Aggravation of Alzheimers disease due to the ... - Semantic Scholar

Aging Cell (2014) 13, pp605–615

Doi: 10.1111/acel.12209

Aggravation of Alzheimer’s disease due to the COX-2-mediated reciprocal regulation of IL-1b and Ab between glial and neuron cells Pu Wang,* Pei-Pei Guan,* Tao Wang, Xin Yu, Jian-Jun Guo and Zhan-You Wang College of Life and Health Sciences, Northeastern University, Shenyang 110819, China

Summary Alzheimer’s disease (AD) is the most common form of dementia and displays the characteristics of chronic neurodegenerative disorders; amyloid plaques (AP) that contain amyloid b-protein (Ab) accumulate in AD, which is also characterized by tau phosphorylation. Epidemiological evidence has demonstrated that long-term treatment with nonsteroidal anti-inflammatory drugs (NSAIDs) markedly reduces the risk of AD by inhibiting the expression of cyclooxygenase 2 (COX-2). Although the levels of COX-2 and its metabolic product prostaglandin (PG)E2 are elevated in the brain of AD patients, the mechanisms for the development of AD remain unknown. Using human- or mouse-derived glioblastoma and neuroblastoma cell lines as model systems, we delineated the signaling pathways by which COX-2 mediates the reciprocal regulation of interleukin-1b (IL-1b) and Ab between glial and neuron cells. In glioblastoma cells, COX-2 regulates the synthesis of IL-1b in a PGE2-dependent manner. Moreover, COX2-derived PGE2 signals the activation of the PI3-K/AKT and PKA/ CREB pathways via cyclic AMP; these pathways transactivate the NF-jB p65 subunit via phosphorylation at Ser 536 and Ser 276, leading to IL-1b synthesis. The secretion of IL-1b from glioblastoma cells in turn stimulates the expression of COX-2 in human or mouse neuroblastoma cells. Similar regulatory mechanisms were found for the COX-2 regulation of BACE-1 expression in neuroblastoma cells. More importantly, Ab deposition mediated the inflammatory response of glial cells via inducing the expression of COX-2 in glioblastoma cells. These findings not only provide new insights into the mechanisms of COX-2-induced AD but also initially define the therapeutic targets of AD.

Key words: Alzheimer’s disease; cytokines; gene expression; neurodegenerative disease; signal transduction.

Aging Cell

Introduction Alzheimer’s disease (AD) is the most common form of dementia and displays the characteristics of chronic neurodegenerative disorders. The neuropathological features of AD are the formation of extracellular amyloid plaques (AP) and tau phosphorylation; the APs are mainly

Correspondence Zhan-You Wang, College of Life and Health Sciences, Northeastern University, Shenyang 110819, China. Tel./fax: +86 24 24245211; e-mail: [email protected] *These authors contributed equally to this work. Accepted for publication 26 January 2014

composed by b-amyloid (Ab) peptides. Although the Ab metabolic processes in AD are not thoroughly understood, the beneficial effects of NSAIDs led the way to the hypothesis that cyclooxygenase (COX) activity particularly that of the inducible isoform COX-2 is involved in the cascade of events leading to neurodegeneration in AD. Indeed, prior works have shown that COX-2 expression is elevated in AD brain (Pasinetti & Aisen, 1998; Ho et al., 1999) and that this expression is correlated with clinical dementia (Ho et al., 2001). In addition, in vitro studies suggest that COX-2 up-regulation in the AD brain may be mediated by the exposure of neurons to Ab, which may contribute to Ab neurotoxicity (Pasinetti & Aisen, 1998). However, recent studies revealed that long-term in vivo treatment of amyloid precursor protein (APP) transgenic mice with NSAIDs significantly diminished Ab deposition (Lim et al., 2000) and improved behavior (Lim et al., 2001). Therefore, cross talk between COX-2 and Ab may play a key role in mediating the development and progression of AD. Although the regulatory mechanisms between COX-2 and Ab remain unclear, the potential roles of the COX-2-induced inflammatory response to the pathogenesis of AD in increasing neuronal damage have been proposed. In AD patients, COX-2 was initially found to be expressed in neuron cells, whereas COX-2 expression was recently found to be induced in microglia cells for diseases related to prions, such as AD or Parkinson’s disease (PD; Veerhuis et al., 2002). Similarly, PGE2, as the major metabolic product of COX-2, is produced in cultured human primary astrocytes after stimulation with interleukin-1b (IL-1b; Blom et al., 1997). Additional evidence revealed that human primary microglia cell cultures can produce PGE2 (Hoozemans et al., 2001). In line with these in vitro works, Montine et al. (1999) reported elevated cerebrospinal fluid PGE2 levels in patients with AD. Although the roles of COX-2 and PGE2 in activating the inflammatory response of AD are still debated, astrocytes or microglia cells are generally regarded to have the same lineage as the targets of COX-2 or PGE2 (Kaur et al., 2001). Therefore, these cells are speculated to be involved in the pathogenesis of AD via cytokine secretion, as evidenced by the IL-1b up-regulation in the brain of AD patients compared with control individuals (Griffin et al., 1989). However, the mechanisms remain unknown. In the current study, we delineated the signaling pathways of COX-2-mediated reciprocal regulation of IL-1b and Ab between glial and neuron cells in mouse or human-derived cell lines, this reciprocal regulation may contribute to the pathogenesis of AD. Reconstructing the signaling network that regulates AD progression may provide insights for developing strategies to treat AD.

Results Heat shock protein 70 mediated the effects of COX-2 on inducing the synthesis of PGE2 and cAMP; this synthesis in turn regulates IL-1b expression in human- or rat-derived glial cells In view of the previous observations suggesting that IL-1b is regulated by COX-2 (Wang et al., 2012) and its potential contribution to the

ª 2014 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd. This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.

605

606 COX-2 mediates cross talk between IL-1b and Ab, P. Wang et al. pathogenesis of AD (Montine et al., 1999), we first examined the response of A172 cells to a COX-2 inhibitor treatment. Our data revealed that a NS398 (50 lM) treatment markedly suppressed the mRNA and protein expression of mPGES-1 and highly induced the expression of heat shock protein 70 (HSP70; Fig. 1A). As mPGES-1 is the enzyme responsible for PGE2 biosynthesis, the incubation of A172 cells with NS398 (50 lM) inhibited the production of PGE2 and its downstream effector, cyclic (c)AMP (Fig. 1B). More interestingly, the treatment of A172 cells with an HSP70 inhibitor, VER155008 (10 lM), obviously induced the phosphorylation of NF-jB at both the Ser 536 and Ser 276 sites in A172 cells (Fig. 1C). These data clearly implied that HSP70 located downstream of COX-2, which might exert its effects on IL-1b regulation via the synthesis of PGE2 and cAMP. To verify this hypothesis, we further examined the mRNA and protein levels of IL-1b in A172 cells treated with NS398 (50 lM). As shown in Fig. 1B, the secretion of IL-1b was obviously attenuated by the NS398 treatment in A172 cells. To further validate the above data, C6 cells were also treated with NS398 (50 lM) or VER155008 (10 lM) for 48 h, and similar results were observed for the expression of mPGES-1, HSP70 and the production of PGE2, cAMP, and IL-1b (Fig. 1D–F). These observations were further supported by the results that mPGES-1 cDNA transfection obviously enhanced the production of PGE2, cAMP, and IL-1b (Fig. 1G). More

NS398 (50 μM)

(D)

–

NS398 (50 μM)

+

β-actin

β-actin

mPGES-1 HSP70

1.5 1.0

*

0.5

PGE2 (pmol cAMP (pmol μg–1 protein) IL-1β (pg μg–1 protein) * *

*

100 0

–

+

The production of PGE2, cAMP and IL-1β

μg–1 protein)

NS398 (50 μM)

–

+

VER155008 (10 μM)

2000

* *

1600

*

1200 800 400

600

PGE2 (pmol μg–1 protein) cAMP (pmol μg–1 protein) IL-1β (pg μg–1 protein)

500 400 300

**

200

*

100 0

–

+

VER155008 (10 μM)

p-NF-κB (Ser 536)

NF-κB (Ser 536)

p-NF-κB (Ser 276)

NF-κB (Ser 276)

β-actin

β-actin

800 600 #

400 200 0

(K)

(I)

*

1000

0

(H)

(F)

(C)

PGE2 (pmol cAMP (pmol μg–1 protein) IL-1β (pg μg–1 protein) pg IL-1β μg–1 protein

mRNA expression

mRNA expression The production of PGE2, cAMP and IL-1β

*

2.0

(E)

(B)

200

Forskolin (10 μM) NS398 (50 μM) COX-2

0

300

+ +

μg–1 protein)

0

400

+ –

β-actin

*

500

– –

HSP70

mPGES-1 HSP70

600

(J)

HSP70

2.0

0.5

mPGES-1 cDNA mPGES-1

2.5

1.0

+

mPGES-1

*

1.5

–

mPGES-1

β-actin 2.5

(G)

IL-1β mRNA expression

+

We next sought to elucidate the signaling cascade of IL-1b synthesis in A172 cells. Given that PGE2 and forskolin induce the activity of the PI3-K/ AKT and PKA/CREB signaling pathways (Fig. 1K), we examined the potential contribution of PI3-K/AKT and PKA/CREB to the synthesis of IL-1b in A172 cells. As a first step, we treated A172 cells with the selective PI3-K inhibitor LY294002 (10 lM) or the PKA inhibitor H89 (1 lM) in the absence or presence of PGE2 (10 lM). These pharmacological inhibitors diminished the PGE2-induced phosphorylation of AKT and CREB without affecting their total expression levels (Fig. 2A,B upper

The production of PGE2, cAMP and IL-1β

–

COX-2 induces the synthesis of PGE2 and cAMP, which in turn regulate IL-1b expression via the PI3-K/AKT and PKA/CREB pathways in A172 cells

6

*

5

– –

+ –

– +

PGE2 (10 μM) Forskolin (10 μM) p-AKT (Ser 473)

*

4

AKT

3 2

p-CREB (Ser 133)

1 CREB

0

β-actin

900 pg IL-1β μg–1 protein

(A)

interestingly, the incubation of A172 cells with PGE2 (10 lM) or the adenylate cyclase agonist forskolin (10 lM) highly induced the mRNA and protein expression of IL-1b (Fig. 1H,I). In addition, the treatment of A172 cells with NS398 (50 lM) thoroughly blocked the effects in which forskolin (10 lM) induced the synthesis of IL-1b by inhibiting the expression of COX-2 (Fig. 1J). These observations from our data demonstrate that HSP70 mediated the effects of COX-2 on regulating the synthesis of IL-1b via PGE2 and cAMP.

*

*

600 300 0 – –

+ –

– +

PGE2 (10 μM) Forskolin (10 μM)

Fig. 1 Involvement of COX-2 and HSP70 in regulating IL-1b synthesis via mPGES-1, PGE2, and cAMP signaling pathways in glial cells. Human glioblastoma A172 cells and rat brain C6 glial cells were treated with NS398 (50 lM) for 48 h (A, B, D, E) or HSP70 inhibitor VER155008 (10 lM) for 48 h (C, F). In selected experiments, A172 cells were transfected with mPGES-1 cDNA for 48 h (G). In separate experiments, A172 cells were treated with PGE2 (10 lM) or forskolin (10 lM) (H–K) in the absence or presence of NS398 (50 lM) for 48 h (J). Total mPGES-1 (A, D, G upper panel), HSP70 (A, D), COX-2 (J), and phosphorylated NF-jB (C, F), AKT, CREB levels (K) were detected by immunoblotting using specific Abs. The equal lane loading is demonstrated by the similar intensities of total AKT, CREB, and b-actin. mPGES-1 (A, D lower panel), HSP70 (A, D lower panel), and IL-1b mRNA levels (H) were determined by qRT–PCR and total amounts of GAPDH served as internal control. The formation of PGE2 and cAMP and the secretion of IL-1b (B, E, G, I, J) were determined using PGE2, cAMP and IL-1b enzyme immunoassay kits, respectively. The data represent the means SE of three independent experiments. *P < 0.05 with respect to the vehicle-treated control. #P < 0.05 compared to forskolin treated alone.

ª 2014 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

COX-2 mediates cross talk between IL-1b and Ab, P. Wang et al. 607

(B)

PGE2 (10 μM) LY294002 (10 μM)

– –

+ –

+ +

p-AKT (Ser 473)

p-NF-κB (Ser 276)

NF-κB

NF-κB

β-actin

β-actin

#

– –

+ –

+ +

200

(G) + –

+ +

#

2 1 0 *

600 # 300

(J)

2 #

0

600 #

200 0 PGE2 (10 μM) KT5720 (5 μM)

3 #

2 1 0 900 800 700 600 500 400 300 200 100 0

*

#

*

5 4

+ –

3 2

– +

#

1 0

900

*

*

4

*

5

600 #

300 0

– –

+ –

+ +

Forskolin (10 μM) KT5720 (5 μM)

4 3 2 1 0

*

Vector p65 cDNA

+ –

+ +

Forskolin (10 μM) CREB siRNA

β-actin 7 6 5 4 3 2 1 0

*

#

1000 900 800 700 600 500 400 300 200 100 0

(K)

6

#

p-NF-κB (Ser 276)

*

#

9 8 7 6 5 4 3 2 1 0

*

1400 1200 1000 800 600 400 200 0

*

Il-1β mRNA expression

3

5

p65 mRNA expression


*

*

NF-κB

Il-1β mRNA expression

3

1000 900 800 700 600 500 400 300 200 100 0

CREB

pg IL-1β μg–1 protein

4

#

– –



NF-κB β-actin

*

3 2 1 0

Forskolin (10 μM) AKT siRNA

NF-κB

6

*

(H) – –

β-actin

5

7 6 5 4


400

NF-κB

900

+ +

#

600

0

0

+ –

800

β-actin

300

– –

*

1000

p-NF-κB (Ser 536)



0 1200

*

p-NF-κB (Ser 276)

#

400

1

p-NF-κB (Ser 536)

*

800

#

2

AKT

0

1

3

CREB

1

4.5 4

4

pg IL-1β μg-1 protein


(F)




0 800 700 600 500 400 300 200 100 0

0


#

1

β-actin

*

AKT

#

600

(I)

*

5

Forskolin (10 μM) H89 (1 μM) p-CREB (Ser 133)

3 2

β-actin

3 2

CREB

p-AKT (Ser 473)

4

900 pg IL-1β μg-1 protein

4.5 4

Forskolin (10 μM) LY294002 (10 μM)

*

5

PGE2 (10 μM) CREB siRNA

p-NF-κB (Ser 536)

#

6

+ +

NF-κB

*

+ +

+ –

NF-κB

0

+ –

– –

PGE2 (10 μM) AKT siRNA

p-NF-κB (Ser 276)

#

– –

+ +

p-NF-κB (Ser 536)

1

(E)

+ –

AKT

*

800 700 600 500 400 300 200 100 0

– –

CREB

3 2

(D)

AKT



4.5 4

(C)

PGE2 (10 μM) H89 (1 μM) p-CREB (Ser 133)


+ +


+ –


– –


(A)

+ –

– +

Vector p65 cDNA

Fig. 2 PGE2- and cAMP-stimulated synthesis of IL-1b via the PI3-K/AKT- and PKA/CREB-dependent NF-jB signaling pathways in human A172 cells. A172 cells were treated with either the PI3-K inhibitor LY294002 (10 lM) (A, E), the PKA inhibitor H89 (1 lM) (B, F), or transfected with siRNA oligonucleotides specific for AKT (C, G) or CREB (D, H) in the absence or presence or PGE2 (10 lM) (A–D) or forskolin (10 lM) (E–H) for 48 h. In separate experiments, A172 cells were treated with the NF-jB p65 subunit inhibitor KT5720 (5 lM) in the absence or presence of PGE2 (10 lM) (I) or forskolin (10 lM) (J). In distinct experiments, A172 cells were transfected with the vector control or with p65 cDNA plasmids before extracting the total mRNA or protein (K). Phosphorylated AKT, CREB, NF-jB at the sites of Ser 536 and Ser 276 and total AKT, CREB, NF-jB were detected by immunoblotting using specific Abs. The equal lane loading is demonstrated by the similar intensities of b-actin. The IL-1b mRNA and protein levels were determined by qRT–PCR and ELISA, respectively. The total amounts of GAPDH and protein served as internal controls for qRT–PCR and ELISA, respectively. The data represent the means SE of three independent experiments. *P < 0.05 with respect to the vehicle-treated control. #P < 0.05 compared to treatments with PGE2 or forskolin alone.


608 COX-2 mediates cross talk between IL-1b and Ab, P. Wang et al. panel) and markedly attenuated the PGE2-stimulated IL-1b mRNA and protein expression (Fig. 2A,B lower panel). Similar results were obtained when we treated the cells with LY294002 or H89 in the absence or presence of forskolin (10 lM; Fig. 2E,F). To validate the nonselective nature of LY294002 and H89, A172 cells were transfected with siRNAs targeting AKT or CREB. These genetic interventions effectively knocked down the protein expression of AKT and CREB, respectively, relative to that in cells transfected with the scrambled siRNA control (Fig. 2C,D upper panel). The suppression of AKT and CREB also abrogated the induction of IL-1b mRNA and protein expression in the presence of PGE2 (10 lM; Fig. 2C,D lower panel). In addition, AKT or CREB knockdown attenuated the effects of forskolin on stimulating the expression of IL-1b in A172 cells (Fig. 2G,H). Therefore, it is clear that the PI3-K/AKT and PKA/CREB signaling pathways played key roles in mediating the effects in which COX-2 induced the expression of IL-1b in glial cells.

neuron cells with VER155008 obviously induced the phosphorylation of NF-jB at both the Ser 536 and Ser 276 sites (Fig. 3A,B). These results demonstrate the involvement of HSP70 in the signaling cascade of BACE-1 expression via NF-jB in neuron cells.

Involvement of PGE2 and cAMP in regulating BACE-1 expression via the PI3-K and PKA signaling pathways in neuron cells

In view of the increased phosphorylation of AKT and CREB and their biological effects on the activity of NF-jB, we examined the potential role of AKT and ERK1/2 in modulating the activities of NF-jB. As shown in Fig. 2A,B,E,F, the treatment of A172 cells with LY294002 or H89 abrogated the PGE2- or forskolin-induced phosphorylation of NF-jB at the sites of Ser 536 and Ser 276, respectively. In addition, the effects of pharmacological inhibitors were confirmed by AKT and CREB siRNA interventions (Fig. 2C,D,G,H). These data suggest that NF-jB is involved in mediating COX-2 signals to regulate the synthesis of IL-1b in A172 cells. To validate this hypothesis, A172 cells were further treated with the NF-jB inhibitor KT5720 (5 lM) in the absence or presence of PGE2 or forskolin. Our data revealed that KT5720 thoroughly diminished the mRNA and protein expression of IL-1b in PGE2- or forskolin-stimulated A172 cells (Fig. 2I,J). The mRNA and protein levels of IL-1b were reversibly enhanced by the transfection of A172 cells with NF-jB p65 cDNA plasmids (Fig. 2K). These observations indicate that NF-jB plays key roles in mediating IL-1b synthesis in PGE2- or forskolin-stimulated A172 cells.

To verify that COX-2 mediates the effects of IL-1b in regulating BACE-1 expression, SH-SY5Y cells were treated with NS398 (50 lM) in the absence or presence of IL-1b (100 ng mL 1) for 48 h (Fig. 3E). Our data demonstrated that NS398 incubation abrogated the effects in which IL-1b induced the phosphorylation of AKT and CREB, leading to blockage of the mRNA and protein expression of BACE-1 in SH-SY5Y cells (Fig. 3E). In addition, treatment of SH-SY5Y cells with PGE2 (10 lM) or forskolin (10 lM) results in activating the PI3-K/AKT and PKA/CREB signaling pathways by phosphorylation of AKT at Ser 473 and CREB at Ser 133, respectively (Fig. 3F); this activation then stimulates the mRNA and protein expression of BACE-1 in SH-SY5Y cells. All these observations indicate that the PI3-K/AKT and PKA/CREB signaling pathways are involved in mediating the effects of COX-2 on BACE-1 expression in neuron cells. To validate the above data, the PI3-K inhibitor LY294002 (10 lM) and the PKA inhibitor H89 (1 lM) were employed to treat SH-SY5Y cells to inhibit the PI3-K and PKA signaling pathways. The results demonstrated that the LY294002 and H89 treatments thoroughly blocked the activities of PI3-K and PKA by inhibiting the phosphorylation of AKT and CREB in IL1b-stimulated SH-SY5Y cells (Fig. 4A,B). More interestingly, LY294002 and H89 incubation suppress the phosphorylation of NF-jB p65 subunit at the sites of Ser 536 and Ser 276, respectively (Fig. 4A,B). To this end, the IL1b-induced BACE-1 expression was suppressed by the treatments with LY294002 and H89. Similar results were obtained in the cells treated with PGE2 (Fig. 4E,F) or forskolin (Fig. 4I,J). Moreover, these observations were further confirmed by an siRNA knockdown of AKT and CREB (Fig. 4C,D,G, H,K,L). Therefore, these data revealed the involvement of the PI3-K/AKT and PKA/CREB signaling pathways in mediating the effects in which PGE2 and cAMP induced the expression of BACE-1 in neuron cells.

Secretion of IL-1b from glial cells subsequently activates COX2 in neuron cells

NF-jB still mediates the critical roles of COX-2 in inducing BACE-1 synthesis in SH-SY5Y cells

In view of the critical roles of neuron cells in the pathogenesis of AD, we could not elucidate the mechanism of AD using only astrocytes or microglia cells. In addition, the inflammatory response cannot directly induce the onset of AD but is able to exert effects on neuron cells, which in turn induce the accumulation of Ab, leading to AD progression (Buxbaum et al., 1992). To decipher the mechanisms, human neuroblastoma SH-SY5Y cells and mouse neuroblastoma n2a cells were employed as model systems because SH-SY5Y and n2a cells are the most commonly used neuron cell lines for AD research (Zheng et al., 2009). As expected, IL-1b (100 ng mL 1) treatment stimulates the mRNA and protein expression of COX-2 in SH-SY5Y or n2a cells (Fig. 3A,B). In addition, the expression of the b-secretase, BACE-1, was highly induced in IL-1b-treated SH-SY5Y or n2a cells (Fig. 3A,B). Similarly, this cytokine incubation also affects the production of PGE2 and cAMP in SH-SY5Y or n2a cells (Fig. 3C,D). These results indicate that COX-2 might regulate BACE-1 expression via signaling pathways in neuron cells that are similar to those in glial cells. In view of the roles of HSP70 in regulating the phosphorylation of NF-jB in glial cells, we further treated SH-SY5Y and n2a cells with the HSP70 inhibitor VER155008 (10 lM). Incubating the

In light of the increased phosphorylation of AKT and CREB and their biological effects on the activity of NF-jB (Wang et al., 2010a,b, 2011a, b, 2012), we examined the potential roles of AKT and ERK1/2 in modulating the activities of NF-jB. As shown in Fig. 4A–L, the treatment of SH-SY5Y cells with LY294002 or H89 abrogated the IL-1b-, PGE2-, or forskolin-induced phosphorylation of NF-jB at the sites of Ser 536 and Ser 276, respectively. These data suggest that NF-jB is involved in mediating COX-2 signals to regulate the synthesis of BACE-1 in SH-SY5Y cells. To validate this hypothesis, SH-SY5Y cells were further treated with the NF-jB inhibitor KT5720 (5 lM) in the absence or presence of IL-1b, PGE2, or forskolin. Our data revealed that KT5720 thoroughly diminished the mRNA and protein expression of BACE-1 in IL-1b-, PGE2-, or forskolin-stimulated SH-SY5Y cells (Fig. 4M–O). These observations indicate that NF-jB plays key roles in mediating BACE-1 regulation via the COX-2, PGE2, cAMP, PI3-K/AKT, and PKA/CREB pathways in IL-1bstimulated SH-SY5Y cells. By demonstrating the powerful roles of NF-jB in regulating the expression of IL-1b or BACE-1 in glial or neuron cells, these data also support the notion that NF-jB is a potential therapeutic target for treating AD.

NF-jB is essential for COX-2-induced IL-1b synthesis in A172 cells



– –

+ –

COX-2 mRNA expression

3.5 3

NF-κB (Ser 276)

β-actin

β-actin

*

200 100 0

– –

(E)

+ + –

rhIL-1β (100 ng mL–1) NS398 (50 μM)

*

+

rhIL-1β (100 ng mL–1)

(F) – –

+ –

PGE2 (10 μM) Forskolin (10 μM)

+ +

AKT

CREB

p-CREB (Ser 133)

HSP70

CREB

BACE-1

BACE-1

β-actin

β-actin

BACE-1 mRNA expression


PGE2 (pmol μg–1 protein) cAMP (pmol μg–1 protein) *

p-CREB (Ser 133)

#

0

We had elucidated the signaling pathways by which COX-2 mediates the effects in which IL-1b induced the expression of BACE-1 in neuron cells, and BACE-1 is the key enzyme for the synthesis and accumulation of Ab (Cai et al., 2001); however, the roles of Ab in the pathogenesis of AD have not been thoroughly discussed. On the one hand, it is generally

1 0

p-AKT (Ser 473)

2

BACE-1 reversibly stimulates the expression of COX-2 in A172 cells via enhancing the accumulation of Ab, furthering the AD progression

3 2

AKT

*

1

5 4

–

p-AKT (Ser 473)

3.5 3

*

900 800 700 600 500 400 300 200 100 0

rhIL-1β (100 ng mL–1) + +

7 6

(D)

The production of PGE2 and cAMP

The production of PGE2 and cAMP

NF-κB (Ser 276)

*

–

rmIL-1β (100 ng mL–1) VER155008 (10 μM)

NF-κB (Ser 536)

PGE2 (pmol μg–1 protein) cAMP (pmol μg–1 protein)

300

– +

NF-κB (Ser 536)

0.5 0

400

+ –

COX-2

1.5 1

500

– –

COX-2

2.5 2

600

(B)

rhIL-1β (100 ng mL–1) VER155008 (10 μM)

*

(C)

Fig. 3 IL-1b induces mRNA and protein expression of COX-2, which in turn upregulates BACE-1 expression and activates of the PI3-K/AKT, PKA/CREB signaling pathways in a HSP70-, PGE2- or forskolindependent manner in human- or mousederived neuron cells. Human neuroblastoma SH-SY5Y (A, C) and mouse neuroblastoma n2a cells (B, D) were treated with IL-1b (100 ng mL 1) or VER155008 (10 lM) for 48 h. In selected experiments, SH-SY5Y cells were treated with NS398 (50 lM) in the absence or presence of IL-1b (100 ng mL 1) for 48 h (E). In separate experiments, SH-SY5Y cells were treated with PGE2 (10 lM) or forskolin (10 lM) for 48 h (F). The total COX-2, BACE-1 (A, B upper panel) and phosphorylated AKT, CREB, NF-jB levels (A, B, E, F upper panel) were detected by immunoblotting using specific Abs. The equal lane loading is demonstrated by the similar intensities of the total AKT, CREB, NF-jB and b-actin. The COX-2, BACE-1 mRNA levels (A, B, E, F lower panel) were determined by qRT–PCR, and the total amounts of GAPDH served as internal controls. The formation of PGE2 and cAMP (C, D) was determined using PGE2 and cAMP enzyme immunoassay kits, respectively. The data represent the means SE of three independent experiments. *P < 0.05 with respect to the vehicle-treated control. #P < 0.05 compared to treatments with IL-1b, PGE2, or forskolin alone.

– +

COX-2 mRNA expression

(A)

7 6 5 4 3 2 1 0

* *

accepted that excess Ab will induce AD via the accumulation and formation of AP. On the other hand, Ab will exert its effects on astrocytes or microglia cells to increase the inflammatory response, which enhances the progression of AD (Giovannini et al., 2002; Kotilinek et al., 2008; Couturier et al., 2011). Interestingly, we found that the conditioned medium collected from neo or sw cells, which were derived from SH-SY5Y cells by transfection with the vector or APP695 cDNA plasmids (Zheng et al., 2009), has ability to stimulate the expression of COX-2 and IL-1b in A172 cells (Fig. 5A). More importantly, the increased


610 COX-2 mediates cross talk between IL-1b and Ab, P. Wang et al.

7 6

p-NF-κB (Ser 276) NF-κB

BACE-1

BACE-1

BACE-1

BACE-1

β-actin

β-actin

β-actin

*

3 2 1 0

#

PGE2 (10 μM) LY294002 (10 μM)

AKT

*

3 #

2 1 0 – –

+ –

+ +

4

*

3 2

CREB

β-actin BACE-1 mRNA expression


4

(F)

#

1 0

(G)

PGE2 (10 μM) H89 (1 μM)

4.5 4 3 2 1 0

(H) – –

+ –

+ +

– –

PGE2 (10 μM) AKT siRNA

+ –

PGE2 (10 μM) CREB siRNA

+ +

CREB

AKT

p-NF-κB (Ser 536)

p-NF-κB (Ser 276)

p-NF-κB (Ser 536)

p-NF-κB (Ser 276)

NF-κB

NF-κB

NF-κB

NF-κB

BACE-1

BACE-1

BACE-1

BACE-1

β-actin

β-actin

β-actin

4 3 #

2 1 0

(J)

Forskolin (10 μM) LY294002 (10 μM)

*

5

– –

+ –

+ +

7 6

*

5 4 3 2

CREB

β-actin

#

1 0

(K)

Forskolin (10 μM) H89 (1 μM)

7 6 5 4 3 2 1 0


6


p-CREB (Ser 133)

AKT


p-AKT (Ser 473)

*

#

(L) – –

+ –

+ +

– –

Forskolin (10 μM) AKT siRNA

+ –

+ +

Forskolin (10 μM) CREB siRNA

p-AKT (Ser 473)

p-CREB (Ser 133)

AKT

CREB

AKT

p-NF-κB (Ser 536)

p-NF-κB (Ser 276)

p-NF-κB (Ser 536)

p-NF-κB (Ser 276)

NF-κB

NF-κB

NF-κB

NF-κB

BACE-1

BACE-1

BACE-1

BACE-1

β-actin

β-actin

β-actin

rhIL-1β (100 ng mL–1) KT5720 (5 μM)

6

*

5 4 3

#

2 1 0

(N)

– –

+ –

+ +

BACE-1

β-actin

β-actin 8 7 6 5 4 3 2 1 0

*

#

*

8 7 6 5 4 3 2 1 0

(O)

PGE2 (10 μM) KT5720 (5 μM)

BACE-1


4

+ +

rhIL-1β (100 ng mL–1) CREB siRNA

+ +

p-NF-κB (Ser 536)

#

+ –

+ –

NF-κB

*

– –

– –

NF-κB

1 0

(M)

rhIL-1β (100 ng mL–1) AKT siRNA

+ +

NF-κB

5 4 3 2

+ –

#

– –

+ –

CREB

β-actin BACE-1 mRNA expression

(I)

+ +

(D) – –

p-NF-κB (Ser 276)

#

+ –

(C)

CREB

*

– –

rhIL-1β (100 ng mL–1) H89 (1 μM)

p-NF-κB (Ser 536)

0 + +

+ +

AKT

1

+ –

+ –

p-CREB (Ser 133)

#

– –

– –

p-AKT (Ser 473)

*

2

(B)



rhIL-1β (100 ng mL–1) LY294002 (10 μM)

3

8 7 6 5 4 3 2 1 0


+ +



4

(E)


+ –

8 7 6 5 4 3 2 1 0

*

#

Forskolin (10 μM) KT5720 (5 μM)

+ +

BACE-1 β-actin


– –


(A)

5

*

4 3 2

#

1 0

Fig. 4 Critical roles of the PI3-K/AKT and PKA/CREB signaling pathways in mediating the regulatory effects of IL-1b, PGE2, or forskolin on the mRNA and protein levels of BACE-1 via NF-jB in human SH-SY5Y cells. SH-SY5Y cells were either treated with the PI3-K inhibitor LY294002 (10 lM) (A, E, I), the PKA inhibitor H89 (1 lM) (B, F, J) or transfected with siRNA oligonucleotides specific for AKT (C, G, K) or CREB (D, H, L) in the absence or presence of rhIL-1b (100 ng mL 1) (A–D), PGE2 (10 lM) (E–H), or forskolin (10 lM) (I–L) for 48 h. In separate experiments, SH-SY5Y cells were treated with the NF-jB p65 subunit inhibitor KT5720 (5 lM) in the absence or presence of rhIL1b (M), PGE2 (10 lM), (N) or forskolin (10 lM) (O). The total BACE-1 and phosphorylated AKT, CREB, NF-jB at the sites of Ser 536 and Ser 276 were detected by immunoblotting using specific Abs. The equal lane loading is demonstrated by the similar intensities of total AKT, CREB, NF-jB, and b-actin. The BACE-1 mRNA levels were determined by qRT–PCR. The total amounts of GAPDH served as internal control for qRT–PCR. The data represent the means SE of three independent experiments. *P < 0.05 with respect to the vehicle-treated control. #P < 0.05 compared to treatments with IL-1b, PGE2, or forskolin alone.



(A)

– – –

+ – –

– + –

+ – +

– + +

Neo conditioned medium SW conditioned medium Aβ antibody (0.5 μg mL–1)

(B) – –

8 7 6 5 4 3 2 1 0

+ –

+ +

##

n2a conditioned medium Aβ antibody (0.5 μg mL–1)

6 4 3

1 0

#

2

#

1 0

+ –

+ C6 conditioned medium + IL-1β antibody (1 μg mL–1)

IL-1β

BACE-1

β-actin

β-actin

5 4 3 2

##

expression of COX-2 and IL-1b caused by the conditioned medium from the SH-SY5Y cells was blocked by an Ab antibody (0.5 lg mL 1) treatment (Fig. 5A). These observations revealed that Ab plays key roles in activating COX-2 and IL-1b in A172 cells (Fig. 5A). To further confirm that the A172-secreted IL-1b is essential for stimulating human neuron cells to express BACE-1, experiments were performed to treat SH-SY5Y cells with IL-1b antibody (1 lg mL 1) in the absence or presence of the conditioned medium from A172 cells (Fig. 5B). Our results revealed that IL-1b antibody incubation abrogated the effects in which the A172conditioned medium induced the expression of BACE-1 in SH-SY5Y cells (Fig. 5B). Similar results were also observed in the experimental system of C6 and n2a cells (Fig. 5C,D). Collectively, the data in the current study were the first to demonstrate that COX-2 mediates the reciprocal regulation of IL-1b and Ab between glial and neuron cells, which potentially contributes to the pathogenesis of AD.

Discussion COX-2 is an important mediator of inflammation in peripheral tissues, which has been detected in the early stage of AD, but not in the late stage of the disease (Yermakova & O’Banion, 2001). Although the metabolic processes of COX-2 in AD are not thoroughly understood, the beneficial effects of NSAIDs led the way to the hypothesis that COX activity, particularly that of the inducible isoform COX-2, is involved in the cascade of events leading to neurodegeneration in AD. To this end, we delineated the signaling pathways of COX-2-mediated reciprocal regulation of IL-1b and Ab between human glial and neuron cells; this reciprocal regulation potentially contributes to the pathogenesis of AD (Fig. 6). Prior work suggests that COX-2, a critical inflammation inducer in peripheral tissues, is also involved in AD progression via inducing the activation of astrocytes or microglia cells (Akiyama et al., 2000).

A172 conditioned medium IL-1β antibody (1 μg mL–1)

*

*

– –

COX-2 IL-1β

*

+ +

(D)


mRNA expression

*

+ –

5

COX-2

7 6

– –

β-actin

* *

– –

(C)

+ +

β-actin

*

# #

+ –

BACE-1

COX-2 IL-1β

*

SW

IL-1β


mRNA expression

COX-2

Fig. 5 COX-2 mediated the reciprocal regulation of Ab and IL-1b between glial and neuron cells; this reciprocal regulation in turn potentially contributes to the progression of Alzheimer’s disease (AD). A172 cells were incubated in conditioned medium, which was collected from neo or sw cells in the absence or presence of Ab antibody (0.5 lg mL 1) (A). In selected experiments, the neo or sw cells were treated with conditioned medium, which was collected from A172 cells in the absence or presence of IL-1b antibody (1 lg mL 1) (B). Similar experiments were performed between C6 and n2a cells (C, D). The mRNA and protein levels of COX-2 (A, C), IL-1b (A, C) and BACE-1 (B, D) were determined by qRT–PCR and Western blots, respectively. The total amounts of GAPDH and b-actin served as internal controls for the qRT–PCR and Western blots, respectively. The data represent the means SE of three independent experiments. *P < 0.05 with respect to the untreated control. #P < 0.05 compared to treatment with just the conditioned medium.

Neo

6 5

*

4 3 2

#

1 0

Chronologically, COX-2 expression was first found to be induced in microglia cells for diseases related to prions, such as AD or PD (Veerhuis et al., 2002). In addition, Badie et al. (2003) reported that microglia isolated from intracranial C6 tumors produced high levels of PGE2 through a COX-2-dependent pathway. Similarly, Minghetti & Levi (1995) suggested that transition of microglia from the resting stage to the activated one in response to a pathological stimulus is characterized in part or in whole by the induction of COX-2. Moreover, highly induced COX-2 and PGE2 were recently reported to up-regulate the levels of IL-1b mRNA in lipopolysaccharide (LPS)-stimulated primary rat microglia cells (Petrova et al., 1999). In accordance with these prior works, our data demonstrated the key role of the endogenous PGE2 and cAMP induced by COX-2 in mediating IL-1b expression in human glial cells (Fig. 1). Elevated levels of IL-1b are associated with an increased risk of AD (Mrak & Griffin, 2001). The overexpressed IL-1b in activated glia of an AD brain (Griffin et al., 1998) can itself induce glial activation and enhance the ability of Ab to activate glia (Hu et al., 1996). In addition, IL-1b promotes the synthesis and processing of the APP (Buxbaum et al., 1992) and can also enhance the expression of other AD-relevant cytokines, such as IL-6 and TNF-a (Benveniste, 1992). In line with these reports, our data revealed that the elevated levels of IL-1b in glial cells stimulate the expression of COX-2 in human neuron cells (Fig. 3), which is responsible for APP cleavage via BACE-1 induction (Fig. 3). In addition, PGE2 and cAMP mediated the effects in which COX-2 induced the expression of BACE-1 (Fig. 3F). This observation is consistent with previously published data showing that human COX-2 expression in APP (swe)/PS1/COX-2 mice induces the potentiation of AP formation and a > 2-fold increase in PGE2 production at 24 months of age (Xiang et al., 2002). Moreover, our data also provide an explanation for why IL-1b secretion from glial cells accelerates the processing of APP and deposition of the Ab (Buxbaum et al., 1992), which potentially contributes to the pathogenesis of AD.



Fig. 6 Proposed cascade of the signaling events regulating the pathogenesis of Alzheimer’s disease (AD) via COX-2mediated cross talk between IL-1b and Ab. COX-2 induces the secretion of IL-1b via the HSP70, PGE2, cAMP, PI3-K/AKT, PKA/ CREB and NF-jB singling pathways in glial cells. The highly induced IL-1b is able to stimulate the expression of COX-2 in neuron cells. The elevated levels of COX-2 activate the PI3-K/AKT and PKA/CREB pathways in a HSP70-, PGE2-, and cAMPdependent manner, which transactivate BACE-1 by phosphorylating NF-jB at the sites of Ser 536 and Ser 276, respectively. Finally, BACE-1 will reversibly trigger COX-2 expression in glial cells in an Ab-dependent manner. These circulations between inflammatory cells and neuron cells will potentially contribute to the development of AD.

Ab deposition is not only the key pathogenic factor of AD but also the most important stimulator or mediator of glial activation, which aggravates the inflammatory response in AD patients (Giovannini et al., 2002; Kotilinek et al., 2008; Couturier et al., 2011). For example, injection of preaggregated Ab1–42 into the nucleus basalis of the rat has been shown to induce microglial and astrocytic activation and cause a strong inflammatory reaction that is characterized by IL-1b production and increased inducible COX-2 (Giovannini et al., 2002). In addition, administration of the COX-2 inhibitor rofecoxib (3 mg kg 1 day 1, 7 days) attenuates the inflammatory response and neurodegeneration evoked by Ab1–42 in AD rats (Giovannini et al., 2002). Kotilinek et al. (2008) further confirmed that COX-2 inhibition improves Ab-mediated suppression of memory in Tg2576 mice. In line with these in vivo results, Couturier et al. (2011) recently revealed that Ab1–42 induces the activation of IjB and NF-jB, which in turn mediate the release of IL-1b by co-culture experiments using astrocytes/microglia and neuron cells. Consistent with these prior works, we found that the Ab produced by human neuron cells has the capacity to stimulate the expression of COX2 in glial cells (Fig. 5). Therefore, it is clear that COX-2 has the capacity to reciprocally regulate the synthesis of IL-1b and Ab between glial cells and neuron cells. Vitagenes including HSP32 and HSP70 were recently identified to be involved in the pathogenesis of neurodegenerative diseases (Calabrese et al., 2009). Of the vitagenes, HSP70 is one of the most extensively studied proteins (Calabrese et al., 2009), and its mRNA expression was observed in the cerebellum hippocampus and cortex of AD patients during the agonal phase of the disease (Perez et al., 1991). In addition, an increase in HSP70 drives damaged nuclear proteins to the nucleolus, clearing other nuclear components of misfolded proteins and decreasing the danger of their widespread aggregation (Dekker et al., 2008). In line with these prior works (Perez et al., 1991), we found that NS398 (50 lM) treatment induced the mRNA and protein expression of HSP70 by inhibiting the expression of COX-2 in glial or neuron cells (Figs 1A,D and

3E). Moreover, we extended the above observations to determine the phosphorylation of NF-jB (Fig. 1C,F). In agreement with our data, Sara et al. (Senf et al., 2008) reported that HSP70 overexpression inhibits NF-jB transcriptional activities in male Sprague–Dawley rats. Moreover, HSP70 expression also shows its effects on suppressing LPS-induced NF-jB activation in the murine macrophage-like cell line RAW264.7 and the human embryonic kidney cell line HEK293 (Chen et al., 2006). We studied other cells in addition to glial cells and observed similar phenomenon in neuron cells, and HSP70 mediated the effects of COX-2 on activating NF-jB by phosphorylation in neuron cells (Fig. 3A, B). Together, these data clearly indicate that HSP70 is involved in the aggravating effects of COX-2 on the pathogenesis of AD. We next wished to dissect the potential regulatory roles of COX-2 on IL-1b expression in glial cells or BACE-1 expression in neuron cells. Consistent with our data showing that H89 partially reversed the stimulatory actions of PGE2 on IL-1b production (Fig. 2), Petrova et al. (1999) also suggested that H89 partially inhibited the effects of PGE2 on TNF-a expression in rat primary microglia cells. The researchers also noted that the modest effect of PKA inhibition on the TNF-a levels suggests that additional pathways are likely to be involved (Petrova et al., 1999). In agreement with their hypothesis (Petrova et al., 1999), our data further demonstrated that the PI3-K/AKT signaling pathway is involved in IL-1b regulation in human glial cells (Fig. 2). Apart from IL-1b regulation by COX-2, it also has the capacity to regulate BACE-1 expression via activating the cAMP, PI3-K/AKT, PKA/CREB, and NF-jB pathways. The activation pattern is consistent with previously published data showing that AKT enzyme activity was significantly increased in the temporal cortex soluble fractions from AD compared with those from nondisease controls (Rickle et al., 2004). Furthermore, AKT activation attenuates the frontal cortex soluble fraction in AD cases more than in nondisease controls (Rickle et al., 2004). In contrast, Dai et al. (2011) reported that AKT activation attenuated the expression of BACE-1 via inhibition the phosphorylation of GSK3 in PC12 cells. However, all these



aforementioned results regarding the involvement of the PI3-K/AKT signaling pathway must be interpreted with caution because the data were generated using nonselective pharmacological antagonists. For instance, LY294002 is an antagonist not only for PI3-K but also for Casein kinase II (Davies et al., 2000). Moreover, GSK3 does not only mediate the effects of PI3-K/AKT on BACE-1 expression in neuron cells. It can also stimulate gene expression via transactivating NF-jB by inducing the phosphorylation and subsequent degradation of inhibitor of jB (IjB; Bai et al., 2009). Therefore, we used siRNA knockdown experiments to confirm the specificity of the pharmacological inhibitors and reinforced our explanation. Moreover, our data revealed that phosphorylation of NF-jB at the sites of Ser 536 or Ser 276 was regulated by the PI3-K/AKT or PKA/CREB signaling pathways, respectively, leading to the synthesis of BACE-1 in human neuron SH-SY5Y cells (Fig. 4). In agreement with our data, Chen et al. (2011) reported that increased NF-jB signaling up-regulates BACE-1 expression in the brains of AD patients. It is also noteworthy that H89 treatment not only shows its effects on suppressing the expression of BACE-1 in our experiments but also inhibits the formation of Ab in human HEK293 cells (Marambaud et al., 1999). In view of these observations, we filled the gaps in our understanding of the pathogenesis of AD by examining the COX-2-mediated reciprocal regulation of IL-1b and Ab between glial and neuron cells, particularly the signaling pathways for IL-1b and BACE-1 synthesis. These findings provide insight into the roles of NSAIDs in inhibiting secretion of the Ab142 peptide in cultured cells and mouse models of AD (Weggen et al., 2003), the suppressive effects of NSAIDs on the c-secretase activity in D385TG mice that accumulated Ab1–42, and the induced potentiation of AP formation caused by COX-2 expression in APP(swe)/PS1/COX-2 mice (Xiang et al., 2002). Furthermore, the results may also facilitate the development of therapeutic strategies for treating AD.

Materials and methods Reagents rhIL-1b, rmIL-1b, forskolin, and the inhibitors NS398, LY294002, H89, and KT5720 and an antibody specific for mPGES-1 were obtained from SigmaAldrich Corp (St. Louis, MO, USA). The antibody specific for BACE-1 and the inhibitor specific for HSP70, VER155008 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Antibodies against b-actin, COX-2, p65, Ab, Akt, p-Akt (Ser 473), CREB, p-CREB (Ser 133), p-NF-jB (Ser 536), p-NF-jB (Ser 276), NF-jB, and IL-1b and siRNAs specific for AKT and CREB were purchased from Cell Signaling Technology, Inc. (Danvers, MA, USA). p65, mPGES-1 cDNA, and the empty pCMV6-XL vector were obtained from Origene Technologies (Beijing, China). The PGE2 and cAMP enzyme immunoassay kits were from Cayman Chemical (Ann Arbor, MI, USA). IL-1b enzyme immunoassay kits were obtained from Raybiotech, Inc. (Norcross, GA, USA). All reagents for the qRT–PCR and SDS-PAGE experiments were purchased from Bio-Rad Laboratories (Hercules, CA, USA). All other reagents were from Invitrogen (Carlsbad, CA, USA) unless otherwise specified.

Cell culture Human glioblastoma A172, rat brain C6 glial cells, human SH-SY5Y, and mouse n2a neuroblastoma cells were grown (37 °C and 5% CO2) on 6-cm tissue culture dishes (106 cells per dish) in appropriate medium. In a separate set of experiments, the cells were grown in serum-free medium for an additional 24 h before incubation with inhibitors in the

presence or absence of PGE2, forskolin, or IL-1b as previously described (Wang et al., 2010a, 2012).

Quantitative real-time PCR (qRT–PCR) qRT–PCR assays were performed with the MiniOpticon real-time PCR detection system (Bio-Rad) using total RNA and the GoTaq one-step realtime PCR kit with SYBR green (Promega, Beijing, China) and the appropriate primers as previously described (Wang et al., 2010b). The GenBank accession number and forward and reverse primers for human COX-2, mPGES-1 (Wang et al., 2011a,b), IL-1b (Wang et al., 2012), p65 (Wang et al., 2010a,b), and GAPDH (Wang et al., 2010b) are provided in our previous publications; for human BACE-1 (NM_138973) FGCAGGGCTACTACGT GGAGA, R-GTATCCACCAGGATGTTGAGC; for rat mPGES-1 (NM_021 583) F-AGGGTGCCATGTTTTCAGAG, R-CAGTCTTTGGAGGAGCCAAG; COX-2 (NM_17232) F-AAAGCCTCGTCCAGATGCTA, R-ATGGTGGC TGTCTTGGTAGG; IL-1b (NM_031512) FAGGCTTCCTTGTGCAAGTGT, R-TGAGTGACACTGCCTTCCTG; GAPDH (NM_017008) F-GGCATGGA CTGTGGTCATGA, R-TTCACCACCATGGAGAAGGC; for mouse COX-2 (NM_011198) F-CCAGCACTTCACCCATCAGTT, R-ACCCAGGTCCTCG CTTATGA; BACE-1 (NM_011792) FCCGGCGGGAGTGGTATTATGA AGT, R-GATGGTGATGCGGAAGGACTGATT; GAPDH (NM_008084) F-AACTTTGGCATTGTGGAAGG, RACACATTGGGGGTAGGAACA. The gene expression values were normalized to those of GAPDH.

Western blot analysis Cells were lysed in a radioimmunoprecipitation assay buffer, and the protein content was determined using a bicinchoninic acid protein assay reagent as previously described (Wang et al., 2010b). The total cell lysates (4 lg) were subjected to SDS-PAGE, transferred to a membrane, and probed with a panel of specific antibodies. Each membrane was only probed with one antibody. b-actin was used as a loading control. All western hybridizations were performed at least in triplicate using a different cell preparation each time.

Measurement of the PGE2, cAMP, and IL-1b concentration in the culture medium The PGE2, cAMP, and IL-1b levels in the media of both the control cells and the pharmacological chemical-treated cells were determined using the PGE2, cAMP, and IL-1b enzyme immunoassay kits, respectively, following the manufacturer’s instructions. The total protein in the medium was used as a loading control, and the results are expressed as pmol PGE2, cAMP, or pg IL-1b per lg of total protein.

Transfection Cells were transfected with 100 nM of an AKT- or CREB-specific siRNA oligonucleotide. In the control experiments, the cells were transfected with 100 nM of scrambled siRNA. For ectopic expression of p65 or mPGES-1, the human A172 cells were transfected with 1.6 lg per dish of plasmid containing the p65 or mPGES-1 cDNA using lipofectamine 2000. In the control experiments, the cells were transfected with 1.6 lg per slide of the empty pCMV6-XL vector (Origene Technologies). The transfected cells were allowed to recover for at least 12 h in growth medium and then incubated overnight in serum-free medium before extraction.



Statistical analysis All data represent the mean SE of at least three independent experiments. The statistical significance of the differences between the means was determined using Student’s t-test or one-way ANOVA as appropriate. If the means were found to be significantly different, multiple pairwise comparisons were performed using the Tukey test (Goldring et al., 1994).

Funding This work was supported in part or in whole by the Natural Science Foundation of China (31300777 and 31371091), the Fundamental Research Funds of China (N120520001 and N120320001), and the Liaoning Provincial Talent Support Program (LJQ2013029).

Conflict of interest The authors declare no competing financial interests.

Authors’ contributions P.W. and P.P.G. conceived and performed all of the experiments, participated equally in the design of the study, and wrote the manuscript. T.W., X.Y., and J.J.G. performed some of the experiments. Z.Y.W. conceived the experiments, interpreted the data, and wrote the manuscript.

References Akiyama H, Barger S, Barnum S, Bradt B, Bauer J, Cole GM, Cooper NR, Eikelenboom P, Emmerling M, Fiebich BL, Finch CE, Frautschy S, Griffin WS, Hampel H, Hull M, Landreth G, Lue L, Mrak R, Mackenzie IR, McGeer PL, O’Banion MK, Pachter J, Pasinetti G, Plata-Salaman C, Rogers J, Rydel R, Shen Y, Streit W, Strohmeyer R, Tooyoma I, Van Muiswinkel FL, Veerhuis R, Walker D, Webster S, Wegrzyniak B, Wenk G, Wyss-Coray T (2000) Inflammation and Alzheimer’s disease. Neurobiol. Aging 21, 383–421. Badie B, Schartner JM, Hagar AR, Prabakaran S, Peebles TR, Bartley B, Lapsiwala S, Resnick DK, Vorpahl J (2003) Microglia cyclooxygenase-2 activity in experimental gliomas: possible role in cerebral edema formation. Clin. Cancer Res. 9, 872– 877. Bai D, Ueno L, Vogt PK (2009) Akt-mediated regulation of NFkappaB and the essentialness of NFkappaB for the oncogenicity of PI3K and Akt. Int. J. Cancer 125, 2863–2870. Benveniste EN (1992) Inflammatory cytokines within the central nervous system: sources, function, and mechanism of action. Am. J. Physiol. 263, C1–C16. Blom MA, van Twillert MG, de Vries SC, Engels F, Finch CE, Veerhuis R, Eikelenboom P (1997) NSAIDS inhibit the IL-1 beta-induced IL-6 release from human post-mortem astrocytes: the involvement of prostaglandin E2. Brain Res. 777, 210–218. Buxbaum JD, Oishi M, Chen HI, Pinkas-Kramarski R, Jaffe EA, Gandy SE, Greengard P (1992) Cholinergic agonists and interleukin 1 regulate processing and secretion of the Alzheimer beta/A4 amyloid protein precursor. Proc. Natl Acad. Sci. USA 89, 10075–10078. Cai H, Wang Y, McCarthy D, Wen H, Borchelt DR, Price DL, Wong PC (2001) BACE1 is the major beta-secretase for generation of Abeta peptides by neurons. Nat. Neurosci. 4, 233–234. Calabrese V, Cornelius C, Dinkova-Kostova AT, Calabrese EJ (2009) Vitagenes, cellular stress response, and acetylcarnitine: relevance to hormesis. BioFactors 35, 146–160. Chen H, Wu Y, Zhang Y, Jin L, Luo L, Xue B, Lu C, Zhang X, Yin Z (2006) Hsp70 inhibits lipopolysaccharide-induced NF-kappaB activation by interacting with TRAF6 and inhibiting its ubiquitination. FEBS Lett. 580, 3145–3152. Chen CH, Zhou W, Liu S, Deng Y, Cai F, Tone M, Tone Y, Tong Y, Song W (2011) Increased NF-kappaB signalling up-regulates BACE1 expression and its therapeutic potential in Alzheimer’s disease. Int. J. Neuropsychopharmacol. 15, 1–14.

Couturier J, Paccalin M, Morel M, Terro F, Milin S, Pontcharraud R, Fauconneau B, Page G (2011) Prevention of the beta-amyloid peptide-induced inflammatory process by inhibition of double-stranded RNA-dependent protein kinase in primary murine mixed co-cultures. J. Neuroinflammation 8, 72. Dai Z, Zhang H, Meng T, Yan N, Li J, Yan Y (2011) Effects of exogenous hydrogen sulfide on b-site amyloid precursor protein cleaving enzyme 1 in pheochromocytoma cells. J. China Med. Univ. 40, 626–630. Davies SP, Reddy H, Caivano M, Cohen P (2000) Specificity and mechanism of action of some commonly used protein kinase inhibitors. Biochem. J. 351, 95– 105. Dekker C, Stirling PC, McCormack EA, Filmore H, Paul A, Brost RL, Costanzo M, Boone C, Leroux MR, Willison KR (2008) The interaction network of the chaperonin CCT. EMBO J. 27, 1827–1839. Giovannini MG, Scali C, Prosperi C, Bellucci A, Vannucchi MG, Rosi S, Pepeu G, Casamenti F (2002) Beta-amyloid-induced inflammation and cholinergic hypofunction in the rat brain in vivo: involvement of the p38MAPK pathway. Neurobiol. Dis. 11, 257–274. Goldring MB, Birkhead JR, Suen LF, Yamin R, Mizuno S, Glowacki J, Arbiser JL, Apperley JF (1994) Interleukin-1 beta-modulated gene expression in immortalized human chondrocytes. J. Clin. Invest. 94, 2307–2316. Griffin WS, Stanley LC, Ling C, White L, MacLeod V, Perrot LJ, White CL III, Araoz C (1989) Brain interleukin 1 and S-100 immunoreactivity are elevated in Down syndrome and Alzheimer disease. Proc. Natl Acad. Sci. USA 86, 7611– 7615. Griffin WS, Sheng JG, Royston MC, Gentleman SM, McKenzie JE, Graham DI, Roberts GW, Mrak RE (1998) Glial-neuronal interactions in Alzheimer’s disease: the potential role of a ‘cytokine cycle’ in disease progression. Brain Pathol. 8, 65–72. Ho L, Pieroni C, Winger D, Purohit DP, Aisen PS, Pasinetti GM (1999) Regional distribution of cyclooxygenase-2 in the hippocampal formation in Alzheimer’s disease. J. Neurosci. Res. 57, 295–303. Ho L, Purohit D, Haroutunian V, Luterman JD, Willis F, Naslund J, Buxbaum JD, Mohs RC, Aisen PS, Pasinetti GM (2001) Neuronal cyclooxygenase 2 expression in the hippocampal formation as a function of the clinical progression of Alzheimer disease. Arch. Neurol. 58, 487–492. Hoozemans JJ, Rozemuller AJ, Janssen I, De Groot CJ, Veerhuis R, Eikelenboom P (2001) Cyclooxygenase expression in microglia and neurons in Alzheimer’s disease and control brain. Acta Neuropathol. 101, 2–8. Hu J, Castets F, Guevara JL, Van Eldik LJ (1996) S100 beta stimulates inducible nitric oxide synthase activity and mRNA levels in rat cortical astrocytes. J. Biol. Chem. 271, 2543–2547. Kaur C, Hao AJ, Wu CH, Ling EA (2001) Origin of microglia. Microsc. Res. Tech. 54, 2–9. Kotilinek LA, Westerman MA, Wang Q, Panizzon K, Lim GP, Simonyi A, Lesne S, Falinska A, Younkin LH, Younkin SG, Rowan M, Cleary J, Wallis RA, Sun GY, Cole G, Frautschy S, Anwyl R, Ashe KH (2008) Cyclooxygenase-2 inhibition improves amyloid-beta-mediated suppression of memory and synaptic plasticity. Brain 131, 651–664. Lim GP, Yang F, Chu T, Chen P, Beech W, Teter B, Tran T, Ubeda O, Ashe KH, Frautschy SA, Cole GM (2000) Ibuprofen suppresses plaque pathology and inflammation in a mouse model for Alzheimer’s disease. J. Neurosci. 20, 5709– 5714. Lim GP, Yang F, Chu T, Gahtan E, Ubeda O, Beech W, Overmier JB, Hsiao-Ashec K, Frautschy SA, Cole GM (2001) Ibuprofen effects on Alzheimer pathology and open field activity in APPsw transgenic mice. Neurobiol. Aging 22, 983– 991. Marambaud P, Ancolio K, Alves da Costa C, Checler F (1999) Effect of protein kinase A inhibitors on the production of Abeta40 and Abeta42 by human cells expressing normal and Alzheimer’s disease-linked mutated betaAPP and presenilin 1. Br. J. Pharmacol. 126, 1186–1190. Minghetti L, Levi G (1995) Induction of prostanoid biosynthesis by bacterial lipopolysaccharide and isoproterenol in rat microglial cultures. J. Neurochem. 65, 2690–2698. Montine TJ, Sidell KR, Crews BC, Markesbery WR, Marnett LJ, Roberts LJ II, Morrow JD (1999) Elevated CSF prostaglandin E2 levels in patients with probable AD. Neurology 53, 1495–1498. Mrak RE, Griffin WS (2001) Interleukin-1, neuroinflammation, and Alzheimer’s disease. Neurobiol. Aging 22, 903–908. Pasinetti GM, Aisen PS (1998) Cyclooxygenase-2 expression is increased in frontal cortex of Alzheimer’s disease brain. Neuroscience 87, 319–324. Perez N, Sugar J, Charya S, Johnson G, Merril C, Bierer L, Perl D, Haroutunian V, Wallace W (1991) Increased synthesis and accumulation of heat shock 70 proteins in Alzheimer’s disease. Brain Res. Mol. Brain Res. 11, 249–254.


COX-2 mediates cross talk between IL-1b and Ab, P. Wang et al. 615 Petrova TV, Akama KT, Van Eldik LJ (1999) Selective modulation of BV-2 microglial activation by prostaglandin E(2). Differential effects on endotoxin-stimulated cytokine induction. J. Biol. Chem. 274, 28823–28827. Rickle A, Bogdanovic N, Volkman I, Winblad B, Ravid R, Cowburn RF (2004) Akt activity in Alzheimer’s disease and other neurodegenerative disorders. NeuroReport 15, 955–959. Senf SM, Dodd SL, McClung JM, Judge AR (2008) Hsp70 overexpression inhibits NF-kappaB and Foxo3a transcriptional activities and prevents skeletal muscle atrophy. FASEB J. 22, 3836–3845. Veerhuis R, Hoozemans JJ, Janssen I, Boshuizen RS, Langeveld JP, Eikelenboom P (2002) Adult human microglia secrete cytokines when exposed to neurotoxic prion protein peptide: no intermediary role for prostaglandin E2. Brain Res. 925, 195–203. Wang P, Zhu F, Konstantopoulos K (2010a) Prostaglandin E2 induces interleukin-6 expression in human chondrocytes via cAMP/protein kinase A- and phosphatidylinositol 3-kinase-dependent NF-kappaB activation. Am. J. Physiol. Cell Physiol. 298, C1445–C1456. Wang P, Zhu F, Lee NH, Konstantopoulos K (2010b) Shear-induced interleukin-6 synthesis in chondrocytes: roles of E prostanoid (EP) 2 and EP3 in cAMP/protein kinase A- and PI3-K/Akt-dependent NF-kappaB activation. J. Biol. Chem. 285, 24793–24804. Wang P, Zhu F, Konstantopoulos K (2011a) Interleukin-6 synthesis in human chondrocytes is regulated via the antagonistic actions of prostaglandin (PG)E2 and 15-deoxy-Delta(12,14)-PGJ2. PLoS ONE 6, e27630.

Wang P, Zhu F, Tong Z, Konstantopoulos K (2011b) Response of chondrocytes to shear stress: antagonistic effects of the binding partners Toll-like receptor 4 and caveolin-1. FASEB J. 25, 3401–3415. Wang P, Zhu F, Konstantopoulos K (2012) The antagonistic actions of endogenous interleukin-1beta and 15-deoxy-Delta12,14-prostaglandin J2 regulate the temporal synthesis of matrix metalloproteinase-9 in sheared chondrocytes. J. Biol. Chem. 287, 31877–31893. Weggen S, Eriksen JL, Sagi SA, Pietrzik CU, Ozols V, Fauq A, Golde TE, Koo EH (2003) Evidence that nonsteroidal anti-inflammatory drugs decrease amyloid beta 42 production by direct modulation of gamma-secretase activity. J. Biol. Chem. 278, 31831–31837. Xiang Z, Ho L, Yemul S, Zhao Z, Qing W, Pompl P, Kelley K, Dang A, Teplow D, Pasinetti GM (2002) Cyclooxygenase-2 promotes amyloid plaque deposition in a mouse model of Alzheimer’s disease neuropathology. Gene Expr. 10, 271–278. Yermakova AV, O’Banion MK (2001) Downregulation of neuronal cyclooxygenase-2 expression in end stage Alzheimer’s disease. Neurobiol. Aging 22, 823– 836. Zheng W, Xin N, Chi ZH, Zhao BL, Zhang J, Li JY, Wang ZY (2009) Divalent metal transporter 1 is involved in amyloid precursor protein processing and Abeta generation. FASEB J. 23, 4207–4217.
