Angiotensin II AT1 Receptor Blockade Decreases Lipopolysaccharide ...

0013-7227/08/$15.00/0 Printed in U.S.A.

Endocrinology 149(10):5177–5188 Copyright © 2008 by The Endocrine Society doi: 10.1210/en.2008-0242

Angiotensin II AT1 Receptor Blockade Decreases Lipopolysaccharide-Induced Inflammation in the Rat Adrenal Gland Enrique Sanchez-Lemus, Yuki Murakami, Ignacio M. Larrayoz-Roldan, Armen J. Moughamian, Jaroslav Pavel, Tsuyoshi Nishioku, and Juan M. Saavedra Section on Pharmacology, National Institute of Mental Health, National Institutes of Health, Department of Health and Human Services, Bethesda, Maryland 20892 Peripheral administration of bacterial endotoxin [lipopolysaccharide (LPS)] to rodents produces an innate immune response and hypothalamic-pituitary-adrenal axis stimulation. Renin-angiotensin-aldosterone system inhibition by angiotensin II AT1 receptor blockade has antiinflammatory effects in the vasculature. We studied whether angiotensin II receptor blockers (ARBs) prevent the LPS response. We focused on the adrenal gland, one organ responsive to LPS and expressing a local renin-angiotensin-aldosterone system. LPS (50 ␮g/ kg, ip) produced a generalized inflammatory response with increased release of TNF-␣ and IL-6 to the circulation, enhanced adrenal aldosterone synthesis and release, and enhanced adrenal cyclooxygenase-2, IL-6, and TNF-␣ gene expression. ACTH and corticosterone release were also increased by LPS. Pretreatment with the ARB candesartan (1 mg/kg䡠d, sc for 3 d before the LPS administration) decreased

A

NGIOTENSIN (Ang) II, the active principle of the renin-angiotensin-aldosterone system (RAAS), is a potent pro-hypertensive factor because of its vasoconstrictor and sodium retentive properties, and is one of the major regulators of aldosterone production and release (1). There are two types of Ang II receptors, AT1 and AT2 (2). In rodents there are two AT1 receptor subtypes, AT1A and AT1B, differentially regulated but pharmacologically similar. The well-known physiological actions of Ang II, including its role in vasoconstriction and aldosterone synthesis, are dependent on AT1 receptor stimulation (1). The physiological role of AT2 receptors is still controversial (3, 4). First Published Online June 12, 2008 Abbreviations: Ang, Angiotensin; ARB, angiotensin II receptor blocker; CEH, cholesterol ester hydrolase; COX-2, cyclooxygenase-2; CpG-DNA, cytosine-phosphate-guanine dinucleotide; eNOS, endothelial nitric oxide synthase; HMG-CoA-R, hydroxymethylglutaryl coenzyme A reductase; HPA, hypothalamic-pituitary-adrenal; iNOS, inducible nitric oxide synthase; LDL-R, low-density lipoprotein receptor; LPS, lipopolysaccharide; nNOS, neural nitric oxide synthase; NOS, nitric oxide synthase; PRA, plasma renin activity; RAAS, renin-angiotensinaldosterone system; SAP, steroidogenesis activatory polypeptide; Sar1Ang II, Sarcosine1-Angiotensin II; SCP-2, sterol carrier protein-2; SR-B1, scavenger receptor B1; StAR, steroidogenic acute regulatory protein; TLR4, toll-like receptor 4. Endocrinology is published monthly by The Endocrine Society (http:// www.endo-society.org), the foremost professional society serving the endocrine community.

LPS-induced cytokine release to the circulation, adrenal aldosterone synthesis and release, and cyclooxygenase-2 and IL-6 gene expression. Candesartan did not prevent the LPSinduced ACTH and corticosterone release. Our results suggest that AT1 receptors are essential for the development of the full innate immune and stress responses to bacterial endotoxin. The ARB decreased the general peripheral inflammatory response to LPS, partially decreased the inflammatory response in the adrenal gland, prevented the release of the pro-inflammatory hormone aldosterone, and protected the antiinflammatory effects of glucocorticoid release. An unrestricted innate immune response to the bacterial endotoxin may have deleterious effects for the organism and may lead to development of chronic inflammatory disease. We postulate that the ARBs may have therapeutic effects on inflammatory conditions. (Endocrinology 149: 5177–5188, 2008)

Recent evidence has revealed that Ang II is an important stress hormone (5) with a remarkable expression of its receptors throughout the hypothalamic-pituitary-adrenal (HPA) axis (6 – 8). Blockade of AT1 receptors with peripherally and centrally acting Ang II receptor blockers (ARBs) prevents activation of the HPA axis, and central and peripheral sympathoadrenal activation characteristic of isolation stress (9, 10). Ang II is also recognized as an important vascular pro-inflammatory factor in hypertension. Ang IIdriven vascular inflammation is considered the result of direct effects on pro-inflammatory cytokine formation, and a consequence of enhanced production and release of the proinflammatory hormone aldosterone, and ARBs reduce the peripheral and cerebrovascular inflammation associated with this disease (11–13). Because of the antistress and antiinflammatory effects of ARBs, we hypothesized that these compounds may also play a role in the response to bacterial infections, and we studied the effects of AT1 receptor blockade on inflammatory stress in normotensive animals. We focused on the adrenal gland, the production site of aldosterone (14, 15). Aldosterone synthesis and release occur exclusively in the adrenal zona glomerulosa, and are regulated in part by AT1 receptors, expressed in large numbers in this zone, and responding to both locally formed and circulating Ang II (16 –18). As a model of inflammatory stress, we chose to study the acute response, or innate immune response, to peripheral

5177

5178

Endocrinology, October 2008, 149(10):5177–5188

administration of the bacterial endotoxin lipopolysaccharide (LPS), a major component of the outer membranes of Gramnegative bacteria. LPS signals by first binding to LPS-binding protein and soluble CD14, forming a complex recognized by the membrane receptors toll-like receptor 4 (TLR4) and membrane-bound CD14. This is followed by a fast and transient release of pro-inflammatory cytokines to the circulation (19, 20). Acute LPS administration produces not only a strong innate immune response with increased production of proinflammatory cytokines (19, 21), but also a classical stress response with HPA axis activation (22, 23). This response includes increased synthesis and release of CRH in the hypothalamic paraventricular nucleus, followed by a large increase in ACTH, glucocorticoid and aldosterone release (24, 25). LPS exerts direct effects on human adrenal gland cells, where TLR4 and CD14 have been identified (26, 27). These effects include stimulation of glucocorticoid secretion and a major increase in the expression of cyclooxygenase-2 (COX2), an enzyme induced by inflammatory stimuli and playing a fundamental role in prostaglandin production and inflammatory processes (26, 28, 29). The interaction of LPS and the adrenal RAAS has not been studied, with the exception of the report of down-regulation of adrenal Ang II receptors by high doses of LPS (30, 31). We asked whether the adrenal RAAS, and particularly Ang II AT1 receptors, were involved in the regulation of the adrenal response to LPS. Materials and Methods Experimental animals Male Wistar Hanover rats, weighing 280 –350 g were purchased from Taconic Farms (Germantown, NY). They were kept in groups of three per cage under standard laboratory conditions, with room temperature at 22 C and 12 h light each day, with water and rat chow ad libitum. The National Institute of Mental Health Animal Care and Use Committee approved all procedures. All efforts were made to minimize the number of animals used and their suffering [National Institutes of Health (NIH) Guide for the Care and Use of Laboratory Animals, NIH Publication No. 80 –23, revised 1996).

Experiment 1: measurement of hormone release Rats received a sc injection of vehicle or sc injection of 1 mg/kg candesartan (Astra-Zeneca, Molndal, Sweden), dissolved in 1 n sodium carbonate and further diluted in isotonic saline, at a final pH of 7.5– 8.0, in the morning (0900 –1000 h) for 3 consecutive days starting the day before tail artery cannulation. Some rats received saline and others 50 ␮g/kg LPS (Escherichia coli serotype 055:B5; Sigma Chemical Co., St. Louis, MO) ip injected on d 3, immediately after the last dose of vehicle or candesartan. Blood samples of 0.5 ml were withdrawn, and the lost blood volume was replenished by gentle intraarterial injection of 30 IU/ml sodium heparin in 0.9% NaCl. Samples were collected just before, and at 0.5, 1, 2, 4, and 6 h after drug administration. The animals were undisturbed during blood sample collection. Group 1 (five rats) was treated with vehicle and injected with saline. Group 2 (nine rats) was treated with vehicle and injected with LPS. Group 3 (10 rats) was treated with candesartan and injected with LPS.

Experiment 2: measurement of intra-arterial blood pressure One group of rats received sc injection of vehicle and another group sc injection of 1 mg/kg candesartan in the morning (0900 –1000 h) for 3 consecutive days starting the day before femoral artery cannulation. All rats received 50 ␮g/kg LPS ip on d 3, immediately after the last dose of vehicle or candesartan. Mean arterial blood pressure was measured with an intra-arterial interface in awake rats (SC1000IA; Hatteras Instru-

Sanchez-Lemus et al. • LPS-Induced Inflammation in Adrenal Gland

ments, Cary, NC). Waves were recorded and analyzed with the software provided by the SC1000 Comm software (Hatteras Instruments). Blood pressure was recorded 15, 30, 45, 60, and 120 min after LPS administration. Basal conditions were recorded 15 min and just before LPS administration. Measurements were recorded for 1 continuous minute, and the average was registered. The animals were undisturbed during the procedure. Group 1 (six rats) was treated with vehicle and injected with LPS. Group 2 (six rats) was treated with candesartan and injected with LPS.

Experiment 3: determination of receptor autoradiography, in situ hybridization, adrenal hormone content and mRNA expression measurements, plasma cytokines and plasma renin activity (PRA) Rats were treated sc with vehicle or 1 mg/kg candesartan at 0900 h for 3 consecutive days. On d 3 starting at 1000 h, one group of rats was injected with 50 ␮g/kg LPS and another group with sterile saline, ip. Three hours after LPS or saline injection, the animals were removed from their cages and taken to a different room to be killed by fast decapitation. Trunk blood was collected and processed for the determination of hormone and cytokine levels and PRA. Adrenal glands and kidneys were dissected, frozen in cold isopentane (⫺50 C), and stored at ⫺80 C until use. One day before the first candesartan injection, animals were handled for 5–10 min each in the animal procedure room (where all injections were applied), to minimize the handling stress during LPS administration. Rats were taken back and kept undisturbed in the animal holding room after each injection. Group 1 (seven rats) was treated with vehicle and injected with saline. Group 2 (nine rats) was treated with vehicle and injected with LPS. Group 3 (seven rats) was treated with candesartan and injected with saline. Group 4 (nine rats) was treated with candesartan and injected with LPS. This experiment was performed three times. In the first experiment, one of the adrenal glands of each animal was used for RNA and protein extraction using a TRIzol (Invitrogen Corp., Carlsbad, CA) protocol, and then for real-time PCR and Western blot, respectively. Plasma was collected to determine cytokine concentrations. The second adrenal gland was used for hormone content quantification. In the second experiment, one adrenal was used for real-time PCR to confirm previous results, and the second was used for receptor autoradiography and in situ hybridization assays. A piece (⬃4 ⫻ 4 ⫻ 2 mm) of kidney cortex from the kidney pole was dissected for determination of renin mRNA concentration by real-time PCR. In the third experiment, freshly removed adrenal capsules, including the zona glomerulosa, were carefully dissected under a microscope and processed as described previously for determination of mRNA expression by real-time PCR. Plasma was collected to determine PRA. Consecutive 16-␮m thick sections of adrenal were cut using a cryostat at ⫺20 C. Sections were thaw mounted on Superfrost Plus slides (Daigger, Vernon Hills, IL), dried for 5 min at 50 C (for in situ hybridization) or overnight at 4 C (for receptor autoradiography), and then stored at ⫺80 C. Alternate sections were used for quantitative receptor autoradiography and in situ hybridization, respectively.

Artery cannulation The procedure was done essentially as originally described by Chiueh and Kopin (32). Rats were anesthetized with isoflurane in oxygen, with 3% isoflurane to induce anesthesia and 2% isoflurane during the surgical procedure. An incision of 1.5 cm was made on the ventral surface of the tail, about 1 cm from its origin. The tail artery (arteria caudalis mediana) was carefully dissected, clamped by lifting the vessel, and ligated distally. Polyethylene tubing (Intramedic Clay-Adams PE-50; BD Diagnostic Systems, Sparks, MD) filled with 300 IU/ml sodium heparin (APP, Inc., Schaumburg, IL) in 0.9% NaCl was inserted into the ventral tail artery for a distance of at least 1 cm and fixed with two ligatures attached to the tail skin. The free end of the cannula was tunneled sc to the neck, exteriorized through the skin, and led out of the cage through stainless steel springs (Instech Lab, Inc., Plymouth Meeting, PA). After surgery each rat was housed individually with a plastic syringe (1 ml) connected to the catheter with a 23-gauge hypodermic needle. In a similar fashion, an arterial catheter was inserted into the lower aorta via the right femoral



5179

TABLE 1. Sequence of primers used for real-time PCR Gene product

Forward primer (5⬘–3⬘)

Reverse primer (5⬘–3⬘)

18S ACE Angiotensinogen AT1B CD14 CEH COX-2 CYP11A1 eNOS HMG-CoA-R IL-6 iNOS LDL-R nNOS Renin SAP SCP-2 SR-B1 StAR TLR4 TNF-␣

GACCATAAACGATGCCGACT ATGGTACAGAAGGGCTGGAA CATGAGTTCTGGGTGGACAA CACCTCGCCAAGGGAGAC ATGCCTCTCCCGCCACACCAG TTTATACTCCCGCTGACTTGAC CGGAGGAGAAGTGGGGTTTAGGAT CAAGCAGCAAAACTCTGGAA GCCCCGGTACTACTCTGTCA AAGAAGAGAATAAACCAAACCCAGT CACAAGTCCGGAGAGGAGAC AGGCCACCTCGGATATCTCT CAAACTCCACTCCATCTCCA CTGCCACGGAGTCCTTCATCAAAC CTGTGCATACTGGCTCTCCA CCTATTCCTGCGTCGGTGTATT GCTTCACGATTGCTTCTCTACC GGAGGACAAGCCCACAAG GGCTGGAAGTCCCTCAAAG AGCCGGAAAGTTATTGTGGTGGTG GAGAGATTGGCTGCTGGAAC

GTGAGGTTTCCCGTGTTGAG TTGTAGAAGTCCCACGCAGA AAGTTGTTCTGGGCGTCACT CACTTGCAGGCTTTGAACC GACCGCCGCCGTAGAACTCCA GATGCTCCACCCACTACCA TGGGAGGCACTTGCGTTGATGG AAAGGCAAAGCGGAATAGGT CCTTGAGTTGGCTCATCCAT TGTGAGCGTGAACAAGAACCAG CAGAATTGCCATTGCACAAC GCTTGTCTCTGGGTCCTCTG CTGCTTCTCATCCTCCAAAA AGCCCCCTCTGCAGCGGTATT GAACCCGATGCGATTGTTAT GTGATGCGGTTGCCCTGAT TGCTCCACCTTGTCCTTCTG TTCGTAGCCCCACAGGAT GTGGCTGGCGAACTCTATCT CAACGGCTCTGGATAAAGTGTCT TGGAGACCATGATGACCGTA

artery and connected to a pressure transducer to measure intra-arterial blood pressure. Animals had complete freedom of movement about the cage, which contained bedding material, laboratory chow, and tap water. Catheters were gently flushed with 500 ␮l 300 IU/ml sodium heparin to keep them patent (25, 33), immediately after surgery between 0900 and 1200 h, a second time at 1900 h, and a third time at 0900 h the next day. Animals were studied 24 h after the insertion of the catheter.

Hormone and cytokine assays Whole adrenal glands were homogenized in 0.3 n perchloric acid and centrifuged 15 min at 4 C, 1800 ⫻ g. Clear supernatants from the homogenates were stored at ⫺80 C until assayed. Blood samples were immediately centrifuged 15 min at 4 C, 1800 ⫻ g, and the plasma obtained was stored at ⫺80 C. Commercial RIA kits were used to determine aldosterone (Diagnostic Systems Laboratories, Inc., Webster, TX), corticosterone (MP Biomedicals, Orangeburg, NY), and ACTH (DiaSorin Inc., Stillwater, MN) following the manufacturers’ recommended protocols. The intraassay coefficients of variation were 4.5, 7.1, and 4.2%, for aldosterone, corticosterone, and ACTH, respectively. Cross-reactivity for corticosterone was 0.02% for the aldosterone kit, and cross-reactivity for aldosterone was 0.03% for the corticosterone kit. Plasma TNF-␣ and IL-6 were measured with commercial ELISA kits (Biosource, Camarillo, CA) according to the manufacturer’s protocol. The intraassay coefficients of variation were 2.7 and 3.9%, respectively.

PRA Blood samples were immediately centrifuged 15 min at 4 C, 1800 ⫻ g, and the plasma obtained was stored at ⫺80 C. PRA was measured with the use of a commercial kit (GammaCoat 125I PRA; DiaSorin). Plasma was incubated at 37 C for 90 min. The amount of Ang I generated was quantified by RIA. The intraassay coefficient of variation was 4.6%.

Measurement of mRNA expression by real-time PCR Total RNA was isolated individually from homogenized adrenal and kidney cortex samples using 1 ml TRIzol, followed by purification and deoxyribonuclease I treatment using an RNeasy Mini kit (QIAGEN, Inc., Valencia, CA) (34). Synthesis of cDNA was performed using 2 ␮g total RNA and Super-Script III first-Strand Synthesis (Invitrogen). Real-time PCR was performed in a 20-␮l reaction mixture consisting of 10 ␮l SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA), 2 ␮l cDNA, and 0.3 ␮m each primer for a specific target on a DNA Engine Opticon (MJ Research, Waltham, MA). For quantitation of CYP11B1 and CYP11B2 mRNA, TaqMan probes (Applied Biosystems) were used according to the manufacturer’s instructions. The other specific primers

used are listed in Table 1. Amplification was performed at 95 C for 10 min, followed by 40 cycles at 95 C for 15 sec and 56 – 60 C for 60 sec. At the end of amplification, the specificity of the PCR was confirmed by melting temperature determination of the PCR product. Serial dilutions of rat cDNA were used to obtain a calibration curve. The individual targets for each sample were quantified by determining the cycle threshold and by using calibration curves. The relative amount of the target was normalized with the housekeeping gene for 18S rRNA and expressed as arbitrary units. The expression of the housekeeping gene was not altered by any of the treatments used (results not shown).

Western blotting Adrenal glands were homogenized using 1 ml TRIzol. After aqueous phase (RNA) was removed, protein was precipitated with isopropanol and washed three times with 0.3 m guanidine-HCl. Samples were vacuum dried and then resuspended in 10 mm Tris-HCl (pH 7.4) containing 1% sodium dodecyl sulfate and 1% protease-inhibitor cocktail (Sigma Chemical). Protein determination was performed with a commercial BCA protein assay kit (Pierce, Rockford, IL). Samples containing approximately 30 ␮g protein were electrophoresed on 10% NuPAGE Bis-Tris Gels (Invitrogen) and transferred to polyvinylidene difluoride membranes. The membranes were blocked for 60 min in blocking buffer (Sigma Chemical) and then incubated 2 h at 22 C with mouse antirat cytochrome P450 aldosterone synthase antibody (1:400; Chemicon International, Inc., Temecula, CA). To control sample-loading variations, the level of ␤-actin was measured using an anti-␤-actin antibody (1:20,000; Santa Cruz Biotechnology, Inc., Santa Cruz, CA), and used as a reference protein for normalization. The expression of ␤-actin was not altered by any of the treatments used. The membranes were rinsed in washing buffer [10 mm Tris-HCl, 100 mm NaCl, and 0.1% Tween 20 (pH 7.4)]. Protein bands were visualized by the SuperSignal West Pico chemiluminescent substrate (Pierce). Quantification was done with the Scion Image Program 4.0.2 (Scion Corp., Frederick, MD), based on the NIH Image Program of the NIH.

In situ hybridization In situ hybridization was performed using [35S]-labeled antisense and sense (control) riboprobes for AT1A, AT1B, and AT2 receptors. The preparation of subclones, rAT1A-S2, rAT1B-S1, and rAT2-S1 was described previously (7). Before use, the sections on slides were warmed in a desiccator at room temperature and then fixed in 4% formaldehyde in phosphate buffer for 10 min. After two washes in phosphate buffer, they were acetylated for 10 min in 0.1 m triethanolamine HCl, 0.9% NaCl, containing 0.25% acetic anhydride, delipidated in ethanol and chloro-

5180



FIG. 1. Blood pressure, PRA, and renal cortex renin mRNA. A, Femoral artery cannulated rats were injected with vehicle or AT1 antagonist for 3 d. Intra-arterial blood pressure, expressed as mean arterial pressure, was measured on d 3. Blood pressure was measured before and after ip administration of LPS at the indicated times. Values represent mean ⫾ SEM for groups of six animals. *, P ⬍ 0.05 compared with correspondent vehicle-treated group; two-way ANOVA and post hoc Bonferroni’s test. B and C, Rats treated with vehicle or AT1 antagonist for 3 d received an ip injection of sterile saline or LPS on d 3. The animals were killed 3 h later. Values are mean ⫾ SEM for groups of seven to nine animals measured individually. Values of PRA are expressed as ng Ang I formed/ml䡠h. mRNA data correspond to relative levels after normalization to 18S rRNA. ***, P ⬍ 0.001 compared with vehicle-treated groups; ##, P ⬍ 0.01, compared with candesartan-saline treated groups; one-way ANOVA and post hoc Tukey’s test. form, and air-dried. Each slide with sections was covered with 150 ␮l hybridization buffer containing 50% formamide, 0.3 m NaCl, 1 mm EDTA, 20 mm Tris (pH 7.5), 1 ⫻ Denhardt’s solution, 10% dextran sulfate, 100 ␮g/ml salmon testes DNA, 250 ␮g/ml yeast RNA, 250 ␮g/ml yeast tRNA, 150 mm dithiothreitol, 0.2% sodium dodecyl sulfate, 0.2% sodium thiosulfate pentahydrate, and 2 ⫻ 107 cpm/ml sense or antisense probe. After hybridization for 18 h at 54 C, the coverslips were removed, and the sections were rinsed several times in 4⫻ standard saline citrate. Nonhybridized probes were digested by incubation with 40 ␮g/ml ribonuclease A (Sigma Chemical) for 30 min at 37 C. After a final high stringency wash in 0.1⫻ standard saline citrate at 65 C for 60 min, sections were dehydrated in graded ethanol containing 0.3 m ammonium acetate, air-dried, and exposed to Biomax MR film (Kodak, Rochester, NY) for 11 d. The mRNA expression was analyzed by measuring optical film densities using the Scion Image 4.0.2 Program. The intensities of the hybridization signals were expressed as nCi/g tissue equivalent after calibration with [14C]-microscales standards (35), and after substraction of the values obtained in the same areas of adjacent sections hybridized with sense (control) probes, which represent a nonspecific hybridization.

Receptor autoradiography Sarcosine1-Angiotensin II (Sar1-Ang II) (Peninsula Laboratories, Belmont, CA) was iodinated by the Peptide Radioiodination Service Center (School of Pharmacy, University of Mississippi, University, MS) with a specific activity of approximately 2200 Ci/mmol. Receptor binding was performed as previously described (6). Sections were preincubated for 15 min at 22 C in a 10-mm sodium phosphate buffer (pH 7.4), containing 0.005% bacitracin, 5 mm EDTA, 120 mm NaCl, and 0.2% proteinase-free BSA. Sections were then incubated for 2 h at 22 C in fresh buffer containing 0.5 nm [125I]Sar1-Ang II. To characterize Ang II receptor subtypes, adjacent tissue sections were incubated as described previously in the presence of either 10 ␮m losartan (DuPont Merck, Wilmington, DE), a selective AT1 receptor antagonist, or 10 ␮m PD123319 (Parke-Davis, Ann Arbor, MI), a selective AT2 receptor ligand, or 5 ␮m unlabeled Ang II (Peninsula Laboratories) to assess nonspecific binding. The number of AT1 receptors was determined as the specific binding displaced by unlabeled losartan. The number of AT2 receptors was determined as the specific binding displaced by unlabeled PD123319. After incubation, slides were washed four times for 1 min in Tris-HCl (pH 7.4) at 4 C, followed by a 30-sec rinse in distilled water at 4 C. Slides were then dried under a stream of cold air and exposed to Biomax MR film. ODs of autoradiograms generated by incubation with the 125I ligands were normalized after comparison with [14C] microscale standards as described and quantified by computerized densitometry using the Scion Image 4.0.2 Program. Binding signal was expressed as fmol/mg protein.

Statistical analysis All results are expressed as means ⫾ sem, for groups of five to 10 animals measured individually. To assess the significance of differences

in hormone release and blood pressure measurements, two-way ANOVA followed by the Bonferroni’s test was used. To evaluate changes in mRNA, proteins, receptor autoradiography, PRA, and adrenal hormones, one-way ANOVA followed by the multiple comparisons Tukey’s test was used. P ⬍ 0.05 was considered statistically significant. All statistics were performed with Prism 3.03 software (GraphPad Software Inc., San Diego, CA).

Results Blood pressure and systemic RAAS

To evaluate LPS effects on systemic blood pressure and hormonal RAAS, we measured the intra-arterial blood pressure of cannulated undisturbed rats, the PRA and the mRNA expression of kidney renin, 3 h after LPS administration. There were no significant changes in mean arterial blood pressure after LPS injection during the interval studied (F ⫽ 0.25; P ⬎ 0.5; Fig. 1). Blockade of AT1 receptors decreased mean intra-arterial blood pressure (F ⫽ 37.3; P ⬍ 0.0001) by 25.6 ⫾ 1.5 mm Hg. The blood pressure decrease produced by candesartan did not change after LPS administration (Fig. 1). AT1 receptor blockade substantially increased PRA and produced a major induction of renin gene expression in kidney cortex. Administration of LPS alone did not change PRA or renin gene expression in the kidney cortex (Fig. 1). The effect of AT1 receptor blockade on PRA and renal renin mRNA expression in animals treated with LPS was significantly lower than that produced by AT1 receptor blockade alone. Plasma cytokines

To determine the systemic inflammation response of LPS, we measured plasma cytokines 3 h after endotoxin injection. Plasma levels of TNF-␣ and IL-6 were undetectable under control conditions and after candesartan administration (Fig. 2). LPS administration dramatically enhanced TNF-␣ and IL-6 plasma levels, and candesartan treatment significantly decreased the LPS effects. Hormone release

To determine the extent of stimulation of the HPA axis by LPS, and the role of AT1 receptors, we studied the ACTH, corticosterone, and aldosterone release after endotoxin administration with and without AT1 receptor blockade. Pre-



5181

FIG. 2. Plasma cytokines. Rats treated with vehicle or AT1 antagonist for 3 d received an ip injection of sterile saline or LPS on d 3. The animals were killed 3 h later. Values are mean ⫾ SEM for groups of seven to nine animals measured individually. **, P ⬍ 0.01 as compared with the candesartan-LPS treated groups; one-way ANOVA and post hoc Tukey’s test. ND, Nondetectable.

treatment with the AT1 receptor blocker alone did not change the basal plasma levels of hormones (Fig. 3). Administration of 50 ␮g/kg LPS enhanced ACTH and corticosterone release with a maximum response at 1–2 h (vehicle-saline vs. vehicleLPS; F ⫽ 39.7 and F ⫽ 32.9, respectively; P ⬍ 0.0001). Blockade of AT1 receptors enhanced the ACTH response to LPS (vehicle-LPS vs. candesartan-LPS; F ⫽ 9.0, P ⬍ 0.01 for candesartan effect; F ⫽ 14.1, P ⬍ 0.0001 for time effect; and F ⫽ 1.4, P ⬍ 0.05 for interaction; Fig. 3). The total LPS-induced increase in corticosterone release was not changed by AT1 receptor blockade, but the peak in hormone release was delayed for about 30 min and extended over time (vehicleLPS vs. candesartan-LPS; F ⫽ 0.05, P ⬎ 0.5 for candesartan effect; F ⫽ 9.5, P ⬍ 0.0001 for time effect; and F ⫽ 4.0, P ⬍ 0.01 for interaction of factors). LPS increased aldosterone plasma levels (vehicle-saline vs. vehicle-LPS; F ⫽ 30.7; P ⬍ 0.0001), with a peak response of LPS at 1 h. Pretreatment with an AT1 receptor blocker significantly decreased but did not completely abolish the LPSinduced aldosterone release (vehicle-LPS vs. candesartanLPS; F ⫽ 7.2, P ⬍ 0.01, for candesartan effect; F ⫽ 12.8, P ⬍ 0.0001 for time effect; and F ⫽ 6.3, P ⬍ 0.0001 for interaction; Fig. 3). Adrenal hormone content

Candesartan treatment alone did not change basal levels of adrenal corticosterone or aldosterone. Endotoxin increased aldosterone and corticosterone content in the adrenal gland, measured at 3 h after injection (Fig. 4). The LPSinduced increase in adrenal aldosterone content was completely abolished by candesartan pretreatment. Conversely, AT1 receptor blockade did not change the increase in adrenal corticosterone content produced by LPS (Fig. 4). Aldosterone synthesis

We next investigated the action of the endotoxin on the aldosterone synthetic pathway in the whole adrenal gland. We first studied the gene expression of the main enzymes

FIG. 3. Hormone release. Tail artery cannulated rats were treated with vehicle or AT1 antagonist for 3 d. Blood samples were collected just before LPS injection and at the indicated times when animals were conscious and undisturbed. Values represent mean ⫾ SEM for groups of five to 10 animals measured individually. *, P ⬍ 0.05 compared with correspondent vehicle-LPS treated group; two-way ANOVA and post hoc Bonferroni’s test.

involved in aldosterone and corticosterone synthesis, cytochrome P450 side-chain cleavage (CYP11A1; pregnenolone synthase) and corticosterone (CYP11B1) and aldosterone (CYP11B2) synthases. Administration of candesartan alone or LPS alone or its combination did not modify the expression of CYP11A1 (vehicle-saline, 1.0 ⫾ 0.05; candesartansaline, 1.0 ⫾ 0.07; vehicle-LPS, 1.0 ⫾ 0.08; and candesartanLPS, 1.0 ⫾ 0.06) or CYP11B1 (vehicle-saline, 0.8 ⫾ 0.07; candesartan-saline, 0.9 ⫾ 0.07; vehicle-LPS, 1.0 ⫾ 0.1; and candesartan-LPS, 1.0 ⫾ 0.07).

5182



FIG. 4. Aldosterone and corticosterone in adrenal. Rats treated with vehicle or AT1 antagonist for 3 d received an ip injection of sterile saline or LPS on d 3. The animals were killed 3 h later. Values are mean ⫾ SEM for groups of seven to nine animals measured individually. ***, P ⬍ 0.001 compared with the rest of the groups; **, P ⬍ 0.01; *, P ⬍ 0.05 compared with salinetreated groups; one-way ANOVA and post hoc Tukey’s test.

Blockade of AT1 receptors down-regulated basal values of CYP11B2 mRNA (48.4 ⫾ 8.4% of basal; Fig. 5). LPS increased the expression of CYP11B2 mRNA and protein (159 ⫾ 17% and 144.5 ⫾ 5.5% of basal, respectively). The increases in CYP11B2 mRNA and protein expression were completely prevented by pretreatment with the AT1 receptor blocker. We determined the effects of LPS on the mRNA expression of some important genes regulating the generation, capture, and transport of cholesterol, critical steps in steroid biosynthesis in the whole adrenal gland (Fig. 6). LPS treatment

increased the gene expression of the low-density lipoprotein receptor (LDL-R), scavenger receptor B1 (SR-B1), and transcription of the limiting enzyme for de novo synthesis of cholesterol, hydroxymethylglutaryl coenzyme A reductase (HMG-CoA-R). We did not find alterations in the gene expression of cholesterol ester hydrolase (CEH), the enzyme responsible for cholesterol mobilization from intracellular stores. In addition, we found increased transcription of the steroidogenesis activatory polypeptide (SAP) and steroidogenic acute regulatory protein (StAR), transporters of cholesterol in cytoplasm and mitochondria, respectively. Conversely, transcription of the sterol carrier protein-2 (SCP-2), a cytoplasmatic cholesterol transporter, decreased after LPS treatment. Candesartan either administered alone or with LPS did not modify the expression of any of the genes studied. We then studied gene expression of CYP11A1 and CYP11B2 in dissected adrenal capsules containing the zona glomerulosa. In the isolated zona glomerulosa, the effects of LPS and candesartan on CYP11B2 were similar to those observed in the whole adrenal gland. LPS stimulated gene expression of CYP11B2, and this change was completely prevented by pretreatment with the AT1 receptor blocker (Fig. 7). There were no effects on the gene expression of CYP11A1 after candesartan or LPS treatment. In isolated adrenal zona glomerulosa, LPS increased the mRNA expression of LDL-R, SR-B1, and HMG-CoA-R, effects similar to those observed in whole adrenal glands. However, in the isolated zona glomerulosa, LPS failed to modify the gene expression of CEH, SCP-2, SAP, and StAR (Fig. 7). As it was the case for the whole adrenal gland, AT1 receptor blockade did not modify the effects of LPS on any of the genes involved in the generation, capture, and transport of cholesterol. Adrenal inflammatory markers

FIG. 5. Adrenal aldosterone synthase. Rats treated with vehicle or AT1 antagonist for 3 d received an ip injection of sterile saline or LPS on d 3. The animals were killed 3 h after LPS administration. Data correspond to relative levels after normalization to 18S rRNA for mRNA and ␤-actin for protein. Representative pictures from Western blot are presented. Values are mean ⫾ SEM for groups of seven to nine animals measured individually. ***, P ⬍ 0.001 compared with candesartan-treated groups; #, P ⬍ 0.05 compared with vehicle-saline treated group; *, P ⬍ 0.05 compared with the rest of the groups; one-way ANOVA and post hoc Tukey’s test.

To evaluate whether LPS produced a local inflammation response in the adrenal gland, we measured the gene expression of inflammatory markers (Fig. 8). We found increases in TNF-␣ and IL-6 mRNA after the LPS challenge. Pretreatment with candesartan significantly reduced the LPS-induced increase in gene expression of IL-6 but did not modify the LPS stimulation of TNF-␣ mRNA expression (Fig. 8). Similarly, adrenal COX-2 mRNA was up-regulated by LPS, and AT1 receptor blockade significantly inhibited this effect. In addition, inducible and neural isoforms of nitric oxide synthase (NOS) (iNOS and nNOS, respectively) were increased, whereas endothelial NOS was decreased by en-



5183

FIG. 6. Adrenal mRNA expression of genes involved in cholesterol metabolism. Rats treated with vehicle or AT1 antagonist for 3 d received an ip injection of sterile saline or LPS on d 3. The animals were killed 3 h later. Data correspond to relative mRNA levels after normalization to 18S. Values are mean ⫾ SEM for groups of seven to nine animals measured individually and expressed as percentage of correspondent vehicle-saline treated group. For all the genes tested, the vehicle-saline and candesartan-saline groups were not different. *, P ⬍ 0.05 compared with candesartan-saline treated group; one-way ANOVA and post hoc Tukey’s test.

dotoxin treatment (Fig. 8). None of the effects of LPS on NOS isoenzymes was affected by AT1 receptor blockade. LPS receptors

To determine whether LPS could have direct effects on adrenal gland, we studied the gene expression of LPS receptors. The adrenal gland expresses the LPS receptor genes for TLR4 and CD14. LPS treatment significantly decreased TLR4 and, conversely, increased CD14 mRNA expression (Fig. 9). The LPS effects on the gene expression of its own receptors were not affected by the AT1 receptor blocker. Adrenal RAAS

We studied the effects of LPS on adrenal RAAS. We detected the presence of mRNA for all components of the RAAS in the

FIG. 7. Gene expression in adrenal zona glomerulosa. Rats treated with vehicle or AT1 antagonist for 3 d received an ip injection of sterile saline or LPS on d 3. The animals were killed 3 h later. Data correspond to relative mRNA levels after normalization to 18S rRNA. B, Data are expressed as percentage of correspondent vehicle-saline treated group, where for all the genes tested, the vehicle-saline and candesartan-saline groups were not different. Values are mean ⫾ SEM for groups of seven to nine animals measured individually. ***, P ⬍ 0.001 compared with candesartan-treated groups; #, P ⬍ 0.05 compared with vehicle-saline treated group; *, P ⬍ 0.05 compared with candesartan-saline treated group; oneway ANOVA and post hoc Tukey’s test.

adrenal gland, including mRNA expression of renin, angiotensinogen, ACE, and the Ang II receptors AT1A, AT1B, and AT2 (Fig. 10 and Table 2). In situ hybridization revealed AT1A, AT1B, and AT2 receptor mRNA in the adrenal zona glomerulosa, with a predominance of AT1B receptor mRNA (Fig. 10). In the adrenal medulla, we detected only AT1A and AT2 receptor mRNAs, with a clear predominance of AT2 receptor mRNA. Candesartan treatment alone did not modify the expression of angiotensinogen, renin, or ACE mRNAs in the adrenal gland but decreased AT1B receptor mRNA (Fig. 10 and Table 2). We also found that candesartan reduced the number of detectable AT1 receptors in adrenal zona glomerulosa by 60% and AT2 receptors in adrenal medulla by 30% (Table 3). Administration of LPS decreased angiotensinogen and renin mRNA, and increased ACE mRNA (Table 2). LPS treat-

5184



FIG. 8. Adrenal mRNA expression of pro-inflammatory markers. Rats treated with vehicle or AT1 antagonist for 3 d received an ip injection of sterile saline or LPS on d 3. The animals were killed 3 h later. Data correspond to relative mRNA levels after normalization to 18S rRNA. Values are mean ⫾ SEM for groups of seven to nine animals measured individually. **, P ⬍ 0.01 and ***, P ⬍ 0.001 compared with saline-treated groups; #, P ⬍ 0.05 compared with vehicleLPS treated group; one-way ANOVA and post hoc Tukey’s test.

ment significantly decreased AT1B and AT2 receptor mRNA in the adrenal zona glomerulosa, and AT2 receptor mRNA in the adrenal medulla (Fig. 10). Conversely, LPS did not produce significant changes in AT1A receptor mRNA in either the zona glomerulosa or medulla. LPS administration did not change [125I]Sar1-Ang II binding to AT1 or AT2 receptors (Table 3). Pretreatment with candesartan prevented the LPS-induced increase in ACE mRNA in the adrenal gland, without affecting the LPS-induced decreases in angiotensinogen and renin mRNA (Table 2). Similarly, candesartan did not alter the LPS-induced decrease in AT1B, or AT2 receptor mRNA (Fig. 10). In addition, the combined treatment with candesartan and LPS further decreased AT1B gene expression in adrenal cortex (Fig. 10 and Table 2). The decrease in AT1B gene expression induced by candesartan was the result of a mechanism independent of the LPS effect, as evidenced by the two-way ANOVA analysis (F ⫽ 147.7, P ⬍ 0.0001, for LPS effect; F ⫽ 10.6, P ⬍ 0.01 for candesartan effect; and F ⫽ 0.2, P ⬎ 0.05 for interaction of factors). Similar results on AT1B regulation were found using real-time PCR (Table 2).

Discussion

For the present study, we focused on the effects of acute LPS administration and AT1 receptor blockade on the adrenal gland. Our goal was to determine the participation of the adrenal gland on the innate immune response as a conse-

FIG. 9. Adrenal mRNA expression of LPS receptors. Rats treated with vehicle or AT1 antagonist for 3 d received an ip injection of sterile saline or LPS on d 3. The animals were killed 3 h later. Data correspond to relative mRNA levels after normalization to 18S rRNA. Values are mean ⫾ SEM for groups of seven to nine animals measured individually. **, P ⬍ 0.01 and *, P ⬍ 0.05 compared with saline-treated groups; one-way ANOVA and post hoc Tukey’s test.

quence of endotoxin administration, and the role of Ang II AT1 receptors. LPS administration

We report that acute administration of a low dose of LPS produces a generalized inflammatory reaction, with large increases in plasma levels of the inflammatory cytokines TNF-␣ and IL-6, concomitant with HPA axis activation, as determined by enhanced ACTH, corticosterone, and aldosterone release. We found relatively high basal hormone levels in our study. This is probably related to the characteristics of the model used, requiring anesthesia and surgery to perform arterial cannulation, followed by 24 h isolation before LPS administration, and isolation stress has previously increases hormone secretion in rats (9). In any case, the time course and degree of the LPS-induced hormone release in our experiments were comparable to that reported by others (24) This confirms the well-known reciprocal interactions between the immune, endocrine, and neural systems (22, 25, 36). LPS profoundly affected the expression of its own receptors in the adrenal gland, indicating that this organ is a major target for systemically administered endotoxin (26, 29). LPS up-regulated adrenal CD14 mRNA, an effect consistent with the earlier report of enhanced CD14 mRNA expression in cerebral endothelial cells and brain (37). Conversely, LPS down-regulated adrenal TLR4 mRNA, as has been shown in human adrenal cells (26). This indicates a complex regulation, leading to enhancement of LPS effects and cellular com-



5185

FIG. 10. Adrenal mRNA expression of AT1 and AT2 receptors. Rats treated with vehicle or AT1 antagonist for 3 d received an ip injection of sterile saline or LPS on d 3. The animals were killed 3 h later. Graphs on the left represent the quantification of in situ hybridization. Values are means ⫾ SEM for groups of seven to nine animals measured individually. Pictures on the right show representative sections of hybridization on adrenal zona glomerulosa (arrow) and medulla (arrowhead). ***, P ⬍ 0.001 compared with saline-treated groups; #, P ⬍ 0.05 compared with vehicle-saline treated group; one-way ANOVA and post hoc Tukey’s test. Scale bar, 1 mm.

pensatory mechanisms to limit the adrenal response to the endotoxin. LPS significantly increased aldosterone synthesis and release. This was evidenced by enhanced plasma aldosterone concentrations and adrenal aldosterone content, with a parallel enhanced expression of CYP11B2 mRNA and protein. CYP11B2, aldosterone synthase, catalyzes the last two steps in forming aldosterone from 11-deoxycorticosterone (18), the “late” pathway for aldosterone synthesis. In whole adrenal glands, LPS administration increased the gene expression of most of the factors involved in the generation, uptake, and transport of cholesterol, including de novo rate-limiting enzymes, plasma membrane receptors, and transporters, considered critical during the “early” synthetic pathway for steroid synthesis (1, 16, 38). The decrease in SCP-2 mRNA expression is an exception to the LPS-mediated generalized increase in most steps involved in steroid generation. SCP-2 binds and appears to transfer cholesterol to mitochondria (18). However, SCP-2 has been linked to additional cell processes that may enhance or delay steroid hormone synthesis, such as increase in cholesterol uptake or increase of cholesterol esterification, respectively (39). The relevance of SCP-2 modulation in adrenal gland remains to be elucidated. On the other hand, when we studied the isolated adrenal zona glomerulosa, we found that LPS-induced activation of gene expression was limited to the LDL-R, SR-B1, and HMG-CoA-R genes, with no effect on the CEH gene or those genes involved in cholesterol transport. These results indicate that the effects of LPS are different for

the specific zones in the adrenal cortex, suggesting the possibility of selective effects on the synthesis of glucocorticoids and sexual steroids. The characteristics of the in vivo hormonal response to administration of LPS differ from those observed during in vitro studies. In human adrenocortical cells, incubation with LPS produced a slow increase in cortisol release but did not change aldosterone secretion (26). In contrast, in vivo experiments (24) (present results) show a fast and clear release of both corticosterone and aldosterone. These observations indicate that the hormonal response to LPS in vivo may be the consequence of a combination of direct effects in the adrenal gland and indirect effects through HPA axis stimulation. We studied the effect of LPS on the circulating and the local adrenal RAAS. LPS administration did not alter systemic blood pressure, PRA, or kidney expression of renin mRNA. This indicates that at the dose administered, the endotoxin did not significantly influence the activity of the peripheral RAAS. Conversely, LPS profoundly influenced the local adrenal RAAS. The endotoxin produced a major decrease in the mRNA expression of adrenal renin, angiotensinogen, and the AT1B and AT2 receptors. Reduced AT1 and AT2 receptor mRNA expression has been earlier reported after administration of a much larger dose of the endotoxin (29, 30). This suggested that the activity of the local adrenal RAAS may decrease as a consequence of LPS administration. However, we found that LPS did not change AT1 and AT2 receptor binding 3 h after endotoxin administration. Thus, LPS may not decrease adrenal RAAS activity when injected acutely,

5186



TABLE 2. Adrenal renin-Ang II system mRNA expression measured by real-time PCR

Renin Angiotensinogen ACE AT1B

Vehicle-saline

Candesartan-saline

Vehicle-LPS

Candesartan-LPS

1.39 ⫾ 0.09 1.55 ⫾ 0.11 1.19 ⫾ 0.04 2.26 ⫾ 0.13

1.49 ⫾ 0.17 1.68 ⫾ 0.06 1.30 ⫾ 0.03 1.84 ⫾ 0.12c

0.96 ⫾ 0.09a 1.24 ⫾ 0.09a 1.53 ⫾ 0.06b 0.81 ⫾ 0.14a

1.0 ⫾ 0.11a 1.17 ⫾ 0.07a 1.18 ⫾ 0.08 0.47 ⫾ 0.06a,c

Rats treated with vehicle or AT1 antagonist for 3 d received an ip injection of sterile saline or LPS on d 3. The animals were killed 3 h later. Data correspond to relative mRNA levels after normalization to 18S rRNA. Values are mean ⫾ SEM for groups of seven to nine animals measured individually. a P ⬍ 0.05 as compared with saline-treated groups. b P ⬍ 0.05 as compared with the rest of the groups. c P ⬍ 0.05 as compared with correspondent vehicle group; one-way ANOVA and post hoc Tukey’s test.

and the down-regulation of adrenal RAAS gene expression may represent a later stage, physiologically important negative feedback directed to avoid a harmful excess in aldosterone release (15). Because adrenal Ang II receptors are exposed to circulating as well as locally formed Ang II, our study does not clarify the relative participation of the hormonal and local RAAS in the acute response to endotoxin administration. The mechanisms of adrenal Ang II receptor down-regulation by LPS are not clear. It is possible that enhanced LPS-mediated ACTH participate because ACTH administration down-regulates adrenal AT1 and AT2 receptor mRNA (40), and adrenal Ang II receptor down-regulation occurs in other models of stress (41). In addition, LPS-mediated Ang II receptor down-regulation may be the result of enhanced IL-1␤ or TNF-␣, effects mediated through a nitric oxide pathway (30). In addition to its effects on AT1 receptors, LPS administration decreased AT2 receptor mRNA, and AT1 blockade reduced AT2 binding. These results may indicate that AT2 receptors participate in the adrenal effects of LPS, and support the proposal of an interaction between the AT1 and AT2 receptor types in adrenal function (42). LPS and AT1 receptor blockade

The close relationship between the effects of LPS and RAAS activity is demonstrated by the major influence of AT1 receptor blockade reported here. We chose to treat the animals with candesartan, a potent ARB that efficiently blocks peripheral AT1 receptors (43). Previously, we showed that 2 wk candesartan pretreatment, blocking peripheral and central AT1 receptors, decreased the HPA response to isolation stress (9, 10, 41, 44). We found that a 3-d candesartan pretreatment decreased systolic blood pressure and produced a major increase in PRA and kidney renin mRNA, demon-

strating effective AT1 receptor blockade. LPS, whereas not altering kidney renin mRNA or PRA when administered alone, significantly blunted the candesartan-induced increase in these parameters. The relevance of this effect in our model is probably limited because candesartan effectively blocked AT1 receptors. In the adrenal gland, we demonstrated that candesartan pretreatment significantly reduced the LPS-stimulated aldosterone synthesis and release by preventing CYP11B2 stimulation. In addition, administration of candesartan to rats not injected with LPS significantly decreased CYP11B2 mRNA expression. This indicates that the steady-state formation of aldosterone is under the control of AT1 receptor activation. Our observations are in line with the well-known role of Ang II in aldosterone formation and release (16 –18). Conversely, candesartan did not alter the effects of LPS on the early pathway in aldosterone synthesis, indicating that the role of AT1 receptors is confined to the late pathway. AT1 blockade enhanced the early ACTH release and delayed but did not reduce the increase in corticosterone secretion. The lack of correlation in the ACTH-corticosterone response after stress has been previously observed. For example, water deprivation decreases the ACTH response to immobilization with no effect on corticosterone levels (45), and repeated daily LPS administration for 2 wk increased the ACTH response to immobilization but decreased corticosterone release (24). This apparent contradiction may be the result of complex interactions between ACTH and Ang II effects on the adrenal gland (24, 45–50). For example, Ang II may regulate corticosterone release directly in the zona fasciculata through stimulation of the small numbers of AT1 receptors present in this zone (51). Because the LPS-induced ACTH release is not prevented by candesartan, it is possible that the residual aldosterone release observed after ARB administration is a consequence of ACTH stimulation (1, 16, 49).

TABLE 3. Quantitative autoradiography of Ang II receptors in adrenal gland

Zona glomerulosa AT1 AT2 Medulla AT1 AT2

Vehicle-saline

Candesartan-saline

Vehicle-LPS

Candesartan-LPS

214 ⫾ 15 135 ⫾ 9

83 ⫾ 11a 125 ⫾ 15

258 ⫾ 17 113 ⫾ 10

85 ⫾ 9a 92 ⫾ 11

ND 480 ⫾ 26

ND 365 ⫾ 14a

ND 485 ⫾ 20

ND 320 ⫾ 27a

Rats treated with vehicle or AT1 antagonist for 3 d received an ip injection of sterile saline or LPS on d 3. The animals were killed 3 h later. Values are mean ⫾ SEM for groups of seven to nine animals measured individually and are expressed as fmol/mg protein. ND, Nondetectable. a P ⬍ 0.001, as compared with vehicle-treated groups; one-way ANOVA and post hoc Tukey’s test.


Candesartan treatment significantly reduced the innate immune response produced by acute endotoxin administration. This was evidenced by the substantial decrease in the release of the LPS-stimulated pro-inflammatory cytokines TNF-␣ and IL-6 into the general circulation. This effect was probably the result of receptor blockade in macrophages located in multiple organs responding to the immune challenge (19). The local inflammatory effects of LPS in the adrenal gland are partially dependent on AT1 receptor stimulation, as revealed by the reduction of the LPS-induced COX-2 and IL-6 expression by candesartan. Other inflammatory markers regulated by LPS, such as TNF-␣, were not influenced by the ARB. This indicates the existence of additional regulatory pathways controlling the adrenal inflammatory effects of the endotoxin. Adenosine and dopamine may be among these regulators (52, 53). The ARB-mediated decrease in aldosterone release may also be considered an important antiinflammatory effect because aldosterone is a well-known proinflammatory hormone (1, 14, 15). Although our study demonstrates important antiinflammatory effects of the ARB under acute conditions, the relevance of this treatment during chronic ARB treatment has not been determined. Prolonged therapy with ARBs is frequently associated with aldosterone breakthrough, a phenomenon of increased aldosterone release no longer under AT1 receptor control (54). The effects of prolonged treatment with ARBs on chronic LPS-induced aldosterone synthesis and release remain to be determined. Other bacterial factors involved in adrenal inflammatory stress include the unmethylated cytosine-phosphate-guanine dinucleotides (CpG-DNAs) in bacterial DNA (55). CpG motifs are detected by TLR9, receptors expressed in adrenal glands, spleen, kidney, liver, lung, and brain, among others. TLR9 is not required for LPS-induced nuclear factor-␬B activation and cytokine secretion (56). Whether the ARBs affect the innate immune response started by TLR-9 through bacterial CpG-DNA remains to be tested. Inflammation stress

ARBs reduce the peripheral and cerebrovascular inflammation associated with hypertension (12, 13). Our results suggest that the antiinflammatory effects of ARBs are not restricted to cardiovascular disease but may extend to acute bacterial endotoxin-induced disease. The acute antiinflammatory properties of ARBs have been also demonstrated in the cold-restraint stress model, in which a reduction of inflammation to the gastric mucosa participates in the prevention of gastric ulcerations (41). Our results confirm the hypothesis of a major role of AT1 receptors in stress. The effects of ARBs are dependent on the stress model studied. Stress stimuli can represent anticipated reactions to a possible threat, with no loss of homeostasis, or responses to real threats when homeostasis is lost (57). During isolation stress, an anticipated reaction, ARBs fully prevent the central and peripheral sympathetic and the HPA axis activation (9, 10). When rats are submitted to cold-restraint (41) or LPS stress, in which homeostasis is lost, HPA axis stimulation is not decreased by ARBs. During cold re-


5187

straint, the strong antiinflammatory effects of enhanced glucocorticoid release are necessary to protect from life-threatening gastric ulcerations (41). During endotoxin stress, glucocorticoid release plays a similar protective, antiinflammatory role (58). Stimulation of glucocorticoid release during cold restraint and LPS helps to maintain homeostasis. Thus, the lack of effects of ARBs on glucocorticoid release during these conditions can be considered therapeutic and protective. Conclusions

We demonstrate here that acute administration of LPS, in addition to producing a generalized inflammatory response, has both direct and indirect effects on the adrenal gland, including a profound influence on the local RAAS. Some of the effects of the endotoxin are dependent on AT1 receptor activation, as demonstrated by their blockade with the ARB candesartan. AT1 receptor blockade limits the LPS-induced release of pro-inflammatory cytokines to the circulation, the adrenal release of the pro-inflammatory hormone aldosterone, and COX-2 and IL-6 gene expression in the adrenal gland, without changes in the antiinflammatory corticosterone response. An unrestricted innate immune response to the bacterial endotoxin may have deleterious effects for the organism and may lead to the development of chronic inflammatory disease or even multiple organ failure (20, 21). For these reasons, we postulate that the ARBs, in addition to their blood pressure lowering activity, may have therapeutic effects on inflammatory conditions. Acknowledgments Received February 20, 2008. Accepted June 4, 2008. Address all correspondence and requests for reprints to: Enrique Sanchez-Lemus, Section on Pharmacology, Division of Intramural Research Programs, National Institute of Mental Health, National Institutes of Health, Department of Health and Human Services, 10 Center Drive, MSC 1514, Building, 10, Room 2D57, Bethesda, Maryland 20892. E-mail: [email protected]. This study was supported by the Division of Intramural Research Programs, National Institute of Mental Health, National Institutes of Health, Department of Health and Human Services. Disclosure Statement: The authors have nothing to disclose.

References 1. Williams GH 2005 Aldosterone biosynthesis, regulation, and classical mechanism of action. Heart Fail Rev 10:7–13 2. Inagami T, Guo DF, Kitami Y 1994 Molecular biology of angiotensin II receptors: an overview. J Hypertens Suppl 12:S83–S94 3. Saavedra JM 1999 Emerging features of brain angiotensin receptors. Regul Pept 85:31– 45 4. de Gasparo M, Catt KJ, Inagami T, Wright JW, Unger T 2000 International union of pharmacology. XXIII. The angiotensin II receptors. Pharmacol Rev 52:415– 472 5. Saavedra JM, Benicky J 2007 Brain and peripheral angiotensin II play a major role in stress. Stress 10:185–193 6. Tsutsumi K, Saavedra JM 1991 Characterization and development of angiotensin II receptor subtypes (AT1 and AT2) in rat brain. Am J Physiol 261(1 Pt 2):R209 –R216 7. Johren O, Inagami T, Saavedra JM 1995 AT1A, AT1B, and AT2 angiotensin II receptor subtype gene expression in rat brain. Neuroreport 6:2549 –2552 8. Israel A, Stromberg C, Tsutsumi K, Garrido MR, Torres M, Saavedra JM 1995 Angiotensin II receptor subtypes and phosphoinositide hydrolysis in rat adrenal medulla. Brain Res Bull 38:441– 446 9. Armando I, Carranza A, Nishimura Y, Hoe KL, Barontini M, Terron JA, Falcon-Neri A, Ito T, Juorio AV, Saavedra JM 2001 Peripheral administration of an angiotensin II AT(1) receptor antagonist decreases the hypothalamicpituitary-adrenal response to isolation stress. Endocrinology 142:3880 –3889

5188


10. Saavedra JM, Armando I, Bregonzio C, Juorio A, Macova M, Pavel J, Sanchez-Lemus E 2006 A centrally acting, anxiolytic angiotensin II AT1 receptor antagonist prevents the isolation stress-induced decrease in cortical CRF1 receptor and benzodiazepine binding. Neuropsychopharmacology 31: 1123–1134 11. Zhou J, Ando H, Macova M, Dou J, Saavedra JM 2005 Angiotensin II AT1 receptor blockade abolishes brain microvascular inflammation and heat shock protein responses in hypertensive rats. J Cereb Blood Flow Metab 25:878 – 886 12. Ando H, Zhou J, Macova M, Imboden H, Saavedra JM 2004 Angiotensin II AT1 receptor blockade reverses pathological hypertrophy and inflammation in brain microvessels of spontaneously hypertensive rats. Stroke 35:1726 –1731 13. Savoia C, Schiffrin EL 2006 Inflammation in hypertension. Curr Opin Nephrol Hypertens 15:152–158 14. Intengan HD, Schiffrin EL 2001 Vascular remodeling in hypertension: roles of apoptosis, inflammation, and fibrosis. Hypertension 38:581–587 15. Joffe HV, Adler GK 2005 Effect of aldosterone and mineralocorticoid receptor blockade on vascular inflammation. Heart Fail Rev 10:31–37 16. Connell JM, Davies E 2005 The new biology of aldosterone. J Endocrinol 186:1–20 17. Mulrow PJ 1999 Angiotensin II and aldosterone regulation. Regul Pept 80: 27–32 18. Capponi AM 2004 The control by angiotensin II of cholesterol supply for aldosterone biosynthesis. Mol Cell Endocrinol 217:113–118 19. Rivest S 2003 Molecular insights on the cerebral innate immune system. Brain Behav Immun 17:13–19 20. Bosshart H, Heinzelmann M 2007 Targeting bacterial endotoxin: two sides of a coin. Ann NY Acad Sci 1096:1–17 21. Han J, Ulevitch RJ 2005 Limiting inflammatory responses during activation of innate immunity. Nat Immunol 6:1198 –1205 22. Beishuizen A, Thijs LG 2004 The immunoneuroendocrine axis in critical illness: beneficial adaptation or neuroendocrine exhaustion? Curr Opin Crit Care 10:461– 467 23. Hopkins SJ 2007 Central nervous system recognition of peripheral inflammation: a neural, hormonal collaboration. Acta Biomed 78(Suppl 1):231–247 24. Grinevich V, Ma XM, Herman JP, Jezova D, Akmayev I, Aguilera G 2001 Effect of repeated lipopolysaccharide administration on tissue cytokine expression and hypothalamic-pituitary-adrenal axis activity in rats. J Neuroendocrinol 13:711–723 25. Moncek F, Aguilera G, Jezova D 2003 Insufficient activation of adrenocortical but not adrenomedullary hormones during stress in rats subjected to repeated immune challenge. J Neuroimmunol 142:86 –92 26. Vakharia K, Hinson JP 2005 Lipopolysaccharide directly stimulates cortisol secretion by human adrenal cells by a cyclooxygenase-dependent mechanism. Endocrinology 146:1398 –1402 27. Nishimura M, Naito S 2005 Tissue-specific mRNA expression profiles of human toll-like receptors and related genes. Biol Pharm Bull 28:886 – 892 28. Ichitani Y, Holmberg K, Maunsbach AB, Haeggstrom JZ, Samuelsson B, De Witt D, Hokfelt T 2001 Cyclooxygenase-1 and cyclooxygenase-2 expression in rat kidney and adrenal gland after stimulation with systemic lipopolysaccharide: in situ hybridization and immunocytochemical studies. Cell Tissue Res 303:235–252 29. Cover PO, Slater D, Buckingham JC 2001 Expression of cyclooxygenase enzymes in rat hypothalamo-pituitary-adrenal axis: effects of endotoxin and glucocorticoids. Endocrine 16:123–131 30. Bucher M, Ittner KP, Hobbhahn J, Taeger K, Kurtz A 2001 Downregulation of angiotensin II type 1 receptors during sepsis. Hypertension 38:177–182 31. Bucher M, Hobbhahn J, Kurtz A 2001 Nitric oxide-dependent down-regulation of angiotensin II type 2 receptors during experimental sepsis. Crit Care Med 29:1750 –1755 32. Chiueh CC, Kopin IJ 1978 Hyperresponsivitiy of spontaneously hypertensive rat to indirect measurement of blood pressure. Am J Physiol 234:H690 –H695 33. Konarska M, Stewart RE, McCarty R 1990 Habituation and sensitization of plasma catecholamine responses to chronic intermittent stress: effects of stressor intensity. Physiol Behav 47:647– 652 34. Yamakawa H, Jezova M, Ando H, Saavedra JM 2003 Normalization of endothelial and inducible nitric oxide synthase expression in brain microvessels of spontaneously hypertensive rats by angiotensin II AT1 receptor inhibition. J Cereb Blood Flow Metab 23:371–380 35. Miller JA 1991 The calibration of 35S or 32P with 14C-labeled brain paste or 14C-plastic standards for quantitative autoradiography using LKB Ultrofilm or Amersham Hyperfilm. Neurosci Lett 121:211–214 36. Besedovsky HO, del Rey A 1996 Immune-neuro-endocrine interactions: facts and hypotheses. Endocr Rev 17:64 –102


37. Singh AK, Jiang Y 2004 How does peripheral lipopolysaccharide induce gene expression in the brain of rats? Toxicology 201:197–207 38. Foster RH, MacFarlane CH, Bustamante MO 1997 Recent progress in understanding aldosterone secretion. Gen Pharmacol 28:647– 651 39. Schroeder F, Atshaves BP, McIntosh AL, Gallegos AM, Storey SM, Parr RD, Jefferson JR, Ball JM, Kier AB 2007 Sterol carrier protein-2: new roles in regulating lipid rafts and signaling. Biochim Biophys Acta 1771:700 –718 40. Kitamura Y, Sasamura H, Nakaya H, Maruyama T, Hayashi M, Saruta T 1998 Effects of ACTH on adrenal angiotensin II receptor subtype expression in vivo. Mol Cell Endocrinol 146:187–195 41. Bregonzio C, Armando I, Ando H, Jezova M, Baiardi G, Saavedra JM 2003 Anti-inflammatory effects of angiotensin II AT1 receptor antagonism prevent stress-induced gastric injury. Am J Physiol Gastrointest Liver Physiol 285: G414 –G423 42. Jezova M, Armando I, Bregonzio C, Yu ZX, Qian S, Ferrans VJ, Imboden H, Saavedra JM 2003 Angiotensin II AT(1) and AT(2) receptors contribute to maintain basal adrenomedullary norepinephrine synthesis and tyrosine hydroxylase transcription. Endocrinology 144:2092–2101 43. Fabiani ME, Dinh DT, Nassis L, Casley DJ, Johnston CI 2000 In vivo inhibition of angiotensin receptors in the rat kidney by candesartan cilexetil: a comparison with losartan. Am J Hypertens 13:1005–1013 44. Nishimura Y, Ito T, Hoe K, Saavedra JM 2000 Chronic peripheral administration of the angiotensin II AT(1) receptor antagonist candesartan blocks brain AT(1) receptors. Brain Res 871:29 –38 45. Aguilera G, Lightman SL, Kiss A 1993 Regulation of the hypothalamicpituitary-adrenal axis during water deprivation. Endocrinology 132:241–248 46. Aubry JM, Turnbull AV, Pozzoli G, Rivier C, Vale W 1997 Endotoxin decreases corticotropin-releasing factor receptor 1 messenger ribonucleic acid levels in the rat pituitary. Endocrinology 138:1621–1626 47. Ulrich-Lai YM, Engeland WC 2002 Adrenal splanchnic innervation modulates adrenal cortical responses to dehydration stress in rats. Neuroendocrinology 76:79 –92 48. Ulrich-Lai YM, Arnhold MM, Engeland WC 2006 Adrenal splanchnic innervation contributes to the diurnal rhythm of plasma corticosterone in rats by modulating adrenal sensitivity to ACTH. Am J Physiol Regul Integr Comp Physiol 290:R1128 –R1135 49. Enriquez de Salamanca A, Garcia R 2003 Rat glomerulosa cells in primary culture and E. coli lipopolysaccharide action. J Steroid Biochem Mol Biol 85:81– 88 50. Zacharowski K, Zacharowski PA, Koch A, Baban A, Tran N, Berkels R, Papewalis C, Schulze-Osthoff K, Knuefermann P, Zahringer U, Schumann RR, Rettori V, McCann SM, Bornstein SR 2006 Toll-like receptor 4 plays a crucial role in the immune-adrenal response to systemic inflammatory response syndrome. Proc Natl Acad Sci USA 103:6392– 6397 51. Spinedi E, Aguado L, Basilotta G, Carrizo D 1989 Angiotensin II and glucocorticoid release: direct effect at the adrenal level and modulation of the adrenocorticotropin-induced glucocorticoid release. J Endocrinol Invest 12: 321–327 52. Ritchie PK, Spangelo BL, Krzymowski DK, Rossiter TB, Kurth E, Judd AM 1997 Adenosine increases interleukin 6 release and decreases tumour necrosis factor release from rat adrenal zona glomerulosa cells, ovarian cells, anterior pituitary cells, and peritoneal macrophages. Cytokine 9:187–198 53. Ritchie PK, Ashby M, Knight HH, Judd AM 1996 Dopamine increases interleukin 6 release and inhibits tumor necrosis factor release from rat adrenal zona glomerulosa cells in vitro. Eur J Endocrinol 134:610 – 616 54. Bomback AS, Klemmer PJ 2007 The incidence and implications of aldosterone breakthrough. Nat Clin Pract Nephrol 3:486 – 492 55. Tran N, Koch A, Berkels R, Boehm O, Zacharowski PA, Baumgarten G, Knuefermann P, Schott M, Kanczkowski W, Bornstein SR, Lightman SL, Zacharowski K 2007 Toll-like receptor 9 expression in murine and human adrenal glands and possible implications during inflammation. J Clin Endocrinol Metab 92:2773–2783 56. Hemmi H, Takeuchi O, Kawai T, Kaisho T, Sato S, Sanjo H, Matsumoto M, Hoshino K, Wagner H, Takeda K, Akira S 2000 A Toll-like receptor recognizes bacterial DNA. Nature 408:740 –745 57. Herman JP, Figueiredo H, Mueller NK, Ulrich-Lai Y, Ostrander MM, Choi DC, Cullinan WE 2003 Central mechanisms of stress integration: hierarchical circuitry controlling hypothalamo-pituitary-adrenocortical responsiveness. Front Neuroendocrinol 24:151–180 58. Rhen T, Cidlowski JA 2005 Antiinflammatory action of glucocorticoids–new mechanisms for old drugs. N Engl J Med 353:1711–1723

Endocrinology is published monthly by The Endocrine Society (http://www.endo-society.org), the foremost professional society serving the endocrine community.