Activin Bioactivity Affects Germ Cell Differentiation in the Postnatal ...

BIOLOGY OF REPRODUCTION 82, 980–990 (2010) Published online before print 3 February 2010. DOI 10.1095/biolreprod.109.079855

Activin Bioactivity Affects Germ Cell Differentiation in the Postnatal Mouse Testis In Vivo1 Sridurga Mithraprabhu,3 Sirisha Mendis,4 Sarah J. Meachem,4,6 Laura Tubino,4 Martin M. Matzuk,7,8,9 Chester W. Brown,8,10 and Kate L. Loveland 2,3,5,11 Department of Biochemistry and Molecular Biology,3 Monash Institute of Medical Research4 and Department of Anatomy and Developmental Biology,5 Monash University, Clayton, Victoria, Australia Prince Henry’s Institute of Medical Research,6 Clayton, Victoria, Australia Departments of Pathology,7 Molecular and Human Genetics,8 Molecular and Cellular Biology,9 and Pediatrics,10 Baylor College of Medicine, Houston, Texas Australian Research Council Centre of Excellence in Biotechnology and Development,11 Australia INTRODUCTION

The transforming growth factor beta superfamily ligand activin A controls juvenile testis growth by stimulating Sertoli cell proliferation. Testicular levels are highest in the first postnatal week, when Sertoli cells are proliferating and spermatogonial stem cells first form. Levels decrease sharply as Sertoli cell proliferation ceases and spermatogenic differentiation begins. We hypothesized that changing activin levels also affect germ cell maturation. We detected an acute and developmentally regulated impact of activin on Kit mRNA in cocultures of Sertoli cells and germ cells from Day 8, but not Day 4, mice. Both stereological and flow cytometry analyses identified an elevated spermatogonium:Sertoli cell ratio in Day 7 testes from Inhba BK/BK mice, which have decreased bioactive activin, and the germ cell markers Sycp3, Dazl, and Ccnd3 were significantly elevated in Inhba BK/BK mice. The flow cytometry measurements demonstrated that surface KIT protein is significantly higher in Day 7 InhbaBK/BK germ cells than in wild-type littermates. By Day 14, the germ cell:Sertoli cell ratio did not differ between genotypes, but the transition of type A spermatogonia into spermatocytes was altered in InhbaBK/BK testes. We conclude that regulated activin signaling not only controls Sertoli cell proliferation, as previously described, but also influences the in vivo progression of germ cell maturation in the juvenile testis at the onset of spermatogenesis.

Activins are members of the large transforming growth factor b superfamily of dimeric ligands. They are homodimers or heterodimers of the inhibin b subunits bA, bB, and bC, encoded by Inhba, Inhbb, and Inhbc, respectively. Activin A (Inhba) was originally identified as a reproductive hormone that regulates hypothalamic-pituitary-gonadal axis function [1]. We now understand that activin A is a multifunctional growth factor that is integral to normal mammalian development. In addition, many disease states are associated with perturbed activin signaling or alterations in activin-related molecules [2, 3]. Thus, it is critically important to understand the impact of altered activin signaling, particularly in systems where it has a well-documented physiological role. Activin A is of particular importance in the juvenile testis, and production of this ligand and its regulators is highly dynamic at the onset of spermatogenesis in rodents [4–8]. Sertoli cells, Leydig cells, and peritubular cells are all sites of activin A subunit synthesis in the newborn and juvenile testis [5, 7]. Activin A protein levels are highest during the first week of postnatal rat [7] and mouse [8] testis development, coinciding with the first appearance of spermatogonial stem cells and the final phase of Sertoli cell proliferation [7–9]. Gonocytes present before birth contain the Inhba subunit mRNA and protein; activin A protein, but not the mRNA, is present in these germ cells immediately after birth. During the transition of gonocytes into spermatogonia at the onset of spermatogenic differentiation, the protein is absent [5]. Concordant with the timing of this maturation, germ cells no longer contain activin A protein but instead synthesize mRNAs encoding two activin signaling inhibitors, follistatin and Bambi (BMP and activin membrane-bound inhibitor) [5, 6]. Chronic elevated activin signaling in vivo is linked with formation of Sertoli cell-derived tumors in mice within 4 wk after birth [10–12]. Additionally, testicular follistatin production increases after Day 4 in the mouse [8]. These findings collectively illustrate the capacity and need for finely tuned modulation of activin bioactivity as the testis develops. The action of activin is presumed to be direct on Sertoli cells and germ cells, as they contain mRNAs encoding the type 1A, type 1B, and type IIB activin receptor subunits in the Day 7 mouse [13]. The capacity for activin A to bind germ cells has also been demonstrated by in situ ligand binding [14]. However, the specific effect of activin signaling on germ cell differentiation has not been investigated in vivo to date. Because the decrease in testicular activin levels corresponded

activin, KIT, KITL, Sertoli cells, spermatogenesis, spermatogonia, testis

1

Supported by the National Health and Medical Research Council of Australia (#545916 and #545917 to K.L.L.), National Institutes of Health grants HD32067 (to M.M.M.) and HD01156 (to C.W.B.), Robert Wood Johnson Foundation (to C.W.B.), in part by Research Grant 5FY01-482 from the March of Dimes Birth Defects Foundation (C.W.B.). C.W.B. was a recipient of a Burroughs Wellcome Fund Career Award in the Biomedical Sciences. S. Mithraprabhu, S. Mendis, and L.T. were supported by Monash University PhD Scholarships. 2 Correspondence: Kate L. Loveland, Departments of Biochemistry and Molecular Biology and Anatomy and Developmental Biology, Monash University, Clayton, VIC 3168 Australia. FAX: 613 9902 9500; e-mail: [email protected] Received: 30 June 2009. First decision: 19 August 2009. Accepted: 11 January 2010. Ó 2010 by the Society for the Study of Reproduction, Inc. eISSN: 1529-7268 http://www.biolreprod.org ISSN: 0006-3363

980

Downloaded from www.biolreprod.org.

ABSTRACT

ACTIVIN CONTROLS GERM CELL MATURATION

MATERIALS AND METHODS Animals and Sample Collection All mice were housed at Monash University Central Animal Services. The day of birth was noted as Day 0. InhbaBK mice were maintained as heterozygotes on a congenic inbred C57BL6/J background, and littermates were used in the same experiment (wild-type Inhbaþ/ þ, heterozygous Inhbaþ/ BK , and homozygous InhbaBK/BK). Testes were collected at Day 0 from wildtype Inhbaþ/ þ, heterozygous Inhbaþ/, and homozygous Inhba/ mice and at Day 0, Day 7, and Day 14 from InhbaBK mice. The Inhba/ and their heterozygous and wild-type littermates are collectively designated herein as Inhba, and the InhbaBK/BK and their wild-type and heterozygous littermates are designated as InhbaBK. The InhbaBK were genotyped using the following primers: BK1 forward (CTGTTGAGTGGAAGGAGAG, designed from NM_008380 [Inhba promoter]), BK2 reverse (CGATGAGCCGAAAGTC GATG, designed from NM_008381 [Inhbb mature domain]), and BK3 reverse (GAGATGGGAAGAAGAAGA, designed from NM_008380 [Inhba mature domain]). Combined within one reaction, these primers generate a 308-base

pair (bp) wild-type product (BK1 and BK3) and a 193-bp mutant product (BK1 and BK2) [17, 31]. Samples for RNA preparation were snap frozen and stored at 808C. Testes from Postnatal Day 4 and Day 8 C57 3 CBA (F1) mice were used for Sertoli cell-germ cell coculture experiments. All procedures conformed to the National Health and Medical Research Council/Commonwealth Scientific and Industrial Research Organisation/Australian Agricultural Council Code of Practice for the Care and Use of Animals for Experimental Purposes, and all investigations were approved by the Monash University Standing Committee on Ethics in Animal Experimentation.

Sertoli Cell-Germ Cell Cocultures Seminiferous cords consisting of Sertoli cells and germ cells were isolated from Day 4 and Day 8 testes using sequential digestion to remove interstitial cells, as described previously [32]. The removal of interstitial cells is critical because Leydig cells of both juvenile and adult mice produce KIT [29, 33, 34]. Cord fragments were resuspended at a 1 testis:1.5 ml ratio (Day 4) and a 1 testis:2 ml ratio (Day 8) in Dulbecco modified Eagle medium (DMEM) supplemented with penicillin-streptomycin, nonessential amino acids, and Lglutamine (medium and all supplements from Life Technologies, Inc., Gaithersburg, MD). Six-well plates were precoated with laminin (0.1 lg/cm2 for 2 h; Sigma Chemical Co., St. Louis, MO) before addition of cord fragments (3 ml/well). After 24 h at 328C in 5% CO2, recombinant human activin A (100 ng/ml [Day 4] and 6.25–100 ng/ml [Day 8]; R&D Systems, Minneapolis, MN) or bovine follistatin (200 ng/ml [5]) was added to duplicate samples and then cultured for an additional 24 h. Cells were collected by scraping and washing plates in PBS, snap frozen, and stored below 708C until RNA extraction. Experiments were repeated six times for each treatment group.

Hormone Assays For serum analysis, Day 7 InhbaBK male mice were decapitated, and blood was immediately collected using a Microvette CB 300 capillary tube (Sarstedt, Nu¨mbrecht, Germany). Blood samples were centrifuged at 10 000 rpm for 20 min, and serum was collected and stored at 208C. To have sufficient serum for FSH assay, samples from three to five mice were pooled for each genotype, and at least six samples per genotype were used. Serum FSH concentrations were determined using radioimmunoassay reagents kindly provided by Dr. A. Parlow, National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) (Bethesda, MD). The iodination preparation and antiserum used were rFSH I-8 and anti-rFSH-S-11, respectively, and the results are expressed in terms of NIDDK mFSH-RP-1. Goat anti-rabbit IgG (GAR#12; Monash Institute of Medical Research, Monash University, Melbourne, Australia) was used as a secondary antibody. All measurements were performed on 20-ll duplicates of serum. The lowest limit of detection was below 1.25 ng/ml; the average within-assay coefficient of variation was 7.3%, calculated using a pool of normal mouse serum in each assay.

Stereology The optical dissector stereological method [35] was used to determine the total number of Sertoli cells and germ cells per testis in resin sections. All measurements were performed using a 1003 objective (BX-50 microscope; Olympus). A microcator (D 8225; Heideinhain, Traunreut, Germany) attached to the microscope stage monitored scanned depth. Images were captured by a JVC TK-C1381 video camera coupled to a computer using a Screen Machine II fast multimedia video adapter (FAST, Hamburg, Germany). The software package CASTGRID V1.60 (Olympus) was used to generate an unbiased counting frame superimposed on the video image. Fields were selected by a systematic uniform random sampling scheme, as previously described [35, 36], using a motorized stage (Multicontrol 2000, ITK, Lahnau, Germany). The final screen magnification was 2708-fold. Sertoli cells and spermatogonia were identified based on location within the cord and shape of the cell nucleus. Sertoli cells exhibited irregularly shaped nuclei, which were often positioned toward the basement membrane and contained multiple nucleoli. Type A spermatogonia were identified as circular to ovoid cells with large circular nuclei, located close to the basement membrane. Type B spermatogonia were distinguished by the presence of an ovoid nucleus, large chromatin patches along the nuclear envelope, and their location on the basement membrane. Spermatocytes were identified by round nuclei and chromatin threads (leptotene and zygotene) or lightly stained chromatin with densely stained nucleolar material (pachytene). At least 200 Sertoli cell nuclei and 300 germ cells per animal per sample, with at least three animals per genotype, were counted using an unbiased counting frame (626-lm2 area).


with the onset of spermatogenesis, we hypothesized that activin might regulate germ cell maturation by controlling the activity of key genes implicated in this process. Activin transgenic mouse models provide an ideal tool for investigations of germ cell fate in an environment of chronically reduced or absent activin. The Inhba/ mouse lacks all Inhba subunits and hence produces no activin A [15]; these mice die at birth, failing to suckle due to abnormal palate formation. The Inhba knockin mouse line (InhbaBK/BK) has the Inhba mature domain sequence replaced by the less bioactive Inhbb mature domain sequence, with activin B replacing activin A [16, 17]. In normal testis, the Inhbb subunit protein is present in spermatogonia, spermatocytes, Sertoli cells, and Leydig cells [8]. Activin B exhibits lower affinity for activin A receptors and preferentially binds to ALK7 (activin receptor 1C [ACVR1C]) [18, 19]. Heterozygous Inhba þ/BK mice appear normal, while InhbaBK/BK males exhibit delayed fertility but survive to adulthood [17, 20]. Serum follicle-stimulating hormone (FSH) levels are approximately 50% higher in InhbaBK/BK adult males than in controls [17], indicating that the reproductive abnormalities are not due to deficient FSH production. The significantly lower testicular volume of adult InhbaBK/BK mice relative to their wild-type littermates is similar to that observed in Acvr2/ mice [21]. Thus, activin A has an important role in postnatal testicular growth that cannot be replaced by activin B. The influence of activin on germ cell maturation at the onset of postnatal spermatogenesis was investigated in the present study using both in vitro (acute model) and in vivo (chronic model) analyses. As an essential and established marker of germ cell maturation, we chose to examine the KIT tyrosine kinase receptor, which affects spermatogonial proliferation, differentiation, and survival at the onset of spermatogenesis [22–26]. In the first postnatal wave and during adult spermatogenesis, KIT signaling is initiated by binding of the kit ligand (KITL), which is synthesized in Sertoli cells [27]. Spermatogonial stem cells lack KIT protein [28], but KIT signaling is essential for survival of the more mature differentiating spermatogonia, and the presence of the receptor is an established marker of this cell type [22, 28– 30]. Evidence that activin signaling can affect germ cell maturation emerged both from measurements of Kit mRNA and KIT surface protein (germ cell maturation markers) and from stereological evaluation of germ cell and Sertoli cell numbers in Day 7 and Day 14 InhbaBK/BK mice. These outcomes demonstrate that activin bioactivity levels influence germ cell maturation at the onset of spermatogenesis, contributing to the complex signaling networks that govern normal testis development.

981

982

MITHRAPRABHU ET AL. TABLE 1. List of oligonucleotide primer sequences used to amplify target genes. Gene symbol

Accession no.

Forward primer

Reverse primer

Actb Rn18s Kit Ddx4 (Mvh) Insl3 Clu Kitl Sycp3 Ccnd3 Dazl

NM_007393 NR_003278 NM_021099 NM_010029 NM_013564 NM_013492 NM_013598 NM_011517 NM_007632 NM_010021

aggctgtgctgtccctgtat gtaacccgttgaaccccatt tcatcgagtgtgatgggaaa ggtccaaaagtgacatatataccc tgcagtggctagagcagaga gagcttcatgacccccacta tggatgacctcgtgttatgc gaaatctgggaagccacctt cgagcctcctacttccagtg atgtctgccacaacttctgag

aaggaaggctggaaaagagc ccatccaatcggtagtagcg ggtgacttgtttcaggcaca ttggttgatcagttctcgagt gtgcagccagtaagacagca cttcaggcatcctgtggagt tcagatgccaccataaagtcc ggctttgaaagaagctttgg ccacagcctggtccgtatag ctgatttcggtttcatccatcct

Quantitative mRNA Analysis

Statistical Analysis

Total RNA was prepared from coculture and whole-testis samples using the RNeasy extraction kit (Qiagen, Hilden, Germany) and DNase I (Ambion, Austin, TX), as previously described [29]. The RT with random hexamers (Applied Biosystems, Foster City, CA) was performed according to the enzyme manufacturer’s guidelines. The reaction mixture consisted of 8 ll of Roche (Mannheim, Germany) SYBR Green PCR Mix (Day 4 and Day 8 Sertoli cellgerm cell cocultures) or Applied Biosystems SYBR PCR Master Mix (transgenic mouse testes) with 500 nM of each forward and reverse primers for mouse target genes and 2 ll of diluted template cDNA. The PCR was performed with either a Light Cycler 2.0 (Roche) at 958C for 10 min and then 48 cycles of amplification at 958C for 15 sec, 608C for 5 sec, and 728C for 10 sec or with a 7900HT real-time system (Applied Biosystems) at 958C for 10 min and then 45 cycles of amplification at 958C for 15 sec, 628C for 30 sec, and 728C for 30 sec. Each reaction was performed in triplicate. Primers are listed in Table 1. For sample loading normalization, Actb (encoding beta-actin [for transgenic mouse testes]) and Rn18s (for culture samples) were used. The mRNA levels of Actb and Rn18s were not significantly different between samples. Amplified products were all verified by melting curve analysis, agarose gel electrophoresis, and sequencing. Correlation of crossing points from the sample amplification plot with target mRNA copy number was enabled by producing a standard curve for each product in every experiment using cDNA containing the target gene. Values of target mRNA of the control samples from each coculture experiment were set at 1 to control for differences between experiments. The test sample mRNA values were calculated as the fold change from control values. The wild-type samples were set at a mean arbitrary value of 1, and the heterozygous and mutant mean outcomes were calculated as the fold change from wild-type values. Data are presented with the SEM from at least five samples per genotype for each age.

Data are presented as the mean 6 SEM. All data were analyzed using oneway ANOVA combined with Tukey posttest or unpaired t-test for comparison between each age or treatment group using GraphPAD PRISM 5 (GraphPAD Software, San Diego, CA).

For each flow cytometry analysis, a single testis from each mouse was decapsulated and digested with collagenase-DNase-hyaluronidase in DMEM (1 mg/ml, 0.5 mg/ml, and 1 mg/ml, respectively; Sigma Chemical Co.) for 15–20 min at 358C in a shaking water bath. A 2- to 3-min incubation with 0.05% trypsin (Invitrogen, Carlsbad, CA)-ethylene diamine tetraacetic acid solution was followed by trypsin inactivation with PBS and 10% fetal calf serum (Hyclone, Utah, TX) to obtain single-cell suspensions. Cell labeling for flow cytometry was performed with minor modification of established protocols [37, 38]. Briefly, cells were incubated with the biotin-conjugated rat anti-KIT monoclonal ACK4 antibody [39] at 1:50 dilution in 2.4G2 (rat hybridoma antiFc receptor supernatant [38]) and 2% normal rat serum (NRS; Sigma Chemical Co.) for 30 min. Secondary staining was performed with R-phycoerythrin [PE]conjugated streptavidin (Zymed, South San Francisco, CA) at 1:100 dilution in 2.4G2 and 2% NRS for 30 min. Cells were subsequently fixed in 2% paraformaldehyde for 20 min, permeabilized with 0.1% Triton-X-PBS (BDH Lab Supplies, Poole, England) for 5 min, and immediately stained with antiMVH (1:1000, rabbit polyclonal; Abcam Inc., Cambridge, MA; specificity verified by Western blot [data not shown]) in 1% bovine serum albumin (BSA; Sigma Chemical Co.) and 10% normal goat serum (Sigma Chemical Co.) in PBS for 30 min, followed by Alexa Fluor 488 goat anti-rabbit secondary antibody (1:500 in 0.1% BSA-PBS; Molecular Probes, Eugene, OR) for 30 min. Cells were analyzed on a flow cytometry Canto II Analyzer (Becton Dickinson, Franklin Lakes, NJ). The proportion of KITþ, KIT, MVHþ, and MVH cells in the total cell population was determined for each genotype. The mean fluorescence intensity of KIT-PE was also analyzed. Separate analyses were conducted for at least five males per genotype from each of four independent litters from Inhbaþ/BK matings.

Developmentally Regulated Impact of Activin on Germ Cell Differentiation In Vitro Data compiled from Affymetrix (Affymetrix Inc., Santa Clara, CA) microarrays (http://www.ncbi.nlm.nih.gov/geo/gds/ gds_browse.cgi?gds¼605) indicate that Inhba and Kit mRNA levels are inversely correlated during the first two postnatal weeks in the mouse testis, the time when spermatogenic differentiation first begins [40] (Fig. 1A). We tested the impact of acute activin treatment on Kit expression in germ cells using Sertoli cell-germ cell cocultures from Day 4 and Day 8 testes. Leydig cells, which also express Kit [29], are removed during preparation of these samples. The suitability of these cocultures for assessing changes in Kit mRNA was first tested by addition of retinoic acid and BMP4 on cells from Day 4 wild-type testes. As predicted [41–43], both factors increased Kit mRNA levels (data not shown). The absence of Leydig cells was indicated by low or undetectable insulin-like 3 (Insl3), a fetal Leydig cell marker [44] (data not shown), and Kit values were normalized to mRNA measurements of the germ cell marker DEAD (Asp-Glu-Ala-Asp) box polypeptide 4 (Ddx4, also known as mouse VASA homologue and designated as Mvh herein) for each sample to correct for differences in germ cell numbers between samples during plating. Activin had no significant impact on either Kit or Mvh mRNA levels at Day 4 (Fig. 1B). In contrast, Kit mRNA in Day 8 samples changed significantly in response to activin doses of 25 ng/ml (P , 0.05), 50 ng/ml (P , 0.05), and 100 ng/ml (P , 0.001) (Fig. 1C) relative to untreated controls. Because of its highly specific and virtually irreversible binding to activin, follistatin was added simultaneously with activin. Follistatin alone did not alter Kit mRNA levels (Fig. 1E), but it did suppress the negative impact of activin on Kit when added simultaneously. Mvh mRNA levels at both ages and in different treatments groups did not differ significantly compared with untreated samples (Fig. 1, D and F). In Vivo Levels of Activin Affect Leydig Cells, Sertoli Cells, and Germ Cells in Newborn and Day 7 Mice The effect of altered activin signaling on germ cell differentiation was then tested in vivo using activin transgenic mice. Because Inhba subunit mRNA is synthesized in germ cells, Sertoli cells, and Leydig cells within the juvenile mouse


Flow Cytometry Analysis

RESULTS


testis [8], testes of Day 0 Inhba and InhbaBK and Day 7 InhbaBK were assessed for mRNAs of Mvh, Insl3, and the Sertoli cell marker clusterin (Clu) [45]. This analysis was done to gain an understanding of any changes in the proportions of these cell types. The Mvh mRNA levels in Day 0 Inhba and in Day 0 and Day 7 InhbaBK testes were higher compared with wild-type littermates, reaching significance in homozygous Day 0 Inhba/ and InhbaBK/BK testes (P , 0.01) and in Day 7 Inhba þ/BK and InhbaBK/BK testes (P , 0.05 and P , 0.01,

FIG. 2. In vivo levels of activin affect germ cell, Leydig cell, and Sertoli cell populations in newborn and Day 7 mice. Real-time PCR analysis of whole testis mRNA levels in Day 0 Inhba mice ( þ/ þ, þ/, /) and Day 0 and Day 7 InhbaBK mice ( þ/ þ, þ/BK, BK/BK). A) Day 0 Inhba Mvh. B) Day 0 InhbaBK Mvh. C) Day 7 InhbaBK Mvh. D) Day 0 Inhba Insl3. E) Day 0 InhbaBK Insl3. F) Day 7 InhbaBK Insl3. G) Day 0 Inhba Clu. H) Day 0 InhbaBK Clu. I) Day 7 InhbaBK Clu. Different lowercase letters denote significant differences between genotypes within each age group (P , 0.05). þ/ þ, wild type; / þ and þ/BK, heterozygous; / and BK/BK, homozygous. All values have been normalized to Actb mRNA levels and are recorded as the relative fold change from the þ/ þ value, which is set at 1. At least five testes from individual animals were sampled independently for each genotype and age. Data represent the mean 6 SEM.

respectively) (Fig. 2, A–C). The Insl3 mRNA persists in the juvenile testis, and this was higher in testes of Inhba/ and InhbaBK/BK mice at Day 0 (P , 0.05) and in both Inhba þ/BK and InhbaBK/BK samples at Day 7 (P , 0.01) compared with wild-type animals (Fig. 2, D–F). In contrast, mRNA encoding Clu was present at reduced levels in Day 7 InhbaBK/BK testes (Fig. 2, G–I). Chronic Activin Reduction Affects the Relative Proportions of Germ Cells and Sertoli Cells in Day 7 InhbaBK/BK Testes Whole-testis mRNA analyses of activin transgenic mice revealed that the proportions of Sertoli cells and germ cells are altered. Therefore, stereological analysis of Day 7 germ cells and Sertoli cells was performed to quantify this change. Spermatogonial numbers in Day 7 InhbaBK were not significantly different among the three genotypes (Fig. 3A), but Sertoli cell numbers were significantly reduced (P , 0.05) in both InhbaBK/ þ and InhbaBK/BK testes (Fig. 3B). Thus, the germ cell:Sertoli cell ratios were elevated in heterozygous and


FIG. 1. Developmentally regulated impact of activin on germ cell differentiation in vitro. A) Affymetrix data illustrate relative expression levels of activin bA subunit (grey line) and Kit (black line) across postnatal development in mouse. Data available at: http://www.ncbi.nlm.nih.gov/ geo/gds/gds_browse.cgi?gds¼605. The germ cell types at specific ages during testicular development are shown. The most mature germ cells in the testis are represented at each age: gonocytes (G) at Day 0, type A (Type A) spermatogonia at Days 4–6, type B (Type B) spermatogonia at Days 6– 8, pachytene spermatocytes (PS) at Day 16, round spermatids (RS) at Day 26, and elongating spermatids (ES) at Day 42. B) Real-time PCR analysis of Kit and Mvh mRNA levels in Sertoli cell-germ cell cocultures of Day 4 wild-type mice treated with exogenous activin (ACT) compared with the untreated group (CON). C) Relative Kit mRNA levels in Day 8 Sertoli cellgerm cell cocultures in response to increasing doses of human recombinant activin treatment compared with the CON group. Groups were treated with 25, 50, and 100 ng/ml of activin (A25, A50, and A100, respectively). D) Relative Mvh mRNA levels compared with the CON group in response to different doses of activin. E) Relative levels of Kit mRNA compared with the control samples when treated with ACT, follistatin (FST), or a combination of both (COMBI). Activin treatment results in a significant reduction compared with untreated controls. F) Relative levels of Mvh mRNA compared with the CON group when treated with ACT, FST, or COMBI. Different lowercase letters represent significant differences between genotypes (P , 0.05). Kit mRNA levels have been normalized to Mvh mRNA values to correct for differences in germ cell plating between wells. All samples have been normalized to Rn18s levels and are reported as a relative fold change from the control group value, which is assigned a value of 1. Data represent the mean 6 SEM from six independent cultures.

983

984

MITHRAPRABHU ET AL.

homozygous mutant testes compared with wild-type littermates (Fig. 3C). The FSH levels are elevated in adult InhbaBK/BK serum. Therefore, FSH levels were measured in Day 7 InhbaBK mice using serum samples to assess if the changes in the cell proportions are due to differences in FSH levels. The FSH levels in InhbaBK/BK were not significantly different from those in Inhba þ/ þ mice; however, they were significantly elevated compared with those in InhbaBK/ þ mice (P , 0.05) (Fig. 3D). Reduced Bioactive Activin Levels Associated with Elevated Levels of Kit and Kitl mRNAs While the Kit mRNA signal is derived from both germ cells and Leydig cells in whole-testis samples, germ cells in the Day 0 wild-type testis express low amounts of this mRNA relative to Day 6 testes [29]. Kit mRNA levels were significantly higher in Day 0 testes of both Inhba/ and InhbaBK/BK mutant mice (P , 0.001) compared with their wild-type littermates (Fig. 4, A and B). In Day 7 animals, Inhba þ/BK testes had higher Kit levels compared with Inhba þ/ þ or InhbaBK/BK samples (P , 0.05) (Fig. 4C). The Kitl mRNA levels in newborn Inhba and InhbaBK showed no differences between samples of different genotypes (Fig. 4, D and E), while Day 7 Inhba þ/BK and InhbaBK/BK testes had significantly lower Kitl compared with Inhba þ/ þ (P , 0.05) (Fig. 4F). This difference in Kitl mRNA could be attributed to the changing Sertoli cell numbers in Inhba and InhbaBK testes (Fig. 3B); hence, Kitl mRNA values from newborn and Day 7 testes were normalized to the amount of Clu mRNA present in each of these genotypes (from Fig. 2, G–I) and are shown in Figure 4, G–I. Following this normalization, Kitl mRNA values were significantly elevated in Inhba þ/ testes at Day 0 and in InhbaBK/BK testes at Day 7 compared with the wild-type testes at each age (Fig. 4, G–I).

Testes with Reduced Bioactive Activin Exhibit Elevated Transcription of Meiotic Germ Cell Markers Additional insight into the impact of reduced activin bioactivity on germ cell maturation was gained from measuring levels of three transcripts (Fig. 5, A–C) that are upregulated as germ cells progress from mitosis into meiosis. Sycp3, encoding the synaptonemal complex protein 3 [46], was elevated 4-fold in InhbaBK/BK testes compared with wild-type samples (Fig. 5A), while a less dramatic but significant increase was measured for Ccnd3 (Fig. 5C), encoding cyclin D3, which is a target of the KIT-KITL signaling pathway in the juvenile testes [47, 48]. A slight elevation in the deleted in azoospermia-like (Dazl) transcript, which is required for spermatogonial differentiation and formation of preleptotene spermatocytes [49, 50], was not significant (Fig. 5B). Increased Proportion of Differentiated Spermatogonia and Higher Germ Cell Surface KIT in Day 7 InhbaBK/BK Testes At Day 7, both germ cells and Leydig cells express Kit [29]; therefore, a different approach was used to assess KIT levels in germ cells of mice with decreased activin bioactivity. The flow cytometry measurements of KIT and MVH were performed with Day 7 testes from InhbaBK mice, and percentages of KIT þ (R2 and R3), KIT (R4 and R5), MVH þ (R3 and R5), and MVH (R2 and R4) cells were determined (Fig. 6A and Table 2). Figure 6A shows a typical result for testis cells from a single Inhba þ/BK mouse testis. The proportion of KIT þ cells (R2 and R3) (Fig. 6A) was significantly increased in Inhba þ/BK and InhbaBK/BK samples compared with wild-type samples when fold changes from multiple samples were analyzed (P , 0.05) (Table 2). The Leydig cell proportional representation relative to other cell types (KIT þ MVH [R2]) did not differ (values were 3.9%–5.4%). The percentage of differentiated spermatogonia (KITþ MVH þ [R3]) relative to all other cell


FIG. 3. Chronic activin reduction affects relative proportions of germ cells and Sertoli cells in Day 7 InhbaBK/BK testes. A–C) Stereology data show the numbers of spermatogonia and Sertoli cells (3106) and the germ cell:Sertoli cell ratios. A) Spermatogonia in Day 7 InhbaBK mice (þ/þ, BK/þ, BK/BK). B) Sertoli cells in Day 7 InhbaBK mice (þ/þ, BK/þ, BK/BK). C) Germ cell:Sertoli cell ratios in Day 7 mice (þ/þ, BK/þ, BK/BK). Data represent the mean 6 SEM from at least three samples per genotype. Different lowercase letters denote significant differences between genotypes within each age group (P , 0.05). D) The FSH levels in Day 7 InhbaBK mice (þ/þ, BK/ þ, BK/BK). At least six samples per genotype were used for FSH serum analyses. Data are given as box and whiskers. The box extends from the 25th percentile to the 75th percentile, with a horizontal line at the median (50th percentile), and the whiskers show the range of the data. Different letters denote significant differences between genotypes within each age group (P , 0.05). þ/þ, wild type; /þ and þ/BK, heterozygous; / and BK/BK, homozygous.


985 FIG. 4. Reduced bioactive activin levels regulate Kit and Kitl mRNA production and increase the levels of maturation markers. Real-time PCR analysis of whole testis mRNA levels in Day 0 Inhba mice (þ/þ, þ/, /) and Day 0 and Day 7 InhbaBK mice (þ/þ, þ/BK, BK/BK). A) Day 0 Inhba Kit. B) Day 0 InhbaBK Kit. C) Day 7 InhbaBK Kit. D) Day 0 Inhba Kitl. E) Day 0 InhbaBK Kitl. F) Day 7 InhbaBK Kitl. G) Day 0 Inhba Kitl normalized to Clu mRNA. H) Day 0 InhbaBK Kitl normalized to Clu mRNA. I) Day 7 InhbaBK Kitl normalized to Clu mRNA. þ/þ, wild type; /þ and þ/BK, heterozygous; / and BK/BK, homozygous. All values have been normalized to Actb mRNA levels and are recorded as the relative fold change from the þ/þ value, which is set at 1. At least five testes from individual animals were sampled independently for each genotype and age. Different lowercase letters represent significant differences between genotypes (P , 0.05). Data represent the mean 6 SEM.

differentiated spermatogonia (66% vs. 55%) and a smaller proportion of undifferentiated spermatogonia (34% vs. 45%) in InhbaBK/BK samples (P , 0.05) (Table 2). The proportion of somatic cells (KIT MVH [R4]), which includes Sertoli cells, was significantly lower in the Inhba þ/BK and InhbaBK/BK testes relative to wild-type testes, reflecting the lower number of Sertoli cells, as shown in Figure 3B. Profile mapping of the mean fluorescence intensities of PE as a measure of surface KIT protein on individual cells within

FIG. 5. Testes with reduced bioactive activin exhibit elevated transcription of meiotic germ cell markers. Real-time PCR analysis of whole testis mRNA levels in Day 7 InhbaBK mice ( þ/ þ, BK/BK) was performed for three maturation markers, Sycp3, Dazl, and Ccnd3 (cyclin D3). A) Day 7 InhbaBK Sycp3. B) Day 7 InhbaBK Dazl. C) Day 7 InhbaBK Ccnd3. þ/ þ, wild type; BK/BK, homozygous. All values have been normalized to Actb mRNA levels and are recorded as the relative fold change from the þ/ þ value, which is set at 1. At least five testes from individual animals were sampled independently for each genotype and age. Different lowercase letters represent significant differences between genotypes (P , 0.05). Data represent the mean 6 SEM.


types was significantly elevated in Inhba þ/BK and InhbaBK/BK testes (P , 0.05) compared with wild-type samples. In contrast, the contribution of undifferentiated spermatogonia (KIT MVH þ [R5]) to the total number of germ cells was significantly decreased in InhbaBK/BK testes (P , 0.05). The proportions of differentiated (KITþ MVH þ [R3]) and undifferentiated (KIT MVH þ [R5]) spermatogonia in the total germ cell population (total MVH þ [R3 and R5]) were different among the three genotypes. There was a higher proportion of

986

MITHRAPRABHU ET AL.

FIG. 6. Higher germ cell surface KIT in InhbaBK/BK testes. A) The flow cytometry analyzer profile of Inhbaþ/BK testicular cells stained for KIT and MVH, with PE indicating KITþ cells on the y-axis and Alexa Fluor 488 indicating MVHþ cells on the x-axis. Cells in each quadrant represent the following: R2: KITþ MVH (Leydig cells); R3: KITþ MVHþ (differentiated germ cells); R4: KIT MVH populations; and R5: KIT MVHþ (undifferentiated germ cells). B) The PE intensity profiles representing KITþ germ cells of Inhbaþ/þ. C) The PE intensity profiles representing KITþ germ cells of Inhbaþ/BK. D) The PE intensity profiles representing KITþ germ cells of InhbaBK/BK.

Germ Cell Maturation Rate Is Altered in Day 14 InhbaBK/BK Mice Examination of Day 14 testes using stereological analysis revealed that total germ cell and Sertoli cell numbers were

significantly decreased in InhbaBK/BK testes (Fig. 7, A–E). The absolute numbers of type A spermatogonia in Inhba þ/BK and InhbaBK/BK testes were reduced to 63.6% and 28.6%, respectively, compared with wild-type testes at Day 14 (Fig. 7A), while type B numbers were significantly reduced to 15.7% of wild type only in InhbaBK/BK samples (Fig. 7B). Similarly, spermatocyte (Fig. 7C), total germ cell (Fig. 7D), and total Sertoli cell (Fig. 7E) numbers were significantly reduced (to around 30.6%, 25.9%, and 28.3% of wild type, respectively) only in InhbaBK/BK testes. In contrast to the elevated germ cell:Sertoli cell ratio measured in InhbaBK/BK testes at Day 7 relative to wild-type samples, this ratio did not differ between wild-type and InhbaBK/BK samples at Day 14

TABLE 2. Increased proportion of differentiated spermatogonia.*

Genotype þ/þ (n ¼ 5) þ/BK (n ¼ 5) BK/BK (n ¼ 5)

Leydig and differentiated germ cells (total KITþ)

All germ cells (total MVHþ)

Differentiated spermatogonia (KITþMVHþ)

Undifferentiated spermatogonia (KITMVHþ)

Other somatic cells (KITMVH)

18.0 6 4.6a 27.3 6 7.5b 28.1 6 11b

25.5 6 6.7a 34.7 6 5.5b 34.2 6 6.3b

14.1 6 4.3a (55%a) 21.8 6 6.0b (62%ab) 23.2 6 9.9b (66%b)

11.4 6 3.5 (45%a) 12.8 6 3.1a (38%ab) 10.9 6 5.6b (34%b)

70.4 6 7.1a 59.8 6 6.8b 60.9 6 6.1b

* Percentages of KITþ (R2 and R3), KIT (R4 and R5), MVHþ (R3 and R5) and MVH (R2 and R4) cells are represented in each of the quadrants (from Fig. 6A). Numbers listed correspond to the percentage of cells that fall within each quadrant (R2, R3, R4, and R5) relative to the total cell count for that sample. Data are represented as mean 6 SEM from analysis of at least five independent samples per genotype. The proportion of spermatogonial type relative to the total germ cell population (R3/R3 þR5 or R5/R3 þR5) is shown as a percentage in parentheses. a,b Different superscript letters represent significant differences between genotypes (P , 0.05).


the KIT þ MVH þ (R3) region revealed that InhbaBK/BK germ cells had a higher mean signal intensity (Fig. 6D) than Inhba þ/ þ (Fig. 6B) and Inhba þ/BK (Fig. 6C) germ cells. This demonstrates that individual differentiated spermatogonia in mice with chronically reduced bioactive activin have higher KIT protein levels. This shift was observed in the five separate experiments.


987

(Fig. 7F). The proportions of germ cell subtypes (type A spermatogonia and spermatocytes) relative to total germ cell numbers were not significantly different (Fig. 7G). However, type B spermatogonia proportions were significantly lower in the InhbaBK/BK testes (Fig. 7G). The ratio of cells that are converted from type A to type B and then subsequently to spermatocytes was calculated for Day 14 InhbaBK/BK and Inhba þ/ þ testes (Fig. 7H). There was a significant difference in the germ cell type transition between wild-type and InhbaBK/BK samples at Day 14. The type A spermatogonia:type B spermatogonia:spermatocytes ratio was 1:2.24:1.95 in wildtype testes; this ratio was 1:1:4.3 in InhbaBK/BK testes. DISCUSSION This report presents the first evidence to date that acute and chronically altered activin levels influence the maturation of germ cells both in vitro and in vivo. This assessment was performed using KIT production as the primary indicator of spermatogonial maturation because KIT is a key signaling protein and because its binding to KITL is integral to the processes governing spermatogonial proliferation, survival, and maturation [22, 23, 25, 51]. Evidence from transcription of germ cell markers at Day 7 and enumeration of germ cell types at Day 14 further support the conclusion that in vivo levels of bioactive activin contribute to the normal progression of

spermatogenesis by coordinating germ cell maturation and Sertoli cell numbers. Activin A levels decline sharply in the rodent testis within the first postnatal week [7, 8], concordant with gonocyte transformation into spermatogonia [5]. The activin bA subunit has been detected in germ cells, Sertoli cells, and Leydig cells at this time [8]; therefore, the InhbaBK/BK mouse phenotype that emerges as a consequence of lowered activin bioactivity is complex and reflects the fact that there are many cellular targets for activin during fetal and early postnatal testicular development [8]. The FSH levels in Day 7 InhbaBK/BK serum are comparable to Inhba þ/ þ levels; hence, observed differences in germ cell and Sertoli cell numbers or function are not the consequence of altered FSH levels (Fig. 3D). Several previous studies [22, 52, 53] have documented the relationship between KIT and germ cell differentiation. Spermatogonial stem cells and immature germ cells (also termed undifferentiated spermatogonia) lack surface KIT protein, while germ cells reaching the type A1 stage of maturation acquire KIT. Total Kit mRNA levels are also increased at Day 0 in both Inhba/ and InhbaBK/BK testes. However, the proportional changes among the different cell types, including Kit-bearing germ cells and Leydig cells, make it difficult to deduce if this is mediated directly by activin. It is also notable that activin signaling was recently shown to decrease KITL production in granulosa cells of the human fetal


FIG. 7. Total numbers, relative proportions of germ cell subtypes, and rate of conversion of a germ cell type are altered in the Day 14 InhbaBK/BK testes. Stereology data show the numbers of type A and type B spermatogonia, spermatocytes, and Sertoli cells (3106) and the germ cell:Sertoli cell ratios. A) Type A spermatogonia in Day 14 InhbaBK mice (þ/þ, BK/þ, BK/BK). B) Type B spermatogonia in Day 14 InhbaBK mice (þ/þ, BK/þ, BK/BK). C) Spermatocyte numbers in Day 14 InhbaBK mice (þ/þ, BK/ þ, BK/BK). D) Total germ cell numbers in Day 14 InhbaBK mice (þ/þ, BK/þ, BK/BK). E) Sertoli cell numbers in Day 14 InhbaBK mice (þ/þ, BK/þ, BK/BK). F) Germ cell:Sertoli cell ratios in Day 14 InhbaBK mice (þ/þ, BK/þ, BK/BK). G) Proportions of type A and type B spermatogonia and spermatocytes relative to total germ cells in Day 14 InhbaBK mice (þ/þ, BK/BK). H) Diagrammatic representation of the conversion ratios between germ cell subtypes in Day 14 InhbaBK mice (þ/þ, BK/BK). þ/þ, wild type; /þ and þ/BK, heterozygous; / and BK/BK, homozygous. Data represent the mean 6 SEM from at least three samples per genotype. Different lowercase letters denote significant differences between genotypes within each age group (P , 0.05).

988

MITHRAPRABHU ET AL.

ovary [54, 55]. When Kitl mRNA levels were normalized to the mRNA levels of Clu to account for differences in Sertoli cell numbers in the Day 7 InhbaBK mice, a significant increase was seen in the InhbaBK/BK testes (Fig. 4I). The capacity for activin to modulate germ cell maturation appears to be developmentally regulated. Activin did not change Kit mRNA levels in Day 4 Sertoli cell-germ cell cocultures, while Kit levels were decreased in Day 8 samples. This temporal difference indicates that there is a specific time just before the first appearance of differentiating spermatogonia when activin can act to modulate Kit synthesis. The flow cytometry analyses of KIT þ and MVH þ cells presented herein for Day 7 InhbaBK testes indicate that differentiated spermatogonia and total KIT þ cells (both Leydig cells and germ cells) represent a higher proportion of cells in the Inhba þ/BK and InhbaBK/BK testes compared with wild-type samples. This matches our prediction and establishes a new understanding that reduced activin signaling enables germ cell differentiation. Intriguingly, flow cytometry analyses revealed that KIT þ germ cells in homozygous mutant mice also had higher cell surface KIT receptor protein levels. Because the KIT-KITL interaction is required for spermatogonial entry into meiosis [51], the increased production of KIT in germ cells of InhbaBK/ BK mice might indicate that altered germ cell maturation is a specific consequence of reduced activin signaling. KIT and KITL are known to influence spermatogonial proliferation in


FIG. 8. Model for activin modulation of germ cell differentiation at the onset of spermatogenesis. Normal development: Activin is expressed by the gonocyte; follistatin and Bambi are synthesized by the gonocyte when maturing to a spermatogonium. Modulated synthesis of these local factors leads to reduced activin signaling, resulting in regulated Sertoli cell production of KITL and KIT expression in germ cells. Prolonged activin levels (in vitro) (from in vitro data in Fig. 1): Exogenous activin addition reduces Kit expression levels in spermatogonia. Reduced activin levels (in vivo) (from in vivo data in Figs. 4–6 and Table 2): Reduced activin bioactivity reduces Sertoli cell numbers and increases KITL production, cell surface KIT protein levels in germ cells, proportion of differentiated spermatogonia in the Day 7 InhbaBK/BK testes, and rate of maturation of germ cells.

the immature testis by upregulating cyclin D3 (Ccnd3) levels [47, 48] and by enabling germ cell entry into meiosis [51]. Therefore, Day 7 InhbaBK whole testes were used to test for mRNA levels of Ccnd3, Sycp3, and Dazl. All three genes were increased in the InhbaBK/BK testes compared with Inhba þ/ þ testes, with Ccnd3 and Sycp3 showing significance (Fig. 5, A– C). In addition, stereology performed for Day 14 InhbaBK mice revealed that the relationship between germ cells and Sertoli cells had occurred during the second week of postnatal development (Fig. 7, A–F). These findings indicate that there is a shift in the functional relationship of germ cells and Sertoli cells around the time when Sertoli cells undergo terminal differentiation, most likely relating to establishment of the well-documented equilibrium sustained through adulthood in which each Sertoli cell supports a fixed number of germ cells [56]. The conversion of type A to type B spermatogonia was significantly higher in Inhba þ/ þ testes compared with InhbaBK/BK testes, while type B spermatogonia to spermatocyte conversion was significantly higher in InhbaBK/BK testes (Fig. 7H). This indicates that there is a reduced capacity for type A spermatogonia to transition into type B spermatogonia, while those that do transition progress more efficiently into spermatocytes. The enhanced capacity of type B spermatogonia to transition into spermatocytes at Day 14 is in accord with the documented elevation of meiotic germ cell transcripts measured at Day 7 (Fig. 5, A–C). Overexpression of activin inhibitors follistatin and follistatin-like 3 in mice results in a phenotype similar to the InhbaBK/BK male mice. The testes weights of these mice are significantly smaller [57, 58]. Follistatin transgenic mice were infertile, while follistatin-like 3 transgenic mice had reduced Sertoli cell proliferation and reduced fertility. These studies reinforce the fact that chronic reduction in activin signaling modulates Sertoli cell and germ cell development and function. We propose a model in which the reduction of activin bioactivity is vital for the onset of normal spermatogenesis in the early postnatal testis (Fig. 8). Local production of activin A is regulated at this time [8], and its action on germ cells is modulated by inhibitors, including follistatin and Bambi, that are synthesized in spermatogonia [6, 59]. In our model, this local reduction of activin bioactivity enables the normal elevation of Kit and Kitl required for subsequent spermatogonial differentiation [22] and for other processes controlled by availability of the Sertoli cell-produced KITL [23, 60, 61]. Constitutive KIT synthesis is essential for germ cell maintenance at this stage, specifically through the phosphoinositide 3kinase signaling pathway [47, 48]. When elevated activin levels are mimicked by exogenous activin A addition to Day 8 (but not Day 4) germ cells in vitro, total Kit levels are significantly suppressed. This outcome supports the concept that decreased activin signaling is a normal feature of the first wave of spermatogenesis associated with germ cell differentiation. Alternatively, when bioactive activin levels are chronically reduced in the testis, the suppressive effect on Kit and Kitl is diminished. These germ cells exhibit more surface KIT protein, while Sertoli cells produce more KITL, and these testes contain proportionally more differentiated spermatogonia and are triggered to mature into spermatocytes faster compared with wild-type testes. Our working model is that altered activin and subsequently KIT-KITL signaling disrupts the normal coordination of germ cell maturation in InhbaBK/BK; hence, some of these cells differentiate, while others remain as less mature cell types (Fig. 8, Diminished activin [in vivo]). In summary, this study provides the first in vivo evidence to date of a role for activin signaling in germ cell differentiation and Sertoli cell proliferation. This growth factor contributes to


the complex milieu of interactions via autocrine and/or paracrine mechanisms at the onset of spermatogenesis to regulate spermatogonial differentiation. ACKNOWLEDGMENTS We thank Professor Andreas Strasser and Dr. Priscilla Kelly from Walter and Eliza Hall Institute (Melbourne, VIC, Australia) for generously providing us with the ACK4 antibody, flow cytometry protocol, and reagents and Associate Professor Bruce Loveland (Burnet Institute, Melbourne, VIC, Australia) for critical reading of the manuscript. At Monash Institute of Medical Research, we thank Paul Hutchison and James Ngui for help with flow cytometry analyses, Lynda Foulds for providing the follistatin, and Susan Hayward for performing the FSH assay.

REFERENCES

20. Brown CW, Li L, Houston-Hawkins DE, Matzuk MM. Activins are critical modulators of growth and survival. Mol Endocrinol 2003; 17: 2404–2417. 21. Matzuk MM, Kumar TR, Bradley A. Different phenotypes for mice deficient in either activins or activin receptor type II. Nature 1995; 374: 356–360. 22. Yoshinaga K, Nishikawa S, Ogawa M, Hayashi S, Kunisada T, Fujimoto T, Nishikawa S. Role of c-kit in mouse spermatogenesis: identification of spermatogonia as a specific site of c-kit expression and function. Development 1991; 113:689–699. 23. Yan W, Suominen J, Toppari J. Stem cell factor protects germ cells from apoptosis in vitro. J Cell Sci 2000; 113:161–168. 24. Vincent S, Segretain D, Nishikawa S, Nishikawa SI, Sage J, Cuzin F, Rassoulzadegan M. Stage-specific expression of the Kit receptor and its ligand (KL) during male gametogenesis in the mouse: a Kit-KL interaction critical for meiosis. Development 1998; 125:4585–4593. 25. Packer AI, Besmer P, Bachvarova RF. Kit ligand mediates survival of type A spermatogonia and dividing spermatocytes in postnatal mouse testes. Mol Reprod Dev 1995; 42:303–310. 26. Loveland KL, Schlatt S. Stem cell factor and c-kit in the mammalian testis: lessons originating from Mother Nature’s gene knockouts. J Endocrinol 1997; 153:337–344. 27. Manova K, Huang EJ, Angeles M, De Leon V, Sanchez S, Pronovost SM, Besmer P, Bachvarova RF. The expression pattern of the c-kit ligand in gonads of mice supports a role for the c-kit receptor in oocyte growth and in proliferation of spermatogonia. Dev Biol 1993; 157:85–99. 28. Shinohara T, Avarbock MR, Brinster RL. beta1- And alpha6-integrin are surface markers on mouse spermatogonial stem cells. Proc Natl Acad Sci U S A 1999; 96:5504–5509. 29. Prabhu SM, Meistrich ML, McLaughlin EA, Roman SD, Warne S, Mendis S, Itman C, Loveland KL. Expression of c-Kit receptor mRNA and protein in the developing, adult and irradiated rodent testis. Reproduction 2006; 131:489–499. 30. Shinohara T, Orwig KE, Avarbock MR, Brinster RL. Spermatogonial stem cell enrichment by multiparameter selection of mouse testis cells. Proc Natl Acad Sci U S A 2000; 97:8346–8351. 31. Li L, Shen JJ, Bournat JC, Huang L, Chattopadhyay A, Li Z, Shaw C, Graham BH, Brown CW. Activin signaling: effects on body composition and mitochondrial energy metabolism. Endocrinology 2009; 150:3521– 3529. 32. Itman C, Loveland KL. SMAD expression in the testis: an insight into BMP regulation of spermatogenesis. Dev Dyn 2008; 237:97–111. 33. Yan W, Kero J, Huhtaniemi I, Toppari J. Stem cell factor functions as a survival factor for mature Leydig cells and a growth factor for precursor Leydig cells after ethylene dimethane sulfonate treatment: implication of a role of the stem cell factor/c-Kit system in Leydig cell development. Dev Biol 2000; 227:169–182. 34. Rothschild G, Sottas CM, Kissel H, Agosti V, Manova K, Hardy MP, Besmer P. A role for kit receptor signaling in Leydig cell steroidogenesis. Biol Reprod 2003; 69:925–932. 35. Wreford NG. Theory and practice of stereological techniques applied to the estimation of cell number and nuclear volume in the testis. Microsc Res Tech 1995; 32:423–436. 36. Meachem SJ, Wreford NG, Robertson DM, McLachlan RI. Androgen action on the restoration of spermatogenesis in adult rats: effects of human chorionic gonadotrophin, testosterone and flutamide administration on germ cell number. Int J Androl 1997; 20:70–79. 37. Western PS, Miles DC, van den Bergen JA, Burton M, Sinclair AH. Dynamic regulation of mitotic arrest in fetal male germ cells. Stem Cells 2008; 26:339–347. 38. Kelly PN, Puthalakath H, Adams JM, Strasser A. Endogenous bcl-2 is not required for the development of Emu-myc-induced B-cell lymphoma. Blood 2007; 109:4907–4913. 39. Nishikawa S, Kusakabe M, Yoshinaga K, Ogawa M, Hayashi S, Kunisada T, Era T, Sakakura T, Nishikawa S. In utero manipulation of coat color formation by a monoclonal anti-c-kit antibody: two distinct waves of c-kitdependency during melanocyte development. EMBO J 1991; 10:2111– 2118. 40. Small CL, Shima JE, Uzumcu M, Skinner MK, Griswold MD. Profiling gene expression during the differentiation and development of the murine embryonic gonad. Biol Reprod 2005; 72:492–501. 41. Zhou Q, Li Y, Nie R, Friel P, Mitchell D, Evanoff RM, Pouchnik D, Banasik B, McCarrey JR, Small C, Griswold MD. Expression of stimulated by retinoic acid gene 8 (Stra8) and maturation of murine gonocytes and spermatogonia induced by retinoic acid in vitro. Biol Reprod 2008; 78:537–545. 42. Wang Y, Culty M. Identification and distribution of a novel platelet-


1. de Kretser DM, Buzzard JJ, Okuma Y, O’Connor AE, Hayashi T, Lin SY, Morrison JR, Loveland KL, Hedger MP. The role of activin, follistatin and inhibin in testicular physiology. Mol Cell Endocrinol 2004; 225:57–64. 2. Massague J. TGFbeta in cancer. Cell 2008; 134:215–230. 3. Harradine KA, Akhurst RJ. Mutations of TGFbeta signaling molecules in human disease. Ann Med 2006; 38:403–414. 4. Meinhardt A, O’Bryan MK, McFarlane JR, Loveland KL, Mallidis C, Foulds LM, Phillips DJ, de Kretser DM. Localization of follistatin in the rat testis. J Reprod Fertil 1998; 112:233–241. 5. Meehan T, Schlatt S, O’Bryan MK, de Kretser DM, Loveland KL. Regulation of germ cell and Sertoli cell development by activin, follistatin, and FSH. Dev Biol 2000; 220:225–237. 6. Loveland KL, Bakker M, Meehan T, Christy E, von Schonfeldt V, Drummond A, de Kretser D. Expression of Bambi is widespread in juvenile and adult rat tissues and is regulated in male germ cells. Endocrinology 2003; 144:4180–4186. 7. Buzzard JJ, Loveland KL, O’Bryan MK, O’Connor AE, Bakker M, Hayashi T, Wreford NG, Morrison JR, de Kretser DM. Changes in circulating and testicular levels of inhibin A and B and activin A during postnatal development in the rat. Endocrinology 2004; 145:3532–3541. 8. Barakat B, O’Connor A, Gold E, de Kretser D, Loveland K. Inhibin, activin, follistatin and FSH serum levels and testicular production are highly modulated during the first spermatogenic wave in mice. Reproduction 2008; 136:345–359. 9. de Kretser DM, Loveland KL, Meehan T, O’Bryan MK, Phillips DJ, Wreford NG. Inhibins, activins and follistatin: actions on the testis. Mol Cell Endocrinol 2001; 180:87–92. 10. Matzuk MM, Finegold MJ, Su JG, Hsueh AJ, Bradley A. Alpha-inhibin is a tumour-suppressor gene with gonadal specificity in mice. Nature 1992; 360:313–319. 11. Cipriano SC, Chen L, Kumar TR, Matzuk MM. Follistatin is a modulator of gonadal tumor progression and the activin-induced wasting syndrome in inhibin-deficient mice. Endocrinology 2000; 141:2319–2327. 12. Cipriano SC, Chen L, Burns KH, Koff A, Matzuk MM. Inhibin and p27 interact to regulate gonadal tumorigenesis. Mol Endocrinol 2001; 15:985– 996. 13. Puglisi R, Montanari M, Chiarella P, Stefanini M, Boitani C. Regulatory role of BMP2 and BMP7 in spermatogonia and Sertoli cell proliferation in the immature mouse. Eur J Endocrinol 2004; 151:511–520. 14. Krummen LA, Moore A, Woodruff TK, Covello R, Taylor R, Working P, Mather JP. Localization of inhibin and activin binding sites in the testis during development by in situ ligand binding. Biol Reprod 1994; 50:734– 744. 15. Matzuk MM, Kumar TR, Vassalli A, Bickenbach JR, Roop DR, Jaenisch R, Bradley A. Functional analysis of activins during mammalian development. Nature 1995; 374:354–356. 16. Corrigan AZ, Bilezikjian LM, Carroll RS, Bald LN, Schmelzer CH, Fendly BM, Mason AJ, Chin WW, Schwall RH, Vale W. Evidence for an autocrine role of activin B within rat anterior pituitary cultures. Endocrinology 1991; 128:1682–1684. 17. Brown CW, Houston-Hawkins DE, Woodruff TK, Matzuk MM. Insertion of Inhbb into the Inhba locus rescues the Inhba-null phenotype and reveals new activin functions. Nat Genet 2000; 25:453–457. 18. Tsuchida K, Nakatani M, Yamakawa N, Hashimoto O, Hasegawa Y, Sugino H. Activin isoforms signal through type I receptor serine/threonine kinase ALK7. Mol Cell Endocrinol 2004; 220:59–65. 19. Nakamura T, Asashima M, Eto Y, Takio K, Uchiyama H, Moriya N, Ariizumi T, Yashiro T, Sugino K, Titani K, Sugino H. Isolation and characterization of native activin B. J Biol Chem 1992; 267:16385–16389.

989

990

43.

44. 45.

46. 47.

48.

49.

51.

derived growth factor receptor beta variant: effect of retinoic acid and involvement in cell differentiation. Endocrinology 2007; 148:2233–2250. Pellegrini M, Grimaldi P, Rossi P, Geremia R, Dolci S. Developmental expression of BMP4/ALK3/SMAD5 signaling pathway in the mouse testis: a potential role of BMP4 in spermatogonia differentiation. J Cell Sci 2003; 116:3363–3372. O’Shaughnessy PJ, Willerton L, Baker PJ. Changes in Leydig cell gene expression during development in the mouse. Biol Reprod 2002; 66:966– 975. Plotton I, Sanchez P, Perrard MH, Durand P, Lejeune H. Quantification of stem cell factor mRNA levels in the rat testis: usefulness of clusterin mRNA as a marker of the amount of mRNA of Sertoli cell origin in post pubertal rats. J Endocrinol 2005; 186:131–143. Yuan L, Liu JG, Zhao J, Brundell E, Daneholt B, Hoog C. The murine SCP3 gene is required for synaptonemal complex assembly, chromosome synapsis, and male fertility. Mol Cell 2000; 5:73–83. Feng LX, Ravindranath N, Dym M. Stem cell factor/c-kit up-regulates cyclin D3 and promotes cell cycle progression via the phosphoinositide 3kinase/p70 S6 kinase pathway in spermatogonia. J Biol Chem 2000; 275: 25572–25576. Dolci S, Pellegrini M, Di Agostino S, Geremia R, Rossi P. Signaling through extracellular signal-regulated kinase is required for spermatogonial proliferative response to stem cell factor. J Biol Chem 2001; 276: 40225–40233. Saunders PT, Turner JM, Ruggiu M, Taggart M, Burgoyne PS, Elliott D, Cooke HJ. Absence of mDazl produces a final block on germ cell development at meiosis. Reproduction 2003; 126:589–597. Schrans-Stassen BH, Saunders PT, Cooke HJ, de Rooij DG. Nature of the spermatogenic arrest in Dazl / mice. Biol Reprod 2001; 65:771–776. Rossi P, Lolicato F, Grimaldi P, Dolci S, Di Sauro A, Filipponi D, Geremia R. Transcriptome analysis of differentiating spermatogonia stimulated with kit ligand. Gene Expr Patterns 2008; 8:58–70.

52. Dym M, Jia MC, Dirami G, Price JM, Rabin SJ, Mocchetti I, Ravindranath N. Expression of c-kit receptor and its autophosphorylation in immature rat type A spermatogonia. Biol Reprod 1995; 52:8–19. 53. de Rooij DG, Grootegoed JA. Spermatogonial stem cells. Curr Opin Cell Biol 1998; 10:694–701. 54. Coutts SM, Childs AJ, Fulton N, Collins C, Bayne RA, McNeilly AS, Anderson RA. Activin signals via SMAD2/3 between germ and somatic cells in the human fetal ovary and regulates kit ligand expression. Dev Biol 2008; 314:189–199. 55. Childs AJ, Anderson RA. Activin A selectively represses expression of the membrane-bound isoform of Kit ligand in human fetal ovary. Fertil Steril 2009; 92:1416–1419. 56. Orth JM, Gunsalus GL, Lamperti AA. Evidence from Sertoli cell-depleted rats indicates that spermatid number in adults depends on numbers of Sertoli cells produced during perinatal development. Endocrinology 1988; 122:787–794. 57. Xia Y, Sidis Y, Schneyer A. Overexpression of follistatin-like 3 in gonads causes defects in gonadal development and function in transgenic mice. Mol Endocrinol 2004; 18:979–994. 58. Guo Q, Kumar TR, Woodruff T, Hadsell LA, DeMayo FJ, Matzuk MM. Overexpression of mouse follistatin causes reproductive defects in transgenic mice. Mol Endocrinol 1998; 12:96–106. 59. Mather JP, Roberts PE, Krummen LA. Follistatin modulates activin activity in a cell- and tissue-specific manner. Endocrinology 1993; 132: 2732–2734. 60. Yan W, Linderborg J, Suominen J, Toppari J. Stage-specific regulation of stem cell factor gene expression in the rat seminiferous epithelium. Endocrinology 1999; 140:1499–1504. 61. Hakovirta H, Yan W, Kaleva M, Zhang F, Vanttinen K, Morris PL, Soder M, Parvinen M, Toppari J. Function of stem cell factor as a survival factor of spermatogonia and localization of messenger ribonucleic acid in the rat seminiferous epithelium. Endocrinology 1999; 140:1492–1498.


50.

MITHRAPRABHU ET AL.