An in vivo reporter system for measuring increased inclusion ... - Nature

Gene Therapy (2001) 8, 1532–1538  2001 Nature Publishing Group All rights reserved 0969-7128/01 $15.00 www.nature.com/gt

RESEARCH ARTICLE

An in vivo reporter system for measuring increased inclusion of exon 7 in SMN2 mRNA: potential therapy of SMA ML Zhang1, CL Lorson2, EJ Androphy1 and J Zhou1 1 2

Department of Dermatology, New England Medical Center and Tufts University School of Medicine, Boston, MA; and Department of Biology, Arizona State University, Tempe, AZ, USA

Spinal muscular atrophy (SMA) is a degenerative motor neuron disorder resulting from homozygous loss of the SMN1 gene. SMN2, a nearly identical copy gene, is preserved in SMA patients. A single nucleotide difference between SMN1 and SMN2 causes exon 7 skipping in the majority of SMN2 mRNA. Gene therapy through modulation of SMN2 gene transcription in SMA patients may be possible. We constructed a series of SMN mini-genes comprised of SMN exon 6 to exon 8 sequences fused to green fluorescence protein (GFP) or luciferase reporters, to monitor SMN exon 7 splicing. These reporters recapitulated the splicing patterns of the endogenous SMN gene in stable cell lines. The

SMN1-luciferase reporter was approximately 3.5-fold more active than SMN2-luciferase and SMN1-GFP intensities were visually distinguishable from SMN2-GFP. We have screened chemical inducers and inhibitors of kinase pathways using stable SMN-reporter lines and found that the phosphatase inhibitor sodium vanadate specifically stimulated exon 7 inclusion within SMN2 mRNAs. This is the first compound identified that can stimulate exon 7 inclusion into transcripts derived from the endogenous SMN2 gene. These results demonstrate that this system can be utilized to identify small molecules that regulate the splicing of SMN exon 7. Gene Therapy (2001) 8, 1532–1538.

Keywords: gene therapy; spinal muscular atrophy (SMA); survival motor neuron (SMN); splicing; small molecules; gene therapy; high throughput screening (HTS)

Introduction The survival motor neuron (SMN) gene was identified as the genetic locus of spinal muscular atrophy (SMA) using linkage mapping.1 There are two SMN genes within the disease locus on human chromosome 5q13: centromeric (SMN2) and telomeric (SMN1).1 They are separated by more than 20 kilobases (kb)2 and likely evolved from a recent duplication of the entire region.3 Other species including mouse and rat only have the homologue of the telomeric copy of SMN.4,5 The two SMN genes and their predicted proteins are identical except for a few translationally silent nucleotides within exon and intron sequences. The SMN1 copy is deleted or gene converted in more than 95% of SMA patients,3,6 while mutations in SMN2 have no clinical consequence. Missense mutations have been also identified in the SMN1 gene of a small number of SMA patients,7,8 confirming SMN1 as the disease gene. SMN2 does have a function in disease development in that there is a direct correlation between SMN2 copy number and disease severity, with low copy numbers found in early onset SMA and higher copy numbers in less severe and delayed forms.9 The results are consistent with SMA mouse models in which a single

Correspondence: J Zhou, Department of Dermatology, New England Medical Center, 750 Washington Street, Box 166, Boston, MA 02111, USA Received 5 March 2001; accepted 6 July 2001

copy of human SMN2 was sufficient to restore viability to a SMN−/− animal, however severe SMA developed and mice die within days after birth. Mice with eight copies of human SMN2 are phenotypically normal.10–13 The promoters, introns, and flanking regions for SMN1 and SMN2 have been completely sequenced and are almost identical. Transcription assays comparing the SMN promoters implied that the two are transcriptionally equivalent.14,15 One of the nucleotides that differ creates a DdeI site in exon 8 of SMN2, thus RT-PCR analysis and digestion of the PCR products with DdeI distinguishes SMN1 and SMN2 expression.16 By this analysis, the endogenous SMN1 and SMN2 mRNAs are equally expressed in essentially all cells and tissue types. The clue to the critical difference came from the observation that the transcripts undergo alternative splicing. SMN1 and SMN2 alleles can produce an identical full-length SMN transcript with the translation termination codon at the end of exon 7, followed by a non-coding exon 8. The primary product of SMN1 is full-length SMN mRNA.16–18 However, SMN2 transcripts are alternatively spliced, resulting in SMN⌬5, SMN⌬7 and SMN⌬5,7, which lack exon 5, 7, or both exons 5 and 7, respectively. It is estimated that more than 80% of SMN2 transcripts exclude exon 7.16,19 Lorson et al16 have recently reported that a single nucleotide difference at the sixth nucleotide position in exon 7 (7+6 position) is responsible for the alternative splicing. When the nucleotide is ‘C’ as in SMN1, exon 7 is recognized and included. When 7+6 is ‘T’ as in

Small molecules affecting SMN2 splicing ML Zhang et al

SMN2, the majority of transcripts exclude exon 7. This explains why SMN2 cannot compensate for the loss of the SMN1 gene, as it does not produce normal amounts of full length SMN mRNA. By analyzing SMN minigenes constructed from exon 6, intron 6, exon 7, intron 7 and exon 8, we recently identified other cis elements including at least three splicing enhancers20 within exon 7. The SR-like protein Tra2␤1 specifically binds exon 7 RNA and promotes inclusion of this exon.21 A subset of SR proteins may also affect exon 7 splicing (Lorson et al, unpublished data). However, it is still unclear how these trans SR factors or other non-SR proteins precisely regulate exon 7 recognition and processing. To understand the splicing mechanisms of SMN premRNA splicing and the pathogenesis of SMA, we describe the development of a powerful reporter gene based system for SMN exon 7 splicing assays. This reporter system works by transient transfection and when the vectors are integrated into stable cell lines, thereby making this system well suited for high throughput screens (HTS) designed to identify small molecules that regulate SMN exon 7 splicing. Using these vectors, the phosphatase inhibitor sodium vanadate was found to dramatically alter the splicing pattern of SMN2 and promote the inclusion of exon 7 in SMN2-derived mRNAs. Importantly, sodium vanadate promoted inclusion of exon 7 in the endogenous SMN2 transcripts in vivo. This is the first example of a chemical that can modulate endogenous SMN2 splicing patterns, demonstrating that the reporters will be powerful tools to develop additional pharmacological compound screens. Our results also suggest that gene therapy by modulation of splicing of an in vivo gene is possible.

Results SMN mini-genes reporter We previously demonstrated that SMN1 and SMN2 transcripts derived from mini-genes containing exon 6 to exon 8 and intervening introns splice like their respective endogenous counterparts.16 The primary defect of SMN2 is that it produces low levels of full-length and high levels of the exon 7 skipped product. A pharmacological compound that stimulates SMN1-like levels of full-length transcripts from SMN2 pre-mRNA could be identified through HTS as a potential SMA therapy. HTS require rapid and efficient interpretation of compound effectiveness, therefore developing vectors that mimic native SMN expression patterns and provide straightforward readout are critical. There are two requirements for the new vectors: they must recapitulate the splicing patterns of endogenous SMN genes and measure the incorporation of exon 7. A number of cis regulatory elements have been identified that are required for proper processing of SMN exon 7, therefore insertion of any large DNA fragment, either a reporter gene or an epitope-tag directly into SMN exon 7, could potentially alter the splicing signals within this exon. To avoid interfering with SMN exon 7 splicing regulation the enzymatic reporter gene was introduced into the 3⬘ end of the exon 8 reading frame. To inactivate the translation termination codon at the 3⬘ end of exon 7, a single nucleotide G was inserted into exon 7 after the 48th nucleotide (Figure 1a). This region of exon 7 has been previously characterized for

1533

Figure 1 Construction of SMN-reporter mini-genes. Shown in panel A is the overlapping extension PCR strategy to construct SMN mini-genes fused to a reporter gene. Three PCR products x, y and z were generated from SMN exon 6 to exon 8 and the reporter gene (GFP or luciferase) as templates. The final PCR products from intron 6FW to reporter-stop were cloned into the appropriate plasmid backbone between the BclI (SMN intron 6) and NotI (pCI polyliker) sites. Inclusion of exon 7 in the SMN mini-gene mRNA results in in-frame reporter gene (panel B).

SMN exon 7 splicing and this portion of the exon is less sensitive to mutation. This single nucleotide insertion did not affect SMN exon 7 splicing of transcripts derived from the SMN1 or SMN2 mini-gene constructs (data not shown). The reporter gene, either luciferase or GFP, was fused 21 nucleotides downstream from the 5⬘ end of exon 8. The intervening intron 7 is wild-type in both constructs. The initiation codon at the 5⬘ end of the reporter gene (luciferase or GFP) was modified by removing the ‘A’ thereby preventing internal translation and background expression. When exon 7 from these reporter constructs is skipped, exon 6 is spliced on to exon 8 and the reporter is out-of-frame. When exon 7 is included, the reporter is in-frame and GFP or luciferase expression can be monitored. Therefore these reporters result in a gain of signal when exon 7 is included in the final transcript and result in a transcript analogous to full-length SMN. Although terminal exons are recognized and processed differently from internal exons, large deletion and substitutions do not affect splicing to SMN exon 8. Transfection of mini-genes into mammalian cells To validate the expression patterns of the SMN-GFP or SMN-luciferase mini-genes, the vectors were transiently transfected into 293 and C33A cells. Luciferase activity from SMN1-luc (3 000 000 counts) was three-fold greater Gene Therapy


1534

than SMN2-luc (1 000 000 counts) (Figure 2b). Luciferase activities for these experiments were within the linear range of the assay (data not shown). These results are consistent with the splicing patterns for endogenous SMN1 and SMN2 genes, ie full-length SMN1 (Fl-SMN1) mRNA is three- to four-fold higher than Fl-SMN2 mRNA in normal cells. The spliced products were confirmed by RT-PCR (Figure 2c). Only Fl-SMN was observed from SMN1-luc while 70% of SMN2-Luc mRNA lacked exon 7 (SMN⌬7). Similar results were obtained with the SMN GFP reporter constructs measured either by GFP intensity and RT-PCR analysis (Figure 2a and c). Recently hTra2␤1 has been shown to reduce exon 7 skipping in SMN2 transcripts. To determine whether hTra2␤1 similarly regulates SMN-GFP and SMN-luciferase mini-genes, each vector was transiently expressed with an amount of hTra2␤1 shown to stimulate full-length expression from SMN2. Htra␤1 increased approximately two-fold the levels of luciferase activity from the SMN2-luciferase construct without changing the levels of activity from the SMN1-luciferase construct, suggesting that hTra2␤1 specifically affects SMN exon 7 splicing rather than nonspecifically increasing expression levels (panel a).21 RTPCR from parallel transfections confirmed these results (Figure 3b). Other SR proteins previously reported to be incapable of stimulating full-length SMN expression from SMN2 also had no effect upon exon 7 splicing of SMN1 or SMN2 GFP and luciferase mini-gene constructs (data not shown). These data demonstrate that the SMNreporter mini-genes faithfully reproduce the endogenous SMN gene splicing patterns and can be used for the studies of exon 7 splicing and drug screening. Stable C33A cell lines to investigate exon7 splicing To generate stable cell lines, the mini-genes were subcloned into the IRES neomycin-selectable vector (Clontech, Palo Alto, CA, USA). Following transfection, stable C33A cells lines were established following neomycin selection. Luciferase activities and RT-PCR were performed from pools of stable cells, as well as single cell clones. Ratios of luciferase activities between SMN1luciferase and SMN2-luciferase from stable cell pools were similar to those observed from transient transfected cells (data not shown). Luciferase activities varied among five individual stable cell lines, however RT-PCR results indicated splicing patterns identical to endogenous SMN transcripts. These differences may be due to varying integration sites. These results demonstrate development of a sensitive, highly reproducible cell-based reporter system that mimics the SMN splicing pattern for endogenous SMN exon 7. To increase the sensitivity for luciferase assays in 96-well plates, a single clone with high luciferase expression from SMN2-Luc and SMN1-Luc was chosen to conduct further experiments and for drug screening. Involvement of phosphorylation in SMN2 exon 7 splicing Since these vectors could be used for HTS, it would be of paramount importance to demonstrate that a small molecule or chemical was capable of modifying splicing from the SMN reporter genes. It has been shown that phosphorylation of SR proteins and other splicing factors can modulate alternative splicing. Therefore we questioned whether protein phosphorylation and signaling pathways were involved in the regulation of SMN exon

Gene Therapy

Figure 2 Expression of SMN mini-genes in transfected C33A cells. (a) SMN-GFP results. SMN1-GFP is visually brighter than SMN2-GFP. Luciferase activities with standard deviations are shown in panel b. SMN1-luc activity is three-fold higher than that of SMN2-luc, consistent with the splicing of SMN1 and SMN2 genes. (c) RT-PCR results from SMN-luc and SMN-GFP transfected C33A cells. First-strand cDNA synthesis and amplification of plasmid-derived cDNAs by PCR were performed as described. Almost 100% of transcripts are full-length from SMN1GFP/SMN1-Luc (lanes 1 and 4), while about 70% of SMN2 transcripts lack exon 7 (lanes 2 and 3).


1535

Figure 3 Effects of Tra2␤1 on pre-mRNA splicing of SMN mini-genes. Constructs of Tra2␤1 and SMN-luc mini-genes were co-transfected into C33A cells. (a) Expression of Tra2␤1 did not affect luciferase activity from SMN1-luc mini-gene, while Tra2␤1 increased luciferase activity from the SMN2-luc mini-gene by three-fold. Stimulation of exon 7 inclusion was confirmed by RT-PCR as shown in panel b: lane 3, 70% of SMN2-luc transcripts are SMN⌬7 in the absence of Tra2␤1; lane 4, more than 60% of SMN2-luc mRNA are Fl-SMN in the presence of Tra2␤1.

7 pre-mRNA splicing. Using the stable SMN-GFP and SMN-luc in C33A cell lines, inhibitors and activators of signaling pathways and protein kinases, as well as chemicals affecting cell cycles were assayed for their affects upon SMN exon 7 splicing. Of the compounds tested (Table 1), sodium vanadate dramatically changed the

Figure 4 Effects of sodium vanadate on exon 7 splicing of SMN premRNA. Stable transfected SMN1-luc and SMN2-luc C33A cell lines were treated with either 2% DMSO or 50 ␮m of sodium vanadate in 2% DMSO for 24 h. Relative luciferase activities are shown in panel a. DMSO-treated SMN2-Luc activity is used as a control with a relative level as 1. The relative increase of luciferase activity from SMN2-Luc cells with sodium vanadate treatment is much higher than that from SMN1luc, suggesting sodium vanadate stimulates exon 7 inclusion from the SMN2 gene. In panel b, SMN2-Luc stable transfected C33A cells were treated with different concentrations of sodium vanadate for 24 h.

ratio of full-length to ⌬7 transcripts from the SMN2 minigene. Luciferase activity from SMN2-luciferase increased six- to eight-fold while the activity from SMN1-luciferase increased 1.5- to two-fold (Figure 4a). The reproducible increase of SMN1-luciferase may partly be due to effects upon the CMV promoter. However, the increase of luciferase activity in SMN2-luciferase relative to SMN1-

Table 1 Inhibitors tested in SMN-luc cell lines Chemicals Genistein Chelerythrine chloride PMA (phorbol ester) 8-Bromo-cAMP Hydroxyurea Cycloheximide Na3VO4 SB 203580 U0126

Inhibitor

Solvent

SMN2-luc

SMN1-luc

Tyrosine kinase inhibitor Protein kinase C inhibitor Tyrosine kinase inhibitor Protein kinase A inhibitor DNA synthesis inhibitor Protein synthesis inhibitor Phosphatase inhibitor P38 MEK inhibitor MAPK3 inhibitor

DMSO DMSO DMSO DMSO PBS DMSO H2O DMSO DMSO

+ + + +/− − +/− ++++ + −

+/− +/− + +/− − +/− + + −

+, Increase of luciferase activity; −, decrease of luciferase activity; +/−, no change of luciferase activity. Gene Therapy


1536

luciferase was primarily caused by increased inclusion of exon 7 in SMN2 mRNA. Exon 7 inclusion was confirmed by RT-PCR analysis (Figure 4b). In the absence of sodium vanadate, only 20–30% of SMN2-Luc transcripts included exon 7. The percentage of SMN2-Luc Fl-length expression increased in a dose-dependent manner with the concentration of sodium vanadate such that approximately 70% of SMN2 transcripts included exon 7 in the presence of 100 ␮m sodium vanadate. The concentration of sodium vanadate was titrated and time-course experiments were performed to characterize the effect(s) of sodium vanadate treatment upon SMN exon 7 splicing. Less than 10 ␮m sodium vanadate (Figure 4a) could effectively increase the inclusion of exon 7 in SMN2 mRNA while 50 ␮m resulted in the highest amount of SMN2 full-length expression (Figure 5). Sodium vanadate concentrations over 100 ␮m stimulated exon 7 inclusion, but cell death was observed. The effect of sodium vanadate on splicing was observed between 10 and 24 h of treatment. As expected, longer incubation was toxic to cells. The cellular response to sodium vanadate including transcription and phosphorylation may explain why it took 10 h for the chemical to affect the splicing of exon 7. Existing proteins or mRNAs in cells may also buffer the response to the compound. Nevertheless, these results suggest that the phosphorylation status of some cellular factor can

regulate the splicing of SMN2 gene. Further studies will be needed to investigate the specific protein targets and identify the signal pathways affecting phosphorylation involved in SMN splicing. Splicing of endogenously SMN2 pre-mRNA One important question was to investigate whether sodium vanadate could affect endogenous SMN genes. To date, no compound or factor has been shown to stimulate full-length expression from the endogenous SMN2 gene. To determine whether sodium vanadate can modulate splicing of the endogenous SMN pre-mRNA exon 7, as well as the synthetic mini-genes, C33A cells, 293 cells, SMA type I fibroblasts, as well as other cell lines were treated with sodium vanadate. Total RNA was then isolated from these cells and RT-PCR performed. To distinguish mRNA species from SMN1 from SMN2, RT-PCR products were digested with DdeI. A unique DdeI site is present in SMN2-derived cDNA products due to the nonpolymorphic nucleotide difference in SMN exon 8. The results from fibroblast cells from SMA type I patients are shown in Figure 5. These patients lack the SMN1 gene, thus RT-PCR products are exclusively from SMN2derived mRNA. Similar to the change in expression patterns observed with the SMN2-Luc mini-gene, endogenous SMN2 expression patterns were dramatically altered with increasing amounts of sodium vanadate. A concomitant increase in full-length SMN was detected while levels of the exon 7 skipped product decreased. Without treatment, 25–30% of SMN2-derived mRNAs lacked exon 7, however, following treatment with 50–100 ␮m sodium vanadate, ⬎95% of SMN2-derived mRNAs were fulllength. Similar levels of SMN2 exon 7 inclusion were observed in other cell types such as C33A, 293 and U2OS cells (data not shown). These results demonstrate that sodium vanadate effectively modulates SMN exon 7 splicing and can stimulate SMN1-like levels of full-length mRNA from the endogenous SMN2 gene.

Discussion

Figure 5 Effects of sodium vanadate on endogenous SMN2 splicing. SMA type I-derived fibroblasts were treated with 50 ␮m and 100 ␮m of sodium vanadate for 24 h. Since SMA I patients lack the SMN1 gene, RT-PCR was used to quantify Fl-SMN2 and SMN2⌬7 mRNA. RT-PCR after sodium vanadate treatment showed the SMN2 mRNA was primarily full length (panel a). Panel b shows relative levels of Fl-SMN2 and SMN2⌬7 before and after sodium vanadate treatment: 25% of SMN2 mRNA lacks exon 7 without sodium vanadate treatment while 95% of SMN2 mRNA included exon 7 after 100 ␮m sodium vanadate treatment. Gene Therapy

Spinal muscular atrophy (SMA) is a unique genetic disorder. There are two SMN genes in the human genome, however only deletions or mutations of the SMN1 gene are responsible for the disease. The intact SMN2 gene is greater than 99% identical and is present in one or more copies in the majority of SMA patients. SMN2 cannot compensate for the loss of SMN1 because SMN2-derived transcripts predominantly lack exon 7, resulting in a biochemically defective and unstable SMN⌬7 protein. One goal for potential SMA therapy is to identify small molecules that stimulate inclusion of exon 7 from SMN2derived mRNAs thereby increasing the amount of active full-length SMN protein. To investigate the inclusion or exclusion of exon 7 in SMN2 pre-mRNA, an obvious and straightforward approach would be to insert a reporter gene or an epitope into exon 7 so that reporter activities could be used to monitor the efficiency of SMN exon 7 inclusion. However, exon 7 is a relatively small exon with only 54 base pairs. It has been shown that there are at least three splicing enhancers residing in this exon.20 Large insertions would likely alter the natural regulation of the exon. Instead of directly inserting a reporter gene into exon 7, we designed and constructed vectors in which the


reporter gene’s reading frame initiated 21 base pairs downstream from the beginning of exon 8. Since exon 8 is normally not translated from the full-length SMN transcript, the termination codon in exon 7 was inactivated by a single nucleotide insertion. There are several advantages to this design: (1) potential consequences for the proper recognition of exon 7 are minimized since only one nucleotide was inserted; (2) by placing the reporter in exon 8 we would not expect any changes in splicing since the regulatory mechanisms for terminal exons are much less stringent than internal exons;22 (3) the first 21 bp of exon 8 are retained so that the splicing elements used by intron 7 for exon 8 splicing would likely be intact; (4) different reporter cassettes can be easily fused to exon 8 without compromising exon 7 definition, which could not be assumed if the reporters were fused to exon 7; and (5) background from exon 7 skipped mRNAs should be negligible. Although only a single nucleotide was inserted into exon 7, the position of the insertion could potentially change its splicing patterns. We tested several different insertions, all of which showed similar splicing patterns for exon 7 (data not shown). Besides mini-gene constructs, cell lines are another consideration for HTS. While we have found that the SMN1 and SMN2 splicing patterns are consistent among many cell types and tissues, we cannot exclude the possibility that SMN transcripts are processed differently in motor neurons, especially during their differentiation. While C33A cells were successfully used to identify sodium vanadate, human spinal cord motor neuron cell lines are probably preferable for large scale screening of chemical libraries. Sah et al23 have developed immortalized human fetal spinal cord cell lines called HSP1 and HSP2. However, low transfection efficiency makes them unfavorable for HTS. As an alternative, stable NSC34 cell lines, a widely used fusion motor neuron cell line developed by Cashman et al,24 may be useful. We have previously shown that a single nucleotide and at least three splicing enhancers within the exon 7 modulate the splicing of the exon. While cis-elements are important for regulation of exon 7 splicing in SMN premRNA, trans-splicing factors are necessary for these ciselements to function. We have reported that Tra2␤1 stimulated exon 7 inclusion within SMN2 mRNA.21 To identify factors and their potential roles in exon 7 splicing, we treated our stable cell lines with chemical compounds that stimulate or antagonize kinases and signaling pathways (Table 1). We tested the stress/MAP kinase pathway as it has been shown recently that p38 kinase/pathway played a role in alternative splicing of adenovirus E1A pre-mRNA by effecting the distribution and phosphorylation of hnRNP A1 protein.25 However, neither the P38 kinase inhibitor SB 203580 nor MAPK3 kinase inhibitor U0126 promoted inclusion of exon 7 into SMN2 mRNA. Broader kinase inhibitors such as genistein and phorbol ester (PMA) (tyrosine kinases), 8bromo-cAMP (protein kinase A), and chelerythrin chloride (protein kinase C) did not influence SMN exon 7 processing (Table 1). Since motor neurons are quiescent nondividing cells, we tested cell cycle inhibitors hydroxyurea and cycloheximide, but these did not affect relative luciferase activities in the stable cell lines. The phosphatase inhibitor sodium vanadate stimulated inclusion of exon 7 in SMN2 mRNA. This is the first chemical identified that can regulate endogenous SMN2

pre-mRNA splicing. There are clearly therapeutic implications for SMA, although sodium vanadate is not a candidate for patient treatment because of its toxicity. Sodium vanadate inhibits ATPase and alkaline, tyrosine and multiple other phosphatases. The implication is that protein phosphorylation or dephosphorylation apparently can regulate the SMN2 mRNA splicing. The most likely proteins influenced by sodium vanadate are SR proteins, snRNPs or hnRNPs. Investigations of their expression, phosphorylation and distribution in the presence or absence of sodium vanadate is currently underway. In summary, we established a cell-based system for in vivo high throughput screening to identify compounds that could promote exon 7 inclusion in SMN2 mRNA using reporter genes. We demonstrated the efficiency of the system and identified sodium vanadate as a factor to regulate SMN2 splicing. Identification of additional compounds by HTS is underway. These compounds should illustrate how phosphorylation or dephosphorylation of specific proteins modify exon 7 splicing and may represent additional targets for therapeutic intervention. This system provides an alternative approach for gene therapy by altering splicing of the SMN2 pre-mRNA with chemical compounds.

1537

Materials and methods Constructs and other plasmid DNA Previously we generated mini-constructs that included exon 6, intron 6, exon 7, intron 7 and exon 8.16 These were used as templates to generate mini-gene-reporter cassettes with high fidelity Taq polymerase (Roche, Indianapolis, IN, USA) using the overlapping extension PCR strategy. Three PCR products (Figure 1a), PCR A (intron 6FW: exon 7+CRS), PCR B (exon 7+G FW: exon 8–21) and PCR C (exon 21-reporter, reporter-stop), were obtained. The PCR products from intron 6FW to reporter-stop were obtained by a mixture of the three PCR products as templates and cloned into the appropriate plasmid backbone between the BclI (SMN intron 6) and NotI (pCI polyliker) sites. The following primer sets were used to generate the indicated modified constructs. The underlined base G or C is an extra nucleotide inserted into exon 7 at the position between base pair number 48 and number 49. Primers: P1-Intron 6FW: 5⬘ CCTCCGCCTCCCAAAGTT 3⬘ P2-Exon 7+G RS: 5⬘ GACTTACTCCTTAGATTTAAGG 3⬘ P3-Exon 7+C FW: 5⬘ CATTCCTTAAATCTAAGGAG TAAGTC 3⬘ P4-Exon 8–275RS: 5⬘ CCCCCACCCCAGTCTTTTAC 3⬘ P5a-Exon 8–21-Luc: 5⬘ GAAATGCTGGCATAGAGC AGCTGGAAGACGCCAAAACATAAAG 3⬘ P5b-Exon 8–21-GFP: 5⬘ GAAATGCTGGCATAGAG CAGCTGGTGAGCAAGGGCGAGGAG 3⬘ P6a-Luc-stop: 5⬘ AAAGCGGCCGCTTACAATTTGG 3⬘ P6b-GFP-stop: 5⬘ AAAGCGGCCGCCTAGATCCGGT GGATCCCGG 3⬘ Cell culture, transfection and stable cell line selection C33A and 293 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS). Cell transfections were carried out using standard CaPO4 procedures. Stable cell lines were Gene Therapy


1538

selected in the presence of G418 for 2 weeks. Immortalized fibroblast cells from SMA patients were cultured in F12 medium with 10% FBS and 10% BM condimed supplements (Roche) as described.26 Reporter assays Cells at 48 h post-transient transfection or stable transfected cells were harvested in luciferase lysis buffer (Promega, Madison, WI, USA) and luciferase activities determined. Protein concentrations were determined for normalization of cell mass. Multiple transfections were conducted in triplicate for transient transfections and representative results are shown. GFP activities from transient or stable transfected cells were visualized under a Nikon (Garden City, NY, USA) fluorescence microscope. Reverse transcription-PCR (RT-PCR) Total RNA was isolated from transient or stable transfected cells using Trizol (Gibco, New York, NY, USA). First-strand cDNA synthesis and amplification of plasmid derived cDNAs and endogenous cDNAs from SMN genes were performed as previously described.16 pCI: Fwd#2 (GCT AAC GCA GTC AGT GCT TC) primer20 and a primer within the reporter gene (GFP-220AS: CTGAAGCACTGCACGCCGTAG; or Luc-200AS: ATAG CTTCTGCCAACCGAAC) were used in the PCR step of plasmid derived cDNAs. PCR products from endogenous SMN mRNAs were obtained with primers Ex5Fwd (5⬘CTA TCA TGC TGG CTG CCT-3⬘) and Ex8Rev (5⬘-CTA CAA CAC CCT TCT CAC AG-3⬘) and digested with DdeI. Reaction products were resolved in a 2% agarose gel. Full-length and ⌬7 transcripts were quantitated by Molecular Analyst (BioRad, Hercules, CA, USA) and expressed as percent relative to full-length expression within the same reaction. Effects of chemical inhibitors and activators on SMN2 splicing Inhibitors and activators for signal pathways, kinases and cell cycles and other chemicals (Table 1) were purchased from Sigma (St Louis, MO, USA). They were dissolved in either H2O or DMSO at a stock concentration of 10 mm. Stable C33A cell lines transfected with luciferaseminigenes, 293 cells, and SMA fibroblasts were treated with these compounds at concentrations ranging from 0 ␮m to 200 ␮m.

Acknowledgements We thank Adrian Krainer for the Tra2␤1 expression constructs. Funding for these studies was provided by the Muscular Dystrophy Association, and NIH R01 NS40275 to EJA. JZ was supported by Andrew’s Buddies and Families of SMA. CLL was supported by a New Investigator Development Award from the Muscular Dystrophy Association.

References 1 Lefebvre S et al. Identification and characterization of a spinal muscular atrophy-determining gene. Cell 1995; 80: 155–165. 2 Burglen L et al. Structure and organization of the human survival motor neurone (SMN) gene. Genomics 1996; 32: 479–482. 3 Burghes AH. When is a deletion not a deletion? When it is converted. Am J Hum Genet 1997; 61: 9–15. 4 Bergin A et al. Identification and characterization of a mouse homologue of the spinal muscular atrophy-determining gene, survival motor neuron. Gene 1997; 204: 47–53. Gene Therapy

5 Battaglia G et al. Expression of the SMN gene, the spinal muscular atrophy determining gene, in the mammalian central nervous system. Hum Mol Genet 1997; 6: 1961–1971. 6 Melki J. Spinal muscular atrophy. Curr Opin Neurol 1997; 10: 381–385. 7 Brahe C et al. Frameshift mutation in the survival motor neuron gene in a severe case of SMA type I. Hum Mol Genet 1996; 5: 1971–1976. 8 Wirth B. An update of the mutation spectrum of the survival motor neuron gene (SMN1) in autosomal recessive spinal muscular atrophy (SMA). Hum Mutat 2000; 15: 228–237. 9 Vitali T et al. Detection of the survival motor neuron (SMN) genes by FISH: further evidence for a role for SMN2 in the modulation of disease severity in SMA patients. Hum Mol Genet 1999; 8: 2525–2532. 10 Frugier T et al. Nuclear targeting defect of SMN lacking the Cterminus in a mouse model of spinal muscular atrophy. Hum Mol Genet 2000; 9: 849–858. 11 Hsieh-Li HM et al. A mouse model for spinal muscular atrophy. Nat Genet 2000; 24: 66–70. 12 Jablonka S et al. Reduced survival motor neuron (Smn) gene dose in mice leads to motor neuron degeneration: an animal model for spinal muscular atrophy type III. Hum Mol Genet 2000; 9: 341–346. 13 Monani UR et al. The human centromeric survival motor neuron gene (SMN2) rescues embryonic lethality in Smn(−/−) mice and results in a mouse with spinal muscular atrophy. Hum Mol Genet 2000; 9: 333–339. 14 Echaniz-Laguna A, Miniou P, Bartholdi D, Melki J. The promoters of the survival motor neuron gene (SMN) and its copy (SMNc) share common regulatory elements. Am J Hum Genet 1999; 64: 1365–1370. 15 Monani UR, McPherson JD, Burghes AH. Promoter analysis of the human centromeric and telomeric survival motor neuron genes (SMNC and SMNT). Biochim Biophys Acta 1999; 1445: 330–336. 16 Lorson CL, Hahnen E, Androphy EJ, Wirth B. A single nucleotide in the SMN gene regulates splicing and is responsible for spinal muscular atrophy. Proc Natl Acad Sci USA 1999; 96: 6307–6311. 17 Gennarelli M et al. Survival motor neuron gene transcript analysis in muscles from spinal muscular atrophy patients. Biochem Biophys Res Commun 1995; 213: 342–348. 18 Gavrilov DK et al. H. Differential SMN2 expression associated with SMA severity. Nat Genet 1998; 20: 230–231. 19 Monani UR et al. A single nucleotide difference that alters splicing patterns distinguishes the SMA gene SMN1 from the copy gene SMN2. Hum Mol Genet 1999; 8: 1177–1183. 20 Lorson CL, Androphy EJ. An exonic enhancer is required for inclusion of an essential exon in the SMA-determining gene SMN. Hum Mol Genet 2000; 9: 259–265. 21 Hofmann Y et al. Htra2-beta 1 stimulates an exonic splicing enhancer and can restore full-length SMN expression to survival motor neuron 2 (SMN2). Proc Natl Acad Sci USA 2000; 97: 9618–9623. 22 Dye MJ, Proudfoot NJ. Terminal exon definition occurs cotranscriptionally and promotes termination of RNA polymerase II. Mol Cell 1999; 3: 371–378. 23 Sah DW, Ray J, Gage FH. Bipotent progenitor cell lines from the human CNS. Nat Biotechnol 1997; 15: 574–580. 24 Cashman NR et al. Neuroblastoma × spinal cord (NSC) hybrid cell lines resemble developing motor neurons. Dev Dyn 1992; 194: 209–221. 25 van der Houven van Oordt W et al. The MKK(3/6)-p38-signaling cascade alters the subcellular distribution of hnRNP A1 and modulates alternative splicing regulation. J Cell Biol 2000; 149: 307–316. 26 Patrizi AL et al. SMN protein analysis in fibroblast, amniocyte and CVS cultures from spinal muscular atrophy patients and its relevance for diagnosis. Eur J Hum Genet 1999; 7: 301–309.