Antisense lnhibition of the Photosystem I Antenna Protein ... - NCBI

Plant Physiol. (1997) 115: 1525-1 531

Antisense lnhibition of the Photosystem I Antenna Protein Lhca4 in Arabidopsis thaliana’ Hong Zhang*, Howard M. Goodman, and Stefan Jansson Department of Biological Sciences, Texas Tech University, Lubbock, Texas 79409 (H.Z.); Department of Genetics, Harvard Medical School, and Department of Molecular Biology, Massachusetts General Hospital, Boston, Massachusetts 021 14 (H.M.G.); and Department of Plant Physiology, University of Umea, 901 87 Umea, Sweden (S.J.)

The function of Lhca4, a gene encoding the photosystem I type I V chlorophyll ahbinding protein complex in Arabidopsis, was investigated using antisense technology. Lhca4 protein was reduced in a number of mutant lines and abolished in one. The inhibition of protein was not correlated with the inhibition of mRNA. No depletion of Lhcal was observed, but the low-temperature fluorescence emission spectrum was drastically altered in the mutants. The emission maximum was blue-shifted by 6 nm, showing that chlorophyll molecules bound to Lhca4 are responsible for most of the longwavelength fluorescence emission. Some mutants also showed an unexplainable delay in flowering time and an increase in seed weight.

The LHC proteins serve as antennas to capture light energy and deliver it to the photosystem reaction centers of thylakoid membranes in green plants (Anderson, 1986). They are encoded by the nuclear Lkc genes, synthesized in the cytosol, and posttranslationally taken up by chloroplasts. More than 100 Lkc genes have been isolated from various spermatophytes (Jansson et al., 1992), and they can be grouped into 10 different classes, corresponding to 10 different LHC proteins. The genes Lkcal to Lkca4 encode LHC I proteins associated with PSI, the genes Lkcb3 to Lkcb6 encode proteins associated with PSII, and the genes Lkcbl and Lhcb2 encode proteins that serve as peripheral antenna (commonly called LHC 11) to both photosystems (Jansson, 1994). The ancestor of the LHC proteins seems to be a small one-helix protein (HLIP, for High-Light Induced Protein), which is induced under high-light conditions in cyanobacteria (Dolganov et al., 1995). Homologous proteins are found in a11 photosynthetic eukaryotes, and the 10 types of LHC proteins that are found in recent higher plants (angiosperms and gymnosperms) appear to have evolved more than 350 million years ago and to date have been highly conserved (Janssonand Gustafsson, 1991).This implies that a11 10 must have a specific function in the

* This work was supported by a grant from Hoechst AG (Frankfurt, Germany) to H.M.G. and by the Swedish Forestry and Agricultural Research Council to S.J. * Corresponding author; e-mail brahz8ttacs.ttu.edu; fax 1-806742-2963.

light-harvesting antenna, but not very much is known about these specific functions. The four Lhca proteins are of similar size (20-24 kD) and bind, in addition to Chl a and Chl b, lutein, violaxanthin, and p-carotene. Violaxanthin can be photoconverted into antheraxanthin and zeaxanthin, probably increasing the rate of radiationless energy dissipation under conditions of excess light. This process, one component of the so-called nonphotochemical quenching of Chl a fluorescence, is also one of the functions of the LHC proteins. The Lhca proteins seem to be present in dimers (Jansson et al., 1996), but to study their specific functions using a biochemical approach is not an easy task. PSI particles containing a11 four Lhca proteins have been prepared from various species (Ikeuchi et al., 1991; Knoetzel et al., 1992; Tjus et al., 1995),but there exists no protocol by which some of them can be selectively extracted from the complex. In fact, a11 procedures used to solubilize the Lhca proteins from the PSI core result in a major loss of pigment, indicating that the pigment-protein interactions often are weaker than the protein-protein interactions. As a consequence, the pigment composition of the Lhca proteins has only been estimated. It was noted early that LHC I could be subfractionated into two pools: one showing a fluorescence emission maximum at 730 nm (LHCI-730) and the other (LHCI-680) at 680 nm (Haworth et al., 1983; Lam et al., 1984). Later it was found that Lhcal and Lhca4 corresponded to LHCI-730 and Lhca2 and Lhca3 corresponded to LHCI-680 (Ikeuchi et al., 1991; Knoetzel et al., 1992). More recent studies have indicated that LHCI680 and LHCI-730 might not be true functional units. Biochemical and genetic studies have shown that Lhca2 and Lhca3 seem not to be intimately associated with each other (Knoetzel et al., 1992; Tjus et al., 1995; Janson et al., 1996), and the same is the case for Lhcal and Lhca4 (Bossmann et al., 1997; Jansson et al., 1997). Thus, it seems that LHC I dimers independently associate with PSI. When the specific functions of a given polypeptide are to be studied, genetics provides a powerful tool. If a mutant lacking one specific LHC protein could be isolated, comparative studies between mutant and wild-type plants would answer most questions concerning any unique role Abbreviations: Chl, chlorophyll; LHC, light-harvesting Chl a/b-binding protein complex. 1525

1526

Zhang et al.

of this protein in light-capture and energy dissipation. Mutants can be isolated either by screening of a large number of randomly mutagenized plants or by construction of specific mutants. Because of difficulties in predicting the phenotype of mutants, screening of randomly mutagenized populations is not easy to perform. Mutants deficient in Chl b (and, as a consequence, depletion of LHC proteins) have been isolated from various species, but every detailed study of the LHC protein composition of such plants has shown that the mutations were pleiotropic and resulted in depletion of severa1 LHC proteins (Kr61 et al., 1995; Falbel et al., 1996; Bossmann et al., 1997). In prokaryotic organisms such as cyanobacteria, homologous recombination is efficient, and nu11 mutants can be relatively easily obtained by gene replacement. This technique has been used extensively, e.g. in studies of the PSI core proteins (Chitnis, 1996), but it cannot be applied to higher plants. Instead, the antisense approach has been widely used in reverse-genetic studies of higher plants. However, this technique has some drawbacks: the degree of inhibition is quite variable, and sometimes the mRNA level can be severely reduced without affecting the protein level. For example, Flachmann and Kiihlbrandt (1995)were able to reduce the mRNA level of tobacco (Nicotiana tabacum L.) Lhcbl to more than 95%, and yet the amount of Lhcbl protein was not affected. We wanted to test whether the levels of LHC proteins could be reduced with antisense technology in Arabidopsis thaliana. Ten of the LHC genes from A. thaliana have previously been isolated (Leutwiler et al., 1986; Zhang et al., 1991; Jensen et al., 1992; McGrath et al., 1992; Green and Pichersky, 1993; Wang et al., 1994; Zhang et al., 1994),and cDNAs representing the remaining nine genes have recently been obtained (S. Jansson, unpublished data), making A. thaliana the first plant species in which the Lhc supergene family has been fully characterized. Since Lhca4 is a single-copy gene in Arabidopsis (Zhang et al., 1994), it might be a good target for antisense gene-repression studies. Here we present the initial characterization of transgenic plants in which the expression of Lhca4 is down-regulated.

MATERIALS AND METHODS Plant Crowth Conditions

Plants were grown in a greenhouse at 22°C for 4 weeks and then were harvested at 3 PM for DNA and RNA preparation. Both wild-type and transgenic plants were harvested at the same time to avoid the potential effect of circadian rhythm regulation on the expression of the Lhca4 gene. Plants used for analysis of flowering timing were grown in a growth chamber that was set for 16 h of light and 8 h of darkness, with a PPFD of 120 pmol m-’ s-’. For thylakoid protein preparations and 77 K fluorescence emission analysis, plants were grown in a growth chamber in 8 h of light with a PPFD of approximately 100 pmol m-’

Plant Physiol. Vol. 11 5, 1997

s-l (23°C) and 16 h of darkness (18°C) to prolong the vegetative phase.

Vector Construction and Arabidopsis Transformation

The binary vector pBIN121 (Jefferson et al., 1987) was digested with XbaI and SstI, and the GUS gene sequence was replaced with the antisense sequence of Lhca4 (Zhang et al., 1991) to which XbaI and SstI restriction sites were included at the ends, and then wild-type Arabidopsis plants (ecotype C24) were transformed with the construct, according to the protocol of Valvekens et al. (1988). The sequences of the two oligonucleotides used in subcloning the antisense Lhca4 into the vector are as follows: oPB-1, GAAGAGCTCATCCATTCTTCTTCAAGTGC; and oPB-2, CTCTCTGAGAGAGTACAACAATGTTGATT.

DNA and RNA Manipulations

Genomic DNA was prepared according to the method of Dellaporta et al. (1983), and total RNA was isolated according to the method of Chomczynski and Sacchi (1987). Both DNA and RNA were separated by electrophoresis (5 and 10 pg/lane, respectively), blotted to Biotrans nylon membranes (ICN Biomedicals, Aurora, OH), and hybridized to corresponding probes. Hybridization was carried out according to the method of Church and Gilbert (1984) using probes labeled by random priming (for DNA-blot analysis) and the PCR method (for RNA-blot analysis). The Lhca4 transcript-specific probe used in the RNA-blot analysis was made as follows: the Lhca4 cDNA (Zhang et al., 1991) in pBluescript was linearized with restriction enzyme SmaI (5’ to the cDNA insert), and then the linearized plasmid was used as a template for single-stranded DNA biosynthesis using an antisense oligonucleotide, pBR-2R, as the primer. The reaction conditions were similar to PCR conditions, i.e. 94°C for 1 min, 46°C for 1 min, and 72°C for 2 min for 50 cycles, but with only one primer and [cx-~’P]~ATP (100 pCi) instead of cold dATP in the reaction mixture. Washing conditions were as follows: two times (for 10 min each) in 0.5% BSA, 1 mM EDTA, 40 mM NaHPO, (pH 7.2), and 5% SDS at 64”C, and then four times (for 5 min each) in 1 mM EDTA, 40 mM NaHPO, (pH 7.2), and 1%SDS at 64°C. The antisense oligonucleotide pBR-2R corresponds to nucleotides 558 to 540 of the Lhca4 cDNA clones (Zhang et al., 1991); therefore, it would initiate a DNA fragment of about 560 bp that binds to the 5’ side of the Lhca4 transcript. The sequence of pBR-2R is TTCTTGATGTCTTGCCAC. The Arabidopsis gene encoding the 18s RNA, isolated in the laboratory of H.M. Goodman (unpublished data), was used as the interna1 standard for RNA-blot analysis.

Thylakoid Protein Preparation and Quantitative lmmunoblotting

Arabidopsis leaves were homogenized in a buffer consisting of 10 mM KHPO,, 5 mM MgCl,, and 330 mM sorbitol, filtered, and centrifuged. The pellet was washed in the

1527

Antisense inhibition of Lhca4 in Arabidopsis thaliana

same medium, pelleted, and subsequently washed three times in 10 mM Tricine (pH 7.5), 5 mM MgCl2/ and 50 rr\M sorbitol. Chl a and b were quantified according to the method of Porra et al. (1989). Quantitative immunoblotting was performed according to the method of Jansson et al. (1997). Antibodies specific for Lhca4 and Lhcal (Kr61 et al., 1995) were used to detect the corresponding proteins.

Table I. Segregation data of some T, generation seeds on kanamycin plates WT, wild type. Plants3 WT 7

22 23

Fluorescence Spectrum Measurement

The fluorescence spectrum (77 K) was recorded for intact leaves using a trifurcated fiberglass-centered fluorescence spectrometer, as described by Ogren and Oquist (1984). The excitation light had the wavelength of 436 nm, and no correction was made for light source or photomultiplier response. Leaves were dark adapted for 5 min before measurement.

RESULTS Construction of Lhca4 Antisense Plants

We used the cDNA sequence from nucleotides -60 to +946 of Lhca4 for the construction of the antisense vector in Agrobacterium (Fig. 1). Wild-type Arabidopsis plants (ecotype C24) were used as hosts for Agrobacterium infection, and a total of 68 transgenic lines were produced. The original 68 independently transformed lines (the T0 generation) were selfed and produced Tl progeny that were plated on kanamycin plates for segregation analyses. Segregation data of some transgenic lines are shown in Table I. Plants with multiple T-DNA insertions tend to display phenotypes with a causal relationship to the introduced antisense transgenes (Zhang et al., 1992). We therefore focused our study on four lines with multiple T-DNA insertions (22, 24, 65, and 71), as well as two lines with one T-DNA insertion (7 and 23). One individual from each of the lines 7, 23, 24, 65, and 71 was chosen and kept as an individual line for subsequent analyses. No effort was made to isolate one of the progeny from the original transgenic line 22, even though the segregation data indicated that it might contain multiple T-DNA insertions. Line 22 was buck-harvested every generation and treated as an individual line. The genomic DNAs were isolated from wild-type and transgenic plants of the T2 generation and then analyzed by Southern analysis. Digestion with the enzyme Dral gave a RB

Antisense Lhca4 (-60 to +946) Ij? —| CaMV 35S Promoter

Dra I

Xba I

Km + 0

23 44

24 65

58 31 21

71

29

Km -

Km +/Km -

80 7

0 3.3

0 19 0 0 0

T-DNA Insertion11

0

1 (P > 0.05) 3 (P > 0.1) 1 (P > 0.5)

3.1

3 (P > 0.1) 2 (P > 0.1) 3 (P>0.1)

a

The original transformants were designated as the T0 generation b plants. The T-DNA insertion number was predicted based on the segregation data.

single band of about 2.5 kb in wild-type DNA when probed with a Lhca4 cDNA (Fig. 2), suggesting that Dral does not cut within the structural part of the Lhca4 gene. However, Dral does cut once near the right border of the T-DNA sequence (Fig. 1); a band additional to the endogenous Lhca4 band would indicate an insertion event in the transgenic plants. As can be seen from Figure 2, transgenic line 7 showed two extra bands, even though the segregation data indicated that it might result from a single T-DNAinsertion event. The explanation could be due to a tandem duplication of T-DNA following T-DNA transfer, because the size of the middle band corresponds approximately to the size of one T-DNA sequence from border to border (about 5.2 kb). Line 22 showed two extra bands with one band significantly weaker than the other. This might be due to the fact that the DNA was isolated from a small number of plants in which one chromosome with a T-DNA insertion was segregating away. Line 23 contained just one copy of T-DNA, as predicted from the segregation data. Line 24 also contained one copy of T-DNA, even though the original transformant might contain more. As expected, lines 65 and 71 contained more than one T-DNA insertion.

r- cs tN

9.4 — 6.6 — 4.4 —

»«

U1

vo

•—I

i—

*

LB

^jNOS-ter

SstI

Figure 1. Construction of Lhca4 antisense vector used to transform Arabidopsis. The drawing is not to scale. RB and LB are the right and left border sequences, respectively, of the Ti plasmid from Agrobacterium, and NOS-ter is the terminator sequence from the nopaline synthase gene (Jefferson et al., 1987). CaMV, Cauliflower mosaic

2.3 — 2.0 —

Figure 2. DNA gel-blot analysis of wild-type (WT) and anti-Lhca4 transgenic (T2 generation) plants. The DNA was cut with Dral and probed with an Lhca4 cDNA clone. H/ndlll-digested A DNA length markers are given at left in kilobases.

1528

Zhang et al.

r— es

Plant Physiol. Vol. 115, 1997

which was present at approximately wild-type levels (Fig. 4).

cs

— Lhca4

Absence of Lhca4 Had a Drastic Effect on the Low-

Temperature Fluorescence Emission

— 18sRNA Figure 3. RNA gel-blot analyses of wild-type (WT) and anti-Lhca4 transgenic (T2 generation) plants. The probes used are listed on the right. The blot was first hybridized with a single-stranded probe that recognizes only the endogenous Lhca4 transcript. Then, the blot was stripped and hybridized again with a double-stranded 18S DMA probe.

The Level of Antisense Inhibition Was Variable

The total RNAs from wild-type plants and transgenic plants of the T2 generation were isolated, blotted, and probed with an Lhca4 transcript-specific probe. As shown in Figure 3, the endogenous transcript of Lhca4 was reduced by 80% in five of six antisense transgenic plants but was only slightly reduced in line 24. Since wild-type and transgenic plants were sown and harvested at the same time, the differences in Lhca4 transcript levels among these plants should not be caused by the circadian rhythm regulation of Lhc genes. Our data suggest that the cauliflower mosaic virus 35S promoter is strong enough to significantly reduce the mRNA of Lhc genes, which usually have some of the strongest promoters among plant genes. When the level of Lhca4 protein was measured by quantitative immunoblotting, it was found that the level of depletion varied considerably among transgenic lines of the T4 generation. In one line (22) the protein was undetectable, and in the others the amount of Lhca4 was between 20% (line 7) and 60% (line 71) of the wild-type level (Fig. 4). Arabidopsis Lhca4 migrates as two closely spaced bands. Since only one Lhca4 gene is present, the two forms must represent differences in posttranslational modification. Two electrophoretic forms of Lhca4 have also been observed in barley (J. Knoetzel, personal communication). We also assayed Lhcal (the other LHCI-730 protein) in the mutant lines. Depletion of Lhca4 did not destabilize Lhcal,

wt 7

22 23 24 65 71

wt

22

Since the two LHCI-730 proteins are assumed to give rise to a 730-nm fluorescence emission peak at 77 K, we were interested to see whether the fluorescence properties of the plants were affected. We recorded the fluorescence emission spectrum of individual leaves from different plants in the T4 transgenic lines (Fig. 5). Some mutants had spectra similar to the wild type, but some had the long wavelength emission very much reduced, and the peak was significantly blue-shifted. In line 22, which had no Lhca4/ the peak was shifted by 6 nm, from 728 to 722 nm. The blue shift correlated well with the level of inhibition of Lhca4 (Table II). No significant differences could be seen between spectra recorded from leaves that were shaded or unshaded between individual plants of the same transgenic line (data not shown), showing that the differences were caused by the genotype and not by subtle differences in growth conditions between individual lines.

Delayed Flowering and Increased Seed Weight in

Some Transformants Some of the lines produced progeny that displayed a late-flowering phenotype. To obtain quantitative data to describe this event, we grew T3 plants in growth chambers in 16 h of light/8 h of darkness. We analyzed flowering time by recording the percentage of bolting plants on a daily basis, since it is much easier to watch bolting than to watch flower bud opening. Arabidopsis plants usually produce the first flower a few days after bolting. We counted the days required for 50% of the plants to bolt. Wild-type plants bolted after 25 d, lines 7, 22, and 23 bolted after 30 to

Lhca4 7

23

24 65 71

Lhcal Figure 4. Immunoblot analyses of wild-type (wt) and anti-Lhca4 transgenic (T4 generation) plants. Thylakoid membrane proteins were detected with monospecific antibodies against Lhca4 and Lhcal. Only one-half of the amount of Chl was loaded in the lanes labeled 24, 65, and 71.

660

720

740

760

Figure 5. Fluorescence emission spectra (77 K) of wild-type (wt) and three anti-Lhca4 transgenic (T4 generation) plants.

Antisense inhibition of Lhca4 in Arabidopsis thaliana Table II. Some features displayed by the transgenic lines WT, wild type. F,,

Line

Leve1 of Lhca4

Seed Wt

%”

nm

mg/l O00 seedsb

WT 7 22 23 24 65 71

1O 0 20 O 30 40 40 60

72 8 723

17.5 18.4

722 72 5 72 6 727 72 7

20.0 19.6 33.4 33.8 34.8

a Lhca4 level in leaf tissues was obtained by measuring the intensity of the Lhca4 band in western-blot analysis (Fig. 4) and then normalizing it with Chl content. T h e wild-type Lhca4 level is set at 100%. Seeds of T, transgenic plants were weighed.

35 d, and lines 24, 65, and 71 bolted after 40 to 45 d (data not shown). Under a shorter light period, lines 7,22, and 23 behaved in a manner similar to the wild type, whereas lines 24,65, and 71 were still delayed. The transgenic line 32, not analyzed in detail, had an even more pronounced phenotype and did not bolt until d 100. The lines with the most pronounced flowering delay produced larger seeds. One thousand wild-type Arabidopsis seeds normally weigh about 20 mg, whereas seeds from the transgenic lines 24, 65, and 71 weigh more than 30 mg (Table 11), which is more than a 50% increase in seed weight. However, even though seed size increased, total yield per plant decreased, because the number of seeds produced by an individual lateflowering plant was significantly reduced when compared with wild-type plants (data not shown).

DlSCUSSlON

Using antisense technology we have strongly reduced the expression of Lkca4 in A. tkaliana and observed nove1 phenotypes. In one of the lines Lhca4 protein was absent, whereas the other lines showed various degrees of inhibition. As noted in other studies (Palomares et al., 1993; Temple et al., 1993; Flachmann and Kiihlbrandt, 1995), there was no obvious correlation between the level of mRNA and protein depletion; the lines exhibiting both very high and moderate inhibition of Lhca4 protein levels had approximately the same amount of mRNA. The molecular mechanisms for antisense inhibition are not understood (Matzke and Matzke, 1995), but it is quite clear that using antisense inhibition to study gene function in Arabidopsis is very effective. The only previous attempt (to our knowledge) to effect Lhc gene expression by means of antisense inhibition was not successful. Flachmann and Kühlbrandt (1995) were not able to reduce the level of Lhcbl protein in tobacco (N. tabacuin L.), although the mRNA level was reduced to 5%. One reason for the difference between their results and ours could be that Lhcbl in a11 species investigated so far is encoded by a multigene family (Jansson et al., 1992), whereas Lkca4 is a single-copy gene, and the amount of Lkcbl transcript in Arabidopsis is approximately 20 times higher than that of Lkca4 (S. Jans-

1529

son, unpublished data). Another possibility is related to the accelerated life cycle of Arabidopsis, as compared with tobacco. A more long-lived leaf such as the tobacco leaf can perhaps, over time, accumulate enough protein even if the mRNA level is only 5% of the wild type. Nevertheless, our results show that, in some cases, total inhibition of gene expression of a highly expressed photosynthetic antenna protein can be achieved in A. thaliana. Recently, studies of barley (Houdeum vulgaue L.) clzlouina mutants have provided evidence for the origin of different low-temperature fluorescence emission peaks (Bossmann et al., 1997). These mutants have been obtained by visual screening for changes in the pigmentation. By that method, mutants in pigment biosynthesis or other pleiotropic mutants are more likely to be found than mutants in one of the Lkc genes; none of the barley cklovina mutants lack only one LHC protein. The antisense plants described here simplify such analyses: a11 differences in the performance of the photosynthetic light reaction should have a casual relationship to the expression of the antisense gene and reduction in the amount of Lhca4. Absence of Lhca4 in transgenic line 22 causes a drastic decrease in the longest-wavelength fluorescence, resulting in both a lowered fluorescence in general and also a blue shift by 6 nm. The whole spectrum of long-wavelength fluorescence is significantly blueshifted in Arabidopsis as compared with barley. This could possibly reflect a difference in antenna protein composition between the two species, but since fluorescence emission is a highly complex phenomenon, other explanations are also possible. The low-temperature fluorescence peak is, at least in our hands, dependent on growth conditions, making exact comparisons between species hard to make. Nevertheless, the barley studies have also indicated that the most red-shifted fluorescence is coupled to the presence of Lhca4. The delayed flowering was observed numerous times with plants grown under a11 conditions tested, and the trait was heritable. However, in contrast to the difference in fluorescence spectrum, the delay in flowering time and the increased seed weight were not correlated with the depletion of Lhca4 protein; plants with only moderate depletion displayed the most pronounced phenotypes. We do not understand why these transgenic plants show these phenotypes. Zabaleta et al. (1994) showed that antisense inhibition of plastid P-chaperonin caused a late-flowering phenotype in tobacco plants; therefore, it seems that some functions of chloroplasts are involved in the control of flowering timing. Recently, Anderson et al. (1995) suggested that PSI itself may be a regulator for plant development, which further supports our notion that antisense inhibition of Lhca4 can cause the late-flowering phenotype. The differences in the reduction of Lhca4 apoprotein and in phenotypes (i.e. flowering timing and seed weight) among transgenic plants could be due to different mechanisms of inhibition by transgenes; those with moderate depletion of Lhca4 were mainly from multiple T-DNA insertion plants, and those with more depletion were mainly from single T-DNA insertion plants (Fig. 2; Table 11). Multiple T-DNA insertion may be more pleiotropic, whereas the single T-

Zhang et al.

1530

DNA insertion m a y be m o r e specific i n suppressing gene expression (Matzke a n d Matzke, 1995). The reduction i n t h e leve1 of Lhca4 did n o t result i n depletion of Lhcal. This corroborates previous findings that L h c a l a n d Lhca4, w h i c h a r e assumed t o make up one complex (LHCI-730), c a n accumulate in t h e absence of each other (Bossmann e t al., 1997; Jansson e t al., 1997). Whether the depletion of Lhca4 had any other effect on PSI of t h e m u t a n t plants is currently under study. We believe that t h e ongoing studies on these m u t a n t s will shed light on t h e exact role of Lhca4 in t h e photosynthetic a p p a r a t u s of higher plants a n d that inactivation of m a n y other A. tkaliuna genes encoding photosynthetic proteins will be achieved in t h e future.

ACKNOWLEDGMENTS

We thank Jing Wang for taking care of the transgenic plants and Ulrika Nystrom for carrying out immunoblotting. We also thank professors Randy Allen, Candace Haigler, and Scott Holaday for critically reading the manuscript. Received April 30, 1997; accepted September 4, 1997. Copyright Clearance Center: 0032-0889/97/115/1525/07.

LITERATURE CITED

Anderson JM (1986) Photoregulation of the composition, function, and structure of thylakoid membranes. Annu Rev Plant Physiol 3 7 93-136 Anderson JM, Chow WS, Park Y-I (1995) The grand design of photosynthesis: acclimation of the photosynthetic apparatus to environmental cues. Photosynth Res 46: 129-139 Bossmann B, Knoetzel J, Jansson S (1997) Screening of chlorina mutants of barley (Hordeum vulgare L.) with antibodies against light-harvesting proteins of PSI and PSII: absence of specific antenna proteins. Photosynth Res (in press) Chitnis PR (1996) Photosystem 1. Plant Physiol 111: 661-669 Chomczynski P, Sacchi N (1987) Single-step method of RNA isola tion by guanidinium thiocyanate-phenol-chloroform extraction. Ana1 Biochem 161: 156-159 Church GM, Gilbert W (1984) Genomic sequencing. Proc Natl Acad Sci USA 81: 1991-1995 Dellaporta SL, Wood J, Hicks JB (1983) A plant DNA minipreparation: version 11. Plant Mo1 Biol Rep 4: 19-21 Dolganov NAM, Bhaya D, Grossman AR (1995) Cyanobacterial protein with similarity to the chlorophyll a/b binding proteins of higher plants: evolution and regulation. Proc Natl Acad Sci USA 92: 636-640 Falbel TG, Meehl JB, Staehelin LA (1996) Severity of mutant phenotype in a series of chlorophyll-deficient wheat mutants depends on light intensity and the severity of the block in chlorophyll synthesis. Plant Physiol 112: 821-832 Flachmann R, Kühlbrandt W (1995) Accumulation of plant ant e m a complexes is regulated by post-transcriptional mechanisms in tobacco. Plant Cell 7: 149-160 Green BR, Pichersky E (1993) Nucleotide sequence of an Arabidopsis thaliana Lhcb4 gene. Plant Physiol 103: 1451-1452 Haworth P, Watson JL, Arntzen CJ (1983) The detection, isolation and characterization of a light-harvesting complex which is specifically associated with photosystem I. Biochim Biophys Acta 724: 151-158 Ikeuchi M, Hirano A, Inoue Y (1991) Correspondence of apoproteins of light-harvesting chlorophyll u/b complexes associated

Plant Physiol. Vol. 115, 1 9 9 7

with photosystem I to cab genes: evidence for a nove1 type IV apoprotein. Plant Cell Physiol 32: 103-112 Jansson S (1994) The light-harvesting chlorophyll n/b-binding proteins. Biochim Biophys Acta 1184 1-19 Jansson S, Andersen B, Scheller HV (1996) Nearest neighbor analysis of higher plant photosystem I holocomplex. Plant Physiol 112: 409-420 Jansson S, Gustafsson P (1991) Evolutionary conservation of the chlorophyll a/b-binding proteins: cDNAs encoding type I, I1 and I11 LHC I polypeptides from the gymnosperm Scots pine. Mo1 Gen Genet 229: 67-76 Jansson S, Pichersky E, Bassi R, Green BR, Ikeuchi M, Melis A, Simpson DJ, Spangfort M, Staehelin LA, Thornber JP (1992) A nomenclature for the genes encoding the chlorophyll a/bbinding proteins of higher plants. Plant Mo1 Biol Rep 10: 242-253 Jansson S, Stefánsson H, Nystrom U, Gustafsson P, Albertsson PA (1997) Photosystem I and I1 antenna proteins in the different thylakoid domains. Biochim Biophys Acta 1320: 297-309 Jefferson RA, Kavanaugh TA, Bevan MW (1987) GUS fusion: b-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J 6 3901-3907 Jensen PE, Kristensen M, Hoff T, Lehmbeck J, Stummann BM, Henningsen KW (1992) Identification of a single-copy gene encoding a type I chlorophyll a/b-binding polypeptide of photosystem I in Arabidopsis thaliana. Physiol Plant 8 4 561-567 Knoetzel J, Svendsen I, Simpson DJ (1992) Identification of the photosystem I antenna polypeptides in barley-isolation of three pigment binding antenna complexes. Eur J Biochem 206: 209-215 Kr61 M, Spangfort MD, Huner NPA, Oquist G , Gustafsson P, Jansson S (1995)Chlorophyll a/b-binding proteins, pigment conversions and early light-induced proteins in a chlorophyll b-less barley mutant. Plant Physiol 1 0 7 873-883 Lam E, Ortiz W, Malkin R (1984) Chlorophyll a / b proteins of photosystem I. FEBS Lett 168: 10-14 Leuhviler LS, Meyerowitz EM, Tobin EM (1986) Structure and expression of three light-harvesting chlorophyll a/b-binding protein genes in Arabidopsis thaliuna. Nucleic Acids Res 14:40514076 Matzke MA, Matzke AJM (1995) Homology-dependent gene silencing in transgenic plants: what does it really te11 us? Trends Genet 11: 1-3 McGrath JM, Terzaghi WB, Sridhar P, Cashmore AR, Pichersky E (1992) Sequence of the fourth and fifth photosystem I1 type I chlorophyll a/b-binding protein genes of Arabidopsis tlraliana and evidence for the presence of a full complement of the extended CAB gene family. Plant Mo1 Biol 19: 725-733 Ogren E, Oquist G (1984) Photoinhibition of photosynthesis in Lernna gibba as induced by the interaction between Iight and temperature. 111. Chlorophyll fluorescence at 77 K. Physiol Plant 62: 193-200 Palomares R, Herrmann RG, Oelmuller R (1993) Antisense RNA for components associated with the oxygen-evolving complex and the Rieske iron/sulfur protein of the tobacco thylakoid membrane suppresses accumulation of mRNA, but not of protein. Mo1 Gen Genet 1 9 0 305-312 Porra RJ,Thompson WA, Kriedemann PE (1989) Determination of accurate extinction coefficients and simultaneous equation for assaying chlorophylls a and b extracted with four different solvents: verification of the concentration of chlorophyll standards by atomic absorption spectroscopy. Biochim Biophys Acta 975: 384-394 Temple SJ, Knight TJ, Unkefer PJ, Sengupta-Gopalan C (1993) Modulation of glutamine synthetase gene expression in tobacco by the introduction of an alfalfa glutamine synthetase gene in sense and antisense orientation: molecular and biochemical analysis. Mo1 Gen Genet 236: 315-325 Tjus SE, Roobol-Boza M, Palsson LO,Andersson B (1995) Rapid isolation of photosystem I chlorophyll-binding proteins by anion exchange perfusion chromatography. Photosynth Res 45: 41-49 Valvekens D, Montagu V, Van Lijsebettens M (1988) Agrobucterium tumefaciens-mediated transformation of Arabidopsis thuliana

Antisense inhibition of Lhca4 in Arabidopsis thaliana root explants by using kanamycin selection. Proc Natl Acad Sci USA 85: 5536-5540 Wang J, Zhang H, Goodman HM (1994) An Arabidopsis cab gene homologous to Cab-8 of tomato. Plant Physiol 104 297 Zabaleta E, Oropeza A, Assad N, Mande1 A, Salerno G, HerreraEstrella L (1994) Antisense expression of chaperonin 60p in transgenic tobacco plants leads to abnormal phenotypes and altered distribution of photoassimilates. Plant J 6 425432 Zhang H,Hanley S, Goodman HM (1991) Isolation, characteriza-

1531

tion, and chromosomal location of a new cab gene from Arubidopsis thuliana. Plant Physiol 96: 1387-1388 Zhang H, Scheirer DC, Fowle W, Goodman HM (1992) Expression of antisense or sense RNA of an ankyrin repeat-containing gene blocks chloroplast differentiation in Arabidopsis. Plant Cell 4: 1575-1588 Zhang H, Wang J, Goodman HM (1994) Differential expression in Arubidopsis of Lhca2, a PSI cab gene. Plant Mo1 Biol 25: 551-557