Activity and expression of the multidrug resistance proteins P ... - Nature

Leukemia (2001) 15, 1544–1553  2001 Nature Publishing Group All rights reserved 0887-6924/01 $15.00 www.nature.com/leu

Activity and expression of the multidrug resistance proteins P-glycoprotein, MRP1, MRP2, MRP3 and MRP5 in de novo and relapsed acute myeloid leukemia DM van der Kolk1,2, EGE de Vries2, L Noordhoek4, E van den Berg4, MA van der Pol5, M Mu¨ller3 and E Vellenga1 Divisions of 1Hematology, 2Medical Oncology, 3Gastroenterology and Hepatology, University Hospital of Groningen; 4Department of Medical Genetics, University Groningen; and 5Division of Hematology, Medical Center Free University, Amsterdam, The Netherlands

The multidrug resistance proteins (MRPs) MRP1, MRP2, MRP3, MRP5 and P-glycoprotein (P-gp) act in concert with each other to give a net resultant pump function in acute myeloid leukemia (AML). The aim of the present study was to analyze the activity of these proteins, which might be upregulated at relapse as compared with de novo AML due to clonal selection. The mRNA expression and activity of P-gp and the MRPs were determined with RT-PCR and flow cytometry, in conjunction with phenotype, as measured with the monoclonal antibodies CD34, CD38 and CD33, in 30 paired samples of de novo and relapsed AML. P-gp and MRP activity varied strongly between the cases (rhodamine 123 efflux-blocking by PSC833: 5.4 ⴞ 7.7, and carboxyfluorescein efflux-blocking by MK-571: 4.3 ⴞ 6.7, n ⴝ 60). P-gp and MRP activity were increased in 23% and 40% of the relapse samples, and decreased in 30% and 20% of the relapse samples, respectively (as defined by a difference of ⬎2 ⴛ standard deviation of the assays). Up- or downregulation of mRNA expression was observed for MDR1 (40%), MRP1 (20%), MRP2 (15%), MRP3 (30%), and MRP5 (5%). Phenotyping demonstrated a more mature phenotype in 23% of the relapsed AML cases, and a more immature phenotype in 23% of the relapses, which was independent of the karyotypic changes that were observed in 50% of the studied cases. P-gp and MRP activity correlated with the phenotypic changes, with higher P-gp and MRP activities in less mature cells (r ⴝ −0.66, P ⬍ 0.001 and r ⴝ ⴚ0.31, P ⴝ 0.02, n ⴝ 58). In conclusion, this study shows that P-gp and MRP activity are not consistently upregulated in relapsed AML. However, P-gp and MRP activities were correlated with the maturation stage as defined by immune phenotype, which was observed to be different in 46% of the relapses. Leukemia (2001) 15, 1544–1553. Keywords: acute myeloid leukemia (AML); P-glycoprotein (P-gp); multidrug resistance proteins (MRPs); relapse

Introduction The overexpression of ATP-binding cassette (ABC) membrane transporters that function as drug efflux pumps has been identified as an important cause of treatment failure in acute myeloid leukemia (AML).1–6 These include the ABC transporters P-glycoprotein (P-gp),7,8 encoded by the multidrug resistance 1 gene (MDR1), which is located on chromosome 7q21, and the multidrug resistance protein 1 (MRP1),9 encoded by the MRP1 gene, located on chromosome 16p13. The simultaneous functional expression of P-gp and MRP1 has been shown to be correlated with poor overall survival in AML.10–12 The transport kinetics of anthracyclines by P-gp and MRP1 are rather similar.13 An important difference between P-gp and MRP1 is that MRP1 transports cationic and neutral compounds only in the presence of glutathione (GSH).14,15 Recently six additional MRP family members, MRP2 to MRP7, have been identified.16–19 The role of these MRP1 isoforms in

Correspondence: E Vellenga, Division of Hematology, Department of Internal Medicine, University Hospital Groningen, Hanzeplein 1, 9713 GZ Groningen, The Netherlands; Fax: +31–50–3614862 Received 16 January 2001; accepted 13 June 2001

multidrug resistance (MDR) is not yet well defined. MRP2 has been described to transport GSH conjugates and chemotherapeutic agents, such as cisplatin,16 etoposide and vincristine.20 MRP3 has been shown to pump methotrexate and etoposide, but not GSH;21 MRP4 has been described to confer resistance to methotrexate after short-term exposure, and to 9-(2phosphonylmethoxethyl)-adenine (PMEA)22 and azidothymidine;23 while MRP5 was found to transport 6-mercaptopurine,24,25 which is also used in the palliative treatment of AML.26–28 MRP6 and MRP7 have not yet been found to play a role in multidrug resistance.18,19 Patients with AML are treated with intensive chemotherapy regimens, including daunorubicin, idarubicin, etoposide and mitoxantrone, which are substrates for the multidrug resistance (MDR) proteins. These induction chemotherapy regimens result in a first complete remission (CR) rate of 60– 70%.29–31 However, despite the intensive regimen, a considerable number of AML patients show resistance to the treatment or relapse after CR and eventually die from their disease, which results in a 5 year disease-free survival of 25–35%.32–35 Little is known about the expression and function of P-gp and the MRPs in refractory and relapsed state AML patients. In some studies MDR1 or MRP1 mRNA expression have been described to be upregulated in relapsed or refractory AML vs AML at diagnosis,36–38 whereas in other studies no distinct differences were observed.38,39 So far, no data have been published concerning the functional activity of P-gp and MRP and mRNA expression of the MRP1 homologues in de novo vs relapsed state AML. In the present study, our interest was to analyze the functional activity of P-gp and the MRPs (MRP1, MRP2 and MRP3), that act in concert with each other to give a net resultant pump function, which might be upregulated at relapse as compared with the primary AML due to clonal selection or to intrinsic defects of the AML cells. A few large studies have described changes in karyotype between diagnosis and relapse in AML,40,41 in which less complex or more complex karyotypes were observed at relapse. We have described a correlation between the lack of MRP activity and the occurrence of MRP1 deletions in AML patients with an inversion on chromosome 16 in a previous study.42 We therefore determined in the present study the karyotype of the AML patients at diagnosis and at relapse, with emphasis on the chromosomal loci 16p13 and 7q21, on which MRP1 and MDR1 are located. Thirty paired samples of de novo and refractory or relapsed state AML were studied. P-gp and MRP activity were determined with a flow cytometric assay. MDR1, MRP1, MRP2, MRP3 and MRP5 mRNA expressions were measured by means of reverse transcriptasepolymerase reaction (RT-PCR). Since it has been described that P-gp expression and function are correlated with the maturation stage of AML cells,12,43 we also measured the expression of the monocolonal markers CD33, CD34 and CD38.

P-gp and MRPs in de novo and relapsed AML DM van der Kolk et al

Patients, materials and methods

Patients After informed consent, bone marrow aspirates or peripheral blood were collected from AML patients at the time of diagnosis and relapse between July 1992 and April 2000 at the University Hospital Groningen and Free University Hospital Amsterdam. Patients were classified at presentation of the disease according to the French–American–British (FAB) classification.44 Leukemic blasts were enriched by Ficoll–Isopaque (Nycomed, Oslo, Norway) density gradient centrifugation, cryopreserved in RPMI 1640 medium (Bio Whittaker, Brussels, Belgium) supplemented with 10% fetal calf serum (FCS) (Hyclone, Logan, UT, USA) and 10% dimethyl sulfoxide (DMSO) (Merck, Amsterdam, The Netherlands), and stored at −196°C. For the present study paired cases, which were available at the time of diagnosis as well as at relapse, were selected. Upon analysis, AML blasts were thawed, treated with DNAse (Boehringer Mannheim, Almere, The Netherlands), washed with RPMI 1640 medium, and incubated for 30 min in RPMI 1640 medium, supplemented with 10% FCS at 37°C, 5% CO2. If more than 10% T cells were present, as determined by the percentage of CD3-positive cells, T lymphocytes were depleted by 2-aminoethylisothiouronium bromidetreated sheep red blood cell (SRBC) rosetting. T cell-SRBC rosettes were removed by Ficoll–Isopaque density gradient centrifugation. May–Gru¨nwald Giemsa staining was performed to determine the percentage of blast cells in the AML cells, and in all cases the percentage of blast cells was ⬎90%.

Detection of functional drug efflux in combination with CD34 expression Functional activity of the P-gp and MRP transporter proteins was demonstrated as described previously.45 To analyze P-gp activity we used rhodamine 123 (Rh123) (Sigma Chemical, Bornem, Belgium) in combination with the P-gp-specific inhibitor PSC833 (provided by Novartis Pharma, Basel, Switzerland). To determine MRP (MRP1 and homologues MRP2 and probably MRP3) activity the compound carboxyfluorescein diacetate (CFDA) was used, which permeates the plasma membrane and upon cleavage of the ester bonds is transformed into the fluorescent anion CF. The leukotriene D4 receptor antagonist and MRP inhibitor MK-57146 was used to inhibit CF efflux. Cells (0.5 × 106) were loaded for 20 min at 37°C, 5% CO2 with 0.1 ␮m CFDA or 200 ng/ml Rh123 with or without inhibitor (20 ␮m MK-571 or 2 ␮g/ml PSC833) in RPMI 1640 medium. Thereafter cells were washed in ice-cold medium and incubated for 1 h in drug-free medium with or without inhibitor at 37°C, 5% CO2. Efflux was stopped by pelleting the cells and adding ice-cold medium. Thereafter cells were either incubated for 30 min on ice, or labeled with a APClabeled monoclonal antibody CD34 (IQ Products, Groningen, The Netherlands), incubated for 30 min on ice and washed with ice-cold medium. CF, Rh123 and APC fluorescence of 5000 events were measured with a FACScalibur flow cytometer. The efflux-blocking factors of the inhibitors in CD34− cells, CD34+ cells, or in the whole cell population, were expressed as the median relative fluorescence units (FU) in inhibitor blocked cells divided by the median relative FU in unblocked cells after 60 min. To determine the reproducibility of the assay, the P-gp and MRP activities were measured three

times in some AML patient samples. Based on these results the s.d. of the assay was determined, and up- or downregulation at relapse vs the primary samples was defined as a difference of ⬎2 × s.d. of the assay.

1545

RNA extraction and RT-PCR Total cellular RNA was isolated from 5 × 106 AML blasts (if a sufficient cell number could be obtained) using 1 ml of Trizol reagent (Life Technologies, Breda, The Netherlands). RNA was extracted, precipitated and washed according to the manufacturer’s protocol. RNA (1–5 ␮g, for each of the AML patients the same amount of RNA was taken for the samples at diagnosis and relapse) was reverse transcribed in 20 ␮l of RT buffer containing 1.8 mm each of dATP, dGTP, dCTP and dTTP (Promega, Madison, WI, USA), 9 mm MgCl2, 68 mm KCl, 45 mm Tris/HCl (pH 8.3), 0.8 mg/ml bovine serum albumine, 28% glycerol, 10 U of Moloney murine leukemia virus reverse transcriptase (Pharmacia, Woerden, The Netherlands), 4.8 U RNAguard (Pharmacia), 0.2 ␮g pd(N)6 random primers (Pharmacia) and 3 mm dithiothreitol (Life Technologies). The reaction conditions were 65°C for 10 min and 37°C for 60 min. Thereafter, 30 ␮l H2O was added up to a final volume of 50 ␮l cDNA. PCR analysis for MDR1, MRP1, MRP2, MRP3 and MRP5 mRNA was performed in 25 ␮l PCR buffer containing 2 ␮l of cDNA using the following primer pairs: MDR1 sense: 5⬘AAAAAGATCAACTCGTAGGAGTG3⬘; antisense: 5⬘GCA CAAAATACACCAACAA3⬘; MRP1 sense: 5⬘AATGCGCCAA GACTAGGAAG3⬘, antisense: 5⬘ACCGGAGGATGTTGAA CAAG3⬘; MRP2 sense: 5⬘CTGGTTGATGAAGGCTCTGT3⬘, antisense: 5⬘CTGCCATAATGTCCAGGTTC3⬘; MRP3 sense: 5⬘CCCTCTGAGCACTGGAAGTC3⬘, antisense: 5⬘GCAGGT GACATTTGCTCTGA3⬘; MRP5 sense: 5⬘GGATAACTTCTC AGTGGG3⬘, antisense: 5⬘GGAATGGCAATG CTCTAAAG3⬘. Amplified products consisted of 161 (MDR1), 990 (MRP1), 1067 (MRP2), 564 (MRP3) and 380 (MRP5) basepairs (bp). For ␤-2 microglobulin PCR, which was performed as an internal standard, primers were: sense: 5⬘CCAGCAGA GAATGGAAAGTC3⬘, antisense: 5⬘GATGCTGCTTACATG TCTCG3⬘; the amplified product consisted of 268 bp. The PCR reactions were subjected to the following cycle numbers of, respectively, denaturation (95°C, 30 s), annealing (55°C for MDR1 and MRP5, 56°C for MRP1, MRP3 and ␤-2 microglobulin, 58°C for MRP2, 30 s and extension (72°C, 30 s, MDR1 and MRP2: 31 cycles, MRP1 and MRP5: 29 cycles, MRP3: 32 cycles and ␤-2 microglobulin: 20 cycles. Reaction products (5 ␮l) were separated on a 1.5% agarose gel in Tris-acetate-EDTA (TAE) buffer. The PCR reaction product bands were visualized by ethidium bromide staining. Densitometric scanning was performed with a Image Master VDS (Pharmacia, Woerden, The Netherlands), and optical density (OD) was expressed as OD × mm2 using the program Diversity One 1D (PDI, New York, NY, USA). The band density of each mRNA product in a patient sample at diagnosis was compared with the density of the band at relapse. To determine the reproducibility of the RT-PCR assay of the ␤-2 microglobulin, MDR1, MRP1, MRP2, MRP3 and MRP5 genes, the RT-PCR reaction of each gene was performed six times in three independent AML samples. The absorbance of the bands was measured and the standard deviation (s.d.) and the 95% confidence interval of the assay was calculated. Leukemia


1546

Maturation stage

Table 1

To determine the maturation stage of the AML blasts, phenotyping was performed using monoclonal antibodies against CD34 in combination with CD38 or CD33, or immunoglobulin G isotype-matched controls (Becton Dickinson, Mountain View, CA, USA). 0.5 × 106 Cells were incubated with 5 ␮l of fluorescein isothiocyanate- or phycoerythrin-labeleled mouse monoclonal antibodies for 20 min at 4°C, washed with RPMI 1640 medium, and analyzed with a FACScalibur flow cytometer (Becton Dickinson Medical Systems, Sharon, MA, USA). The percentages of the following subclasses of cells were determined: CD34+/CD38−, CD34+/CD33−, CD34+/CD33+ and CD34−/CD33+, whereby the CD34+/CD38− cells were considered as the more immature cells, and the CD34−/CD33+ cells as the mature population. The reproducibility of the assay was determined by measuring the percentage of the different subclasses three times in some patient samples. Based on these results, the s.d. of the assay was calculated and up- or downregulation of a specific subclass at relapse vs the primary sample was defined as a difference of ⬎2 × s.d. of the assay. A maturation status of the cells was calculated using the following formula:

Patient No.

(%CD34+/CD38− × 0) + (% CD34+/CD33− × 1) + (% CD34+/CD33+ × 2) + (% CD34−/CD33+ × 3) % CD34+/CD38− + % CD34+/CD33− + % CD34+/CD33+ + % CD34−/CD33+ resulting in a maturation status between 0 and 3, 0 representing the most immature and 3 representing the most mature subclass. The s.d. was calculated and a difference in maturation status between primary and relapse was defined as a difference of ⬎2 × s.d. In the patient samples in which no CD34+/CD38− percentage could be determined, the maturation stage was calculated using the CD34+/CD33−, CD34+/CD33+ and CD34−/CD33+ percentages.

Cytogenetics Bone marrow or peripheral blood cells from primary as well as relapsed samples were cultured for 24 and 48 h in RPMI 1640 supplemented with 15% FCS. The cultures were harvested and chromosome preparations were made according to standard cytogenetic techniques. The chromosomes were G-banded using trypsin or pancreatin, and karyotypes were described according to the International System for Human Cytogenetic Nomenclature (ISCN) 1995.

Statistical analysis The Mann–Whitney U and Wilcoxon non-parametric tests were used to calculate significant differences, and correlations were calculated using the Spearman bivariate nonparametric correlation test. Data were expressed as mean ± s.d. P values ⬍0.05 were considered significant. Results

Patient characteristics Paired bone marrow and peripheral blood samples were collected from 30 AML patients at diagnosis and relapse or Leukemia

Characteristics of AML patients

FAB Agea classification

1 2

M2 M2

43 22

3

M4

46

4

M2

63

5

M5

62

6

M5

64

7 8 9 10b 11 12 13b 14 15

M1 M0 M2 M2 M1 M5 M3 M2 M2

33 66 64 45 60 63 73 60 35

16

M3

36

17 18 19b 20 21 22 23

M4 M0 M2 M2 M2 M2 M2

64 56 66 41 46 64 57

24 25

M2 M4

64 49

26 27 28

M1 M2 M5A

31 58 68

29

M2

52

30

M4

54

Treatment

ara-c, ida, amsa ara-c, ida, amsa, etop, mito ara-c, ida, amsa, etop, mito ara-c, dauno, amsa, etop, mito ara-c, ida, amsa, etop, mitox ara-c, ida, amsa, etop, mito ara-c, ida, amsa ara-c, dauno, amsa ara-c, dauno ara-c, ida, amsa ara-c, ida, amsa ara-c, dauno, etop, mito ara-c, dauno ara-c, dauno, amsa ara-c, dauno, amsa, etop, mito ara-c, ida, amsa, etop, mito, ara-c, dauno ara-c, ida, amsa ara-c ara-c, ida, amsa ara-c, ida, amsa ara-c, ida ara-c, dauno, amsa, etop, mito ara-c, dauno ara-c, ida, amsa, etop, mito ara-c, ida, amsa ara-c, ida, amsa ara-c, dauno, amsa, etop, mito ara-c, ida, amsa, etop, mito ara-c, ida, amsa

Remission

CR PR CR PR CR CR NR PR CR CR CR CR CR CR CR CR CR CR PR CR CR PR CR NR CR CR CR CR CR CR

ara-c, cytosine arabinoside, dauno, daunorubicin; ida, idarubicin; amsa, amsacrine; etop, etoposide; mito, mitoxantrone; CR; complete remission: PR, partial remission; NR, no response. a Age at diagnosis. b These patients showed secondary AML after myelodysplastic syndrome.

refractory disease. The patients were treated with intensive chemotherapy regimens according to the protocol of the Dutch–Belgian Hemato-Oncology Cooperative Group for AML (Hovon 4/4A or Hovon 29),47,48 which included the chemotherapeutic agents cytosine-arabinoside (Ara-C, 200 mg/m2, i.v., days 1–7), daunorubicin (45 mg/m2, i.v., days 1– 3) or idarubicin (12 mg/m2, i.v., days 5–7) in the induction cycle of chemotherapy, Ara-C (2 g/m2, i.v., days 1–6) plus amsacrine (120 mg/m2, i.v., days 4–6) in the second induction cycle. Patients with FAB classification M3 received all-trans retinoic acid. After the two induction cycles, patients were to receive a third cycle consisting of mitoxantrone (10 mg/m2, i.v., days 1–5) plus etoposide (100 mg/m2, i.v., days 1–5), an autograft, or a HLA-matched allograft, depending on the risk estimates according to protocol and the availability of a HLAmatched donor. After treatment 23 AML patients reached


complete remission (CR), five patients reached partial remission (PR), defined as ⬍25% of AML blasts in the bone marrow smear, and two patients were refractory to the treatment and did not reach remission. Patient characteristics are described in Table 1.

P-gp activity, MRP activity and CD34 expression To study whether P-gp or MRP activity was upregulated at relapse as compared with de novo AML cases, we determined the activity of the transporter proteins in 30 paired samples. Since it has been described that the functional activity of Pgp is related to the expression of CD34,45 we performed the P-gp and MRP functional assay in combination with the measurement of CD34 expression. The functional activity of P-gp in the whole blast population

Figure 1 P-gp activity in combination with CD34 expression. Fluorescence dot plots showing Rh123 content and CD34 expression after 60 min of efflux with (b) or without (a) PSC833.

demonstrated a great variability in efflux-blocking factors. Rh123 efflux-blocking factors of PSC833 varied between 0.9 and 42.4 (5.4 ± 7.7, mean ± s.d., n = 60). A difference in efflux-blocking factor of ⬎26% (= 2 × s.d. of the assay) between primary and relapsed samples was considered significant. The P-gp activity was upregulated in seven relapsed cases and downregulated in nine relapsed cases as compared with the primary samples. The P-gp activity in the whole group of relapsed samples (5.8 ± 9.0, n = 30) did not differ from the whole group of diagnosis samples (5.0 ± 6.2, n = 30, P = 0.54). However, the P-gp activity in CD34− cells was lower than in CD34+ cells (efflux-blocking factors of 1.5 ± 0.7, n = 54, vs 7.4 ± 9.4, n = 54, P ⬍ 0.001). An example of Pgp activity in CD34− vs CD34+ cells (patient No. 19) is shown in Figure 1. MRP activity also showed a great variability in the whole blast population. CF efflux-blocking factors of MK-571 varied between 0.8 and 42.8 (mean 4.3 ± 6.7, n = 60). MRP activity was increased (as defined by a difference of ⬎20% (= 2 × s.d. of the assay) in 12 relapsed cases and decreased in six cases as compared with the primary samples. The MRP activity of the whole group of relapsed and refractory patients did not differ from the whole group of primary samples, namely 4.6 ± 7.5 (n = 30), vs 4.0 ± 5.9 (n = 30, P = 0.3). CF efflux-blocking factors of MK-571 were higher in the CD34+ compartment (5.0 ± 7.0, n = 56) than in the CD34− compartment (2.7 ± 1.8, n = 55, P ⬍ 0.001). The P-gp and MRP activities of the individual patients are shown in Figure 2.

1547

Figure 2 P-gp and MRP activity in primary and relapsed AML patients. P-gp and MRP activities, expressed as Rh123 efflux-blocking factors of PSC833 and CF efflux-blocking factors of MK-571, respectively, are presented in the whole blast population (a and d), in the CD34− compartment (b and e) and in the CD34+ compartment (c and f), at presentation and at relapse of the AML. Leukemia


1548

MDR1, MRP1, MRP2, MRP3 and MRP5 mRNA expression To test whether the differences in P-gp and MRP activity between primary and relapsed state AML patient samples were correlated with the mRNA expression of MDR1 and MRP1, MRP2 and possibly MRP3, a semiquantitative RT-PCR analysis was performed. The relative mRNA expressions of these MDR genes, and of MRP5, as compared to that of ␤-2 microglobulin were calculated. RT-PCR analysis was possible in 18 paired samples. For each AML patient the difference between the value at diagnosis vs the relapsed or refractory sample was expressed. The results are presented in Figure 3a–e. MDR1 mRNA, as depicted in Figure 3a, is upregulated in relapsed vs diagnosis samples in five cases, whereas in three cases it is downregulated; 10 patient cases showed no difference. The up- or downregulation of MDR1 mRNA correlated well with the up- or downregulation of P-gp activity (r = 0.58, P = 0.01, n = 18) in the relapsed vs the primary samples. The differences between primary and relapsed samples of MRP1, MRP2, MRP3 and MRP5 mRNA expressions are depicted in Figure 3b–e, and showed a heterogenous pattern. MRP1 mRNA expression at relapse was upregulated in only one case and showed a reduced expression in three cases, MRP2 mRNA expression was upregulated in three relapsed cases. Considering MRP3 mRNA, an increased expression was observed in three cases and a reduced expression was

observed in three relapsed cases. No major changes in MRP5 mRNA expression were observed; in only one case a decrease in MRP5 mRNA expression was found at relapse. A correlation was found between up- and downregulation of MDR1 and MRP2 mRNA expression (r = 0.60, P = 0.009, n = 18). No correlations were observed between the up- or downregulation of MRP1, MRP2, MRP3 and MRP5 mRNA expressions. In addition, no correlations were observed between the upor downregulation of the different MRP mRNA expressions and the up- or downregulation of MRP activity as expressed by CF efflux-blocking factors of MK-571.

Maturation stage Since we found a strong correlation between the P-gp and MRP activities and the expression of CD34, we were interested whether a correlation could be observed between the pump function and the differentiation stage of the AML samples as measured by immune phenotype, with a combination of the monoclonal markers CD34, CD38 and CD33. Cells that were CD34-positive and CD38-negative (CD34+/CD38−) were considered as the most immature, whereas cells that were CD34−/CD33+ were considered as the most mature cells. A difference of ⬎32% (=2 × s.d. of the assay) between the primary and relapsed cases was considered significant. The percentage of CD34+/CD38− cells was increased in nine and decreased in eight relapsed cases as

Figure 3 Differences of mRNA expressions of the MDR genes between primary and relapsed AML patients. Differences of mRNA expressions between relapsed and primary samples are shown of MDR1 (a), MRP1 (b), MRP2 (c), MRP3 (d) and MRP5 (e). The dotted line (=0.266) represents the 95% confidence interval of the assay. Leukemia


compared with the primary samples, and the CD34+/CD33− percentage was increased in nine and decreased in eight relapsed cases. The percentage of CD34+/CD33+ cells was augmented in 14 cases and reduced in five cases, which represented a significant upregulation of the percentage of CD34+/CD33+ cells at relapse vs the primary sample (26.8 ± 24.0 at diagnosis, vs 41.4 ± 31.1 at relapse, n = 29, P = 0.01). The percentage of CD34−/CD33+ cells was higher in nine and lower in 11 relapsed cases as compared to the primary cases. The results are presented in Table 2. Since these findings might implicate a shift in the maturation stage, due to the occurrence of a new clone, the maturation status of the AML blasts was calculated, ranging from 0 to 3, 0 representing the most immature cell population, and 3 representing the more mature cell population. A difference of ⬎9.6% (2 × s.d.) between relapsed and primary samples was considered significant. In seven cases the maturation status represented a more immature character and in seven cases the maturation status represented a more mature character at relapse (Figure 4). A correlation was observed between the percentage of CD34+/CD38− cells and P-gp as well as MRP activity (r = 0.28, P = 0.04, n = 55, and r = 0.44, P = 0.001, n = 55, respectively). In addition, a correlation was found between CD34 positivity and P-gp activity (r = 0.51, P ⬍ 0.001, n = 59). A strong negative correlation was observed between the percentage of the more mature CD33+ cells and P-gp activity (r = −0.54, P ⬍ 0.001, n = 57). However, the strongest correlation was observed between the calculated maturation status and P-gp activity (r = −0.66, P ⬍ 0.001, n = 58), and between the maturation status and MRP activity (r = −0.31, P = 0.02, n = 58) (Table 3), indicating that the Table 2

1549

Figure 4 Maturation status in primary and relapsed AML patients. The calculated maturation status of 30 AML patients at the time of diagnosis (䊉) and at relapse (䊊), 0 representing the most immature and 3 representing the most mature status. nd, not done.

changes in pump activity, observed in the relapsed AML samples, were dependent on the changes in maturation stage.

Karyotype To examine whether the changes in maturation status and in P-gp and MRP activities between primary and relapse cases were reflected by changes in karyotype, cytogenetic analysis was performed in 29 patient samples at presentation and was possible in 16 samples at relapse. Four patients had a normal karyotype at the time of diagnosis as well as at relapse, and

Phenotype of the AML blasts at diagnosis and at relapse

Patient No.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30

CD34+/CD38− (%) primary relapse 0 0 5 0 0 1 39 56 nd nd nd 16 4 15 0 0 0 7 0 nd 16 1 2 3 1 0 0 0 2 1

0 0 11 0 5 0 91 69 nd nd nd 10 0 29 1 0 3 3 8 nd 14 0 0 1 1 0 0 1 0 2

CD34+/CD33− (%) primary relapse 0 61 0 0 0 0 66 62 4 5 67 0 39 19 47 0 0 5 80 nd 26 17 10 45 0 2 9 87 8 1

3 65 0 0 0 0 92 83 14 14 50 3 38 7 28 1 0 2 1 nd 19 0 0 35 0 6 14 5 0 1

CD34+/CD33+ (%) primary relapse 13 15 34 8 0 41 0 1 50 67 1 23 29 21 27 0 4 52 15 nd 66 56 66 0 4 71 47 5 39 23

78 27 36 18 75 7 0 2 37 73 9 16 42 50 20 0 27 87 91 nd 76 23 79 0 68 87 70 62 29 13

CD34−/CD33+ (%) primary relapse 87 6 52 83 97 58 0 1 0 26 17 59 2 5 23 68 33 13 0 nd 2 16 12 0 84 6 19 0 7 70

13 2 52 80 24 80 0 2 16 12 21 24 7 23 22 43 23 3 6 nd 2 41 13 0 22 4 9 27 54 76

nd, not done. Leukemia


1550

Table 3

Correlations between immune phenotypic subclasses and P-gp and MRP activity

P-gp activity MRP activity

CD34

CD33

0.52 (⬍0.001) 0.25 (0.06)

−0.54 (⬍0.001) −0.06 (0.65)

CD34+/CD38−

0.28 (0.04) 0.44 (0.001)

CD34+/CD33−

CD34+/CD33+

CD34−/CD33+

Maturation stage

0.61 (⬍0.001) 0.20 (0.12)

0.06 (0.68) 0.10 (0.47)

−0.68 (⬍0.001) −0.18 (0.17)

−0.66 (⬍0.001) −0.31 (0.02)

The results represent correlation coefficients between the percentages of the different immune phenotypic subclasses, and P-gp and MRP activity, expressed as Rh123 efflux-blocking factors of PSC833 and CF efflux-blocking factors of MK-571, respectively; P values are presented in parentheses, significant correlations are presented in bold.

four patients had a karyotype showing the same clonal chromosomal abnormalities at both time points. However, eight AML patients demonstrated chromosomal clones at relapse, which were different from the time of diagnosis. Three of these patients showed a normal karyotype at diagnosis and various clonal chromosomal abnormalities at relapse (patient Nos 2, 4 and 5), three patients (Nos 7, 16 and 23) showed clonal devolution, presenting a chromosomal aberrant clone at diagnosis, which was not observed in the relapsed material, and in two patients (Nos 9 and 18) clonal evolution was observed, showing additional chromosomal abnormalities at relapse as compared with the primary AML (Table 4). Since we have previously described a correlation between MRP activity and the occurrence of MRP1 deletions in AML patients with inversion 16,33 we now focussed on chromosome 16p13, and chromosome 7q21, on which MDR1 resides. Patient No. 2 showed a translocation of chromosome 16p13 in the relapsed sample, not in the primary sample. However, no significant differences in MRP1 mRNA expression or MRP activity were observed in this patient sample. Two patients (Nos 8 and 17) showed an additon or derivative of chromosome 7q21. No correlations were observed between the differences in karyotype and P-gp or MRP activities, and between the differences in karyotype and maturation status. Discussion Several studies have described the poor prognostic value of P-gp,1–6 and to a certain extent MRP10–12 in AML, which might imply a clonal selection of cells with high P-gp and MRP activity at the time of relapse. This is supported by some studies describing an upregulation of MDR1 or MRP1 mRNA in relapsed AML samples as compared to primary AML.36–38 However, these findings were not confirmed by other studies.38,39 In the present study, we observed no consistent upregulation of MDR1, MRP1, -2, -3 or -5 mRNA expression in relapsed vs de novo AML cells. In addition, no consistent upregulation of P-gp or MRP functional activity was found at relapse. A distinct correlation was observed between P-gp activity and maturation stage of the AML blasts, and between MRP activity and maturation stage, with a higher P-gp or MRP activity in the less differentiated cells. This change in maturation stage was not a consistent finding in all relapsed cases; in 23% of the cases the relapsed AML blasts expressed a more mature phenotype, whereas in 27% the relapsed cells had become less mature. These changes might be related to the emergence of new karyotypic clones, which were observed in 50% of the studied cases. The karyotypic changes in the relapsed samples, which were also noticed in some larger studies,40,41 included variations on the chromosomes 7q21 Leukemia

and 16p13, on which MDR1 and MRP1 are located. However, we did not observe a correlation between changes in karyotype and the activity of the MDR genes, or between changes in karyotype and maturation, indicating that other intrinsic defects might exist, which lead to the phenotypic changes. MRP1 and MRP2 mRNA expression in AML blasts have been described earlier;45 the expression of MRP3 and MRP5 mRNA in AML blasts is described here for the first time and demonstrated a variable expression, which could be increased or decreased at relapse vs diagnosis. No correlations were observed between MRP activity, as measured by the CF efflux-blocking capacity of MK-571, and MRP1, -2, -3, or -5 mRNA expression. As described previously, MRP1 and MRP2 show the same substrate specificities49,50 and both have been found to transport CF.45,51 With regard to MRP3, which shows 58% amino acid identity with MRP1, it has been demonstrated that MRP3, in contrast to MRP1 does not transport GSH.21 CF, however, is transported independently of GSH,51 which makes it a potential candidate to be pumped by MRP3. MRP5 has been described to transport cyclic nucleotides25 and the anticancer drugs 6mercaptopurine and thioguanine. However, it is unlikely that MRP5 activity is measured in the flow cytometric assay with CF and MK-571, since MK-571 does not inhibit the MRP5mediated transport.25 Furthermore, the observed discrepancy between the mRNA expressions and the MRP functional assay might be due to the different contribution of MRP1, MRP2, MRP3, and possibly other MRPs such as MRP4, MRP6 or MRP7, in the CF efflux assay. We observed a correlation between the up- and downregulation of MDR1 and MRP2 mRNA expression. Although a colocalization of both proteins has been reported,51 a coregulation of MDR1 and MRP2 has not been described before. These findings suggest that interactions might exist between the different MDR transporter proteins. A similar observation was observed in AML patients with the chromosomal inversion 16; patients with deletion of MRP1 showed upregulation of other MRP genes.42 Some studies have been conducted with PSC833 as sole MDR modifier in relapsed AML patients.52,53 Considering the results of the present study, which show a diversity of changes in MDR genes, it seems highly unlikely that one MDR modifier will overcome multidrug resistance in AML. Since P-gp as well as MRP has been described to transport substrates that are used in the treatment of AML, and the functional expression of both proteins is correlated with poor outcome, it seems more interesting to treat patients in the future with a combination of MDR inhibitors, or with chemotherapeutic agents that are not transported by the MDR drugs. In conclusion, this study shows that the P-gp and MRP activity


Table 4

Patient No.

Primary

1 2 3 4 5

46,XX[20] 46,XY[20] 46,XX[20] 46,XY[20] 46,XX[20]

6 7

46,XY,t(6;9)(p23;q34)[20] 46,XY,del(12)(p12p13)[15]/46,XY, ?del(12)(p12p13)[3]/46,XY,del(5)(q14q31)[2] 44–47,X,?add(X)(q22),−2,−2,?add(3)(q11), add(6)(q1?3), add(7)(q21),−8,?dic(12;16)(p11;q11), −14,add(18)(q21),del(19)(p13),+21,+1−2r,+1–3mar[cp8] 46,XY,add(5)(q11.2),add(9)(p13),der(20)t(9;20) (p13;q11.2)[4]/45,XY,?der(3;17)(q11;p1)add(3)(p1?3), add(5)(q11.2),−11,−19,−21,+mar1,+mar2,+mar3[9] 46,XY [7] 46,XX[20] 46,XY[20] 47,XX,+11[16]/46,XX[4] 46,XY[20] 46,XY[20] 46,XY,t(8;21)(q22;q22),del(9)(q21q22)[17]/ 45,idem,−Y[3] 47,XX,t(15;17)(q22;q11)[15]/47,idem,+8[2]/ 46,XX[3] 46,XX,t(1;3)(p36;q21), der(7)t(7;14)(q21;q13)[19]/ 46,XX[1] 45,XY,inv(1)(p13p34)?c, inv(3)(q21q26),−7[20]

8 9

10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30

1551

Karyotype of the AML blasts at diagnosis and at relapse

46,XY[20] 46,XX,t(8;21)(q22;q22)[19]/46,XX[1] 45,XX,add(2)(p1?4),der(3)?t(3;7)(q27;q32),−7, add(12)(q24)[20] 46,XX[20] 46,XX,t(8;21)(q22;q22),del(9)(q22q34)or(q22.3) 46,XX[19]/47,XX,del(7)(q3)[1] 46,XX[20] 46,XX[20] 46,XX[20] nd 46,XY[20] 46,XY[20]

Relapse

46,XX[20] 46,XY, der(16)t(1;16)(q13;p13)[12]/46,XY[8] 46,XX[20] 46,XY,add(6)(p23)[20] 46,XX,add(3)(q12)[2]/46,XX,?t(4;10)(p16;q23)[2]/46,XX,t(1;15) (q4;q1)[1]/46,XX,t(?;15)(?;q1),inc[1]/46,XX,add(1)(q4)[1]/46,XX[13] 46,XY,t(6;9)(p23;q34)[10] 46,XY,del(12)(p12p13)[9]/46,XY,?del(12)(p12p13)[5]/46,XY[6] nd 44–45,XY,der(3;17)(q11;p1)add(3)(p1?3),?add(5)(q11.2),−11, add(11)(p15),−12,add(14)(p11),der(18)t(12;18)(q11 or q12;p11.3), add(19)(p13),−21,+mar1,+mar3[cp17]/46,XY [2] nd nd 47,XX,+11[3]/47,XX,+C[1]/46,XX[13] 46,XY[20] 46,XY[20] nd 47,XX,+8,t(15;17)(q22;q11)[16]/46,XX[4] 46,XX,t(1;3)(p36;q21), der(7)t(7;14)(q21;q13)[10]/ 46,idem,del(11)(p13p15)[10] 45,XY,inv(1)(p13p34)?c, inv(3)(q21q26),−7[4]/45, idem, t(8;11)?(q21;p14)[2]/45,idem,t(1;17)(q21;q11)[14] nd 46,XX,t(8;21)(q22;q22)[20] nd nd 46,XX,t(8;21)[19]/46,XX[1] nd nd nd nd nd nd nd

add, addition; del, deletion; der, derivative, inv, inversion; t, translocation; nd, not done.

depends on the maturation stage of the AML blasts, which can be different at relapse vs AML at diagnosis.

4

Acknowledgements This study was supported by a grant of the Foundation of Pediatric Oncology Groningen (SKOG 99–01).

5

References 1 Marie J-P, Zittoun R, Sikic BI. Multidrug resistance (MDR1) gene expression in adult acute leukemias: correlations with treatment outcome and in vitro drug sensitivity. Blood 1991; 78: 586–592. 2 Campos L, Guyotat D, Archimbaud E, Calmard-Oriol P, Tsuruo T, Troncy J, Treille D, Fiere D. Clinical significance of multidrug resistance P-glycoprotein expression on acute nonlymphoblastic leukemia cells at diagnosis. Blood 1992; 79: 473–476. 3 Guerci A, Merlin HL, Missoun N, Feldmann L, Marchal S, Witz F, Rose C, Guerci O. Predictive value for treatment outcome in acute myeloid leukemia of cellular daunorubicin accumulation

6 7 8 9

and P-glycoprotein expression simultaneously determined by flow cytometry. Blood 1995; 85: 2147–2153. Leith CP, Kopecky KJ, Chen IM, Eijdems L, Slovak ML, Mc Connell TS, Head DR, Weick J, Grever MR, Appelbaum FR, Willman CL. Frequency and clinical significance of the expression of the multidrug resistance proteins MDR1/P-glycoprotein, MRP1 and LRP in acute myeloid leukemia: a southwest Oncology Group Study. Blood 1999; 94: 1086–1099. Michieli M, Damiani D, Ermacora A, Masolini P, Raspadori D, Visani O, Scheper RJ, Baccarani M. P-glycoprotein, lung resistance-related protein and multidrug resistance associated protein in de novo acute non-lymphocytic leukaemias: biological and clinical implications. Br J Haematol 1999; 104: 328–335. Legrand O, Perrot J-Y, Simonin G, Baudard M, Marie J-P. JC-1: a very sensitive fluorescent probe to test Pgp activity in adult acute myeloid leukemia. Blood 2001; 97: 502–508. Simon M, Schindler M. Cell biological mechanisms of multidrug resistance in tumor. Proc Natl Acad Sci USA 1994; 91: 3497– 3504. Licht T, Pastan I, Gottesman MM, Hermann F. The multidrug resistance gene in gene therapy of cancer and hematopoietic disorders. Ann Hematol 1996; 72: 184–193. Cole SPC, Bhardwaj G, Gerlach JH, Mackie JE, Grant CE, Almquist KC, Stewart AJ, Kurz EU, Duncan AMV, Deeley RG. OverLeukemia


1552 10 11

12

13

14

15

16

17

18 19

20 21

22 23

24

25 26 27

Leukemia

expression of a novel transporter gene in a multidrug resistance human lung cancer cell line. Science 1992; 258: 1650–1654. Legrand O, Simonin G, Perrot J-Y, Zittoun R, Marie J-P. Pgp and MRP activities using calcein-AM are prognostic factors in adult acute myeloid leukemia patients. Blood 1998; 91: 4480–4488. Legrand O, Simonin G, Beauchamp-Nicoud A, Zittoun R, Marie J-P. Simultaneous activity of MRP1 and Pgp is correlated with in vitro resistance to daunorubicin and with in vivo resistance in adult acute myeloid leukemia. Blood 1999; 94: 1046–1056. Van der Kolk DM, de Vries EGE, van Putten WLJ, Verdonck LF, Ossenkoppele GJ, Verhoef EG, Vellenga E. P-gp and MRP activities in relation to treatment outcome in acute myeloid leukemia. Clin Cancer Res 2000; 6: 3205–3214. Marbeuf-Gueye C, Broxterman HJ, Dubru F, Priebe W, GarnierSuillerot A. Kinetics of anthracycline efflux from multidrug resistance protein-expressing cancer cells compared with Pglycoprotein-expressing cancer cells. Mol Pharmacol 1998; 53: 141–147. Loe DW, Almquist KC, Deeley RG, Cole SPC. Multidrug resistance protein (MRP)-mediated transport of leukotriene C4 and chemotherapeutic agents in membrane vesicles. Demonstration of glutathione-dependent vincristine transport. J Biol Chem 1996; 271: 9675–9682. Renes J, de Vries EGE, Nienhuis EF, Jansen PLM, Mu¨ller M. ATPand glutathione-dependent transport of chemotherapeutic drugs by the multidrug resistance protein MRP1. Br J Pharmacol 1999; 126: 681–688. Taniguchi K, Wada M, Kohno K, Nakamura T, Kawabe T, Kawakami M, Kagotani K, Okumura K, Akiyama S, Kuwano M. A human canalicular multispecific organic anion transporter (cMOAT) gene is overexpressed in cisplain-resistant human cancer cell lines with decreased drug accumulation. Cancer Res 1996; 56: 4124–4129. Kool M, de Haas M, Scheffer GL, Scheper RJ, van Eijk M, Juijn JA, Baas F, Borst P. Analysis of expression of cMOAT (MRP2), MRP3, MRP4 and MRP5, homologs of the multidrug resistanceassociated protein gene (MRP1), in human cancer cell lines. Cancer Res 1997; 57: 3537–3547. Kool M, van der Linden M, de Haas M, Baas F, Borst P. Expression of human MRP6, a homologue of the multidrug resistance protein gene MRP1, in tissues and cancer cells. Cancer Res 1999; 59: 175. Hopper E, Belinsky MG, Zeng H, Tosolini A, Testa JR, Kruh GD. Analysis of the structure and expression pattern of MRP7 (ABCC10), a new member of the MRP subfamily. Cancer Lett 2001; 162: 181–191. Keppler D, Cui Y, Koning J, Leier I, Nies A. Export pumps for anionic conjugates encoded by MRP genes. Adv Enzyme Regul 1999; 39: 237–246. Kool M, van der Linden M, de Haas M, Scheffer GL, de Vree ML, Smith AJ, Jansen G, Peters GJ, Ponne N, Scheper RJ, Oude Elferink RPJ, Baas F, Borst P. MRP3, an organic anion transporter able to transport anti-cancer drugs. Proc Natl Acad Sci USA 1999; 96: 6914–6919. Lee K, Klein-Szanto AJ, Kruh GD. Analysis of the MRP4 drug resistance profile in transfected NIH3T3 cells. J Natl Cancer Inst 2000; 92: 1934–1940. Schuetz JD, Connelly MC, Sun D, Paibir SG, Flynn PM, Srinivas RV, Kumar A, Fridland A. MRP4: a previously unidentified factor in resistance to nucleoside-based antiviral drugs. Nat Med 1999; 5: 1048–1051. Wijnholds J, Mol CAAM, van Deemter L, de Haas M, Scheffer GL, Baas F, Beijnen JH, Scheper RJ, Hatse S, De Clerq E, Balzarini J, Borst P. Multidrug-resistance protein 5 is a multispecific organic anion transporter able to transport nucleotide analogs. Proc Natl Acad Sci USA 2000; 97: 7476–7481. Jedlitschky G, Burchell B, Keppler D. The multidrug resistance protein 5 (MRP5) functions as an ATP-dependent export pump for cyclic nucleotides. J Biol Chem 2000; 275: 30069–30074. Funke I, Wiesneth M, Platow S, Kubanek B. Palliative cytoreduction in refractory acute leukemia: a retrospective study of 57 adult patients. Ann Hematol 2000; 79: 132–137. Miyawaki S, Tanimoto M, Kobayashi T, Minami S, Tamura J, Omoto E, Kuriyama K, Hatake K, Saito K, Kanamaru A, Oh H, Ohtake S, Asou N, Sakamaki H, Yamada O, Jinnai I, Tsubaki K, Takeyama K, Hiraoka A, Matsuda S, Takahashi M, Shimazaki C, Adachi K, Kageyama S, Ohno R et al. No beneficial effect from

28

29

30 31 32

33

34

35 36

37

38 39

40 41

42

43

44 45

46

addition of etoposide to daunorubicin, cytarabine, and 6mercaptopurine in individualized induction therapy of adult acute myeloid leukemia: the JALSG-AML92 study. Japan Adult Leukemia Study Group. Int J Hematol 1999; 70: 97–104. Coulthard SA, Howell C, Robson J, Hall AG. The relationship between thiopurine methyltransferase activity and genotype in blasts from patients with acute leukemia. Blood 1998; 92: 2856–2862. Mayer JR, Davis RB, Schiffer CA, Berg DT, Powell BL, Schulman P, Omura GA, Moore JO, McIntyre OR, Frei E. Third intensive postremission chemotherapy in adults with acute myeloid leukemia. New Engl J Med 1994; 331: 896–903. Cassileth PA, Lynch E, Hines JD. Varying intensity of postremission therapy in acute myeloid leukemia. Blood 1993; 79: 1924–1930. Schiller G, Gajewski J, Territo M. Long-term outcome of high-dose cytarabine-based consolidation chemotherapy for adults with acute myelogenous leukemia. Blood 1992; 80: 2977–2982. Cassileth PA, Harrington DP, Appelbaum FR, Hillard ML, Rowe JM, Paiette E, Willman C, Hurd DD, Bennett JM, Blume KG, Head DR, Wiernik PH. Chemotherapy compared with autologous or allogeneic bone marrow transplantation in the management of acute myeloid leukemia in first remission. New Engl J Med 1998; 339: 1649–1656. Godwin JE, Kopecky KJ, Head DR. A double-blind placebo-controlled trial of granulocyte colony-stimulating factor in elderly patients with previously untreated acute myeloid leukemia: a Southwest Oncology Group Study (9031). Blood 1998; 15: 3607–3615. Lo¨wenberg B, Van Putten WLJ, Verdonck LF. Autologous bone marrow transplantation in acute myeloid leukemia in first remission: results of a Dutch prospective study. J Clin Oncol 1990; 8: 287–294. Burnett AK, Transey P, Watkins R. Transplantation of unpurged autologous bone-marrow in acuate myeloid leukaemia in first remission. Lancet 1984; 2: 1068–1070. Lyttelton MP, Hart S, Ganeshaguru K, Hoffbrand AV, Mehta AB. Quantitation of multidrug resistant MDR1 transcript in acute myeloid leukaemia by non-isotopic quantitative cDNA polymerase chain reaction. Br J Haematol 1994; 86: 540–546. Beck J, Handgretinger R, Klingebiel T, Dopfer R, Schaich M, Ehninger G, Niethammer D, Gekeler V. Expression of PKC isozyme and MDR-associated genes in primary and relapsed state AML. Leukemia 1996; 10: 423–433. Zhou DC, Zittoun R, Marie JP. Expression of multidrug resistanceassociated protein (MRP) and multidrug resistance (MDR1) genes in acute myeloid leukemia. Leukemia 1995; 9: 1661–1665. Schneider E, Cowan KH, Bader H, Toomey S, Schwartz GN, Karp JE, Burke PJ, Kaufmann SH. Increased expression of the multidrug resistance-associated protein gene in relapsed acute leukemia. Blood 1995; 85: 186–193. Estey E, Keating MJ, Pierce S, Stass S. Change in karyotype between diagnosis and first relapse in acute myelogenous leukemia. Leukemia 1995; 9: 972–977. Garson OM, Hagemeijer A, Sakurai M, Reeves BR, Swansbury GJ, Williams GJ, Alimena G, Arthur DC, Berger R, de la Chapelle A. Cytogenetic studies of 103 patients with acute myelogenous leukemia in relapse. Cancer Genet Cytogenet 1989; 40: 187–202. Van der Kolk DM, Vellenga E, van der Veen AY, Noordhoek L, Timmer-Bosscha H, Ossenkoppele GJ, Raymakers RA, Mu¨ller M, van den Berg E, de Vries EGE. Deletion of the multidrug resistance protein MRP1 gene in acute myeloid leukemia: the impact on MRP activity. Blood 2000; 95: 3514–3519. Te Boekhorst PAW, de Leeuw K, Schoester M, Wittebol S, Nooter K, Hagemeyer A, Lo¨wenberg B, Sonneveld P. Predominance of functional multidrug resistance (MDR-1) phenotype in CD34+ acute myeloid leukemia cells. Blood 1993; 82: 3157–3162. Gralnick HR. Classification of acute leukemia. Ann Intern Med 1977; 87: 740. Van der Kolk DM, de Vries EGE, Koning JA, van den Berg E, Mu¨ller M, Vellenga E. Activity and expression of the multidrug resistance proteins MRP1 and MRP2 in acute myeloid leukemia cells, tumor cell lines and normal hematopoietic CD34+ peripheral blood cells. Clin Cancer Res 1998; 4: 1727–1736. Jones TR, Zamboni R, Belley M, Champion E, Charette L, FordHutchinson AW, Frenette R, Gauthier J-Y, Leger S, Masson P,


McFarlane S, Piechuta H, Rokach J, Williams H, Young RN. Pharmacology of L-660, 711 (MK-571): a novel potent and selective leukotriene D4 receptor antagonist. Can J Physiol Pharmacol 1989; 67: 17–28. 47 Lo¨wenberg B, Suciu S, Archimbaud E, Haak H, Stryckmans P, de cataldo R, Dekker AW, Berneman ZN, Thyss A, Van der Lelie J, Sonneveld P, Visani G, Fillet G, Hayat M, Hagemeijer A, Solbu G, Zittoun R. Mitoxantrone versus daunorubicin in induction-consolidation chemotherapy—the value of low-dose cytarabine for maintenance of remission, and an assessment of prognostic factors in acute myeloid leukemia in the elderly: final report. European Organization for the Research and Treatment of Cancer and the Dutch–Belgian Hemato-Oncology Cooperative Hovon Group. J Clin Oncol 1998; 15: 872–881. 48 Vellenga E, van Putten WLJ, Boogaerts MA, Daenen SMGJ, Verhoef GEG, Hagenbeek A, Jonkhoff AR, Huijgens PC, Verdonck LF, van der Lelie J, Schouten HC, Gmu¨r J, Wijermans P, Gratwohl A, Hess U, Fey MF, Lo¨wenberg B. Peripheral blood stem cell transplantation as an alternative to autologous marrow transplantation in the treatment of acute myeloid leukemia. Bone Marrow Transplant 1999; 23: 1279–1282. 49 Keppler D, Cui Y, Konig J, Leier I, Nies A. Export pumps for

50

51

52

53

anionic conjugates encoded by MRP genes. Adv Enzyme Regul 1999; 39: 237–246. Cantz T, Nies AT, Brom M, Hofmann AF, Kepper D. MRP2, a human conjugate export pump, is present and transports fluo 3 into apical vacuole of Hep G2 cells. Am J Physiol Gastrointest Liver Physiol 2000; 278: G522–G531. Barhoumi R, Bowen JA, Stein LS, Echols J, Burghardt RC. Concurrent analysis of intracellular glutathione content and gap junctional intercellular communication. Cytometry 1993; 14: 747– 756. Kornblau SM, Estey E, Madden T, Tran HT, Zhao S, Consoli U, Snell V, Sanchez-Williams G, Kantarjian H, Keating M, Newman RA, Andreeff M. Phase I study of mitoxantrone plus etoposide with multidrug blockade by SDZ PSC-833 in relapsed or refractory acute myelogenous leukemia. J Clin Oncol 1997; 15: 1796–1802. Advani R, Visani G, Milligan D, Saba H, Tallman M, Rowe JM, Wiernik PH, Ramek J, Dugan K, Lum B, Villena J, Davis E, Paietta E, Litchman M, Covelli A, Sikic B, Greenberg P. Treatment of poor prognosis AML patients using PSC833 (valdospar) plus mitoxantrone, etoposide, and cytarabine (PSC-MEC). Adv Exp Med Biol 1999; 457: 47–56.

1553

Leukemia