microdilution method. Results: The isolate from the CPPA patient was identified as A. fumigatus. The isolate demonstrated very high MICs of itraconazole (>8 μg/ml) and voriconazole (8 μg/ml), determined by CLSI method. Nucleotide sequencing of the cyp51A gene revealed the mutations in Gly138Ser (GGC→AGC) and Asn248Lys (AAT→AAA) when compared with cyp51A of the azole susceptible isolates Af293 and AfS35. To test which residue causes decreased azole susceptibility, amino acid Ser138 and/or Lys248 were replaced with Gly and/or Asn, respectively, in the azole resistant isolate by Cas9/CRISPR-mediated homologous recombination with PCR fragment containing hygromycin marker. Azole susceptibility testing by Etest of recombinant strains showed an increased susceptibility by the replacement of Ser138 by Gly, not Asn248 by Lys. Reversely, azole susceptibility was slightly decreased when Ser138 mutation was introduced into the azole-susceptible strain AfS35, indicating that a mutation at Ser138 of the two residues is contributed to azole resistance in the clinical isolate. Conclusion: Serine at position 138 of the Cyp51A predominantly contributes to low susceptibility in the azole resistant isolate from a CPPA patient. Genetic recombination, which has been hampered so far in clinical isolates, can be now achieved using Cas9/CRISPR genome editing. This technique could be useful to investigate azole resistant mechanism by other point mutation of Cyp51A.

P431 Maintaining fitness through phenotypic plasticity in Aspergillus fumigatus; elucidating transcriptional differences between three clinical isolates exposed to itraconazole M.W.J. Hokken1 , J Coolen1 , J Zoll1 , W.J.G. Melchers1 , P.E. Verweij1 1 RadboudUMC, NIJMEGEN, Netherlands Radboud UMC, NIJMEGEN, Netherlands

2

Objective: The incidence of invasive aspergillosis in immunocompromised patients has increased over the last decades, emphasizing the importance of azoles as first-line treatment. Since 2000, azole resistance has emerged worldwide, and mutations in the CYP51A gene combined with repeats in the promoter region appear to be the main mechanism of azole resistance. Studies showed a rapid development of resistance after sequential subculturing on azole-containing media. Before these genetic mutations arise, A. fumigatus is challenged with a new, stressful environment when exposed to azoles. The fungus possibly maintains fitness through phenotypic plasticity (PP); the ability to adapt its phenotype in a changing environment to maintain growth and reproduction. This process may eventually allow the emergence and selection for resistant isolates, resulting in a full resistant population. Genetic differences between A. fumigatus isolates could be important features in how A. fumigatus exerts PP in a changing environment. This study focuses on the differences between clinical A. fumigatus isolates when adjusting its transcriptome during azoles stress, mimicking the human lung environment. Methods: Three wild-type clinical A. fumigatus isolates were inoculated for 24 h in Aspergillus Minimal Medium. After 24 h, itraconazole was added at IC50 concentrations. Strains were harvested through Miracloth after 0, 30, 60, 120 and 240 minutes. Subsequently, RNA was extracted and TruSeq mRNA libraries were created for analysis on a NextSeq500 (Illumina). Paired-end reads of 2 × 75 bp were generated in High Output mode. Reads were aligned with STAR against the reference genome sequence of A. fumigatus Ensemble CADRE 30. Differentially expressed genes (DEGs) were identified (adjusted P value 1.5, or < -1.5) by DESeq2 for R by Bioconductor. Results: A total of 30 samples were obtained; three clinical isolates, harvested at five different time points, in duplicate. All samples showed at least 80% mapping to the Af293 reference genome, with an average read coverage of 65x the complete A. fumigatus genome. A core group of 2002 genes was found to be differentially expressed in all isolates. Interestingly, the isolates had 687, 363 and 547 unique differentially expressed genes (DEGs), respectively. Analysis of these genes shows strain specific transporters, stress signaling components and pathogenesis-associated genes. Conclusion: RNAseq gives insights into how the stress response of A. fumigatus to itraconazole promotes survival of the fungus in the patient, before any stable genetic mutations arise. Results suggest that PP can be strain specific, and adaptation to overcome environmental stress can be achieved in different ways. This study could help to understand how inter-strain variability in growth speed or virulence arises. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 425547 50280a70-f748-4262-9f413536704d3a16.png

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Medical Mycology, 2018, Vol. 56, No. S2

P432 Mexican Culture Collection WFCC-WDCM-500 importance as biological resource center in biotechnology medical research 3 ´ Daniel A. Estrada-Barcenas1 , Juan C. Estrada-Mora2 , Sergio Zepeda-Hernandez 1 ´ y Estudios Avanzados del I.P.N., MEXICO City, Mexico Centro de Investigacion ´ y de Estudios Avanzados del I.P.N., MEXICO City, Mexico Centro de Investigacion 3 ´ Universidad Autonoma Metropolitana, Unidad Cuajimalpa, MEXICO City, Mexico 2

Objective: The Mexican Culture Collection of Microorganisms is recognized as Biological Resource Centre (BRC) by CONABIO (Comision ´ Nacional para el Conocimiento y Uso de la Biodiversidad, M´exico); member of WFCC since 1974 under acronym CDBB-500: maintains and studies bacteria, actinomycetes, filamentous fungi, yeast and microalgae strains in order to provide fundamental support for basic and applied research on microbiology. Used for educational and practical purposes, general and specific interest on healthy microbiology, biotechnology, genetics, applied biology and other fields of science. The cultures are available and distributed on demand for education and research in accordance with national and international rules for the present and future generations in latinoamerican and worldwide. This collection has served as a general research resource for the isolation, preservation and distribution of microorganisms to scientific community. Actually a web page, it maintains strain updated information, generated from screening and research, can be accessed through an on-line public catalogue to promote full utilization of microbiological resources of CDBB-500. It shows strains information, registry number, acronyms, depositor, uses and applications, as well as growth conditions. A data base system is in development together with Information Technology Department of in the Division of Communication Sciences and Designat the Metropolitan Autonomous University M´exico in order to facilitate the data management. This aims of this paper is to recount of the pathogenic fungi species from the data base system. Methods: The Collection holds over 2000 well-documented and authenticated strains (including test and control strains) preserved in several methods, mainly in liquid nitrogen. An exhaustive search was made to know the number of strains and species of fungi with medical and veterinary importance, looking the references the pathogenic microorganisms of our base system. Results: We found 23 pathogenic species of fungi, included in 16 genera, out of a total of 158 strains. All species are considered opportunistic and not obligate parasites. 13 species are yeasts and 13 are filamentous fungi. The species recounted are: Absidia glauca, Aspergillus flavus, Aspergillus fumigatus, Aspergillus niger, Aureobasidium pullulans, Candida albicans, Candida dublinensis, Candida glabrata, Candida parapsilosis, Candida tropicalis, Criptococcus albidus, Fusarium oxysporum, Histoplasma capsulatum, Lichtheimia corymbifera, Lichtheimia ramosa, Mucor circinelloides, Mucor racemosus, Paecilomyces lilacinus, Pseudogymnoascus destructans, Rhizomucor miehei, Rhizomucor pusillus, Rhizopus oryzae, Trichophyton equinum, Trichophyton interdigitale, Trichosporon cutaneum and Trichosporon pullulans. Conclusion: According to the modern tendencies, WFCC-CDBB-500 has increased its services in different application areas, particularly in healthy sector in Mexico, providing strains stocks and specific information of it; all of this with a great value in the biotechnology development. The collection is a reference bank of pathogenic fungi, which represents less than 8% of the total of strains. It is important to raise awareness in the medical sector about the importance of WFCC-CDBB-500 as an endorsement of the pathogenic fungi diversity, to know emerging diseases and outbreaks.

P433 Extraction and screening of Paracoccidioides lutzii antigens for the development of monoclonal antibodies A N D Moura1 , L Thomaz1 , L M Lopes-Bezerra2 , C P Taborda1 1 University of Sao Paulo (USP)/Institute of Biomedical Sciences, SAO PAULO, Brazil 2 University of Sao Paulo (USP), SAO PAULO, Brazil Objective: Extract and prospect antigens from P. Lutzii group isolates, to evaluate the protective potential, to construct a panel of MAbs, and to submit those with a better therapeutic potential to the humanization process. Methods: Isolates Pb01, Pb66 and Pb8334 are being cultivated in Fava Netto medium. Glycolipids (Gl) are extracted by Folch method. To obtain glycoproteins (Gp) the masses are autoclaved in citrate buffer and precipitated with ethanol. Protein extracts are being obtained by the SDS-DDT method. Extracts will be used in a screening by Dot and Western Blot. The most promising samples will be separated by 2D electrophoresis and detected by colorimetric method with Schiff’s reagent. The band resulting from the expression of the molecule with the greatest immunogenic potential will be isolated and identified by Mass Spectrometry. Mabs will be produced by hybridoma technology. Results: To date, 23 g of fungal mass of Pb66 have been extracted and purified by TLC. Gp of 28,09 g of Pb01, 30,67 g of Pb66 and 28,96 g of Pb8334 were extracted and lyophilized. We obtained 107,8 mg/mL of cytoplasmic proteins of Pb01 and 212,12 mg/mL of Pb18, 52,93 mg/mL of surface proteins of Pb01 and 79,97 mg/mL of Pb18. Screening by Dot Blot was done agaisnt Pb66 antigens with mice PCM polyclonal sera (anti-Pb66, anti-Pb8334, anti-Pb01 e anti-Pb18) and mice Histoplasmosis polyclonal serum. The result indicates high affinity by all the sera with Gps, and affinity and specificity by PCM sera because of P. lutzii isolates for all the Gls fractions. There was no cross reaction against the extracts of Gl. There was no signal with the proteins samples. Conclusion: Until now the results showed that the extracts can be promising for the search of a new therapeutic tool.

P434 Use of platelet-rich plasma and platelets lysate as blood biometerials for improvement of spototrichosis lesions M. Didehdar1 , H. Mohajerani2 , E. Najafi3 1 Arak University of Medical Sciences, ARAK, Iran 2 Islmic AzadUniversity of Arak, ARAK, Iran 3 Isalmic Azad University of Arak, ARAK, Iran Objective: Sporotrichosis is a subacute or chronic infection caused by the dimorphic fungus Sporothrix schenckii. In this disease usually affects the cutaneous, subcutaneous tissues. Platelets are cells involved in blood clotting and also have an important role in monocyte migration and wound healing. Therefore, this study aimed to investigate the effect of platelets and their products on sporotrichosis lesions. Methods: In this study, nine adult hamsters were divided in three groups of three. Suspension provided from colony of fungal filamentous form was injected as subcutaneous in skin of hamster tail. After creating cutaneous on hamsters, one of the groups was treated with platelet-rich plasma, the other group was treated with platelet lysate and the control group did not receive any treatments. After two weeks, the lesions were investigated for the presence of yeast cells in infected tissue that was stained with Gomori Methenamine Silver method. Results:The lesions were improved in both groups of platelets lysate and plasma and no yeast form were observed in the tissues. In control group, the lesion had no changes and yeast cells were observed in infected tissue. Conclusion: Platelets and their products have the regenerative properties and the ability to call the immune cells to sites of infection. The findings of this study showed that platelets products can be a new idea for regenerating of cutaneous and subcutaneous lesions of sporotrichosis.

ABSTRACT

P435 In vitro activity of econazole in comparison with three common antifungal agents against clinical Candida strains isolated from superficial infections A. Hosseinnejad1 , M. Abastabar2 , T. Shokohi3 , M. Hedayati3 , R. Rouhi Kord1 , H. Badali3 1 Mazandaran University of Medical Sciences, Sari, Iran, SARI, Iran 2 Mazandaran University of Medical Sciences, SARI, Iran 3 School of Medicine, Mazandaran University of Medical Sciences, Sari, Iran, SARI, Iran Objective: Candida species are the most common organisms involved in superficial fungal infections, worldwide. Although econazole is among the most frequently used topical formulations for the treatment of candidiasis, no information is available regarding the susceptibility profiles of Candida species in Iran Methods: In vitro susceptibility of 100 clinical Candida isolates belonging to 6 species from superficial candidiasis of Iran towards to econazole was compared with three other common antifungal agents including itraconazole, fluconazole, and miconazole. Minimum inhibitory concentrations (MICs) values were analyzed according to the Clinical and Laboratory Standards Institute (CLSI) M38-A3 document. All isolates were previously identified to the species level, using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) on ITS region. Results: The MIC of econazole, itraconazole, miconazole, and fluconazole were within the range of 0.016-16, 0.032-16, 0.01616, and 0.25-64 μg/ml, respectively. In general, econazole and miconazole were more active against Candida isolates, compared to the other two agents. Conclusion: The present study demonstrated that for Candida albicans isolates, miconazole and econazole had the best effect, but in non-albicans Candida species, itraconazole and miconazole displayed more activity than other antifungal agents.

P436 Serodiagnosis of aspergillosis in falcons (Falco spp.) by Afmp1p-based enzyme-linked immunosorbent assay 5 ¨ , K.-F. Chan1 , M. Joseph2 , S. Xue1 , C.-C. Tsang1 , U. Wernery2 , C. Hebel3 , A. Damerau4 , J. Kinne2 , J.-P. Cai1 , H. Kuspert R. Raghavan2 , J.Y.M. Tang1 , G. Syriac2 , S.K.P. Lau1 , S. Jose2 , P.C.Y. Woo1 1 The University of Hong Kong, POKFULAM, Hong kong 2 Central Veterinary Research Laboratory, DUBAI, United Arab Emirates 3 F3 Falcons R, DUBAI, United Arab Emirates 4 University of Applied Sciences, BERLIN, Germany 5 Falcon Center GbR, HELVESIEK, Germany

Objective: Falconry, the use of birds of prey to hunt wild quarry, has a long tradition in the Arabian region. During the last decades the Arabian falconers have shifted from species that have naturally occurred in the region to falcons that are adapted to colder climates as well as hybrid birds, of which the immunity can be impaired. As a result, aspergillosis, most commonly caused by Aspergillus fumigatus, has emerged as one of the main health problems in this group of birds. This disease in falcons may be associated with high mortality and difficulties in clinical and laboratory diagnosis. We previously cloned an immunogenic protein, Afmp1p, in A. fumigatus and showed that anti-Afmp1p antibodies were present in human patients with A. fumigatus infections, making Afmp1p potentially useful for serodiagnosis of human aspergillosis. In this study, we hypothesise that an Afmp1p-based enzyme-liked immunosorbent assay (ELISA) could also be applied for serodiagnosis of aspergillosis in falcons. The aim of this study was to develop an Afmp1p-based ELISA system for the serodiagnosis of falcon aspergillosis. Methods: Total IgY was first purified from falcon sera and used to raise a polyclonal anti-falcon IgY antibody using a guinea pig model. This polyclonal antibody was then conjugated with horseradish peroxidase for use in subsequent ELISA. Next, laboratory falcons were experimentally infected with A. fumigatus intratracheally and had their blood drawn at different timepoints post-infection for the characterisation of any anti-Afmp1p antibody response developed. Western blotting was carried out to examine the presence of any immunoreaction between Afmp1p and the sera of the experimental falcons before and after infection. An Afmp1p-based ELISA was then developed to characterise the change in anti-Afmp1p antibody profiles of the experimentally infected falcons throughout the infection course. The performance of this Afmp1p-based ELISA was evaluated using serum samples from 129 apparently healthy falcons and 12 falcons diagnosed with aspergillosis by endoscopy taken during routine annual health checks. Results: A guinea pig polyclonal antibody against falcon IgY was generated, and its titre (as half maximal effective concentration [EC50 ]) and detection limit were 1:7,332 and 2,538 pg/mL, respectively. This polyclonal antibody against falcon IgY possessed a high specificity to falcons and did not cross-react with the IgYs of other bird species, including chicken, duck and goose. All four laboratory falcons experimentally infected with A. fumigatus through the intratracheal route developed culture- and histology-proven invasive aspergillosis. Anti-Afmp1p antibodies were first detected in their sera from day 12–50 post-infection. For the Afmp1p-based ELISA, the mean±SD absorbance at 450 nm using sera from 129 apparently healthy falcons was 0.186±0.073. Receiver operating characteristics curve analysis showed an absorbance cut-off value of 0.407. Using this cut-off, one negative serum gave an absorbance outside the normal range, giving a specificity of 99.2%. For the 12 field sera from falcons with confirmed aspergillosis, nine gave absorbance values equal to or above the cut-off, giving a sensitivity of 75%. Conclusion: The Afmp1p-based ELISA is useful for serodiagnosis of falcons with aspergillosis in veterinary microbiology laboratories, complementing endoscopy, fungal culture and histology.

S147

P438 Lipid-dependent strains in Malassezia pachydermatis ´ F.J. Cabanes ˜ M. R. Bragulat, L. Puig, G. Castella, ` Universitat Autonoma de Barcelona, BELLATERRA, BARCELONA, Spain Objective: Malassezia pachydermatis is a zoophilic yeast frequently isolated from the skin of wild and domestic carnivores. Unlike the rest of Malassezia species, M. pachydermatis is described as a non-lipid dependent yeast, as it is able to grow on Sabouraud glucose agar (SGA) without lipid supplementation. All other Malassezia species require lipid supplementation for growth in SGA, and are named lipid-dependent species. In this study we have examined three atypical lipid-dependent M. pachydermatis strains and confirmed their identity by DNA sequencing. Methods: Morphological characteristics were observed after 7 days of incubation at 32◦ C on mDA. Physiological characterization was based on the splitting of esculin due to β-glucosidase activity, catalase reaction and growth at 37◦ C, 40◦ C, 42◦ C and ◦ 45 C on mDA. The ability to assimilate Tween 20, Tween 40, Tween 60, Tween 80 and Cremophor EL was tested with the Tween diffusion test on SGA and yeast nitrogen base agar (YNBA). Internal transcribed spacer (ITS) region (including the genes ITS1, 5.8S rRNA and ITS2), large subunit of the ribosomal RNA (LSU) region, chitin synthase 2 (CHS2) and β-tubulin genes were amplified and sequenced. Results: The strains were not able to grow both on YNBA supplemented with peptone and glucose, and on YNBA with peptone only, at 32◦ C. These strains were able to grow on mDA at 37◦ C and 40◦ C, but failed to grow at 42◦ C. They showed β-glucosidase activity, and the catalase reaction was positive. In the Tween diffusion test performed on SGA, the strains were not able to grow on the entire surface of the agar. On this medium and on YNBA, growth was only observed around the lipid supplements. Sequencing of the ITS and LSU rRNA regions, β-tubulin and CHS2 genes confirmed that the three lipid-dependent strains belonged to the species M. pachydermatis. Conclusion: While most M. pachydermatis isolates are able to grow on SGA, we have isolated and characterized three three atypical lipid-dependent M. pachydermatis strains. The identity of these lipid-dependent strains was confirmed by DNA sequencing. In the phylogenetic tree of the LSU sequences, these strains were grouped and interspersed with other non-lipid dependent M. pachydermatis strains. The finding of these unusual lipid-dependent strains exemplifies the large variability within the species M. pachydermatis, which involves rare atypical strains with particular growth requirements.

P439 In Vitro Activity of Luliconazole, Lanoconazole, and Efinaconazole Compared with Five Antifungal Drugs Against Melanized Fungi and Relatives G. R. Shokoohi1 , H. Mirhendi2 , H. Badali3 , S. Ansari4 , A. Rezaei-Matehkolaei5 , B. Ahmadi6 , A. Vaezi3 , M.M. Alshahni7 , K. Makimura7 1 Jahrom University of Medical Science, Jahrom, Iran, JAHROM, Iran 2 Isfahan University of Medical Sciences, Isfahan, Iran, ISFAHAN, Iran 3 Mazandaran University of Medical Sciences, Sari, Iran, SARI, Iran 4 Shahid Beheshti University of Medical Sciences, Tehran, Iran, TEHRAN, Iran 5 Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran, AHVAZ, Iran 6 Bushehr University of Medical Sciences, BUSHEHR, Iran 7 Teikyo University, Tokyo, Japan, TEIKYO, Japan Objective: Melanized fungi are a diverse group of fungi, which are commonly found on decomposing plant debris, dead plant material, rotten wood, air, and soil. The importance of melanized fungi has recently gained increased focus, owing to the significant increase in the number of patients with predisposing factors throughout the world. Treatment regimens are controversial and sometimes associated with a poor outcome when antifungal resistance is involved. New antifungal agents with better activity and lower side effects can help to improve the management of these infections. To the best of our knowledge only limited data are available on the in vitro activity of luliconazole, lanoconazole, and efinaconazole against dematiaceous fungi and relatives. Therefore, we evaluated the activity of luliconazole, lanoconazole, efinaconazole, and five comparators against dematiaceous fungi and relatives. Methods: The present study is to investigate the in vitro susceptibilities of 130 clinical and environmental isolates of melanized fungi and relatives. In vitro antifungal susceptibility testing was performed according to CLSI document M38-A2. Final concentration ranges of 0.016 to 16 μg/mL for amphotericin B, itraconazole, and voriconazol, 0.063 to 64 μg/mL for fluconazole, 0.00005 to 0.031 μg/mL for luliconazole, 0.0002 to 0.12 μg/mL for lanoconazole, 0.001 to 0.5 μg/mL for efinaconazole and terbinafine. Results: The GM MICs against all clinical black fungal strains of various genera were as follows, in increasing order: luliconazole, 0.0008 g/ml; lanoconazole, 0.0028 g/ml; efinaconazole, 0.0966 g/ml; itraconazole, 0.2383 g/ml; voriconazole,0.4313 g/ml; terbinafine, 0.4528 g/ml; amphotericin B, 1.25 g/ml; and fluconazole, 28.006 g/ml. The GM MICs of all environmental isolates were asfollows: luliconazole, 0.002 g/ml; lanoconazole, 0.009 g/ml; efinaconazole, 0.10 g/ml; voriconazole, 0.20 g/ml; itraconazole, 1.18 g/ml; amphotericin B, 2.2 g/ml; terbinafine, 0.5 g/ml; and fluconazole, 38.4 g/ml. Conclusion: Given the fact that fungal infection due to dematiaceous fungi has increased and treatment is still challenging, the selection of proper antifungal agents is therefore critical to reducing the duration of treatment and to achieve successful results. Therefore, it appears that these two new imidazoles and new triazoles are promising candidate for treatment of fungal infection due to black fungi and relatives.

P437 Malassezia furfur from birds. ˜ F.J. Cabanes, L. Puig, M.R. Bragulat, G. Castella´ ` Universitat Autonoma de Barcelona, BELLATERRA, BARCELONA, Spain Objective: Although M. furfur (sensu stricto) is a common member of the human skin microbiota, it has been also reported from the skin of various animal species. However, in several studies, some yeasts have been identified as M. furfur on the basis of phenotypic characteristics and/or using some PCR techniques, but without rDNA sequencing confirmation. In this study we have examined some M. furfur strains from birds, confirmed their identity by DNA sequencing and compared with other M. furfur strains from other origins. Methods: Morphological characteristics were observed after 7 days of incubation at 32◦ C on mDA. Physiological characterization was based on the splitting of esculin due to β-glucosidase activity, catalase reaction and growth at 37◦ C, 40◦ C and 42◦ C on mDA. The ability to assimilate Tween 20, Tween 40, Tween 60, Tween 80 and Cremophor EL was tested with the Tween diffusion test on SGA and yeast nitrogen base agar (YNBA). Internal transcribed spacer (ITS) region (including the genes ITS1, 5.8S rRNA and ITS2), large subunit of the ribosomal RNA (LSU) region, and β-tubulin genes were amplified and sequenced. Results: These strains were able to grow on mDA from 32 to 42◦ C. The catalase reaction and the β-glucosidase activity were positive. On SGA and YNBA, although some intermediate assimilation patterns were found, all the strains from birds were able to grow around the different lipids assayed. Sequencing of the ITS and LSU rRNA regions and b-tubulin genes confirmed that the lipid-dependent strains from birds belonged to the species M. furfur. In the LSU phylogenetic tree, the strains from birds appear grouped in one clade with low bootstrap support. However, the phylogenetic trees of both ITS and β-tubulin sequences of M. furfur strains analysed revealed two strongly supported clades. One clade included strains isolated from humans and domestic animals and the other clade comprised the strains from wild animals including all the strains from birds. Conclusion: The identity of the strains from birds as M. furfur was confirmed by DNA sequencing. LSU sequences differences among M. furfur strains analysed were less than 1%, not exceeding the within-species variation generally observed to occur in Malassezia. Regarding the ITS and β-tubulin gene, all the strains from birds were grouped in the same cluster and separated from strains isolated from human beings and domestic mammals.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

P440 Characterization of some virulence factors in Malassezia spp. L. Angiolella1 , V. Tedesco1 , G. Giusiano2 1 Sapienza University of Rome, ROMA, Italy 2 Universidad Nacional del Nordeste, CONICET, RESISTENCIA, Argentina Objective: The main objectives of this work was to evaluate “in vitro” the hydrophobicity levels, the adherence on a plastic surface and the biofilm formation of 51 clinical isolates of Malassezia spp. Methods: 32 M. furfur, 10 M. sympodialis, 5 M. globosa, 2 M. slooffiae, 1 M. restricta and 1 M. pachydermatis, were all clinical isolates tested. M. furfur and M. sympodialis references strains were also included. In order to examine the adherence capacity to plastic surface, the yeasts were grown for 72 h at 32◦ C in Leeming-Notman modified broth, washed twice with sterile PB and then resuspended at 37◦ C in RPMI 1640 modified for Malassezia plus 10% FBS at 7.5 × 102 cells/ml. After incubation for 3 h at 37◦ C in six-well polystyrene plates followed by extensive washing, 1 ml of Leeming-Notman Agar medium modified was poured into each well and let solidify. After incubation for 72 h at 37◦ C, colonies were counted and the results were expressed as a percentage of the inoculum size. Cellular surface hydrophobicity (CSH) levels were determined by two-phase system. The biofilm formation was determined by tetrazolium salt (XTT) reduction assay. Results: All isolates of Malassezia spp. were hydrophobic, adherent and producers of biofilm on abiotic surfaces with different capacity. In particular, hydrophobicity was variable and ranged from 24 ± 0.1% for M. pachydermatis to 69.50 ± 14.6% for M. restricta. Similar values were observed for M. furfur and M. globosa. Adherences values also display variability, with ranges between 8.4 ± 1.1% for M. pachydermatis to 85.00 ± 2.3% for M. restricta. High values of adherence were obtained for M. globosa (65.22 ± 3.5). In addition, the no lipid-dependent yeast M. pachydermatis showed low values of adherence and hydrophobicity respect to the other Malassezia species. All Malassezia spp. were able to form biofilm on surface, ranged from 0.179 ± 0.13% for M. slooffiae to 0. 574 ± 0.20% for M. furfur. Except for M. pachydermatis, similar values were reported for the other Malassezia species tested. Conclusion: Our results suggest that all clinical isolates of Malassezia spp. were hydrophobic. Since the hydrophobicity is an important factor to adherence, varying degrees of success on abiotic surface were obtained. These characteristics are also involved in the high ability to form biofilm observed in this study. These important virulence factors could be responsible of this yeast changing from a commensal to a pathogenic status. The revision of the genus Malassezia has opened up new questions about the pathogenicity of Malassezia species.

S148

Medical Mycology, 2018, Vol. 56, No. S2

P441 Effects of Pistacia Atlantica subsp. Kurdica on aflatoxin production by Aspergillus parasiticus

P444 Biosynthesis and physiochemical characterization of melanin from Fonsecaea monophora

S. Oliya1 , S. Khodavaisy2 , S. Rezaie3 1 Taamasrar Institute, TEHRAN, Iran 2 Mazandaran University of Medical Sciences, SARI, Iran 3 Tehran University of Medical Sciences, SARI, Iran

Peiying Feng, Yingdan Chen, Chun Lu Sun Yat-Sen University, Guanghzou, China

Objective: Aflatoxins are highly toxic secondary metabolites mainly produced by Aspergillus parasiticus. This species can contaminate on a wide range of agricultural commodities including cereals, peanuts and crops. In recent years researches on medicinal herb such as Pistacia atlantica subsp. kurdica lead to reduce the microbial growth and also have a particular effect on production of aflatoxins as carcinogenic compounds. In this study we to examine the P. atlantica subsp. kurdica as natural compound to inhibit the growth and anti-mycotoxin in A. Parasiticus. Methods: In vitro antifungal susceptibility testing due to the P. atlantica subsp. kurdica for Aspergillus parasiticus was performed according to CLSI document M38-A2. The rate of aflatoxin production was determined using HPLC technique after exposure to different concentrations of (62.5 mg/ml- 125 ml mg/ml) gum. The changes in expression of the aflR gene level were analyzed by use of a quantitative real-time PCR assay. Results: The P. atlantica subsp. kurdica can inhibited the mentioned A. parasiticus growth at 125 mg/ml. HPLC results revealed a significant decrease in aflatoxin production in 125 mg/ml of P. atlantica subsp. Kurdica and AFL-B1 production was entirely inhibited. Base on quantitative Real Time PCR results, the rate of aflR gene expression was significantly decreased after treating with P. atlantica subsp. kurdica. Conclusion: The P. atlantica subsp. kurdica has anti-toxic properties in addition to inhibitory effect on A. Parasiticus growth, and able to decrease aflatoxin production effectively in a dose-dependent manner. Therefore this herbal extract maybe considered as a poteintial anti-mycotoxin agent in medicine or industrial agriculture.

P442 Eumycetoma: A Peruvian case series B. Bustamante1 , J. Oyarce2 , P.E. Campos3 1 Instituto de Medicina Tropical Alexander von Humboldt, UPCH, LIMA, Peru 2 Servicio de Infectolog´ıa, Departamento de Medicina, Hospital III EsSalud, IQUITOS, Peru 3 ´ Investigaciones Medicas en Salud, LIMA, Peru Objective: To report the epidemiological and clinical characteristics of eumycetoma patients diagnosed in a referral tertiary hospital of Lima-Peru. Methods: All patients with a diagnosis of eumycetoma evaluated at the Cayetano Heredia Hospital between 2000 and 2017 were included. Diagnosis of eumycetoma required demonstration of grains at clinical or histopathological examination. Epidemiological and clinical data was extracted from clinical and mycology laboratory records. The isolates were identified on the basis of cultural and morphological characteristics. Results: Nineteen eumycetoma patients were diagnosed between 2000 and 2017, mostly males (n = 15, 79%), with a median age of 37 yo (range: 6 - 65) at the time of diagnosis. The median duration of disease was 65 months (range: 5 - 504), and eleven out of 14 patients (78.6%) reported history of agricultural activity until the onset of the disease. Most patients (13 out of 19) were residents of two regions, Piura (8) and Lambayeque (5), which are two neighboring regions located in northern Peru, and characterized by being arid and sandy areas with an average annual temperature of 23◦ C and presence of carob trees. Lesions were located on the foot in 17 patients, on the leg in one patient and on the hand in another patient. All patients but two (89.5%) had the classic clinical triad (tumor, sinus tracts, and macroscopic grains). Ten out of 15 patients (66.6%) with imaging evaluation presented bone lesions. Among 17 patients with presence of macroscopic grains, 12 (70.6%) were black and 5 were white-yellowish grains. In the other two patients, the presence of grains was only evidenced in the histopathology. Ten of the 12 patients (83.3%) with black grain eumycetoma acquired the disease in the regions of Lambayeque and Piura. The etiological agent was isolated in 12 patients; Madurella mycetomatis in eight, Fusarium spp in two, Scedosporium apiospermum specie complex in one, and Phaeoacremonium sphinctrophorum in another patient. The identification of two isolates, one M. mycetomatis and the P. sphinctrophorum strain, were confirmed by DNA sequencing. Most patients received itraconazole for treatment. Conclusion: In Peru, eumycetoma patients are diagnosed lately, when disease has already reached an advanced stage. Limited data suggest that eumycetoma acquisition in Peru occurs mainly in arid and sandy areas of northern regions.

P443 Validation of ITS from GenBank database in diagnosing medically important black yeasts and relatives species of Herpotrichiellaceae Kittipan Samerpitak1 , A.H.G Gerrits Van Den Ende2 , Sybren G. DE Hoog2 1 Faculty of Medicine, Khon Kaen University, KHON KAEN, Thailand 2 Westerdijk Fungal Biodiversity Institute, UTRECHT, Netherlands Objective: To investigate the use of ITS from GenBank database and NCBI blast searching in diagnosing black yeast and relatives species of Herpotrichiellaceae. Methods: Three hundred and fifty six ITS sequences(ITS1-5.8S-ITS2) of 115 medically important and saprophytic black yeast and relatives species in family Herpotrichiellaceae viz. Cladophialophora(33 species), Exophiala(40 species), Fonsecaea(9 species), Phialophora(23 species)and Rhinocladiella(10 species) were collected from GenBank database. The criteria for collecting sequences were legitimate names according to Mycobank deposition and type or the reference strains. Phylogenetic analysis using neighbor joining with K2+G model was performed to investigate the strength of the species clusters. Each of type/reference sequences was tested by megablast searching of NCBI in order to observe its precision and accuracy in identification. Results: Using neighbor joining analysis, 90.43% of investigated species (104/115 species) were boundaries were well defined with high supports. Eleven species-boundaries revealed ambiguously, six of them, the members mixed with another species in the same cluster viz. C. devriesii & F. brasiliensis, F. compacta & F. pedrosi, P. chinensis & P. verrucosa, whereas the members of P. mustea, P. calyciformis and P. brunnescens were clustered together. True taxonomic positions of two species, P. intermedia and P. phaeophora, could not be indicated because each species members showed two different positions in the analysis. Testing ITS sequences with NCBI megablast searching showed that 94.78% of species (109/115 species) were 94%-100% identity with maximum scores and specific to their own types or reference species. ITS sequences of six species were cross to be specific to another type species viz. C. devriesii & F. brasiliensis, F. compacta & F. pedrosi, P. chinensis & P. verrucosa, concordant to the results from neighbor joining analysis as previously described. Moreover, P. mustea, P. calyciformis and P. brunnescens were also 99–100% identity to Pleurostoma richardsiae, the ex-member of Phialophora which is now classified into Calosphaeriaceae. Conclusion: ITS sequence (ITS1-5.8-ITS2) might be unsuitable marker for higher taxa classification, but well distinguished to delimit species of black yeasts and relatives in Herpotrichiellaceae. It could be used as a tool to identify most species (94.78% of investigated species) and highly specific to type and reference strains without cross-specific to other species (94-100% identity). Cross-specific identity might reflect ambiguous classification of those taxa, revision of them might have to be considered. However, most medical pathogen, especially, the hazardous causative agents of CNS infection viz. C. bantiana, E. dermatitidis, R. mackenziei, can be specifically identified by ITS with megablast searching (96-100% identity). Therefore, GenBank database and NCBI blast searching are reliable and standardized enough to use for correct identification of black yeasts and relatives in Herpotrichiellaceae, and validation of ITS for identifying black yeasts and relatives in other families deposited in the GenBank database should be further performed.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Objective: To study the melanin physiochemical characterization and melanin synthesis pathway of Fonsecaea monophora. Methods: Pure melanin mass was extracted from the F. monophora isolate using the cell wall crude extract method. Then we used Ultravolet (Uv), Fourier transformed infrared (FT-IR) and electron paramagnetic resonance (EPR) spectra assay to evaluate the physiochemical characterization of melanin. Furthermore, we observed the pigment production of the colonies on different mediums (PDA, PDA with L-DOPA, PDA with DOPA-melanin inhibitors and PDA with DHN-melanin inhibitors), and the quantity of melanin produced on different above media were measured using BioTek Eon microplate reader. Results: The melanin extracted from F. monophora shared similar physiochemical and spectroscopic properties with the synthetic L-DOPA melanin. The formation of melanin pigment statistically significant increased on the L-DOPA medium, and decreased on the DOPA-melanin inhibitor medium (sodium azide) and DHN-melanin inhibitors medium (phthalide and tricyclazole) compare to those on PDA medium. Conclusion: The melanin produced by F. monophora is mainly DOPA melanin, and it may synthesize simultaneously by DOPA-melanin and DHN-melanin pathway.

P445 Updates and comparative analysis of the mitochondrial genome of Paracoccidioides brasiliensis (Pb18) and Paracoccidioides americana (Pb03) using Oxford-Nanopore MinION sequencing ˜ 3 , Juan E. Gallo4 , Juan G. McEwen2 , Oliver K. Clay5 Elizabeth Misas1 , Oscar M. Gomez2 , Jose F. Munoz 1 ´ para Investigaciones Biologicas, ´ Corporacion Medellin, Colombia 2 Universidad de Antioquia, Medell´IN, Colombia 3 Broad Institute of MIT and Harvard, Cambridge, USA 4 Universidad CES, Medell´IN, Colombia 5 Universidad del Rosario, Medell´IN, Colombia Objective: The mitochondria have a fundamental role in controlling the cellular networks impacted by antifungal drugs, as well as a prominent role in fungal virulence. Specific mitochondrial mutations lead to either sensitivity or resistance to antifungal drugs. Paracoccidioides spp. is the etiologic agent of paracoccidioidomycosis (PCM), a clinically important fungal disease endemic in Latin America. In the genus Paracoccidioides 5 species have been described. This work includes two of them, P. brasiliensis (S1) and P. americana (PS2), that could be used as references to optimize the assemblies of the three remaining species. The available draft mitochondrial genome assemblies for Paracoccidioides spp. present significant differences in length and gene content. This work aims to optimize the currently available draft mtDNA genome assemblies for the reference strains of P. brasiliensis Pb18 and P. americana Pb03, using Oxford Nanopore long-read sequencing in order to construct de novo assemblies and Illumina HiSeq2000-2500 short-read sequencing to achieve high base-level accuracy. Methods: The reference strains of P. brasiliensis Pb18 and P. americana Pb03 were re-sequenced using MinION Oxford Nanopore and Illumina HiSeq2000. For each strain, the complete genome was assembled de novo using Canu v-1.5, subsequently the contig corresponding to the mitochondrial sequence was identified. It was separated from the rest of the assembly and used as a reference to map the Illumina reads with BWA v-0.6.1. Finally the sequence was corrected using Pilon v-1.6. The annotations of the improved mitochondrial assemblies for Pb03 and Pb18 were then corrected using a homology inference approach. Results: For Pb18 we obtained 36126 reads with an average size of 2.6 kb and for Pb03 we obtained 71528 reads with an average size of 3.1 kb using MinION. The Illumina HiSeq2000 paired-end read sequencing produced 46.8 million read pairs with a length of 101 bp for the Pb18 strain, and 62 million 101 bp read pairs for the Pb03 strain. The Canu assembler allowed the construction of a single contig corresponding to the whole mitochondrial genome of the strains Pb18 and Pb03, although in both cases a contig of longer than expected length was recovered. The reference assembly using BWA and the Illumina reads showed an average coverage of 9770X for Pb18 and 6963X for Pb03. The Pilon program corrected 336 errors in the sequence of Pb18 and 981 errors in Pb03, which included single nucleotide errors and small indels. Conclusion: This work contributes to the development of several strategies for obtaining reliable assemblies of mtDNA genomes for which no close reference sequence is available, without the need for physical nuclear DNA vs mtDNA separation or mtDNA enrichment prior to the sequencing. Also the updated mtDNA genomes should enable more accurate SNP and other comparative or evolutionary analyses. Colciencias grant 221365842971, Sostenibilidad UdeA 2017–2018 and Programa Beca Doctorado Nacional convocatoria-647 supported this work.

P446 The Intestinal Mycobiota of Nero Siciliano Pig L. Giuffre’, I Sapienza, G Criseo, O Romeo, E D’Alessandro University of Messina, MESSINA, Italy Objective: The Pig’s gut microbiota represents one of the most important and complex microbial community in nature involved in numerous physiological processes of the host such as the development of the gastrointestinal system, uptake of feeding, release of active metabolites, stimulation and modulation of the immunity system. Although in the last years a lot of studies involving the characterization of the pig’s intestinal microbiota have been conducted, most of them have only focused on bacterial community, and very little is currently known about the composition of the fungal population or “mycobiota”. Nero Siciliano is an autochthonous pig breed reared in the internal areas of Sicily island (Italy), specifically in Madonie’s Park and Nebrodi’s Park. This breed shows wild phenotypic traits that differ from other commercial varieties bred in an intensive way. Here we report the first characterization of the intestinal mycobiota of Nero Siciliano pig by using a culture-dependent approach and DNA sequencing. Methods: A total of 21 pigs, from a swine farm in Messina, were sampled using rectal swabs. The fungi were isolated by streaking the rectal swabs on Sabouraud (SDA) and Potato (PDA) Dextrose Agar plates respectively. The fungal colonies were initially identified using conventional morphological and physiological tests and subsequently their identity was confirmed by standard Sanger sequencing of the ITS1-5,8S-ITS2 region of the rDNA. Results: A total of 48 fungal strains were obtained from all examined fecal specimens. Molecular data showed that at least 8 different fungal genera colonized the gut of our pigs and Wickerhamomyces anomalus and Geotrichum candidum (10/48; 21% each) were the most isolated species followed by Diutina catenulata (8/48; ∼17%), Clavispora lusitaniae (7/48; ∼15%), Trichosporon asahii (5/48; ∼10%), Pichia kudriavzevii (2/48; ∼4%), Rhodotorula mucillaginosa (2/48; ∼4%), and other species (4/48; ∼8%). Conclusion: The data reported in this study showed that the intestinal gut of Nero Siciliano pig is colonized by the fungal species W. anomalus, G. candidum, D. cutenulata, R. mucillaginosa and T. asahii, which were already previously reported as basic components of the pig’s mycobiota in other studies. Interestingly, our study shows that Nero Siciliano pig is also colonized by C. lusitaniae and P. kudriavzevii, two species with high pathogenic potential for humans. The differences between the mycobiota of the Nero Siciliano pig and that of other breeds could be related to several reasons such as genetic factors, kind of feeding and to the different breeding methods. However, whole-metagenome shotgun analyses are in progress in our lab in order to elucidate the complex structure of Nero Siciliano pig intestinal microbiota and its possible effects on the well-being of this animal.

ABSTRACT

P447 Abundance of Aspergillus fumigatus in conventional and organic farming systems Jennifer Born1 , Amelia E. Barber2 , Sandra Suske1 , Oliver Kurzai3 , Holger B. Deising1 1 Martin-Luther-University Halle-Wittenberg, Halle, Germany 2 Leibniz Institute of Natural Product Research and Infection Biology - HKI, Jena, Germany 3 ¨ ¨ University of Wurzburg, WURZBURG, Germany Objective: Aspergillus fumigatus is a ubiquitous saprophytic fungus, whose ecological niche is the soil and decaying vegetation. It can cause a wide variety of diseases in humans, ranging from allergic syndromes to invasive aspergillosis in immunosuppressed patients. In recent years, the incidence of azole resistance has increased worldwide and resistant infections are strongly associated with treatment failure. Structural similarities in medical and agricultural azoles and the intensive use of azoles in crop protection raised the idea that azole resistance in patients with aspergillosis originates from agricultural environments. Therefore, we are interested in the abundance of asexual spores produced by A. fumigatus in agricultural environments and their azole resistance, depending on agricultural management types, to assess the risk of infection. Methods: Soil samples were collected from 10 agricultural sites in the German federal states of Thuringia, Saxony and SaxonyAnhalt and the abundance of spores on agricultural sites under organic and conventional farming was compared. Conventional sites were evaluated both pre and post the azole application. Additionally, we collected soil samples monthly on one conventional- and one organic-cultivated site during the growing season and isolated A. fumigatus strains from different soil depths of 0 to 30 cm. Results: Analysis of 1000 soil samples yielded 1530 novel Aspergillus fumigatus isolates. We did not detect significant differences in the abundance of spores produced on conventional and organic fields, but found significant differences between preand post-azole application. While the abundance of spores in conventionally managed crops decreased significantly during the vegetation phase due to fungicide application, it remained constant in organic fields over the period investigated. The spore density was significantly reduced below 15 cm soil depth. Conclusion: Our data show that fungicide application is a major determinant in the abundance of A. fumigatus spores in agricultural environments and indicate a lack of competitiveness of A. fumigatus spores in deeper soil layers which is of great interest for agricultural practice. Resistance testing of collected A. fumigatus isolates to medical and agricultural azoles as well as the comparison of resistance rates present in different agricultural farming systems is currently in progress.

P448 Synthesis of surface-modified superparamagnetic nanoparticles by PEG-400 to embedding Ag and Au nanoparticles as antifungal agents K. Zomorodian1 , H. Veisi2 , S. Yazdanpanah1 1 Shiraz University of Medical Sciences, SHIRAZ, Iran 2 Shiraz University of Medical sSciences, SHIRAZ, Iran Objective: Intelligent drugs such as those controlled by magnetic forces could open a new horizon to overcome drug resistance. It has been shown previously that Ag and Au nanoparticles have considerable antimicrobial activities. Hence, combination of these nano particles with Iron molecule could help one to guidethe molecule to the infected area. In present study, we carried out chemical synthesis and characterization a Fe3O4@PEG-Ag and Fe3O4@PEG-Au nanocomposites which prepared as a core/shell nanostructures. Moreover, antifungal activities of these molecules against some pathogenic fungi were determined. Methods: Fe3O4 nanoparticles were synthesized by co-precipitation of bi/trivalent iron ions. so poly ethylene glycol (PEG) added as a shell on the surfaces of nanoparticles. Finally, Ag and Au ions reduced on the nanoparticles to synthesis Fe3O4@PEGAg and Fe3o4@PEG-Au, respectively. Nanostructures were characterized with FT-IR, FESEM-EDS, VSM, TEM and AFM. The compounds were evaluated for their antifungal activity against A.fumigatus, A.clavatus and A.flavus and Candida species based on M27-A3 and M38-A protocols as recommended by CLSI. Results: Newly synthesized compounds exhibited good antifungal activity, as they could inhibit the growth of the tested fungi at concentration of 16–64 μg/mL. Ag particles showed better activity than Au particles. Conclusion: Concentration of these nano particles could be increased by magnetic force. Therefore, these novel compounds with antifungal properties might be used for treatment of localized infection and invasive aspergillosis and candidiasis in specific location or tissue by magnetic fields. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 421038 e24a9205-659d-4458-a295-c426 b3c8e3d2.png

P449 Investigating the role of C-type lectin receptors in pneumocystis Murina P. A. Otieno-Odhiambo1 , S.P. Parihar1 , N.F. Mthembu1 , R. Keeton1 , F. Brombacher1 , J. Kolls2 , G.D. Brown3 , J.C. Hoving1 1 Institute of Infectious Diseases and Molecular Medicine, University of Cape Town, CAPE TOWN, South Africa 2 Center for Translational Research in Infection and Inflammation., TULANE SCHOOL OF MEDICINE, NEW ORLEANS, USA 3 Aberdeen Fungal Group, Institute of Medical Sciences, University of Aberdeen, ABERDEEN, United Kingdom Objective: To investigate the role of the CLR Clecsf8 (Clec4d, Mcl, Dectin 3) and the associated downstream signalling molecule protein kinase c delta (Pkcδ) in host response to Pneumocystis murina and to confirm that of Dectin-1 in our setting. Methods: Using our established Pneumocystis murina mouse model and mice deficient in CLRs including Dectin-1, Clecsf8 (Clec4d, Mcl, Dectin 3) or the Pkcδ that engages SYK coupled CLRs, we hope to dissect the innate immune response in Pneumocystis murina infection. Results: Our preliminary data suggests the involvement of Pkcδ in Pneumocystis murina recognition as Pkcδ −/− mice shows significant higher lung burden compared to the wild type. In the presence of an intact acquired immune system, Dectin-1 seems to play no role in Pneumocystis murina infection as Dectin-1-deficient mice show no difference in their lung burdens compared to wildtype mice. For Clecsf8, though the lung burdens are significantly higher in the presence of an acquired immune system, Clecsf8-deficient mice eventually clear the infection by day 21 comparable to wildtype mice. Conclusion: Our data suggest that CLRs utilising Pkcδ are involved in Pneumocystis recognition and clearance. Although Clecsf8 seems to play a redundant role in clearing Pneumocystis in immunocompetent mice, we will determine if depleting CD4+ T cells in mice lacking Clecsf8 drives disease susceptibility, as previously demonstrated with Mincle and Dectin-1. We aim to discover new insights into the underlying host mechanisms involved in protective immunity to Pneumocystis which may lead to improved treatments for immunocompromised hosts.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

S149

P450 The impact of spore surface attributes of Lichtheimia corymbifera during infection to human cells D. E. Montano1 , V.U. Schwartze1 , M. Abdelwahab Hassan2 , K. Voigt3 , H.M Dahse2 ¨ Jena, JENA, Germany Friedrich Schiller Universitat Leibniz-Institute for Natural Product Research and Infection Biology, JENA, Germany 3 ¨ Naturstoff-Forschung und Infektionsbiologie HKI, JENA, Germany Leibniz-Institut fur 1

2

Objective: Lichtheimia corymbifera is a causative agent of mucormycosis, a life-threatening infection caused by members of the fungal order Mucorales. Mucormycosis infection is associated with a high mortality due to its rapid destruction of tissue, difficult early-diagnosis, and resistance to various antifungal agents, which reduces therapeutic options. A previous study reported the full genome sequences of L. corymbifera, providing a molecular basis to understand its pathogenicity-associated features. Moreover, studies in our group predict genes encoding proteins involved in host-pathogen interactions. Spore cell-wall proteins and pigments are known to play an important role in other fungal pathogens like A. fumigatus when interacting with the host. However, little is known about the contribution of spore surface proteins and pigments of L. corymbifera when initiating the infection of host cells. Therefore, we will study the role of candidate spore surface proteins and pigments in adhesion, invasion, and damage to endothelial, epithelial, and alveolar macrophage cells, which represent the first line of defense during pulmonary infections. Methods: To determine the most relevant players during the initiation of infection, we plan to use in vitro infection models, confocal laser scanning microscopy and flow cytometric analysis. In addition, we will employ a yeast surface display and generate specific antibodies that will mask the candidate surface proteins. In a final step, we will confirm the role of these proteins by silencing the genes involved in initial host-pathogen interactions. Results: With all these strategies, we expect to determinate mechanisms developed by L. corymbifera that challenge pulmonary epithelial and endothelial cells, the primary custodians of the lung. Furthermore, we will uncover specific ligand-receptor interactions involved in the invasion of the host cells, as well as, strategies established by this pathogen to avoid the host immune response and survive inside the cells, such as in macrophages. Conclusion: As a long-term, our findings will provide new insights to develop novel diagnostics and treatments to counteract infections caused by L. corymbifera.

P451 Geographical and ethnic differences in Malassezia species distribution on healthy skin C. Leong, J. Goh, A. Irudayaswamy, T. Dawson Institute of Medical Biology, SINGAPORE, Singapore Objective: Malassezia spp. are lipid dependent yeasts which live as skin commensals. They have been implicated in skin conditions such as pityriasis versicolour and atopic dermatitis and can cause serious opportunistic infection in immunocompromised individuals. Of the nine species found on human hosts, five species (M. sympodialis, M. slooffiae, M. furfur, M. globosa, M. restricta) have been regularly isolated at varying frequencies. The factors accounting for these species distribution differences are unknown and could be due to differences in culture method, climate or other factors. Ethnic skin types vary in lipid content, hydration levels and skin barrier function which may affect the local skin mycobiome. In this study, we aimed to determine if skin ethnicity affects the species of Malassezia colonizing the skin of healthy individuals and if this may account for different species distributions observed worldwide. Methods: Malassezia spp. were sampled from the skin of 40 healthy volunteers from 4 different ethnic backgrounds (Chinese, Malay, Indian and Caucasian) with equal gender distribution living in Singapore. This involved swabbing of the nasal sidewall with a saline wetted swab and culture on modified Leeming-Notman agar for 7 days at 32◦ C. Species identification of individual colonies was performed using molecular typing methods and ITS sequencing. Results: The average healthy individual in our Singapore cohort had 2–3 species of Malassezia. M. sympodialis, M. dermatis, M. furfur, M. globosa and M. restricta were the most frequently cultured species respectively. Differences were observed in Malassezia species distribution when stratified by skin ethnicity, with each ethnic group being colonized by specific groups of Malassezia. The species composition within each ethnic group was similar between males and females. Conclusion: Variations in Malassezia species distribution on healthy skin were observed among different ethnic groups in Singapore. This suggests that skin ethnicity is a key underlying factor in the composition of the skin mycobiome, possible due to differential expression of lipid in different ethnic skin types. It is likely that Malassezia studies around the world reflect a species distribution representative of the ethnic background of their local populations. Characterizing the healthy skin mycobiome composition will be useful in defining the role of Malassezia in health and disease. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 421515 4e3f9f5b-6fe6-4e14-9f4c-9622 fe88019c.png

P452 Real World Evidence on the Burden of Illness Experienced by HIV Patients with Systemic Mycoses Rhonda Schreiber1 , Anna Forsythe2 , Jaclyn Hearnden2 , Gareth Lewis1 1 Mayne Pharma, RALEIGH, USA 2 Purple Squirrel Economics, NEW YORK, USA Objective: As systemic mycoses are commonly opportunistic infections and immunocompromised patients are disproportionately affected, we investigated the burden of illness experienced by HIV-positive patients with systemic mycoses. Methods: Electronic medical records from over 34 million patients in 30 US hospital institutions were queried and patients with mycoses including aspergillosis, histoplasmosis, and blastomycosis were identified via ICD-10 codes. Three mutually exclusive cohorts were established consisting of 1. Systemic mycoses patients who had neither HIV nor another form of immunosuppression (immunosuppressant treatment, transplants, cancers), 2. HIV-positive patients with systemic mycoses, or 3. HIV-positive patients without systemic mycoses. Proportions of patients experiencing constitutional symptoms were evaluated. The rate of symptoms was accounted during six months from initial treatment with antifungal medications for cohorts 1 and 2 or initial HIV diagnosis for cohort 3. The proportion of patients in each cohort who experienced each symptom was determined and two comparisons were performed using two-tailed t-tests (95% percent confidence limits): Cohort 1 versus Cohort 2; and Cohort 2 versus Cohort 3. Results: A search conducted on 26 October 2017 spanning five years identified 11,619 patients with systemic mycoses who were treated with antifungals. Of these patients, Cohort 1 (N = 2370) and Cohort 2 (N = 532) were established. Systemic mycoses patients with and without HIV-positive status had similar mean ages (HIV+: 50 vs. No HIV: 52) but dissimilar proportions of white (HIV+:44% vs. No HIV: 65%) and male (HIV+: 79% vs. No HIV: 51%) patients. Cohort 3 (N = 91275) included HIVpositive patients without systemic mycoses. The rates of constitutional symptoms experienced by HIV-positive patients with systemic mycoses were significantly greater than those experienced by systemic mycoses patients not diagnosed with HIV (>260% increase, P 180%, P 80% similarity co-efficient) showing less genetic diversity within each FAFLP type. Type-II clustered strains were isolated from the scalp of SD/D patients (P < 0.05). M. arunalokei isolates were clustered into two FAFLP types (P = 0.05). All FAFLP type-I isolates (n = 10,71%) were from the scalp of moderate and severe SD/D patients, whereas all type-II isolates (n = 4,29%) were from nasolabial folds of either SD/D patients or healthy controls. All 11 FAFLP types of M. globosa formed very loose structured cluster showing high genetic diversity in intra and inter-FAFLP types. Majority of the isolates (n = 63,74%) clustered to form FAFLP type-II, followed by type X (n = 5,6%), type-I (n = 4,5%), type-III (n = 3,3.5%), type-IV (n = 3,3.5%), type-V (n = 2,2%), type-VIII (n = 2,2%) and type-VI, VII, IX, XI (n = 1,1% each). No geographic specific isolate clustering was observed in FAFLP. Conclusion: M. restricta FAFLP type-II and M. arunalokei FAFLP type-I strains were exclusively isolated from the scalp of moderate to severe form of SD/D. However, no such severity specific clustering was observed in M. globosa. The results strongly suggest the role of particular genotypes of M. restricta and M. arunalokei in causation of SD/D.

S152

P463 Comparison of Bloodstream and Vaginal Candida albicans isolates: Susceptibility to Antifungal Drugs and Pathogenicity in an Experimental Infection M. Mandelblat, Y. Yunik, M. Frenkel, E. Segal Tel Aviv University, TEL AVIV, Israel Objective: As part of ongoing research on comparison of bloodstream (S) and vaginal (M) Candida albicans isolates in reference to various phenotypic and genotypic characteristics the aims of the present research are: Assessment of susceptibility of the albicans strains to relevant antifungtals: Amphotericin B (AMB) and Nystatin (NYT) and to an experimental formulation of these drugs – Amphotericin B-Intralipid (AMB-IL) and Nystatin-Intralipid (NYT-IL). Assessment of pathogenicity of the albicans S and M strains in an in vivo model of murine vaginal infection. Methods: Strains: Twenty strains ofalbicans from patients with candidemia (S-strains) and 20 strains from women with vaginitis (M-strains). Control strain C.albicans CBS 562 Antifungals and Susceptibility Testing: Amphotericin B (AMB) (Fungizone), AMB- Intralipid (AMB-IL), Nystatin (NYT) and NYT-Intralipid (NYT-IL). AMB-IL and NYT-IL were prepared under vigorous agitation for 18 h, resulting in a homogenous suspension with most of the AMB/NYT associated with the lipid phase, for at least 1 month at 4◦ C. The microbroth assay in 96 well microplates using RPMI medium was used for susceptibility testing. Susceptibility was evaluated using spectral readings in an EMax+ Microplate Reader at 560 nm and 650 nm, for the standard and experimental formulations, respectively. Experimental Vaginitis: was induced in female ICR mice pretreated with estradiol benzoate to elicit a constant estrus state and then inoculated intra-vaginally with the albicans S and M strains. Infection was followed- up to 30 days, assessing infection by enumeration of Candida colony forming units (CFU) in vaginal exudate and by histopathology. Results: Susceptibility to Antifungals: The data of these assays indicated that the AMB-IL and NYT-IL formulations were more active than AMB and NYT, resulting in lower minimal inhibitory concentration (MIC) and minimal fungicidal concentration (MFC) values (see Figure 1). It was also found that the S strains had higher MIC and MFC values than the M strains, (see Figure 1 and Figure 2). Pathogenicity in murine vaginal infection: Comparison of S and M strains as groups did not reveal a significant difference. In both groups there were strains with higher pathogenic potential, such as Strain S14 and M33. These strains showed the same pattern in an experimental murine systemic infection. Conclusion: The data of this study do not point to a significant difference in virulence between the mucosal and bloodstream strains as groups. However, it suggests that the blood strains may possibly be less sensitive to treatment. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 412365 547e06ff-7654-4b4a-a469-b08c 11fadc06.jpg Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 412365 547e06ff-7654-4b4a-a469-b08c 11fadc06.jpg Caption 2: Figure 1,Figure 2

P464 Comparison of virulence profile of C. albicans and C. tropicalis isolated from patients with Candida infection and hospital environment V. Hallur, A. Mahapatra, B. Deb, S. Tripathy, S. Misra, A. Praharaj All India Institute of Medical Sciences Bhubaneswar, BHUBANESWAR, India Objective: To isolate C. albicans & C. tropicalis from hospital environment and clinical samples.To determine biofilm, phospholipase and protease production of clinical and environmental isolates of C. albicans & C. tropicalis.To compare the virulence profile of clinical and environmental C. albicans & C. tropicalis isolates. Methods: Yeasts were isolated from high touch surfaces in the hospital (medical & surgical intensive care units, operation theatre, casualty) by swabbing sterile swabs soaked in antibiotics solution and inoculating them into brain heart infusion broth with chloramphenicol, followed by incubation at 37’ for 5 days. Turbid broths were then sub cultured onto CHROM agar and Candida identified as per standard microbiological protocol. Clinically significant yeasts submitted to diagnostic laboratory for routine culture and sensitivity during the study period were also included in this study. Ten each of C. albicans & C. tropicalis from hospital environment and clinical infection were subjected to assays for biofilm formation, phospholipase, and proteinase production. Assays were performed in triplicate. For detecting biofilm production active cultures were inoculated to 96-well plate and the wells were rinsed with phosphate buffered saline (PBS). Following incubation, the wells were rinsed with PBS, stained with 0.4% crystal violet and air dried. Wells were then rinsed with distilled water and the stain extracted using 95% ethanol. Absorbance of the extracted crystal violet was measured at 595 nm. For detecting the proteinase and phospholipase production 48 hours old cultures were adjusted to 106 cells and 10 μl of this was seeded to milk agar & egg yolk agar. Test was interpreted using proteinase and phospholipase index. Results: Fifty-three Candida (26.5%,53/200) were isolated from 200 environmental samples and 43 clinically significant isolates were obtained from urine (34) and blood samples (9) during the study period. Non-albicans Candida spp. (NAC) predominated (81.1%) among environmental isolates; C. tropicalis (24.52%), and C. lusitaniae (24.52%) followed by C. albicans (18.9%), C. parapsilosis (15.1%), C. krusei (11.3%), C. guilliermondii (5.7%). NAC also predominated (55.8%) in clinical isolates; C. albicans (44.2%) followed by C. tropicalis (39.5%), C. parapsilosis (11.6%), C. krusei (4.7%). All isolates produced biofilm. Mean A595 for clinical and environment C. albicans isolates was 0.138±0.06 and 0.128±0.08. Environmental and clinical C. tropicalis isolates had A595 of 0.147±0.08 & 0.160±0.02. All clinical & 70% of environmental C. albicans, & 20% clinical & 60% of environmental C. tropicalis produced phospholipase. No environmental & 40% of clinical C. albicans, & 10% of the environmental & 40% of clinical C. tropicalis produced proteinase. No statistically significant difference in biofilm, phospholipase and proteinase production was observed between environmental & clinical isolates of C. albicans & C. tropicalis except more clinical C. albicans isolates (40%) produced protease(P = 0.09). Conclusion: No statistically significant difference in biofilm, phospholipase and proteinase production was observed between environmental & clinical isolates ofC. albicans &C. tropicalis except more clinicalC. albicans isolates (40%) produced protease(P = 0.09). Low sample size was the biggest limitation of the study and the findings need to be confirmed using more isolates.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Medical Mycology, 2018, Vol. 56, No. S2

P465 Mardy: Mycology Antifungal Resistance Database A. Nash1 , T. Sewell2 , R.A. Farrer3 , A. Abdolrasouli2 , J.M.G. Shelton2 , M.C. Fisher2 , J.L. Rhodes2 1 University of Oxford, OXFORD, United Kingdom 2 Imperial College London, LONDON, United Kingdom 3 Broad Institute of MIT and Harvard, CAMBRIDGE, USA Objective: The increase of antifungal drug resistance is a major global human health concern and threatens agriculture and environmental biodiversity; in order to tackle these concerns, it is crucial to understand the mechanisms behind antifungal resistance. The curated Mycology Antifungal Resistance Database (MARDy) is a web-service of antifungal drug resistance mechanisms, including amino acid substitutions, tandem repeat sequences and genome ploidy. Methods: MARDy is implemented on a Linux, Apache, MySQL and PHP web development platform and includes a local installation of BLASTn of the database of curated genes. MARDy is curated by members of the Fisher Group at Imperial College London, however, fungal community members can contribute to MARDy via the Contribute page. Given sufficient reference information, an update will take two to three days. We developed a stand-alone Java DB manager to mitigate the need for sophisticated MySQL DB management experience across the team and to provide a safe and consistent means of adding data. Results: There are over 33 genes, 26 organisms, and 26 drugs, in the database to date. This yields over 216 amino acid substitution mechanisms, 3 tandem repeats and 2 ploidy variations as of January 2018. The team continues to submit mechanisms to the database on a weekly basis, results of which can be searched using the simple search tool. Conclusion: For open access, non-commercial use MARDy can be accessed at http://www.mardy.net. Missing or new mycological antifungal resistance data can be relayed to the development team through a contribute entry form. Updates and news will be publicised via a dedicated Twitter feed: @MARDYfungi. MARDy has the potential to become an invaluable tool for clinicians and researchers. We will continue to survey the literature using automated RSS feeds. On discovery of a new resistance mechanism, our in-house Java DB management tool enables any member of the team to update the database with no experience in database management or website development necessary. This quick, transparent and seamless process ensures MARDy remains updated and prevents the website from becoming outdated and obsolete. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 415629 6db23baa-08be-422d-81f9-704 da72b14c7.png Caption 1: The web portal provides search capability of gene names, species and drug name.,

P466 Metagenomic analysis as a support to clinical diagnosis of onychomycosis M.L. Guglielminetti, G. Lupo, A.M. Picco, C. Lombardo, E. Capelli University of Pavia, PAVIA, Italy Objective: Onychomycosis can be caused by yeasts and by dermatophytic and nondermatophytic moulds. These fungi lead to the gradual destruction of the nail plate. Antifungal therapies, both oral and topical, take a long time with very often disappointing results due to the lack both of accurate diagnosis and tests for sensitivity to antifungal drugs before therapy. Thus dermatologists increasingly require the analysis for the pathogens responsible of onychomycosis after a brief interruption of therapy; as a consequence culture dependent methods for onychomycosis diagnosis give frequently false-negative results. In order to overcome the above mentioned problems, the aim of the present work was to compare two different methods: the cultural methods and the sequence analysis method based on the metagenomic approach. Methods: 33 nail samples from 29 patients with clinically diagnosis of onychomycosis in feet and/or hands were investigated. Fungal cultivation was performed using Sabouraud dextrose agar (Oxoid) amended with antibiotics, with and without cycloheximide, to detect yeasts, dermatophyte and nondermatophytic moulds. Total DNA was obtained from nail powder. To obtain fungal amplicons, the ribosomal ITS1 region was targeted, by using primers BITS and B58S3 (Bokulich and Mills, 2013) linked to Illumina adapters. Sequencing libraries were finally constructed through the link of indexes (Nextera XT Index Kit, Illumina, San Diego, CA), quantified, normalized and pooled. Libraries were subjected to paired-end sequencing (2 × 250 bp, nano format). Data analysis was performed using the pipeline Qiime and high-quality reads were clustered into operational taxonomic units (OTUs) at 97%. OTUs were finally annotated using the UNITE fungal ITS reference data set within RDP classifier and the Worcup ITS reference as training dataset. Species assignation on selected OTUs was manually resolved through BLAST searching against mycobank, RDP and GeneBank. Relative abundances of microbial taxa in each sample were calculated and compared. Results: Candida spp. or Trichophyton spp were detected in 14 samples. In 1 sample both Candida and Trichophyton were detected. Filamentous nondermatophytic fungi having a recognized role as unique causative agent of onychomycosis or mixed infections, were recovered in 21 samples. It is difficult to establish when these moulds are etiologic agents of onychomycosis or contaminants. Only repeat testing may solve the problem. Comparing the results obtained by cultivation method and to those obtained by sequencing ITS1 amplicons we observed that 2 out of 33 samples did not provide concordant results. In fact, while from these samples any fungal growth was observed, the amplification of ITS region was achieved, thus suggesting the presence of fungi. Finally high-throughput deep sequencing let us to profile the biodiversity in the samples and by analysis of prevalence it was possible to identify and quantified the pathogen. Conclusion: The application of high-throughput sequence analysis of amplicons produced targeting ITS1 region allows us to detect the presence of fungal DNA even when in vitro growth of fungal colonies was not possible. Moreover the pathogen can be quantified by means the analysis of prevalence of the sequence data.

P467 Aspergillus spp. aerocontamination in a zoological park in France: results of one-year monitoring in a bird nursery and penguin nests ´ 3 , S. Laidebeure3 , N. Dogna3 , L. Barthelemy3 , V. Risco-Castillo1 , C. Angebault2 , J. Guillot1 , C. Guillot2 , A. Lecu E. Dannaoui4 , F. Botterel2 1 ´ erinaire ´ Ecole nationale vet d’Alfort, MAISONS-ALFORT, France 2 ´ ´ Universite´ Paris Est Creteil, CRETEIL, France 3 Parc zoologique de Paris, PARIS, France 4 Universite´ Paris Descartes, PARIS, France Objective: Aspergillosis is a common systemic mycosis in birds and one of the most important causes of death in captive animals, especially penguins. Inadequate ventilation and dusty conditions increase the risk of bird exposure to aerosolized Aspergillus spores. Only few data are available about Aspergillus air contamination in zoological parks. The objective of the present study was to perform a long-term monitoring of the air contamination by Aspergillus spp. in a zoological park in France. Methods: The study was performed in the zoological park of Vincennes, Paris. This park shows a large number of wild birds, including a colony of 20 Humboldt penguins (Spheniscus humboldti). The park also includes specific facilities for incubation and hatching of bird eggs. The monitoring of Aspergillus contamination was performed every two weeks, from January to December 2016. Air samples (300 L) were collected using the Air Strategie Bio-impactor device loaded with Sabouraud dextrose agar plates in 8 sites: 3 inside the bird nursery, 1 in a corridor close to the nursery and 4 inside nests of Humboldt penguins. To select thermophilic fungi, plates were incubated at 37◦ C for 4 days. Fungal colonies were subcultured and identified according to their macroscopic and microscopic appearance. Further proteomic identification (MALDI-TOF) was performed for selected isolates. Results: Aspergillus spp. were recovered from almost every sample. The predominant species was A. fumigatus which was recovered from 77.8% and 45.5% of air samples collected from the penguin nests and the bird nursery, respectively. Aspergillus niger and A. flavus were also regularly isolated. The species A. nidulans was detected in rare occasions from the nursery. The levels of Aspergillus contamination in penguin nests were below 30 colony-forming units (CFU)/m3 and did not vary throughout the year round sampling period. The levels of Aspergillus contamination in the nursery were below 10 CFU/m3 except in two occasions (in March and November) with higher loadings (up to 100 CFU/m3 ) of A. fumigatus. It was not possible to find the origin of these unusual levels of contamination and during the study no clinical case of aspergillosis was diagnosed in the penguin colony. Conclusion: This is the first study of environmental Aspergillus contamination in a French zoological park. Background levels of Aspergillus spores in the nursery and in penguin nests were low, but occasional exceptions occured in the nursery. The predominant Aspergillus species present was A. fumigatus, but other species were also detected. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 417000 dda6be96-4a4b-4dca-9652-2e3b 801e9c19.jpg Caption 1: Figure 1. A Humboldt penguin from the zoological park of Vincennes, France

ABSTRACT

S153

P468 Histopathological study on the prevalence of trichosporonosis among autopsy subjects using peptide nucleic acid probe In situ hybridization technique

P471 Identification and molecular characterization of genes encoding for rhamnosyltransferases in Sporothrix schenckii sensu stricto

S. Sadamoto1 , M. Wakayama1 , M. Shinozaki1 , Y. Nihonyanagi1 , K. Ejima1 , A. Mitsuda1 , N. Tochigi1 , T. Nemoto1 , T. Hishima2 , K. Shibuya1 1 Toho University School of Medicine, TOKYO, Japan 2 Toho university School of Medicine, TOKYO, Japan 2 Tokyo Metropolitan Cancer and Infectious Diseases Center Komagome Hospital, TOKYO, Japan

2

Objective: Whereas culture examination has been generally accepted as the gold standard to identify causative fungi from clinical specimens for invasive fungal infection, its low sensitivity and contamination sometimes become a problem. On the other hands, usefulness of molecular supplemental procedures for histopathological diagnosis of invasive fungal infection become to be introduced. Research has been very active conducting molecular diagnosis such as polymerase chain reaction (PCR) or In situ hybridization (ISH) for diagnosis of invasive fungal infection. Although many novel primers and/or probes for fungi have been introduced, the study applying clinical specimen is still limited and currently not enough for clinical use of ISH. SinceTrichosporon species which being mostly insusceptible to echinocandin are one of the most common dimorphic yeast in Asia including Japan. We sometimes encounter breakthrough trichosporonosis in individuals under administration of this class. It is therefore important to discern Trichosporon spp. from Candida spp. by histopathological examination. However, morphological similarity of these fungi makes hard to identify only by routine histological examination. For choosing optimal antifungal drug, favorable molecular supplemental procedure is required to identify these fungi for histopathological diagnosis. In our previous studies, we invented the peptide nucleic probe (PNA) that designed specific for C. albicans and Trichosporon spp. The purpose of this study is to evaluate the utility of ISH procedure focusing on the histopathological prevalence of trichosporonosis in autopsy subject by using PNA probe ISH. Methods: The formalin-fixed and paraffin embedded (FFPE) tissue involved by invasive yeast infection were employed in the study from autopsy cases which were recorded in Toho University Medical Center Omori hospital or Tokyo Metropolitan Cancer and Infectious Diseases Center Komagome Hospital during 1975–2012. Sections of total 88 specimens mounted on slide glass were deparaffinized and stained with both hematoxylin and eosin and periodic acid-Schiff reaction (PAS). Three expertized pathologists took part in histopathological examination to verify the previous diagnosis of invasive yeast infection and exclude cryptococcosis and mold infection from our cohort. ISH was performed with PNA probes for C. albicans and Trichosporon spp., of which specificity have been confirmed. Figure 1 summarizes the outline. Results: Thirty-one in 88 cases showed positive signal for Trichosporon spp. probe or C. albicans probe, or both. Among them, 8 and 22 cases showed positive signal for Trichosporon spp. probe and C. albicans probe, respectively, 5 out of 8 Trichosporon spp. probe positive cases have been diagnosed as candiasis in the previous autopsy report. Conclusion: The present study extracted 8 invasive trichosporonosis, and 5 of which have been misdiagnosed as candidiasis. The prevalence of trichosporonosis could be higher than that primarily expected. We wish to emphasize that ISH is an useful tool to identify Trichosporon spp. in foci of FFPE. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 417525 93c2d338-e948-4ea9-8c5b-957e 4658d5dc.gif Caption 1: Figer.1 Flow chart of the research.

P469 The Yeasts, a new online and updatable platform for yeast diversity T. Boekhout1 , H.-M. Daniel2 , M. Groenewald3 , A. Yurkov4 , F.-Y. Bai5 , V Robert6 1 Westerdijk Fungal Biodiversity Institute, UTRECHT, Netherlands 2 BCCM/MUCL, Universite´ catholique de Louvain, LOUVAIN-LA-NEUVE, Belgium 3 Westerdijk Fungal Biodiversity Centre, UTRECHT, Netherlands 4 Leibniz Institute DSMZ - German Collection of Microorganisms and Cell Cultures, BRAUNSCHWEIG, Germany 5 5Institute of Microbiology, Chinese Academy of Sciences, BEIJING, China 6 1Westerdijk Fungal Biodiversity Institute, UTRECHT, Netherlands Objective: Yeast diversity is rapidly expanding due to discovery of new species and new insight in their phylogenetic relationships. This also relates to emerging yeasts that are clinically relevant. The Yeasts aims to present information on all yeast species in an updatable and on-line, open access electronic format. Methods: Public information on authenticated yeast strains from public culture collections and other sources will be made available in a species-based electronic information platform. This platform will provide various information on species or strains level that also include clinically relevant data that will be useful for consulting clinicians and all others working in diagnostic laboratories. Results: Information will be clustered according to species boundaries. This species-specific information will be based on species descriptions that will also include information on clinically important subjects, such as physiological properties, most suitable identification tools, clinical occurrence and susceptibility to the most commonly used antifungals. The information provided by the platform will be curated by the scientific community to include most up to date knowledge in the field. Libraries of molecular barcodes, nutritional growth data, and MALDI-spectra may be useful for identification of unknown yeast isolates. Besides, protocols for the isolation and identification of yeast isolates will be provided. Conclusion: The Yeasts will provide a highly useful resource for clinicians and laboratory personnel dealing with the identification of yeast isolates obtained from clinical environments. The system will be open access and updatable, and, hence, a user-friendly tool to accumulate the up to date knowledge on yeasts as best as possible.

P470 Development and Evaluation of an Experimental Model of Invasive Candidiasis caused by Candida auris N.P. Wiederhold, L.K. Najvar, R. Jaramillo, M. Olivo, J. Pizzini, G. Catano, T.F. Patterson UT Health San Antonio, SAN ANTONIO, USA Objective: Candida auris is an emerging cause of invasive candidiasis, with a high rate of antifungal resistance, including multidrug resistance. Animal models of invasive disease are needed to evaluate novel therapeutic strategies. We report our experience with a murine model of C. auris invasive candidiasis. Methods: Immunocompetent and neutropenic ICR mice were used. Mice were rendered neutropenic by 5-fluorouracil (150 mg/kg IV x1) 1 day prior to inoculation via the lateral tail vein. The virulence of two clinical bloodstream isolates of C. auris (UTHSCSA DI16-46 and DI16-47) was assessed over a range of inocula. To assess response to therapy, mice infected with DI16-46 were treated with fluconazole (10 mg/kg orally BID; MIC >64 mg/L) or caspofungin (1 mg/kg by intraperitoneal injection QD; MIC 0.25 mg/L), and therapy was initiated 1 day post-inoculation. Outcome measures included survival and changes in kidney and brain tissue fungal burden. Multiple experiments were conducted to evaluate the reproducibility of the results. Results: Immunocompetent mice were relatively resistant to C. auris, as survival was 100% at day 14 post-challenge at inocula ranging between 5 × 104 to 4.5 × 106 cells/mouse. Mortality was observed with the highest inoculum (4.1 × 107 cells/mouse) but was not uniformly lethal. Fungal burden increased with higher inocula. In neutropenic mice, virulence differed between the two isolates. In mice infected with DI16-47, mortality range between 40% to 70% over an inocula range of 2.6 × 106 to 2.5 × 107 cells/mouse. In contrast, in mice infected with DI16-46, mortality was rapid (median survival 2–3 days) and approached 100% with higher inocula (4.1-8.6 × 107 cells/mouse). In mice infected with the higher inoculum of DI16-46, fluconazole and caspofungin did not improve survival (0% & 15%, respectively) or reduce kidney fungal burden (log10 CFU/g 7.79 & 7.15 vs. 8.09 for placebo). However, when infection was established using a lower inoculum (1 to 5 × 106 cells/mouse), fungal burden was significantly reduced in mice treated with caspofungin (mean range 2.68 - 3.53 log10 CFU/g) compared to controls after 7 days of therapy (mean range 6.27–6.58 log10 CFU/g; P < 0.001). Infection also disseminated to the brain in mice infected with C. auris. However, treatment with caspofungin did not result in significant reductions in brain tissue burden. Conclusion: Immunocompetent mice were relatively resistant to infection. However, C. auris was able to cause lethal disease in neutropenic mice, and a standard dose of fluconazole was ineffective. Treatment with caspofungin did improve outcomes, but this was inoculum dependent. This neutropenic model may be useful in evaluating new treatment strategies against this emerging pathogen.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

1 ´ K. Garc´ıa-Gutierrez , J. H. Ram´ırez-Prado2 , H. M. Mora-Montes1 Universidad de Guanajuato, GUANAJUATO, Mexico ´ Unidad de Biotecnolog´ıa, MERIDA, Mexico

1

Objective: In this study, we aim to analyze three putative genes that may encode for rhamnosyltransferases in Sporothrix schenckii. Methods: The sequences of interest were analyzed and specific primers were designed for isolation of them by PCR. The ORFs were subcloned into the EcoRI and XbaI sites of the pCold II vector, these constructs were used to transform E. coli DH5α cells. To perform gene expression in Pichia pastoris, the ORFs were subcloned into the EcoRI and XbaI sites of the vector pPICZαA. Results: Following this strategy, we have isolated and cloned Ssrha113 that has a size of 699 bp. Conclusion: Since the other two putative genes encoding for rhamnosyltransferases are not expressed in filament cells, their expression is currently analyzed in yeast-like cells.

P472 Molecular docking based on construction of 4-a-sterol demethylase (CYP51) as an active site of Madurella mycetomatis by homology modelling S. A. Khalid1 , T.A. Awad12 , S.O. Abd Algaffar3 , W.W. Van de Sande4 1 University of Science & Technology, OMDURMAN, Sudan 2 King Faisal University, HOFUF, Saudi Arabia 3 Faculty of Pharmacy, University of Science & Technology, Omdurman, Sudan, OMDURMAN, Sudan 4 Erasmus MC, Rotterd, ROTTERDAM, Netherlands Objective: Eumycetoma is a tropical neglected infectious disease causing large tumorous lesions on mainly the extremities. The current treatment consists of a combination of antifungal therapy with azoles and surgery. In order to predict which azoles, have the highest binding capacity to their drug target, a homology model based on the CYP51 target was constructed and its validity was tested by docking some of the currently available triazoles along with a set of synthetic compounds. Methods: Madurella mycetomatis 14-α-sterol demethylase (MmCYP51) Protein sequence (GenBank: KXX80456.1), was built using comparative modelling method using the SWISS MODEL server facilities. The best model which chosen was Aspergillus fumigatus 14-α sterol demethylase (AfCYP51) with PDB ID; 4UYM, with sequence identity 66.09% and resolution of 2.55 Å. Coordinates which are conserved between the target and the template are copied from the template to the model. Insertions and deletions are remodelled using a fragment library. Side chains are then rebuilt. The 3D superposition of the target protein and the template was carried out, and the RMSD for alignment was determined. The docking study was conducted with the docking module of molecular operating environment (MOE) software. The compounds 3D structures were built with Chem3D software then were transferred and saved into MOE database, the energy of each compound was minimized by MMFF94x force field. Protein 3D structures were protonated & energy minimized using MMFF94x force field. Finally, the 3D structures of the prepared proteins were saved as PDB file. A Gaussian Contact surface was drawn around the binding site. The receptor was verified as Receptor and the site as Ligand Atoms. The Placement method used was Triangle Matcher. The first scoring function was set to London dG and the refinement to force field. Results: The molecular docking provided evidence that fosravuconazole 1 is interacting with the enzyme in a way that permits the phosphate group forms potential hydrogen bonding, besides the nitrile and triazole moieties (Figures 1 & 2). Docking results of synthetic compound 2 which previously exhibited promising in vitro activity (IC50 = 0.60 μM) against Madurella myceromatus showed a strong affinity towards CYP51 providing further evidence of the role of a nitrile group in forming hydrogen bonding with enzyme’s residues in a similar fusion to the azoles, exist in this compound and forms a potential hydrogen bond with the enzyme’s residues. It worth noting that eumycetoma is currently treated with itraconazole. Conclusion: The constructed protein target seems to provide certain predictive value and correlation with the in vitro data. Fosravuconazole represents a promise for eumycetoma treatment; however, comprehensive researches is required to discover novel potent drugs. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 420198 8264cae5-cb95-43da-b3bb-333 5281920f5.png

P473 CXCL10 gene promoter polymorphism A-1447 G increase susceptibility to invasive aspergillosis in female oncohematological patients Anastasya Taraskina, M.V. Rudneva, O.V. Shadrivova, E.V. Frolova, T.S. Bogomolova, N.N. Klimko, N.V. Vasilyeva North-Western State Medical University named after I.I. Mechnikov, SAINT-PETERSBURG, Russia Objective: Invasive aspergillosis (IA) – is life-threatening invasive infection, especially in immunocompromised hosts, most of which are oncogematological patients. However it should be noted that the risk of infection and its clinical outcome vary significantly even among patients with similar predisposing clinical factors and microbiological exposure, implying an individualized genetic pattern of susceptibility. The key components of fungal infections pathogenesis are disturbances of the immune system. Chemokine CXCL10, also known as interferon gamma-induced protein 10 (IP10), is a member of CXC chemokines. CXCL10 is an inflammatory mediator, which stimulates the directional migration of Th1 cells as well as increasing T-cell adhesion to endothelium. CXCL10 gene is located at chromosome 4q21. One of the single nucleotide polymorphisms (SNPs) affects expression via (nuclear factor kB) NF-kB transactivation and represents a guanine (A) to adenine (G) transition at position -1447 within the CXCL10 gene promoter (rs 4508917).

The purpose of this studyis to investigate the value of allelic variants A-1447 G CXCL10 gene in risk of development IA in oncohematological patients in St. Petersburg. Methods: 102 oncogematological patients on the background of cytostatic polychemotherapy with symptoms of lung injury were recruited to participate this study. 54 oncogematological patients (53%) either developed proven or probable IA as defined by criteria of EORTC/MSG 2008 (median age 43y ±14, range [22-77y], 57% males) whereas controls (48 oncogematological patients (47%) without IA comparable in age and sex) did not fulfill these criteria. Human genomic DNA from patients was purified from whole blood using standard phenol-chloroform method. The -A1447G SNP was analyzed by amplifying the 290-bp fragment at an annealing temperature of 55C to generate a restriction site for the SacI enzyme in the presence of the G allele. The mutant PCR product was cleaved to produce a fragment of 145-bp while the wild-type remained uncut. Statistical analysis was performed using statistical software SPSS version 21 (IBM, USA). Chi square tests χ 2 (df = 6) were used to examine the differences in allele frequencies and genotype distribution between groups of oncohematological patients. Results: The heterozygous AG genotype prevailed in the both studied groups with a frequency of 0.52 and 0.63, respectively. Despite the fact that the homozygous genotype GG associated with a decreased secretion of CXCL10 protein was found only in group of patients with IA, no statistically significant differences in the distribution of genotypes between the groups were detected (χ 2 = 1.87, p = 0.90). When dividing patients by sex in a female group G allele was significant associated with the occurrence of IA (χ 2 = 3.853, p< 0.50, OR 3.13 95% CI (1.196-8.204). The frequency of G allele in all examined oncogematological patients is 0.2941 and this results is comparable with the carrier frequency in the European population (0.3327) according to the database “1000 Genomes”. Conclusion: Further increase in the number of patients included in the study will allow to make conclusions about the prospect of typing the studied polymorphic variant of the gene CXCL10 as a predictive marker of the risk of mycosis development with a strong significance.

S154

Medical Mycology, 2018, Vol. 56, No. S2

P474 Poly Lactic-co-Glycolic Acid (PLGA) uptake by Candida albicans cells as biodegradable controlled drug delivery carrier

P477 Chitin of Aspergillus fumigatus as a target of neutrophil peptidomimetics

OLGA Kolesova, Giovanna Simonetti, Livia Donati, Gabriella Pasqua, ALESSIO Valletta, LAURA Chronopoulou, CLEOFE Palocci Sapienza University of Rome, ROME, Italy

N. N. Tirkey, Gunjan Uttam, S. Neelabh, Ankita Kumari, Karuna Singh Banaras Hindu University, VARANASI, India

Objective: Polymeric nanoparticle-based carriers are promising agents for the delivery of drugs to the site of action. The polymeric matrix can be of natural or synthetic origin. Natural polymers are usually preferred thanks to their biocompatibility, biodegradability and non-toxicity. An efficient drug delivery requires either high cellular adhesion or uptake of the nanoparticles and release of the drug from the nanoparticles. The aim of this study was to investigate the cellular adhesion and uptake of poly(lacticco-glycolic) acid nanoparticles (PLGA NPs) on Candida albicans in the yeast and hyphal forms as well as to study the antifungal activity of PLGA NPs Methods: NPs preparation. PLGA NPs of different sizes were prepared by using two different innovative methodologies based on nanoprecipitation. A microfluidic approach was used for the preparation of smaller NPs (∼30 nm) (Chronopoulou et al. Journal of nanoparticle research. 2014), while a patented osmosis-based methodology was used to obtain bigger NPs (∼500 nm) (Chronopoulou et al. Langmuir. 2009). Microscopy analysis. The localization of coumarin 6-loaded PLGA NPs into Candida albicans cells was analyzed with an epifluorescence microscope apparatus. Anti-Candida activity. The activity of PGLA NPs on Candida albicans has been performed according to CLSI protocols with some modifications. Results: Among the tested NPs with different diameters, the smaller ones (∼30 nm) entered into Candida albicans yeast and hyphal forms. The bigger particles (∼500 nm) were localized on the fungal wall, according to the microscopy analysis. The MIC values showed that at the highest concentration tested (3000 μg/mL) the NPs did not inhibit the growth of Candida albicans cells Conclusion: The results provide valuable information concerning the localization of PLGA-based NPs on Candida albicans yeast and hyphal forms. The cellular uptake of PLGA NPs with different sizes has been investigated. It has been shown that the cellular localization is highly dependent upon the dimensions of the NPs, those smaller than 30 nm have shown the best possibility to penetrate Candida albicans cells. The lack of activity of investigated NPs on Candida albicans growth was proved. The cellular interaction or uptake of PLGA NPs by Candida albicans yeast and hyphal forms and lack of toxicity constitute preliminary information for their possible use as drug delivery systems.

P475 Experimental induction of tenuazonic acid toxicity in mice model Ankita Kumari, Karuna Singh Banaras Hindu University, VARANASI, India Objective: This study aims to assess the health risks associated with tenuazonic acid (TeA) produced by Alternaria alternata in tomato. In this regard, a murine model has been developed. Methods: TeA was used for the experimental induction of mycotoxicosis in murine model. The mycotoxin was administered intra peritoneally (IP) and orally. Haematological, histopathological and biochemical aspects of the TeA induced toxicosis were analysed. Results: Behavioral observations- A significant decrease in the consumption of feed in both oral and IP groups were noted. Reductions in weights of the mice were noticed in IP group. However, an increase in the weights of the mice was recorded in the oral group. Morphological observations- Hair loss indicating mycotoxicosis was observed in the experimental mice of both the groups. Anatomical observations- Spleenomegaly, hepatomegaly and gross lesions on liver and kidney were seen on autopsy in both the groups. Body: organ weight indices of liver and spleen were also found to increase. Haematological analysis- Neutrophilia was observed in IP while neutropenia was observed in the oral group. Biochemical analyses- Elevated malondialdehyde (MDA), reduced catalase (CAT) and superoxide dismutase (SOD) production; abnormal levels of aspartate transaminase (AST) and alanine transaminase (ALT) were observed which signifies TeA induced oxidative stress. Histological observations- Histopathological changes characterised by non alcoholic fatty liver, nuclear pyknosis and WBC infiltration were observed. Conclusion: The findings of the above study suggest that even at a very small concentration and short exposure, TeA can cause severe damage to the vital organs. Since tomato and its by-products are used worldwide, consumption rate of TeA is high. Regulations should be framed to ensure the verification of compliance of maximum level of TeA with food and feed law. New risk assessment approaches should be considered to investigate the toxicological interactions of TeA in agricultural products, in humans and in animals. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 421086 a2b6cc2e-fb8b-480b-b1c4-4ff 270b63233.jpg

P476 Long-term pathology of the naturally-acquired Pneumocystis primary infection in rats. ´ SL Vargas, C.A. Ponce, R. Bustamante, P.A. Iturra, D.A. Rojas, A. Mendez Biomedical Sciences Institute, University of Chile School of Medicine, SANTIAGO, Chile Objective: To study whether the Pneumocystis primary infection induces long-lasting pathology is relevant and may suggest a role of this fungal infection in chronic airway disease. Pneumocystis is the most common pulmonary infection of healthy infants with a peak incidence between 2 and 5 months of age that goes undiagnosed. We have recently reported an animal model of this primary infection documenting that this infection induces lung damage consisting of increased mucus, airway epithelial thickening, perivascular and peribronchial infiltrates, and increased collagen suggesting chronic changes secondary to Pneumocystis in immunocompetent rats evaluated up to day 75 post-infection. This work extended our evaluations in the same model up to the age of 1 year. Methods: 120 newborn rats were kept in HEPA-filtered air containers throughout the duration of the experiment. They were randomized to exposure at birth to rats with Pneumocystis pneumonia by co-habitation for 48 hours, or to no-exposure and anti-Pneumocystis prophylaxis with TMP/SMZ during the duration of the experiment. Twelve rats per group were sacrificed each time at 40, 60, 80, 258, and 361 days of age under deep anaesthesia with Ketamine-Xylazine. Six of them to be used for histologic determinations were sacrificed by vascular perfusion of 3% buffered formalin via inferior cava vein at a pressure of 25 water cm, and their fixed lungs longitudinally sectioned to separate the proximal and distal lung zones for central and distal airway histologic determinations using Alcian Blue, H&E, and IHQ stains respectively, with Image Pro-plus software. The other 6 rats were used for Pneumocystis and collagen determinations. They were exsanguinated and their lungs removed, placed in RNA-later, and fresh frozen at -80◦ C until processing. Pneumocystis was diagnosed using nPCR and P. carinii-specific primers amplifying the mtLSUrRNA, and collagen levels were biochemically determined. Results: Pneumocystis-DNA was amplified in none (0%) of the non-exposed rats throughout the experiment, and in 6/6(100%), 6/6(100%), 6/6(100%), 2/6(33%), 1/6(17%) of exposed rats at 40, 60, 81, 258, and 361 days respectively. Inflammatory cuffs significantly increased from day 81 and from day 60 up to day 361, respectively around bronchi and vessels. Infiltrates were more prominent and showed sustained increase around vessels. The area of airway epithelium occupied by mucins was 18 and 5 times higher on days 281 and 361 post infection, respectively, than measurements before day 80 in the Pneumocystis-exposed rats. Cuffing inflammation and the area of epithelium occupied by mucins did not vary along the experiment in the non-exposed rats. Collagen levels were not different in both groups throughout the experiment. Conclusion: The primary infection by Pneumocystis induces long-term changes consisting of sustained peribronchial and perivascular inflammation and severely increased mucin secretion being consistent with long-term epithelium changes of mucous cells. These changes support a role of Pneumocystis in chronic airway disease.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Objective: The study aims to design peptidomimetics of neutrophil peptide (NP-2, NP-3a, NP-3b, NP-4, and NP-5) and their interaction with chitin of Aspergillus fumigatus using bioinformatics tools. Methods: Amino acid sequences of neutrophil peptides (NP-2, NP-3a, NP-3b, NP-4, and NP-5) were retrieved from NCBI. ClustalX software was used for identification of conserved regions. The protein structures of neutrophil peptides (NP-2, NP-3a, NP-3b, NP-4, and NP-5) were downloaded from Protein Data Bank (PDB). Protein structure of Chitin of Aspergillus fumigatus was designed by Phyre2 web server. RAMPAGE server was used for Ramachandran Plot Analysis of the predicted chitin structure. Docking software PatchDock and FireDock were used to determine the interactions between structures of neutrophil peptides (NP-2, NP-3a, NP-3b, NP-4, and NP-5) and designed chitin. Peptidomimetics were designed by altering the structures of neutrophil peptides (NP-2, NP-3a, NP-3b, NP-4, and NP-5) using ChemSketch and Open Babel tools. Binding energies were determined between mimetics of neutrophil peptides and chitin. Comparison between binding energies of modified NPs and natural NPs elucidate the effectiveness of the altered NPs over the natural ones. Results: The result showed that all NPs were similar in their sequential organization. Binding between peptidomimetics of NPs and chitin structure was found to be greater than natural NPs. Conclusion: Designed peptidomimetics showed better binding with chitin of Aspergillus fumigatus than natural NPs and could be used as potential drug candidates against infections caused by Aspergillus fumigatus.

P478 Gene-expression profiling in human monocytes during the immune response towards pathogens of systemic infections 1 2 1 ¨ ¨ ¨ , M. Weber1 , T. Hess2 , B. Burfent , J. Schumacher2 , K. Hunniger , O. Kurzai3 A. Hader 1 ¨ Naturstoff-Forschung und Infektionsbiologie-HKI, JENA, Germany Leibniz-Institut fur 2 ¨ Universitatsklinikum Bonn, BONN, Germany 3 ¨ ¨ Wurzburg, ¨ Universitat WURZBURG, Germany

Objective: Human monocytes are of particular importance to defend microbial pathogens that can cause bloodstream infections because they are able to phagocytose, to release cytokines and chemokines and trigger adaptive immune responses. To dissect the response of monocytes towards different pathogen classes and to identify pathogen specific activation patterns we performed a genome-wide gene expression analysis of monocytes after confrontation with Aspergillus fumigatus, Neisseria meningitidis and Staphylococcus aureus. Methods: In the pilot study, human monocytes from venous blood of three healthy male donors were isolated and stimulated with the three different pathogens for 3 h and 6 h. Differentially expressed genes (FDR < 0.05, Fold Change > 1.5) of monocytes were determined for each pathogen after RNA isolation and subsequent RNAseq analysis. Furthermore, bioinformatical analyses enabled us to recapitulate the complex changes in cellular pathways that occur during the stimulation of these immune cells. Currently, we are using these data to perform transcriptome profiling in human monocytes from > 200 healthy males to identify transcriptome variation between individuals during infection. Results: Transcriptomic analysis of activated human monocytes after confrontation with the three selected pathogens revealed a strong immunological core program of gene expression induced by all pathogens. Within this group mainly genes encoding chemokines, pro-inflammatory cytokines and surface marker for activation or adhesion were found. Additionally, A. fumigatus induced a strong fungal-specific response by upregulating genes of the HIF- and the MAPK-signaling pathways. The transcriptional responses to both bacterial pathogens shared a large number of differentially expressed genes encoding chemokines, cytokines and transcription factors of the Jak-STAT signaling pathway. Interestingly, only bacteria induce the expression of many genes encoding cytokines that can activate the adaptive immunity in addition to the common core response. Conclusion: Transcriptional differences between the pathogens can be used to identify pathogen specific immune responses that may built a basis in future studies looking for markers of systemic infections. In the current study, we will analyse inter-individual differences to provide new insights into the genetic control of the innate immune response.

P479 Evaluation of three automated methods for the extraction of circulating DNA: application to the diagnosis of mucormycosis by q-PCR M. Cornu, M. Guerin, J. Leroy, S. Galichet, C. Hallaert, B. Sendid University Hospital, LILLE, France Objective: Mucormycosis are rare invasive fungal infections due to environmental molds from the order of Mucorales, whose incidence has increased during the last decade. These infections affect mainly immunosuppressed patients and are associated to a poor prognosis. The diagnosis, previously based solely on conventional mycological examination, has been improved by the detection of Mucorales circulating DNA with q-PCR. The yield of DNA extraction procedure remains a critical issue for Mucorales DNA detection in blood. Our objective was to compare currently available automated methods for DNA extraction from serum in patients with mucormycosis (MM). R 7500 Real-Time PCR System, whose performance has been evaluated previously as Methods: The Applied Biosystems R 480 Instrument, was used for DNA amplification. We compared three automated methods designed for similar to LightCycler R coupled with NucleoSpin R 96 DNA plasma kit circulating DNA extraction, i) MICROLAB STARlet instrument (Hamilton) R Af DNA kit (Ademtech) and iii) MagNA Pure Compact (Macherey-Nagel), ii) AutoMag instrument coupled with MycoGENIE Instrument coupled with Large Volume MagNA Pure Nucleic Acid Isolation kit (Roche). Depending on the extraction method used, the volume of sample varies from 200 μL to 1 mL. The first method use silica membrane, whereas the two others use magnetic beads to extract DNA. Analysis was performed on both clinical (39 sera sequentially collected from 14 patients with MM) and spiked blood samples. Q-PCR was performed as previously reported by Millon et al. (1). Results: The yields of DNA extraction for all tested procedures were almost similar with a better limit of detection (LoD)

€ (Ademtech)

for Roche and Hamilton/Macherey-Nagel methods (300 C. auris isolates obtained from clinical and screening cases identified within ten U.S. states: California, Connecticut, Florida, Illinois, Indiana, Maryland, Massachusetts, New Jersey, New York, and Oklahoma. Pairwise SNP comparisons of multiple isolates from the same patient and between patients within a facility with active transmission were examined. We sequenced all isolates using Illumina technology (yielding 50–200X coverage) and used a PacBio C. auris reference for comparison. Using the NASP pipeline, we mapped reads using BWA and SAMtools to identify SNPs. We performed principal component analysis using Hamming distance and the adegenet R package. Results: We found all four known C. auris populations represented in the United States. Patient isolates from California, Connecticut, Massachusetts, Maryland, New Jersey, New York, and Oklahoma clustered with isolates from India and Pakistan (South Asian clade). Similar results were found for other states. Patient isolates from Florida, Illinois, and Massachusetts clustered with those from Venezuela and Colombia (South American clade). The patient isolate from Indiana resembled those from South Africa, and two people from New York had isolates that resembled those from Japan and South Korea and clustered to the East Asian clade. Five patients had been hospitalized in a country with known C. auris transmission before C. auris identification. Isolates from each of these patients were highly related to isolates from the country of previous hospitalization. Little intra-host genetic diversity of C. auris was observed within each patient (median SNPs 3, range 0–21). Patient isolates within each facility with active transmission had similarly limited diversity (median SNPs 3, range 0–12). Conclusion: WGS has helped public health officials define, track, and monitor C. auris outbreaks in the United States. These findings suggest multiple recent introductions and support heightened monitoring for C. auris in patients recently hospitalized in a country with known transmission. Minimal diversity observed within and between patients in a facility further suggests recent transmission and need for infection control measures.

P489 Magnetic resonance imaging of infected mouse brains allows non-invasive screening of differences in the virulence of clinical Cryptococcus neoformans strains L. Vanherp1 , A. Hillen1 , J. Poelmans1 , K. Lagrou1 , G. Vande Velde1 , A. Alanio2 , U. Himmelreich1 1 KU Leuven, LEUVEN, Belgium 2 Institut Pasteur, PARIS, France Objective: Variability in the virulence of Cryptococcus neoformans strains can influence the outcome of cryptococcal meningoencephalitis. The standard method to assess the in vivo virulence of fungal strains uses survival studies in animal models. Unfortunately, these studies only give very limited information and no insights in disease manifestation and progression during the infection. The aim of our study was to validate non-invasive imaging methods for their potential to assess virulence of cryptococcal strains in vivo. To this end, we aimed at characterizing potential differences in the course of the disease caused by clinical C. neoformans strains in a murine model by use of preclinical magnetic resonance imaging (MRI) and computed tomography (CT). Methods: 7 clinical Cryptococcus neoformans strains (AD2-82a, AD4-47a, AD5-53a, AD2-04a, AD1-83a, AD1-07a, AD476a) and a reference strain (H99) were injected intravenously (50 000 cells) in female Balb/C mice (n = 3 per strain). Subsequently, infected animals were scanned every 2–4 days using a 9.4T preclinical MRI system (Bruker Biospin, Ettlingen, Germany). The acquired 3D MRI scans were converted to a 3D model to allow quantification of different disease- and morphology-related readouts. In addition, weekly CT of the mouse lungs was performed (Skyscan 1076, Bruker micro-CT). Animals were followed up during the course of the disease and sacrificed when reaching humane endpoints. Results: Humane endpoints were reached between 7 (H99, AD2-82a, AD4-47a) and 18 days (AD4-76a) after infection. For all animals, disease was characterized by an increase in the total brain volume and ventricle volume, which could indicate edema of the brain tissue. Furthermore, the phenotypical presentation of disease in infected animals was different between the clinical strains (Fig. 1). Lesions in the brain parenchyma were visible on the MR images as hyperintense spots distributed throughout the brain, whereby the more virulent strains caused larger numbers of lesions. In contrast, the less virulent strains were generally associated with an accumulation of fluid around parts of the meninges. For most strains, hyperintense regions on the outer edges of the brain and meninges could also be observed. Lung CT did not show the development of a pulmonary infection in this model. Conclusion: In conclusion, MRI can provide additional information on disease manifestation and progression in individual animals, before any symptoms can be detected. We were able to document differences in the disease manifestation between the different clinical C. neoformans strains (e.g. time of onset, meningitis, lesion size and numbers). The use of these non-invasive imaging techniques can reduce the ethical burden associated with virulence studies while at the same time providing more insights in disease manifestation. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 421467 c778d2ab-e104-45d6-aae2-e19c 67b250d9.jpg Caption 1: Figure 1: Longitudinal MRI data for animals infected with different clinical Cryptococcus neoformans strains

ABSTRACT

P490 The mitochondria-associated J-domain protein Dnj1 is required for virulence in the fungal pathogen Cryptococcus neoformans Linda C Horianopoulos, Guanggan Hu, Melissa Caza, James Kronstad University of British Columbia, VANCOUVER, Canada Objective: We aim to understand the molecular mechanisms contributing to the virulence of the fungal pathogen Cryptococcus neoformans. This pathogen is responsible for an estimated 15% of AIDS-related deaths and the treatment options are limited to antifungals with adverse effects. Therefore, it is important to study the molecular biology of C. neoformans to identify proteins and pathways which are required for virulence as potential targets for drug development. The overarching goal of this study is to characterize the role of the J domain containing co-chaperone Dnj1 in Cryptococcus neoformans. We will establish its role in maintaining homeostasis in the fungal cells and facilitating virulence during host infection. Methods: A knockout mutant was generated and characterized in vitro to evaluate the sensitivity of this mutant to certain stress agents, the elaboration of the major virulence factors (capsule, melanin production, and thermotolerance), and phenotypic differences including cell wall composition and architecture. This mutant was also used in a murine intranasal infection model to compare survival and the fungal burden in the mouse organs compared to the wild type and complement strains. In order to gain mechanistic insights, the regulation of the expression of dnj1 was determined using qPCR. At the protein level, Dnj1 was tagged to create strains expressing Dnj1-GFP and Dnj1-HA for further mechanistic studies. The Dnj1-GFP expressing strain was used for co-localization experiments and the Dnj1-HA strain was used to determine protein abundance and interacting proteins. Results: The dnj1 strain had reduced thermotolerance and capsule size compared to the wild type strain in vitro. After further tests to explain these phenotypes, this knockout mutant strain was found to have altered cell wall architecture, increased capsule shedding, and hypersusceptibility to proteotoxic stress. As expected for a co-chaperone, dnj1 gene expression as well as Dnj1-HA protein abundance increased after incubation at elevated temperature. Interestingly, Dnj1-HA co-immunoprecipitated with several mitochondrial proteins suggesting a role in mitochondrial homeostasis. Consistent with this, we found that the Dnj1-GFP fusion protein co-localizes with the mitochondria using fluorescence microscopy. In vivo, mice infected with the mutant strain survived to the end of a 50-day infection and had significantly lower fungal burdens than mice infected with the wild type or complemented strains. Conclusion: Dnj1 is involved in many cellular processes in C. neoformans including several processes required for virulence such as capsule elaboration and thermotolerance. Although our evidence suggests that this is mediated at least in part through mitochondrial functions, the exact mechanisms are not fully understood. Dnj1 is also very distinct from any human proteins outside of the conserved J domain, making it a favourable target for potential antifungal drugs with reduced likelihood of negative off-target effects on the host.

S157

P493 Pantothenic acid improves culturability of dormant Cryptococcus neoformans ` 1 , S. Volant2 , M. Duchateau3 , N. Veluppillai1 , V. Hourdel3 , M. Matondo3 , F. Dromer1 , B. Hommel1 , A. Sturny-Leclere A. Alanio4 1 Institut Pasteur, Molecular Mycology Unit, CNRS UMR2000, PARIS, France 2 C3Bi, Institut Pasteur, PARIS, France 3 ´ ´ Unite´ de spectrometrie de masse et Proteomique, Institut Pasteur, PARIS, France 4 Institut Pasteur, PARIS, France Objective: Latency is an important step in the pathophysiology of cryptococcosis (Garcia-Hermoso et al., JCM, 1999). Biological evidence for dormant cells population of Cryptococcus neoformans (Cn) was obtained in mice (Alanio et al., mBio, 2015). A relevant model of dormancy in Cn has been implemented in vitro using nutrient starvation and hypoxia. This model allowed a biological characterization of the metabolic states in which the yeasts cells were. We thus aimed at uncovering factors involved in reactivation of dormant yeasts and study the metabolic pathways. Methods: After 8 days of hypoxia Cn cells (H99 strain) were harvested and stained with LIVE / DEAD and TUNEL to assess viability / apoptosis / stress response by flow cytometry. In parallel, cell culturability was measured by culture methods. To allow the R device determination of different factors on dormant cells, growth curves analysis and modelization was done using a Bioscreen and Grofit R package. Then, the growth probability at cellular level was determined in liquid minimal medium. Proteomic analysis was done after purification of the yeasts pellets at different time points in hypoxia and compared to normoxia using a protocol based on TCA/acetone/phenol extraction and methanol/acetate precipitation (Wu et al., Nat. protoc, 2014). Samples were analyzed using mass spectrometry to identify and quantify (relative quantification) the recovered proteins (Maxquant & Perseus softwares). The proteins that were up or downregulated was assessed using a Limma approach (Ritchie et al., NAR, 2015). Protein-protein interaction and metabolic pathways of the recovered proteins were assessed with STRING software. Results: After 8 days of hypoxia 0.8% [0.5-1] of cells were culturable, 98.9% [98.8-99.0] were viable and 1.1% [0.9-1.2] were apoptotic. Thus, the majority of the cells (97%) were in a viable but not culturable (VBNC) phenotype. Then, by measuring the growth curves of hypoxic cells, we determined that latency was reduced by the addition of pantothenic acid (vitamin B5), a secreted quorum sensing factor in Cn (Albuquerque et al., mBio 2013), from 4111mn [3866-4451] to 2213mn [1963-2426]. This was suggesting an increased number of viable cells or and increased growth rate. At the cellular level, culturability of VBNC was increased from 1.3 to 2.5 (P < 0.01) meaning that pantothenic acid was able to reactivate a proportion of VBNC. From the proteomic approach, we were able to identify 3772 proteins, among whom 63 were regulated in hypoxia. Then, network analysis of theses regulated proteins determined that fatty acids pathway had a central role in hypoxia. Also, acetyl coenzyme A was always involved in the regulated pathways. Moreover, pantothenic acid is a precursor of acetyl-coenzyme A which strengthens these findings. Conclusion: Culture methods, proteomics and bioinformatics are powerful tools that allowed us to characterize what is VBNC in Cn. In addition, pantothenic acid has the ability to reactivate VBNC. Further studies are needed to clarify the role of pantothenic acid and acetyl coenzyme A in the VNBC phenotype.

P491 Orchestration of chitin synthesis at the septation site of Candida albicans M. Spyrou1 , A.J.P. Brown1 , N.A.R. Gow1 , M.D. Lenardon2 1 University of Aberdeen, ABERDEEN, United Kingdom 2 University of New South Wales, SYDNEY, Australia Objective: Our aim is to understand how four chitin synthases work together to synthesise chitin at the cell division site of the fungal pathogen Candida albicans. Chitin is a structural carbohydrate not found in humans and is an essential component of the fungal cell wall. Chitin synthesis and septation at cell division sites is a highly regulated process, fundamental for cell viability. Understanding the molecular mechanisms behind chitin synthesis and the cell biology of fungal septation may lead to the identification of tractable drug targets for future antifungal chemotherapeutic strategies. In the pathogenic fungus C. albicans, a primary chitinous septum is formed between two dividing cells and is synthesised by four chitin synthases (Chs1, Chs3, Chs2 and Chs8), all four of which localise to sites of septation. Here we map the spatial and temporal orchestration of the Chs machinery during septation and use this information to generate a new model for septal chitin synthesis. Methods: Strains expressing pairs of fluorescently-tagged chitin synthases were generated to examine the timing and position of recruitment in relation to each other. Measurement of the fluorescence intensity of the chitin synthases at the septation sites at the time of recruitment was used to assess their relative abundance. We also used GFP pull-downs to identify proteins which may interact with the chitin synthases and potentially contribute in septum formation. Results: Live-cell fluorescence microscopy observations indicated that all four Chs enzymes were first recruited to the septation site in both yeast and hyphal cells as a ring, and that Chs1, Chs2 and Chs8 then constricted to the centre of the septation site during cell division. After septum formation, Chs2 and Chs8 remained in the centre of the septum as two trans-septal spots throughout hyphal growth. The fluorescence intensity profile of the tagged Chs enzymes indicated that there may be differences in the abundance of the Chs enzymes at septation sites in yeast and hyphal cells. Proteomic analyses identified additional proteins that may be part of the septation complex. Conclusion: A novel model of cell wall synthesis during septation is proposed in which we demonstrate for the first time the spatial and temporal distribution of all four chitin synthases during septation in both yeast and hyphal cells of C. albicans.

P492 The vacuolar sorting protein Vps45 links iron uptake, mitochondrial function and virulence in the pathogenic fungus Cryptococcus neoformans. ´ MElissa Caza1 , Guanggan Hu1 , Erik D. Neilson1 , Minsu Cho2 , Won Hee Jung2 , James W. Kronstad1 1 University of British Columbia, VANCOUVER, Canada 2 Chung-Ang University, ANSEONG, South Korea Objective: Cryptococcus neoformans is the main causative agent of cryptococcal meningitis, a disease that is responsible for ∼ 15% of AIDS-related deaths. In this regard, cryptococosis is the second most common cause of mortality in people with HIV/AIDS. Unfortunately, very few antifungal drugs are available to treat cryptococcal infections. However, understanding the mechanisms of C. neoformans pathogenesis may lead to new therapeutic approaches. The competition for iron between invading microorganisms and mammalian hosts is a pivotal determinant of the outcome of infection, and C. neoformans employs multiple mechanisms to compete for iron during cryptococcosis. In this study, our goal was to examine the role of endocytic trafficking in iron uptake by characterizing a mutant defective in the Sec1/Munc18 (SM) protein Vps45. This protein is known to regulate the machinery for vesicle trafficking and fusion via interactions with SNARE proteins. Methods: Cellular localizations were performed using fluorescence microscopy on Vps45-GFP and Cfo1-GFP strains stained with FM4-64 and MitoTracker Red CMXRos. Growth curves and growth assays on the WT strain, vps45 mutants and complemented strains were performed in the presence of trafficking inhibitors, different iron sources, calcium chelators, mitochondria electron transport chain inhibitors, inducers of reactive oxygen species (ROS), cell wall stressors, and antifungal and antimalarial drugs. Flow cytometry was used to assess ROS stress, mitochondrial membrane permeability and cell wall integrity. Virulence assays were performed in the murine macrophage-like cell line J774A.1 and in an inhalation mouse model of cryptococcosis. Results: As expected, a vps45 deletion mutant was impaired in endocytosis and showed sensitivity to trafficking inhibitors. The mutant also showed poor growth on iron-limited media and a defect in transporting the Cfo1 ferroxidase of the high-affinity iron uptake system from the plasma membrane to the vacuole. Remarkably, we made the novel observation that Vps45 also contributes to mitochondrial function in that a Vps45-Gfp fusion protein co-localized with mitotracker, and a vps45 mutant showed enhanced sensitivity to inhibitors of electron transport complexes. Consistent with mitochondrial function, the vps45 mutant was impaired in calcium homeostasis. To assess the relevance of these defects for virulence, we examined cell surface properties of the vps45 mutant and found increased sensitivity to agents that challenge cell wall integrity and antifungal drugs. A change in cell wall properties was consistent with our observation of altered capsule polysaccharide attachment, and with attenuated virulence in a mouse model of cryptococcosis. Conclusion: These discoveries shed light on the molecular mechanisms underlying the uptake and use of iron as an essential nutrient for the virulence of C. neoformans. Further investigations could lead to the development of antifungal drugs that target Vps45-mediated processes.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

P494 New insights into the Cryptococcus neoformans capsule structure R. J.B. Cordero, A Casadevall Johns Hopkins Bloomberg School of Public Health, BALTIMORE, USA Objective: The capsule of Cryptococcus neoformans is a major virulence factor and a target for both therapeutic and diagnostic strategies. Understanding the capsule is challenging because of its molecular heterogeneity, fragility and the paucity of methodologies available for its isolation and analysis. Decades of research view the capsule as a highly hydrated and dynamic structure formed by a matrix of branched hetero-polysaccharides of large dimensions that decreases in compactness, rigidity, and penetrability as it lengthens radially from the cell wall. Further understanding of the capsule structure requires the integration of novel methodologies for its study and isolation while maintaining its native state. Methods: This project aims to develop new methodologies for isolating intact capsular polysaccharide based on mechanical force and to characterize the polysaccharide conformation at the nanometer scales –covering secondary and tertiary structural levelsusing high-resolution solution neutron scattering. Results: Preliminary experiments show that capsule isolation can be achieved mechanically using shear forces of 100–200 psi without disrupting the cell body. Preliminary Small Angle X-ray scattering data reveal that cryptococcal polysaccharides exhibit space dimensions similar to starch. Conclusion: The ability to isolate the capsule non-chemically demonstrate its modular nature and presents new opportunities to both consolidate previous works and obtain further physicochemical insights of the capsule and its immunological functions. Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 422499 7f8374be-cdcb-41d7-a1cc-6d5db328 bae2.56.39.png Caption 1: Cryptococcus neoformans encapsulated yeast cell visualized by India Ink counterstaining with light microscopy. Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 422499 7f8374be-cdcb-41d7-a1cc-6d5db 328bae2.png

P495 A new receptor is involved in the uptake of Sporothrix spp. by human macrophages G. W.P. Neves1 , N Caetana1 , J Willment2 , C Munro2 , N Gow2 , G Brown2 , L Lopes-Bezerra1 1 Universidade do Estado do Rio de Janeiro, RIO DE JANEIRO, Brazil 2 University of Aberdeen, ABERDEEN, United Kingdom Objective: In the present work a model based on human monocytes-derived macrophages (hMac) was used to study the host primary response to the yeast parasitic phase of the two major Sporothrix species with epidemiologic importance in Brazil. These species, S. schenckii and S. brasiliensis, are currently associated to human and feline sporotrichosis and, to the zoonotic transmission to humans and other animals in endemic areas of Rio de Janeiro State. Methods: Human peripheral blood monocytes cells were obtained from healthy volunteers after written consent. Once differentiated, hMac were infected with both S. schenckii and S. brasiliensis yeast cells, cultivated for 4 or 10 days. Aiming to evaluate the pathogen phagocytosis rate by hMac, microscopy and FACS assays were performed. ELISA tests were used for hMac cytokine secretion analysis and LDH assays were performed to evaluate pathogen mediated cytotoxicity. Nevertheless, antibodies against specific PRRs were used for functional analysis. Results: We hereby show that hMac exhibited a distinct ability to uptake S. schenckii and S. brasiliensis. The cell wall structure and composition is distinct for these two species. The hMac cytokine profile was also dissimilar as both species could induce TNFα secretion but only S. brasiliensis had the capacity to induce a significant secretion of an anti-inflammatory cytokine, IL-10. Furthermore, in a previous work, we showed that aging and/or nutritional stress modify the cell wall architecture. Accordingly, the recognition of each species by hMAc was also impaired by the yeast cell growth condition. Besides, an important modulation of the Sporothrix uptake was observed when the interaction assay was performed in the presence of heat inactivated human serum. Nevertheless, hMac cytotoxicity mediated by S. brasiliensis was dependent on the pathogen phagocytosis. Finally, data with antibodies against specific receptors suggest that a new receptor is involved in S. brasiliensis uptake. This receptor is currently being characterized. Conclusion: Our results clearly show that a thermo-labile serum factor is important to hMac recognition, uptake, cytotoxicity and cytokine response to Sporothrix spp. These results infer the participation of a new receptor, not yet described as involved in Sporothrix uptake. To our knowledge, this is the first report to describe the interaction of primary cell culture human macrophages with the parasitic phase of S. schenckii and S. brasiliensis

S158

P496 Evaluation of a Histoplasma antigen Lateral Flow Assay for the rapid diagnosis of progressive disseminated histoplasmosis in AIDS patients D. H. Caceres1 , M. Minderman2 , L. Chaney2 , B.L. Gomez3 , L.J. Wheat2 , T.M. Chiller1 , M.D. Lindsley1 1 Centers for Disease Control and Prevention (CDC), ATLANTA, USA 2 MiraVista Diagnostics, INDIANAPOLIS, USA 3 Universidad del Rosario and Corporacion para Investigaciones Biologicas (CIB), BOGOTA, Colombia Objective: Histoplasmosis is an important cause of mortality in persons living with HIV and AIDS (PLWHA), especially in countries where patients have limited access to antiretroviral therapies and diagnostic testing. In PLWHA, the progressive disseminated form of histoplasmosis (PDH) can be fatal without treatment. Early diagnosis is critical for providing proper treatment, however, current diagnosis by culture can take weeks and serology may be falsely negative early in infection or as a result of immunosuppression in these patients. Detection of Histoplasma antigen in patient specimens improves sensitivity and timeliness of diagnosis, but the current method by enzyme immunoassay must be performed by highly trained personnel in specialty laboratories. Recently, the development of the lateral flow technology has provided a method that is simple to use and can be performed in a setting closer to the patient. In this study, a lateral flow assay (LFA) was evaluated for the detection of Histoplasma antigen in sera. Methods: Using a MiraVista Diagnostics LFA for detection of Histoplasma antigen, we evaluated 47 serum samples: 19 from patients with AIDS and culture-proven PDH and 28 from patients with other fungal and bacterial infections, as well as healthy people. LFA devices were read by human eye and automated reader. Results: When the LFA test was read by human eye, sensitivity was 95% and specificity was 82%. Using an automated reader, sensitivity was 89% and specificity was 89%. The Kappa index compared human eye and automated reader was 0.87. Cross-reactions were observed principally in samples from patients with proven diagnosis of paracoccidioidomycosis. Conclusion: The MiraVista Diagnostics LFA had high analytical performance and good agreement between human eye and automated reader. This LFA allows Histoplasma antigen testing with minimal laboratory equipment and infrastructure requirements. Based on these results, this new method is a viable option for rapid diagnosis of PDH. LFA provides highly sensitive results in 90% sensitivity), immunodiffusion and complement fixation (two days; ∼65% sensitivity), and conventional microbiological tests, including histopathologic examination (one to two days; ∼75% sensitivity) and culture (two to four weeks; ∼80% sensitivity). Prompt diagnosis of PDH could impact public health by initiating early treatment thereby reducing mortality.

P497 Cryptococcal meningitis is associated with vitamin D deficiency in HIV-infected Zimbabwean adults TK Nyazika1 , L.S Mbwera2 , K Mhandire2 , C Musarurwa2 , W Mujaji2 1 Malawi Liverpool Wellcome Trust, BLANTYRE, Malawi University of Zimbabwe, HARARE, Zimbabwe 3 Univerisity of Zimbabwe, HARARE, Zimbabwe

Medical Mycology, 2018, Vol. 56, No. S2

P499 Changing etiology of chronic recurrent vulvovaginal candidosis in 2003–2016 in saint-petersburg, Russia Y Dolgo-Saburova, O Zhorzh, I Vibornova, O Shurpitskaya, E Raush, T Bogomolova, N Klimko I.Mechnikov North-Western State Medical University, ST. PETERSBURG, Russia Objective: Chronic recurrent vulvovaginal candidosis (CRVC) is a major clinical problem. Results of treatment of CRVC not always are satisfactory. Knowledge of etiology of CRVC is issential for adequate antimycotic therapy. Aim of the study – to examine etiology of CRVC in 2003–2016 in Saint-Petersburg, Russia and to study the peculiarities of CRVC caused by C. albicans with reduced in vitro fluconazole sensitivity. Methods: In prospective study in 2003–2016 we included 1390 immunocompetent HIV-negative CRVC patients (age 15– 70, median – 32,2). Sobel et al 2004 diagnostic criteria of CRVC were used. Determination of Candida species was made with AUXACOLOR 2 (BioRad, USA) and MALDI-TOF MS. CLSI M44-A disk-diffusion method was used for in vitro sensitivity testing to fluconazole. Bacterial vaginosis was diagnosed based on Amsel’s criteria and on detection of Gardnerella vaginalis and Atopobium vaginae using PCR method. RBV diagnosis was established at the ≥4 frequency of the episodes per year. Statistical data manipulation was carried out by of methods of parametric and nonparametric statistics. Results: In 2003–2006 yy. we included 251 CRVC patients (age 15–70, median – 29); 2007–2012 – 706 (age 17–57, median – 27,6); 2012–2016 – 433 (age 17–56, median – 31,3). In 2007–2016 increased the percentage of Candida albicans among agents of CRVC: 2003–2006 – 83%, 2007–2012 – 89%, 2012–2016 – 92% (P < 0,05). At the same time decreased the frequency of C. glabrata (5,2% vs 2,6% vs 2,8%) and C. krusei (4,8% vs 1,3% vs 1,6%). In 2012–2016 was detected reduction of C. albicans susceptibility to fluconazole in vitro: 91% vs 98,5% vs 99,1%, P < 0,05). In 2003–2016 among 1390 CRVC patients were found 55 patients with CRVC caused by C. albicans with reduced in vitro fluconazole sensitivity (the main group). The control group consisted of 270 patients with CRVC caused by C. albicans sensitive to fluconazole. Maintenance fluconazole therapy during 6 months for prevention of CRVC recurrence in the main group received 38% patients vs 31% in control group, P > 0,05). RBV was detected in 78% patients of the main group vs. 19% in control group, P < 0,01. Conclusion: In 2012–2016 the frequency of albicans grew from 83% to 92% (P < 0,05), and reduction of C. albicans sensitivity to fluconazole in vitro from 99% to 91% (P < 0,05) was detected. No influence of maintenance therapy with fluconazole during 6 months on resistance of albicans to this medication in vitro has been detected. The recurrent bacterial vaginosis was more often detected in cases of candidosis caused by C. albicans with a reduced sensitivity to fluconazole (78% vs. 18%, P < 0,01). Picture 1: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 426144 e1cf48b9-c69c-4e87-bc8f-7ebd 97a8022e.png Picture 2: https://www.eventure-online.com/parthen-uploads/89/8ISH/add 1 426144 e1cf48b9-c69c-4e87-bc8f-7ebd 97a8022e.png

2

Objective: Low [25(OH)D] vitamin D together with other immune factors are thought to predispose HIV-infected individuals to unfavourable health outcomes. However, whether serum vitamin D is associated with cryptococcal meningitis (CM) or its outcomes this remains unclear. Thus, the objectives of the present study were to determine the relationship between vitamin D deficiency and CM susceptibility in HIV-infected individuals. Methods: In a comparative cross-sectional study, we recruited 200 participants aged 18-years and older over a period of 12-months. The participants were stratified by HIV infection status into a HIV and CM co-infected group (HIV+/CM+), HIV co-infected with other meningitis group (HIV+/Men+/CM-), HIV infected and meningitis negative group (HIV+/Men-) and HIV uninfected and no meningitis group (HIV-/Men-). Serum vitamin D concentration was measured as a marker of vitamin D status. Results: An overall median vitamin D concentration of 48.8 ng/ml (interquartile range [IQR]; 26.9–63.8) was observed, with 14% of the participants being vitamin D deficient [25(OH)D ≤20 ng/ml]. The frequency of vitamin D deficient individuals was significantly higher in both the HIV+/CM+ (10/51; 20%) [P < 0.001] and HIV+/Men- (22%;11/50) when compared to the HIV-/Men- controls [P = 0.001]. Differences in vitamin D deficiency prevalence between HIV+/CM+ and HIV-/Men- remained significant (P = 0.014) while that with HIV+/Men- was not significant (P = 0.274) after adjusting for age, gender and CD4+ T-cell count in a multivariate logistic regression. Mortality was found to be higher among the HIV+/CM+ group (n = 34/51; 67%) when compared to HIV+/Men+/CM- group (n = 5/50; 10%) [P < 0.001]. Conclusion: Our data suggest that low serum vitamin D is associated with CM susceptibility. However, this association still requires further investigation.

P498 Eradication of fungi from sinuses helps in improvement of lower respiratory tract’s clinical symptoms in children with cystic fibrosis A. M. Barac1 , P. Minic2 , S Rubino3 1 Clinical Center of Serbia, BELGRADE, Serbia 2 Institute of Mother and Child, Belgrade, BELGRADE, Serbia 3 University of Sassari, SASSARI, Italy Objective: Although the pathogenesis of cystic fibrosis (CF) and fungal rhinosinusitis (FRS) has been widely investigated, the relationship of these diseases is not revealed yet. The aim of this study was to evaluate the new methodology for detection of fungi in the sinuses of CF patients with FRS, to assess the association of mycobiota of the paranasal sinus and the lower airways of patients with CF and to determine the performance of a functional endoscopic surgery of sinuses (FESS) to clinical symptoms and mycobiota of lower and upper airways. Methods: The prospective study with 38 CF patients was conducted between January and December 2016. After mycological analyses CF patients were divided into two groups: (1) patients with confirmed fungal presence in sinuses (FRS group) and (2) patients without fungi in sinuses (non-FRS group). The study design included: 1) history data; 2) subjective assessment of severity of chronic rhinosinusitis (CRS) by sinonasal outcome test (SNOT-22); 3) objective assessment of severity of CRS by anterior rhinoscopy; 4) CT imaging of sinuses; 5) mycological examinations of sinonasal aspirate and sputum (before FESS and 3 months after FESS) and 6) functional endoscopic surgery of sinuses (FESS). Subjective and objective assessments of diseases and sinonasal mycological examinations were done before and 3 months after FESS. Results: Our study revealed: (i) 64.2% of CF patients had CRS; (ii) fungal presence in sinonasal aspirate was confirmed in 42% patients (FRS group); (iii) patients with FRS had more severe form of CRS (75.4%) comparing to non-FRS group (P = 0.004); (iv) patients with CF and FRS had statistically more complications of CF (P = 0.024) and worsen response to therapy (P = 0.03) then non-FRS group; (v) all patients from FRS group underwent FESS; 91% of these patients had improvement of clinical symptoms 3 months after FESS; (vi) fungal presence was confirmed in sputum of 64% patients with CF, and in 91% patients from FRS group; (vii) the most common isolated species were Aspergillus fumigatus (57%) and A. flavus (26%) from sinonasal aspirate and A. fumigatus (61%), Alternaria alternata (21%) and A. flavus (12%) from sputum; (viii) 3 months after FESS, fungal presence was confirmed only in sinonasal aspirate of 7% CF patients and in sputum of 18% patients with CF (P = 0.009 and P = 0.01; respectively). Conclusion: This is the first study that investigates the association of fungal presence in sinuses and sputum of CF patients, and its correlation with clinical findings. There is important correlation between pulmonary and sinus pathogens in CF patients. Subjective and objective clinical symptoms of patients with CF were significantly decreased after FESS. This inseparable connection between fungal diseases of lower and upper airways should be consider when treating these infections in CF patients. A huge amount of fungal spores in the air is the threat for the development of fungal airway diseases and early detection of fungi in the sinuses of these patients could decrease complications of CF and prevent development of invasive fungal diseases.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

P500 Emergomyces pasteuriana causing a disseminated infection in an immunocompromised patient K. B. Gast, J.W.J. Esser, P. Huizinga, J.J. Verweij, P.H.J. Van Keulen Elisabeth-TweeSteden Ziekenhuis, TILBURG, Netherlands Objective: Until recently the clinical relevance of Emmonsia species, which are saprophytic, dimorphic fungi, was limited to causing a very rare pulmonary disease (adiaspiromycosis) in immunocompetent patients. In 1994, a novel Emmonsia species, E. pasteuriana, was described causing a disseminated mycosis in a HIV-infected woman. Recently, this species has been renamed to Emergomyces pasteuriana. E. pasteuriana differs from the Emmonsia species, that cause adiaspiromycosis, as it produces no adiaspores and is different from a clinical perspective as it causes disseminated, often fatal infections in predominantly immunocompromised patients. We report an immunocompromised patient with a disseminated E. pasteuriana infection, that has demonstrated positive results when using posaconazole treatment. Methods: A 62-year old women of Moroccan descent, with biliary cirrhosis, chronic kidney failure and auto-immune haemolytic anaemia treated with 50 mg/day of prednisolone and a past history of large B cell non-Hodgkin’s lymphoma, was presented to the emergency room with shortness of breath. Initial chest X-ray showed a density in the right upper lobe. Further analysis with positron emission tomography–computed tomography (PET-CT) was performed, showing two PET positive lesions in the right upper lobe and multiple PET positive subcutaneous lesions, suggestive of malignancy. Biopsy of two subcutaneous lesions showed no malignant cancer cells, but infiltration of predominantly histiocytes and within the histiocytes infiltration of structures resembling yeast cells. Additional molecular fungal identification with internal transcribed spacer rRNA polymerase chain reaction (ITS PCR) revealed Emergomyces pasteuriana. Cultures of these subcutaneous lesions showed, after 12 days of incubation, growth of a dimorphic fungus and molecular identification at the Center of Expertise in Mycology Radboudumc/Canisius Wilhelmina Ziekenhuis (J. F. Meis, MD) confirmed Emergomyces Pasteuriana. Patient was tested negative for human immunodeficiency virus infection and bone marrow biopsy showed no haematological malignancy. The patient was treated with posaconazole (MIC 0.063 mg/L) and prednisolone therapy was gradually lowered to 5 mg per day. After 2 months of posaconazole treatment, she experienced nausea and posaconazole tablets were switched to an oral suspension. A PET-CT scan conducted after 6 months of therapy showed a decline in number and PET intensity of the subcutaneous and lung lesions. Results: This is the first Dutch report of a disseminated Emergomyces pasteuriana infection in an immunocompromised patient showing clinical improvement when using posaconazole treatment. Furthermore, this case underlines that clinicians should be aware of invasive fungal infections in immunocompromised patients as they may mimic malignancy. In this instance, molecular diagnostic techniques can rapidly detect and identify fungi directly from clinical specimens. Conclusion: References Dukik K, et al. Novel taxa of thermally dimorphic systemic pathogens in the Ajellomycetaceae (Onygenales). Mycoses. 2017;60(5):296-309. Dukik K, et al. Antifungal Susceptibility of Emerging Dimorphic Pathogens in the Family Ajellomycetaceae. Antimicrob Agents Chemother. 2018;62(1): pii: e01886-17 Gori S, et al. Cutaneous disseminated mycosis in a patient with AIDS due to a new dimorphic fungus. J Mycol M´ed. 1998;8:57–63. Schwartz IS, et al. 50 Years of Emmonsia Disease in Humans: The Dramatic Emergence of a Cluster of Novel Fungal Pathogens. PLoS Pathog. 2015;11(11):e1005198.

ABSTRACT

S159

P501 The lung mycobiome and its relation with the environmental mycobiota: a pilot study

P504 Molecular characterization and in vitro antifungal susceptibility of candidal microbiome of diabetic patients

1 ´ ´ 2 F. Francisca Colom1 , E. Rubio-Portillo2 , D. Orts3 , E. Revelles1 , C. Perez , E. Llorca3 , J. Anton 1 ´ University Miguel Hernandez, ALICANTE, Spain 2 University of Alicante, ALICANTE, Spain 3 General University Hospital, ELDA, Spain

Fatemeh Zakavi1 , Mahin Tavakoli1 , Tahereh Shokohi2 , Saham Ansari3 , Mojtaba Taghizadeh armaki4 , Mohammad Hedayati2 1 Mazandaran University of Medical Sciences, SARI, Iran 2 Invasive Fungi Research Center, Mazandaran University of Medical Sciences, SARI, Iran 3 Shahid Beheshti University of Medical Sciences, TEHRAN, Iran 4 Babol University of Medical Sciences, BABOL, Iran

Objective: Highly-throughput sequencing-based studies have led to the detection of microorganisms colonizing the lower respiratory tract of healthy individuals. Most of these studies describe the bacterial community of the lungs. Our study was focused in the detection and description of the fungal microbiome of the lower respiratory tract of human adults and its relationship with the mycobiome detected in their domestic environment. Methods: Thirteen Broncho-alveolar lavage samples (BAL) were obtained by bronchoscopy in the General University Hospital in Elda (Alicante. Spain) from patients who underwent bronchoscopy for different diagnostic purposes. Some of these patients also gave their consent to perform a sampling of their houses’ environment (MA samples). All samples were processed for DNA extraction (and for cultures and other studies). The fungal Internal Transcribed Spacer (ITS2) of the extracted DNA was amplified and sequenced by the illumina system. Results of the massive sequencing were analyzed by QIIME 1.8.0 and compared with the ones in the UNITE Database. Results: The results show that the presence of mycobiome in the lower respiratory tract is constant in all patients, with an average richness of 13400 sequences per sample. A significant higher richness was detected in the domestic environment of the patients (averaging 35449 per sample). In contrast, the diversity of the mycobiome is significantly higher in the lungs than in the environment of the patients (Shanon index from 1.39 to 6,9 in BAL samples and from 0.2 to 3.8 in MA samples). Candida is in the core mycobiome of both environments together with Rhodotorula. In lung samples Cryptococcus is a constant member of the mycobiome as Aspergillus and Malassezia are in the domestic environment of the patients. All these genera were detected in both kinds of samples. Conclusion: The mycobiota of the environment seems to be the main source for the lower airway mycobiome. Although some of the species inhaled in relative high concentration disappear or become minority in the lung, others become more prevalent in this environment and constitute the core microbiome of the organ. Among these, fungi which are important opportunistic pathogens like Candida, Cryptococcus and Rhodotorula were detected.

P502 Epidemiological, clinical and aetiological profile of neglected tropical disease eumycetoma, north India M.R. Capoor, N. Dubey, A. Gupta, A.S. Hassan, A. Singh, M. Bala, V. Ramesh Vardhman Mahavir Medical College and Safdarjung Hospital, DELHI, India Objective: Eumycetoma is a neglected tropical disease due to its chronicity and high relapse rate. It is an important public health problem in Africa and South Asia.

Objectives: The current study was undertaken to know the epidemiological, clinical and aetiological profile of eumycetoma cases. Methods: A diagnosis was made clinically on the basis of the classical triad of tumefaction, discharging sinuses and presence of grains in these sinuses. Patients were included on the basis of age, gender, occupation, site of involvement, duration of disease, and underlying bony involvement detected by X-ray examination. the size, shape, colour and consistency of granules were examined macroscopically. Samples were subjected to potassium hydroxide mount, histopathological examination and culture. In cases of nonsporulating mold, slide culture was put up. Nonsporulating and unusual isolates were confirmed on sequencing of the ITS, D1 and D2 region. All patients with eumycetomas were managed with surgical debridement and oral antifungal drugs. Results: Total of 59 skin tissue samples/grains were received from the Department of Surgery and Department of Dermatology. Out of which 30 were eumycetoma and 4 were actinomycetoma. The 30 eumycetoma cases were analysed for the study. The age group included young adults (15-47 years) and majority were males who were farmers and labourers by occupation. The most common site of involvement was the lower extremities especially the foot (23 of 30, 76.66%). The extra- pedal sites of involvement were hands and trunk. All the cases revealed the presence of grains in the center of an abscess cavity comprising predominantly of neutrophils, lymphocytes, histiocytes with or without the presence of foreign body type of giant cells. The spectrum of mycetoma cases included: Aspergillus flavus (7), Aspergillus nidulans (4), Fusarium solani (4), Acremonium kiliense (4), Curvularia lunata (3), Exophiala jeanselmei (1), Madurella mycetomatis (1), Acremonium blochii (1), Fusarium incarnatum (1), Pseudoallescheria boydii (1), Pyrenochaeta romeroi (1), Lasidioplodia theobromae (1) and Phanerochaete chrysosporium (1). On follow up of most of the patients the chemoprophylaxis was successful except for one patient who required amputation. Conclusion: White grain mycetoma were more common than black grain mycetoma in north India. The aetiological diagnosis of eumycetoma relies mainly on isolation and identificationof the agent from the granule and in cases of nonsporulating molds by sequencing. As progression of eumycetomas is relatively slow and pain free, patients do not report early and are therefore, diagnosed at a late stage as was observed in the study. Health education of vulnerable population, especially farmers in tropical countries like India, is therefore, of utmost importance. Eumycetoma if diagnosed early and treated with wide surgical excision and antifungal therapy, the prognosis is good.

P503 Tinea capitis caused by Microsporum canis in three familial cases and it’s human to human transmission in non-endemic country, India M. R. Capoor1 , D. Sharma1 , B. Sharma1 , N. Khunger1 , S. Gupta1 , S.M. Rudramurthy1 , SHAMANTH A S1 , A. Chakrabarti2 1 Vardhman Mahavir Medical College and Safdarjung Hospital, DELHI, India 2 Postgraduate Institute of Medical Education and Research, CHANDIGARH, India Objective: Tinea capitis caused by the zoophilic fungus Microsporum canis is common worldwide in children due to the frequent practice of playing with animals among children. Although animal-to-human and fomite-induced transmission is the norm, inter-human transmission of the fungus is rare. M canis is rarely reported from human cases from India. Objectives: Isolation of M. canis from the three tinea capitis cases and to prove human-to-human transmission in second and third cases by polymerase chain reaction- amplified fragment length polymorphism (PCR-AFLP). Methods: A detailed clinical history was taken and a thorough clinical examination was done of all the three patients. Broken hair and perilesional scrapings were collected from the three patients and these were processed by direct microscopy and culture as per standard techniques. Antifungal susceptibility was done by microbroth dilution, CLSI, M27A3, 2012. Molecular typing of the isolates was carried out using fluorescent amplified fragment length polymorphism technique (AFLP). Results: We report here three such cases of tinea capitis caused by Microsporum canis wherein the first case was infected by the fungus by playing with a cat and the second and third cases were infected by human-to-human spread. Direct microscopy and culture clinched the diagnosis of Microsporum canis. The second and third patients in our case series did not give any history of contact with cats or dogs. However, they had a history of sharing personal items (skull cap and pillows) with the first patient, being source of human spread and it was confirmed by amplified fragment length polymorphism (AFLP) method. All the tested M. canis isolates formed single clade with more than 99.7% similarity with each other, thus confirming clonal origin of the isolates. All the three isolates were sensitive to itraconazole (0.125 μg/ml), terbinafine (0.06 μg/ml) and resistant to griseofulvin (4 μg/ml), respectively. All the three patients were successfully treated with oral terbinafine (double dose per kg body weight) and topical application of ketoconazole cream for two months. Conclusion: It is of utmost importance to elicit the history of contact with cats and dogs in a patient presenting with signs and symptoms suggestive of tinea capitis, which helps in identification of the source and prevent spread to other close contacts in cases of zoophillic fungi like M. canis. Human-to-human transmission, although rare, is a possibility. PCR-AFLP is a newer molecular method facilitating strain typing and determining clonality. Antifungal susceptibility is warranted as resistance to griseofulvin was observed in all the isolates as illustrated in our case.

Downloaded from https://academic.oup.com/mmy/article-abstract/56/suppl_2/S1/5033473 by guest on 12 June 2018

Objective: Candida species are considered as an important part of microbiome of the oral cavity, intestinal tract, vagina and skin. Diabetic patients are prone to more colonization with different microorganisms including Candida species and leading them to serious infections. In this study we aimed the molecular characterization and in vitro antifungal susceptibility of Candida species isolated from diabetic patients. Methods: The skin, mouth and vaginal samples were collected from 300 diabetic patients. The participants were also analyzed for HbA1c (Glycated heamoglobin). The identification of Candida isolates were done by culture on chrome agar and confirmed by PCR-RFLP method. Antifungal susceptibility of Candida isolates to itraconazole, ketoconazole, posaconazole, fluconazole lanoconazole, caspofungin and amphotericin B were determined by the CLSI broth microdilution method (M27-A3). Results: Patients were divided into two groups; controlled (HbA1c < 7) (17.3%) and uncontrolled (HbA1c > 7) (82.7%) diabetes. A total of 111 (37.0%) cases were positive for candida species. C. albicans was the most common species (104 cases, 93.7%). The majority of Candida species (88.3%) were isolated from patients with uncontrolled diabetes. All isolates of Candida species were highly susceptible to voriconazole. C. albicans was resistant against ketoconazole (2.9%), posaconazole (2.9%), itraconazole (4.8%) and amphotericin (6.8%). None-albicans species of Candida were susceptible to all tested antifungals. Conclusion: Overall the patients with uncontrolled diabetes are more susceptible to C. albicans colonization. The isolation of the resistant species of Candida to main antifungals in treatment of candidal infections can be considered as a major risk for diabetic patients to serious infections.

P505 Genome engineering of filamentous fungi for efficient novel molecule production J. W.A Van Dijk, C.C.C. Wang University of Southern California, LOS ANGELES, USA Objective: Fungi are a vast source of natural products and the ongoing efforts to sequence the genome of more species allows extensive genome mining for new compounds with potentially therapeutic effects. Another way to discover or generate new compounds is to genetically engineer the biosynthetic genes involved in product formation. In this research a class of biosynthetic enzymes was engineered to study functionality and create novel enzymes and molecules by rational domain swapping. Methods: A non-ribosomal peptide synthase (NRPS) -like family of enzymes that consists of three separate domains was heterologously expressed in Aspergillus nidulans, a model fungus that allowed us to easily modify those genes or introduce exogenous genes, often without the need to remove introns. Results: We showed that novel hybrid enzymes could be created and produce their expected product based on the functionality of each domain. We further diversified novel molecules by adding tailoring enzymes to expand the chemical space of the natural products. Conclusion: This work provided deeper insight in secondary metabolite biosynthesis in fungi and the extent to which we can manipulate it to make novel molecules. 1. C. J. Balibar et al. (2007) Nat. Chem. Biol. 3 (9), 584–592. 2. C.-J. Guo, et al. (2013) Org. Lett. 15 (14), 3562–3565.