Assessment of Parasitism of House Fly and Stable Fly (Diptera ...

ARTICLE

Assessment of Parasitism of House Fly and Stable Fly (Diptera: Muscidae) Pupae by Pteromalid (Hymenoptera: Pteromalidae) Parasitoids Using a Polymerase Chain Reaction Assay SUSAN T. RATCLIFFE,1 HUGH M. ROBERTSON,2 CARL J. JONES,3 GERMAN A. BOLLERO, AND RICHARD A. WEINZIERL Department of Crop Sciences, University of Illinois, 1102 S. Goodwin Avenue, Urbana, IL 61801

J. Med. Entomol. 39(1): 52Ð60 (2002)

ABSTRACT The internal transcribed spacer (ITS) regions of the ribosomal DNA of house ßies, Musca domestica L., the stable ßies, Stomoxys calcitrans (L.), and four parasitoid species in the genus Muscidifurax (Hymenoptera: Pteromalidae) were characterized to develop a method based on the polymerase chain reaction (PCR) to better deÞne the role of pteromalid parasitism of pupae of the house ßy and stable ßy. Two parasitoid-speciÞc primers were designed to anneal to the 5⬘ end of the 5.8S rRNA gene in the parasitoid species. When paired with a universal primer at the 3⬘ end of the 18S rRNA, the primers ampliÞed the target ITS1 region in 10 pteromalid species. PCR allowed detection of parasitoid DNA within 24 h after females of Spalangia endius Walker oviposited into house ßy puparia. PCR failed to amplify parasitoid DNA or detect parasitism in puparia that were exposed to parasitoid oviposition, allowed to develop 7 d, then killed by freezing and held at 20 Ð24⬚C for 4 d to allow DNA degradation. Digestion of the PCR products with restriction enzymes produced restriction fragment length polymorphisms that allowed identiÞcation of individual parasitoid species. SigniÞcantly greater levels of parasitism (P ⬍ 0.05) were detected by PCR for two of the Þve Þeld collection dates in 1997. On the dates when PCR detected higher levels of parasitism than estimates provided by emergence of adult insects from samples taken at Feedlot M in 1997, more than 65% of all puparia in the emergence samples failed to produce an adult insect. Three puparia collected in 1997 produced double PCR bands that corresponded to PCR band sizes of Muscidifurax spp. and Spalangia sp., possibly indicating multiple parasitism or hyperparasitism. KEY WORDS house ßy, stable ßy, biological control, polymerase chain reaction-restriction fragment-length polymorphism, parasitism, livestock entomology

HOUSE FLIES, Musca domestica L., and stable ßies, Stomoxys calcitrans (L.) (Diptera: Muscidae), have long been considered major pests of livestock. Their continuous reproduction in warm weather and the abundance of larval development sites at livestock facilities make their control difÞcult and costly. Stable ßies cause reductions in weight gain (Campbell et al. 1977 1981, 1987) and milk production (Bruce and Decker 1958). The economic impact of M. domestica on cattle is more difÞcult to substantiate, but its impact on the health of humans and livestock is well documented (Skoda and Thomas 1992, Tan et al. 1997, Iwasa et al. 1999). Control of house ßies and stable ßies is complicated by their ability to disperse to areas surrounding their larval development sites, and their economic 1

E-mail: [email protected]. Department of Entomology, University of Illinois, 502 S. Goodwin Avenue, Urbana, IL 61801. 3 Department of Entomology and Plant Pathology, University of Tennessee, 205 Ellington Plant Sciences, Knoxville, TN 37996. 2

impact has spread from livestock and dairy industries to other businesses and surrounding communities (Hogsette and Ruff 1985; Jones et al. 1987, 1991, 1999; Jones 1995). Many of the biological control agents used to control ßy populations in feedlots and dairy facilities have been pupal parasitoids in the family Pteromalidae (Hymenoptera). Common genera that parasitize pupae of S. calcitrans and M. domestica include Muscidifurax, Nasonia, Pachycrepoideus, Spalangia, Trichomalopsis, and Urolepis (Rueda and Axtell 1985, Hoebeke and Rutz 1988). Several species naturally occur near livestock facilities and some species have been used in inoculative and inundative release programs for biological control (Meyer et al. 1990, Jones and Weinzierl 1997, Weinzierl and Jones 1998). The use of pteromalid pupal parasitoids in ßy control studies has produced varied results. Some of the variation results from the methods used to calculate effectiveness. These methods have generated criti-

January 2002

RATCLIFFE ET AL.: ASSESSMENT OF PUPAL PARASITISM BY PTEROMALIDS USING PCR

cism (Petersen and Meyer 1985). Commonly, each Þeld-collected puparium is placed in a gelatin capsule and held until a ßy or parasitoid emerges. Some puparia fail to produce a ßy or parasitoid, and these are referred to as “duds.” How these duds are handled in calculations of parasitism can have a signiÞcant impact on the conclusions about the level of ßy control provided. Some researchers have determined parasitism levels using only the number of emerging parasitoids and ßies, disregarding the duds (Sheppard and Kissam 1981); this may provide an inaccurate estimation of parasitism and could affect host population growth models. This is especially true when over 50% of the puparia produce no insects (are duds), as was observed by Jones and Weinzierl (1997). Some researchers have attempted to reduce the impact of duds by dissecting puparia to detect abortive parasitism (Petersen and Meyer 1985). Using this emergence/ dissection method may provide a more accurate assessment if parasitoid development has reached a level detectable by dissection and tissue has not decayed beyond recognition when dissections are done. However, these methods often fail to detect aborted parasitism that may have occurred in the Þeld or the laboratory. Aborted parasitism in the Þeld may result from multiparasitism, hyperparasitism, physical trauma to the puparium (including desiccation), or other naturally occurring mortality. An alternative assessment method may be the use of restriction fragment-length polymorphism-polymerase chain reaction (RFLP-PCR) of ribosomal DNA to detect parasitism and allow species identiÞcation of the parasitoid. The internal transcribed spacer (ITS) regions of rDNA repeats can be expected to be highly variable, yet diagnostic for each species. In the past decade the ITS regions of the ribosomal RNA gene repeats have become recognized for such sequence characteristics (e.g., Schlotterer and Tautz 1994, Collins and Paskewitz 1996, Fenton et al. 1997). The purpose of this study was to determine if PCR might provide a more accurate estimation of parasitism than the emergence method by detecting a parasitoid egg in a puparium that may not, for a variety of factors, produce an adult insect and result in a dud. Materials and Methods Identification of Parasitoid Species. Parasitoid and ßy colonies of known identity were used to develop methods of detection and identiÞcation of parasitoid species. Sources of colonies were as follows: Arbico, Tucson, AZ [Nasonia vitripennis (Walker)]; BeneÞcial Insectaries, Oak Run, CA (Muscidifurax zaraptor Kogan & Legner and Spalangia nigroaenea Curtis); Cornell University, Ithaca, NY [Spalangia cameroni Perkins and Urolepis rufipes (Ashmead)]; United States Department of Agriculture, Medical, Agricultural, and Veterinary Research Center, Gainesville, FL (S. calcitrans); United States Department of Agriculture, Midwest Livestock Insects Research Laboratory, Lincoln, NE (Muscidifurax raptor Girault & Sanders, Muscidifurax uniraptor Kogan & Legner, and Tricho-

53

malopsis sarcophagae Gahan); and University of Illinois, Urbana, IL [Muscidifurax raptorellus Kogan & Legner, M. domestica, and Drosophila melanogaster Meigen (Diptera: Drosophilidae)]. Parasitoid speciÞc primers were designed based on sequence variation from two species of Muscidifurax, S. calcitrans, and M. domestica. DNA from these species was ampliÞed using the 18S rRNA primer 1975F (TAACAAGGTTTCCGTAGGTG) and the 5.8S rRNA primer 35R (AGCTGGCTGCGTTCTTCATCGA) to produce 100 ␮l of PCR products from M. domestica, S. calcitrans, M. zaraptor, M. raptorellus, M. raptor and M. uniraptor, and these PCR products were puriÞed for cloning (Ratcliffe 1999). Cloning and plasmid minipreps were prepared by standard methods (Sambrook et al. 1989). Sequences of the 5⬘ end of the 5.8S rRNA gene from M. raptor, M. zaraptor, M. uniraptor, M. raptorellus, S. calcitrans, and M. domestica were manually aligned and compared for regions conserved between parasitoid species and different from S. calcitrans and M. domestica. Two parasitoid-speciÞc primers (1R and -3R) were designed to anneal to the 5⬘ end of the 5.8S rRNA gene. To test the speciÞcity of 1R (GTGATCCACCGTTCAGGGTA), and -3R (ATCCACCGTTCAGGGTAATC), PCR reactions were prepared that paired the parasitoid-speciÞc primers with the universal primer 1975F. Universal primers, 1975F and 35R, known to amplify the region of interest in both parasitoids and hosts was used as a control. For each species, 1 ␮l DNA was added to the PCR solutions containing the primers 1975F and 1R, 1975F and -3R, and 1975F and 35R. Muscidifurax zaraptor, M. raptorellus, M. uniraptor, M. raptor, S. nigroaenea, S. cameroni, S. endius, U. rufipes, T. sarcophagae, N. vitripennis, M. domestica, S. calcitrans, and D. melanogaster were used to determine the speciÞcity of the paired primers (1975F/1R, 1975F/Ð3R, and 1975/35R). Methods of PCR ampliÞcation, visualization of bands, and gel documentation were completed as described by Ratcliffe (1999). To determine if the species in this study could be separated by RFLPs, PCR products from M. raptor, M. uniraptor, M. zaraptor, M. raptorellus, S. nigroaenea, S. cameroni, U. rufipes, T. sarcophagae, and N. vitripennis were digested by AluI, DdeI, DpnI, DraI, HinfI, Sau3(AI), SspI and TaqI and visualized as described in Ratcliffe (1999). Voucher specimens of M. raptor, M. zaraptor, S. nigroaenea, S. cameroni, U. rufipes, T. sarcophagae, N. vitripennis, M. domestica and S. calcitrans used in this study have been deposited in the Illinois Natural History Survey collection. Sensitivity of Detection and Degradation of DNA. Assays were run using known dilutions of parasitoid DNA in host (ßy) DNA and ßy pupae that had been parasitized 24 h before analysis to assess the sensitivity of PCR to detect parasitoid DNA. DNA from M. zaraptor and S. cameroni was added to DNA from M. domestica and (separately) to DNA from S. calcitrans at dilutions of 1:1, 1:10, 1:100, 1:1,000, and 1:10,000 (parasitoid:host). As a control, parasitoid DNA was diluted to 0.1 times and ampliÞed. Production of bands was

54

JOURNAL OF MEDICAL ENTOMOLOGY

Vol. 39, no. 1

Fig. 1. Sequence comparison of the 5⬘ end of the 5.8S rRNA gene for two hosts and four species of Muscidifurax. Five positions (indicated by *) in a 23-position region differed between hosts and parasitoids. Sequences illustrated below begin with three positions of the ITS1 region (⫺3) and end at position 54 of the 5.8S rRNA gene.

considered to be evidence of ampliÞcation of parasitoid DNA. Additional assessments of PCR-based methods focused on detecting parasitism of ßy pupae. To carry out these assays, DNA was extracted from the contents of house ßy puparia using the animal tissue protocol for the Puregene DNA isolation kit D-5500 as described by Ratcliffe (1999). To determine how early in development parasitoids could be detected by the PCR-based method, ⬇24 h following pupation, 150 live M. domestica puparia were presented to a colony of S. endius (⬇500 adults) for 24 h and held in darkness at 20 Ð24⬚C. The puparia were then removed, 100 were placed individually into gelatin capsules and held for parasitoid or host emergence, and 50 were held at ⫺20⬚C until DNA was extracted, ampliÞed, and documented as described in Ratcliffe (1999). To determine if parasitism could be detected using PCR when both the host and parasitoid have died before collection, 225 house ßy puparia were presented to a colony of ⬇500 adult S. endius for 24 h. After 6 d of development, 100 puparia were placed individually into gelatin capsules, and 50 were frozen for extraction of DNA without degradation. The remaining 75 were frozen for 48 h, then removed from the freezer and held at 20 Ð24⬚C for 4 d to allow degradation of the parasitoidsÕ DNA. These puparia were refrozen and later analyzed by PCR as described previously. Assessment of Parasitism in Field-Collected Samples. Samples were collected at beef cattle feedlots on Þve dates from June to September of 1997 to determine the effectiveness of the PCR-based method of detecting parasitism in ßy puparia. All but one of these collections were taken from one feedlot (designated M) in Clay County in south-central Illinois. Weinzierl and Jones (1998) released S. nigroaenea and M. zaraptor at this location in 1991Ð1993. In 1998, puparia were collected on one date from three feedlots in Shelby County. Puparia were collected from manure using ßotation as described by Jones and Weinzierl (1997). Samples from each site were divided, and a portion of the puparia were placed individually into gelatin capsules and held at 20 Ð24⬚C for emergence of a parasitoid or a ßy. The remaining puparia were held at ⫺20⬚C until DNA was extracted, ampliÞed using PCR,

and documented as described earlier. RFLPs were produced as described above to identify the species of parasitoids detected by PCR. Parasitoids that emerged from puparia held in gel caps were identiÞed using keys from Rueda and Axtell (1985). Host identiÞcation was based on larval spiracle patterns evident on the puparia (Anonymous 1964). Mean values of percentage of parasitism detected using PCR-based versus emergence-based assessment were compared using the independent t-test procedure of the Statistical Analysis System (SAS Institute 1994) to determine the signiÞcance of any differences between the two methods. Puparia from petri plates containing Þeld-collected samples were combined and, after debris was removed, were divided into subsamples. Samples to be held for emergence were split randomly into sub-samples of ⬇50 puparia and placed into petri plates. Samples to be processed by PCR were frozen, and each DNA extraction procedure created a sub-sample containing 24 randomly selected puparia. Results and Discussion Identification of Parasitoid Species. After manual alignment of the nucleotides of the 5⬘ end of the 5.8S rRNA gene of M. domestica, S. calcitrans, M. raptor, M. zaraptor, M. raptorellus, and M. uniraptor, two parasitoid-speciÞc primers, 1R and -3R were designed based on sequence data to the 5⬘ end of the 5.8S rRNA gene. Based on sequences from the 5⬘ end of the 5.8S rRNA gene in all six species sequenced, two 20-position regions were identiÞed as conserved among the four parasitoid species and different from S. calcitrans and M. domestica (Fig. 1). The sequences of the 5⬘ end of the 5.8S rRNA gene of M. domestica, S. calcitrans, M. raptor, M. zaraptor, M. raptorellus, and M. uniraptor have been deposited in the GenBank with accession numbers AF343080, AF343081, AF343082, AF343083, AF343084, AF343085, respectively. Sequences, ⬇90 nucleotides in length, of the ITS1 region ßanking the 5⬘ end of the 5.8S rRNA gene for, M. raptor, M. zaraptor, M. raptorellus, and M. uniraptor have been deposited in the GenBank with accession numbers AF343784, AF343785, AF343786, AF343787, respectively. When two parasitoid-speciÞc primers (1R and ⫺3R) designed to anneal to the 5.8S rRNA gene of the

January 2002


55

Fig. 2. PCR products from eight parasitoid species and three ßy species ampliÞed by paired primers (1975F/1R or 1975 F/35R). Lanes M: 1 kb DNA ladder. Lanes 1Ð11: 1975F/1R. Lanes 12Ð22: 1975F/35R. Lanes 1, 12: Muscidifurax raptor. Lanes 2, 13: Muscidifurax uniraptor. Lanes 3, 14: Muscidifurax zaraptor. Lanes 4, 15: Muscidifurax raptorellus. Lanes 5, 16: Spalangia nigroaenea. Lanes 6, 17: Spalangia cameroni. Lanes 7, 18: Urolepis rufipes. Lanes 8, 19: Trichomalopsis sarcophagae. Lanes 9, 20: Musca domestica. Lanes 10, 21: Stomoxys calcitrans. Lanes 11, 22: Drosophila melanogaster.

parasitoids were each paired with the universal 18S rRNA primer 1975F, each pair ampliÞed parasitoid DNA and failed to amplify DNA from the three species of Diptera tested. Using 1R and 1975F to amplify the DNA, PCR products of ⬇850 bp (bp) were produced for the four Muscidifurax species, S. nigroaenea, U. rufipes, T. sarcophagae and N. vitripennis (Fig. 2). DNA extractions from one species, U. rufipes, produced a lower DNA yield and may have resulted from inhibitory compounds found in the cuticle of this species. Spalangia cameroni and S. endius produced PCR products of ⬇650 bp (Fig. 2). PCR products were not produced from M. domestica, S. calcitrans, and D. melanogaster DNA using 1975F and 1R, and the presence of primerdimer at the bottom of each PCR lane containing PCR products from these three species indicated the reactions were not inhibited. PCR products were produced from all species of parasitoids and Diptera using the universal primers 1975F and 35R (Fig. 2, lanes 12 through 22). The PCR products in lanes 20, 21, and 22 served as controls to assure that DNA from the dipteran species could be ampliÞed. We concluded the speciÞcity of the 1R primer allowed ampliÞcation of only parasitoid DNA despite the presence of the hostÕs DNA.

Variability found in ⬇90 bp of the ITS1 region (Fig. 3) indicated pteromalid parasitoid species identiÞcation by RFLP would be possible. Based on the inability to sequence directly from the PCR product, we determined variation within the ITS1 region exists within the Musidifurax and Musca species, but not within individuals. Variation within Musca domestica was documented in previous PCR-RFLP assays that sampled two populations, a laboratory colony and Þeld colony, to determine if PCR-RFLP could be used to identify dipteran larvae of forensic importance (Ratcliffe 1995). Vogler and DeSalle (1994) made a similar discovery in Cicindela dorsalis Say (Coleoptera: Cicindelidae). This variation within species did not appear to affect the ability of restriction enzymes to produce RFLPs for identiÞcation, although the sum of the band sizes was greater than the size of the PCR product. Of the 10 restriction enzymes initially tested, AluI, ApaI, DdeI, EcoRI, EcoRV, HindIII, HinfI, Sau3(AI), and SspI failed to allow distinction between M. raptorellus and M. zaraptor (Ratcliffe 1999). TaqI failed to allow identiÞcation of the Muscidifurax species, except M. zaraptor. Based on the size of the PCR product and the RFLP pattern, TaqI allowed identiÞcation of S. nigroaenea and S. cameroni. RFLPs from U. rufipes and T. sarcophagae were very similar to each other.

Fig. 3. Internal transcribed spacer 1 (ITS1) sequence comparison. Manual alignment of ⬇90 nucleotides of the ITS1 region ßanking the 5⬘ end of the 5.8S rRNA gene for Muscidifurax raptor, Muscidifurax zaraptor, Muscidifurax raptorellus, and Muscidifurax uniraptor.

56

JOURNAL OF MEDICAL ENTOMOLOGY Table 1.

Vol. 39, no. 1

Summary of restriction fragment length polymorphisms (RFLP)

Species

PCR product, bp

AluI

DdeI

DpnI

DraI

Sau3AI

SspI

TaqI

M. raptor M. uniraptor M. zaraptor M. raptorellus S. nigroaenea S. cameroni S. endius U. rufipes T. sarcophagae N. vitripennis

850 850 850 850 800 650 650 850 850 850

450, 350 450, 350 450, 350 450, 350 600, 200 650 Not tested 500, 350 500, 350 500, 350

500, 350 850 850 850 800 650 Not tested 850 600, 250 850

400, 300, 200 400, 300, 200 400, 300, 200 400, 300, 200 No bands 400, 200 Not tested No bands 850 850

600, 250 600, 250 600, 250 600, 250 800 650 Not tested No bands 600, 250 Not tested

350, 300, 200 350, 300, 200 350, 300, 200 350, 300, 200 350, 225, 200 350, 300 Not tested 850 850 850

550, 300 550, 300 550, 300 550, 300 800 650 Not tested 850 850 850

500, 250 500, 250 400, 250 500, 250, 150 300, 250, 150 330, 275 300, 200, 100 400, 300 400, 300 Not tested

Restriction enzymes

PCR product sizes approximated in base pairs (bp), and restriction fragment sizes (bp) following digestion of PCR products by selected restriction enzymes

TaqI was later tested on S. endius and produced a distinct pattern of RFLPs (300, 200, 100 bp) that allowed species identiÞcation (Ratcliffe 1999). Estimated fragment sizes produced by the restriction enzyme digestions are summarized in Table 1. Based on a 3-yr study conducted by Jones and Weinzierl (1997), the most common species in south central Illinois are S. nigroaenea, S. nigra, S. endius, S. cameroni, M. raptor, and M. zaraptor. TaqI allows distinct identiÞcation of each of these species except S. nigra and three of the Muscidifurax species. Later studies conducted by Taylor and Szalanski (1999) reported TaqI produced fragment length differences ranging from 20 to 40 bp from the four Muscidifurax species in this study, but these differences were too slight to be visualized with 1 kb marker used in this study. As a result, Muscidifurax data are presented at the genus level. The ability to separate species may have improved if we had successfully ampliÞed the DNA from the 3⬘ end of the 18S to the 5⬘ end of the 28S, which would have included both ITS regions and increased the variability of sequences between the parasitoids. This region was ampliÞed using universal primers in 10 species of forensically important Diptera and allowed detection of differences between laboratory-reared versus Þeld-collected Cochliomyia macellaria (F.) (Diptera: Calliphoridae) and M. domestica (Ratcliffe 1995). Attempts to amplify this region in the parasitoids were unsuccessful, but additional efforts using the high-yield DNA extraction kit from Puregene may be warranted. In addition, to providing greater separation possibilities using restriction enzyme digests, it may be possible to identify species based on the size of the PCR product of this larger region. This would eliminate an additional step in species identiÞcation. It is unlikely that all pteromalid species of interest would produce a PCR product unique in length and thereby allow positive identiÞcation, but it is possible that the most common parasitoids in a region might be identiÞed on the basis of PCR product size alone. Taylor and Szalanski (1999) were able to separate the four species of Muscidifurax using the restriction enzyme MseI.

Sensitivity of Detection and Degradation of DNA. Sensitivity assays using known dilutions of parasitoid DNA in ßy DNA indicated the presence of parasitoid DNA was detectable in all ratios (1:1Ð1:10,000; parasitoid:host) based on the size of bands produced by the dilutions in comparison with the band produced by the undiluted parasitoid DNA. The intensity of the bands decreased when the ratio of parasitoid to ßy DNA was decreased (Ratcliffe 1999). Of 48 puparia exposed to S. endius for 24 h, frozen, and then assayed by PCR, 13 (27%) produced PCR products 650 bp in length (Ratcliffe 1999). Of the paired samples of puparia held in gelatin capsules for adult emergence, 32% produced adults of S. endius. At 20 Ð24⬚C, S. endius eggs require 2 d to hatch (Rueda and Axtell 1985). Consequently, positive results in this assay indicate that parasitoids can be detected while still in the egg stage within host puparia. Amornsak et al. (1998) reached a similar conclusion following successful detection of Trichogramma australicum Girault (Hymenoptera: Trichogrammatidae) in Helicoverpa spp. eggs (Lepidoptera: Noctuidae) 12 h or less after oviposition. Some pupae may have been parasitized shortly before removal from the cage and frozen immediately for PCR-processing. These pupae (puparia) may have contained tissue samples too minute to be detected by PCR. Similarly, Amornsak et al. (1998) found that T. australicum could be detected 12 h after oviposition, but not immediately afterward. Because PCR techniques may not detect parasitism very soon after oviposition, future sensitivity assays should include time series to identify exactly when in development PCR can provide positive results. Additionally, Þeld samples that will be assessed by PCR probably should be held for 24 h before processing or freezing for processing. The removal of the pupa from the puparia has been necessary to ensure ampliÞcation by PCR, but by the addition of 4 ␮g/ml of bovine serum albumin to the PCR mix to inactivate contaminating nucleases and proteases, consistent ampliÞcation might be attained without removal of the pupa. None of the 72 puparia exposed to S. endius for 24 h, allowed to develop 7 d, killed by freezing, and then allowed to degrade for 4 d produced PCR products. Of

January 2002 Table 2. Julian date


57

Estimates of total parasitism of house fly and stable fly pupae collected from Illinois cattle feedlots in 1997 and 1998 Feedlots

Total pupaea PCR

Parasitism (%)b

Dudsc

Emerge

PCR

Emerge

t-testd

SEM

Emerge (%)

PCR

Emerge

t

df

P

167 209 223 239 261 261 97 total

M M M M M S

82 120 120 192 192 96 802

93 306 307 307 146 202 1,361

5 (6.1) 24 (20.0) 59 (49.2)* 43 (22.4) 101 (52.6)* 16 (16.7) 248 (30.9)

1997 6 (6.5) 43 (14.1) 94 (30.6) 87 (28.3) 47 (32.2) 58 (28.7) 335 (24.6)

26 (28.0) 234 (76.5) 210 (68.4) 116 (37.8) 96 (65.8) 133 (65.8) 815 (59.9)

0.623 0.740 0.332 0.743 0.491 0.977

0.013 0.106 0.084 0.105 0.283 0.465

0.6709 ⫺0.5592 ⫺3.9543 1.4288 ⫺3.6215 1.2373

3.0 4.2 4.5 7.3 9.9 4.3

0.5503 0.6049 0.0137* 0.1947 0.0048* 0.2799

225 225 225 98 total 2 year total

L R S

95 96 96 287 1,089

158 128 121 407 1,768

32 (33.7) 14 (14.6) 5 (5.0) 51 (17.8) 299 (27.5)

1998 45 (28.5) 30 (23.4) 13 (10.7) 88 (21.6) 423 (23.9)

73 (46.2) 47 (36.7) 81 (66.9) 201 (49.4) 1,016

0.666 0.978 1.091

0.242 0.305 0.145

⫺0.5117 1.5891 1.5537

3.8 3.6 3.1

0.6377 0.1970 0.2157

* Estimates of parasitism based on detection by PCR were signiÞcantly greater (P ⱕ 0.05) than estimates based on observations of adult insect emergence. a Total puparia processed by PCR or held for emergence. b Parasitism detected in samples processed by PCR or held for emergence. c Total number of puparia that failed to produce an adult insect. d Independent t-test, SAS Institute 1994.

the paired samples of puparia held in gelatin capsules for adult emergence, 38% produced adults of S. endius. Failure to amplify S. endius DNA after 4 d of degradation suggests that PCR-based processing of Þeld samples will not detect duds that have resulted from parasitoid attack followed by death of the host and the parasitoid, at least not after a few days of degradation. Postet al. (1993) examined preservation of insects for DNA studies using Simulium damnosum Theobald (Diptera: Simuliidae) preserved by a variety of methods. Preserving specimens in liquid nitrogen, storing them in ethanol at 4⬚C, or drying them over silica gel provided the highest yields and largest fragments of DNA. Pinned specimens of unknown age (somewhat similar to the specimens produced by holding freezekilled puparia at 20 Ð24⬚C in this trial) did not produce detectable yields of DNA. House ßy pupae that were held for emergence produced a high percentage of duds; these may have been caused from probing that resulted in the death of the ßy or aborted parasitism. Comparison of duds from emergence samples with the PCR samples was not possible because PCR-based analyses do not distinguish duds from living parasitoids. In addition, as noted above, PCR cannot detect mortality that resulted from probing or previously aborted parasitoids after degradation of DNA has occurred. PCR-based analyses do, however, eliminate the delay associated with holding puparia for emergence of adult insects. This could be useful in assessing the effectiveness of season-long release programs by providing data while the releases continue as opposed to several weeks later. Assessment of Parasitism in Field-Collected Samples. In 1997 and 1998 combined, a total of 2,857 Þeldcollected puparia was processed: 1,089 by PCR and 1,768 by holding the puparia in gelatin capsules for adult emergence. Of the puparia processed by PCR, parasitism was detected in 27.5%; 23.9% of the puparia

held for emergence produced adult parasitoids (Table 2). A t-test indicated no signiÞcant difference in total parasitism estimated for emergence versus PCR for the two seasons together. In 1997, the level of parasitism detected by PCR averaged 30.9%; whereas parasitoids emerged from 24.6% of the puparia held in gelatin capsules. In 1998, parasitoid DNA was detected by PCR in 17.8% of the puparia processed; 21.6% of the puparia held for emergence produced parasitoids. Of the 1,768 puparia held for adult emergence, 57.5% failed to produce either a ßy or a parasitoid and were classiÞed as duds. In 1997 at feedlot M, where samples were collected on Þve dates, estimates of parasitism in June were ⬇6% (based on PCR and emergence samples). Parasitism increased through the season (Table 2). SigniÞcantly greater levels of parasitism (P ⬍ 0.05) were detected by PCR for two of the Þve collection dates in 1997. Parasitism was estimated by PCR at 49.2% in early August (JD 223). For pupae collected on the same date, emergence samples indicated 30.6% parasitism. In late August, parasitism dropped in both PCR and emergence samples to 22.4% and 28.3%, respectively, but by mid-September, estimates of parasitism rose to 52.6 and 32.2%, respectively. Limited rainfall from late-July through mid-August may have contributed to the decrease in parasitism by reducing larval development sites for the hosts and increasing desiccation of pupae. In a 2-yr study, Seymour and Campbell (1993) found parasitism of house ßy pupae increased from 6.3% in June to 33.3% in September, and parasitism of stable ßy pupae also increased. Numerous collection trips in 1998 failed to provide adequate samples throughout the season, presumably because of unusually heavy precipitation, followed by extremely low levels of precipitation in August and September (Midwest Climate Center, Illinois State Water Survey). Only one collection date provided

58


Vol. 39, no. 1

Table 3. Species breakdown of parasitism of house fly and stable fly puparia detected by PCR versus emergence (Emg) of adult insects from puparia Total pupae J.D.

S. nigroaenea

S. endius

Muscidifurax spp.

Feedlot PCR

Emg

PCR (%)

167 209 223 239 261 261

M M M M M S

9 59 111 188 183 83

5 150 294 304 139 174

1 (11.1) 10 (17.0) 33 (29.7) 32 (17.0) 67 (36.6) 10 (12.1)

225 225 225 2-yr total

L R S

23 0 10 666

88 0 34 1,066

8 (34.8) 0 (0.0) 0 (0.0) 161 (24.2)

167 209 223 239 261 261

M M M M M S

73 61 9 4 9 13

88 156 13 3 7 28

4 (5.5) 6 (9.8) 1 (11.1) 0 (0.0) 5 (55.6) 1 (7.7)

225 225 225 2-y total

L R S

72 96 86 423

70 128 87 580

22 (30.5) 14 (14.6) 3 (3.5) 56 (13.2)

Emg (%)

PCR (%)

House ßy, 1997 0 (0.0) 0 (0.0) 15 (10.0) 1 (1.7) 34 (11.6) 5 (4.5) 77 (25.3) 3 (1.6) 17 (12.2) 5 (2.7) 34 (19.5) 2 (2.4) 16 (18.2) 0 (0.0) 3 (8.8) 196 (18.4)

1998 0 (0.0) 0 (0.0) 0 (0.0) 16 (2.4)

Stable ßy, 1997 5 (5.7) 0 (0.0) 11 (7.1) 3 (4.9) 1 (7.7) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 6 (21.4) 0 (0.0) 21 (30.0) 30 (23.4) 9 (10.4) 83 (14.3)

1998 1 (1.4) 0 (0.0) 1 (1.2) 5 (1.2)

samples of ⬎100 puparia from each of three feedlots within 16 km of one another in Shelby County. No signiÞcant differences in estimates of parasitism resulted from assessments based on PCR versus adult emergence for the 1998 samples (Table 2). On the dates when PCR detected higher levels of parasitism than estimates provided by emergence of adult insects from samples taken at Feedlot M in 1997, more than 65% of all puparia in the emergence samples were eventually designated as duds (Table 2). It is possible that a substantial portion of the duds from emergence samples may have resulted from aborted parasitism. The portion of parasitoids that died very shortly before collection of puparia or during laboratory incubation would have been detected by PCR. Because PCR (using the primers chosen for this study) does not detect pathogens, mortality caused by probing by parasitoids, or other factors known to contribute to host pupal mortality, the roles of those mortality factors were not determined. It appears aborted parasitism may not be the major cause of duds in the Þeld-collected samples. Three Þeld-collected samples from Feedlot M (JD 223 1997) produced double bands before digestion of the PCR product. The sizes of the two bands were similar to PCR products produced by Muscidifurax spp. and Spalangia spp. The estimated prevalence of S. nigroaenea for this date was greater in the PCR samples (29.7%) than in the emergence samples (11.6%), and conversely the prevalence of Muscidifurax species was greater in emergence samples (19.7%) than in the PCR samples (16.2%) (Table 3). A similar pattern was ev-

Unknown

Total % parasitism

Emg (%)

PCR (%)

Emg (%)

PCR (%)

PCR

Emg

0 (0.0) 1 (0.7) 1 (0.3) 0 (0.0) 5 (3.6) 2 (1.2)

0 (0.0) 2 (3.4) 18 (16.2) 7 (3.7) 20 (10.9) 2 (2.4)

0 (0.0) 9 (6.0) 58 (19.7) 10 (3.3) 25 (18.0) 12 (6.9)

0 (0.0) 0 (0.0) 1 (0.9) 1 (0.5) 4 (2.2) 0 (0.0)

11.1 22.0 51.4 22.9 52.5 16.9

0.0 16.7 31.6 28.6 33.8 27.6

0 (0.0) 0 (0.0) 0 (0.0) 9 (0.8)

0 (0.0) 0 (0.0) 1 (10.0) 50 (7.5)

7 (8.0) 0 (0.0) 0 (0.0) 121 (11.4)

1 (4.3) 0 (0.0) 0 (0.0) 7 (1.1)

39.1 0.0 10.0

26.1 0.0 29.4

1 (1.1) 3 (1.9) 0 (0.0) 0 (0.0) 0 (0.0) 1 (3.6)

0 (0.0) 1 (1.6) 1 (11.1) 0 (0.0) 0 (0.0) 1 (13.0)

0 (0.0) 4 (2.7) 0 (0.0) 0 (0.0) 0 (0.0) 3 (10.7)

0 (0.0) 1 (1.6) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0)

5.5 18.0 22.2 0.0 55.6 15.4

6.8 11.5 7.7 0.0 0.0 35.7

1 (1.4) 0 (0.0) 0 (0.0) 7 (1.2)

0 (0.0) 0 (0.0) 0 (0.0) 3 (0.7)

0 (0.0) 0 (0.0) 0 (0.0) 7 (1.2)

0 (0.0) 0 (0.0) 0 (0.0) 1 (0.2)

31.9 14.6 4.7

31.4 23.4 11.5

ident on JD 261 at this site. This may indicate multiparasitism of S. calcitrans pupae by Muscidifurax spp. and S. nigroaenea. Because parasitoid development is arrested in the PCR samples by freezing puparia 24 h after collection, Muscidifurax spp. eggs and larvae resulting from later oviposition may not have reached an adequate level of development for detection by PCR. In puparia held for adult emergence, Muscidifurax spp. would more likely complete development (Propp and Morgan 1983) and emerge. The few samples that produced double bands may have occurred when both species had reached comparable sizes and the primers ampliÞed DNA from both species. This may suggest that a portion of the duds in the emergence samples may have resulted from the presence of S. nigroaenea and Muscidifurax spp. in the same puparium and the inability of either species to complete development. In summary, this work established the potential usefulness and the limitations of PCR-based methods for studying parasitism. Parasitoid-speciÞc primers ampliÞed only parasitoid DNA and allowed detection of pteromalid parasitism of house ßy pupae within 24 h of parasitoid oviposition. The use of restriction enzymes, particularly TaqI, produced RFLPs that allowed identiÞcation of the species of parasitoids that commonly attack house ßies and stable ßies in Illinois. Such PCR-based methods of detecting parasitism offer unique opportunities. In the study and practice of biological control of house ßies and the stable ßies by inoculative or inundative releases of parasitoids, the use of these approaches would allow immediate assessments of parasitoid abundance without the need

January 2002


to hold puparia for adult emergence. Such “real-time” knowledge of levels of parasitism would provide an earlier understanding of the impacts of previous parasitoid releases and, perhaps more importantly, allow timely Þne-tuning of further releases. For the maintenance of species purity and detection of contamination in commercial production (rearing) of ßy parasitoids and perhaps many other organisms used in biological control, PCR-based identiÞcation of samples taken from a colony might be more convenient or more accurate in some instances than identiÞcations based on morphological characteristics. PCR-based approaches might also allow novel studies of parasitoid-host relationships. Because it appears that these methods detect the presence of two parasitoid species in or on a single host, they might be used in studies of multiple parasitism and competition. In addition, PCR-based approaches to detecting parasitism might allow researchers to study the relative susceptibility of parasitized versus healthy individuals to other mortality factors. Samples from different populations could be assayed to determine frequencies of parasitism, then subsequent mortality rates could be measured and compared. PCR-based methods would identify parasitism in hosts that might encapsulate the parasitoid or die of other causes; parasitism would not be detected in these hosts if they were reared to allow parasitoid emergence. PCR-based approaches might even be used to study the diet preferences of arthropod predators by extracting DNA from their gut contents (though ELISA may be more useful and robust in many such studies). Polymerase chain reaction-based assessments of parasitism will be limited by certain factors. In this work, degradation of DNA in puparia in which the ßy host and the parasitoid had been dead for only 4 d resulted in failure of PCR to detect parasitoid presence. In studies of the biological control of pupal parasitoids of muscoid ßies, this limitation is signiÞcant because it means that the full role of parasitoids in the occurrence of duds often will not be detected. Degradation is less likely to limit the utility of PCR in studying parasitism of mobile stages of insects, because whether or not such insects are alive at the time of collection is readily discernible; this is not true for the collection of ßy puparia or the collection of eggs of many insect species. PCR-based methods also fail to detect the role of parasitoids in killing hosts simply by stinging them but not ovipositing in them. Where venom is injected by the parasitoid, as Wylie (1971) suggested is true for pteromalids attacking ßy pupae, ELISA may provide more information than PCRbased approaches. Understanding the limitations as well as the beneÞts of PCR-based approaches to studying parasitism will allow their successful use. Acknowledgments We thank David Lampe (Duquesne University) and Kim Walden (University of Illinois) for their technical advice, Todd Fulton and Dot Houchens (University of Illinois) for their assistance with insect rearing, Sandy Osterbur (Uni-

59

versity of Illinois) for her assistance with manuscript preparation, and Christopher Pierce (University of Illinois) and Godrey Kagezi (International Institute of Tropical Agriculture) for their assistance with Þeld sample collections. This work was supported in part by a grant from the USDA North Central Region Integrated Pest Management Program, The University of Illinois Campus Research Board and Hatch Project ILLU-15-0361.

References Cited Amornsak, Q., G. Gordh, and G. Graham. 1998. Detecting parasitised eggs with polymerase chain reaction and DNA sequence of Trichogramma australicum Girault (Hymenoptera: Trichogrammatidae). Aust. J. Entomol. 37: 174 Ð 179. Anonymous. 1964. Pictorial keys to some arthropods and mammals of public health importance. United States Department of Health, Education, and Welfare, Public Health Service, Communicable Disease Center, Atlanta, GA. Bruce, W. N., and G. C. Decker. 1958. The relationship of stable ßy abundance to milk production in dairy cattle. J. Econ. Entomol. 51: 269 Ð274. Campbell, J. B., I. L. Berry, D. J. Boxler, R. L. Davis, D. C. Clanton, and G. H. Deutscher. 1987. Effects of stable ßies (Diptera: Muscidae) on weight gain and feed efÞciency on feedlot cattle. J. Econ. Entomol. 80: 117Ð119. Campbell, J. B., D. J. Boxler, J. I. Shugart, D. C. Clanton, and R. Crookshank. 1981. Effects of house ßies on weight gains and feed efÞciency on yearling heifers on Þnishing rations. J. Econ. Entomol. 74: 94 Ð95. Campbell, J. B., R. G. White, J. E. Wright, R. Crookshank, and D. C. Clanton. 1977. Effect of stable ßies on weight gains and feed efÞciency on calves on growing or Þnishing rations. J. Econ. Entomol. 70: 592Ð594. Collins, F. H., and S. M. Paskewitz. 1996. A review of the use of ribosomal DNA (rDNA) to differentiate among cryptic Anopheles species. Insect. Mol. Biol. 5: 1Ð9. Fenton, B., G. Mallock, and E. Moxey. 1997. Analysis of eriophyid mite rDNA internal transcribed spacer sequences reveals variable simple sequence repeats. Insect Mol. Biol. 6: 23Ð32. Hoebeke, E. R., and D. A. Rutz. 1988. Trichomalopsis dubius (Ashmead) and Dibrachys cavus (Walker): newly discovered pupal parasitoids (Hymenoptera: Pteromalidae) of house ßies and stable ßies associated with livestock manure. Ann. Entomol. Soc. Am. 81: 493Ð 497. Hogsette, J. A., and J. P. Ruff. 1985. Stable ßy (Diptera: Muscidae) migration in northwest Florida. Environ. Entomol. 14: 170 Ð175. Iwasa, M., S. Makino, H. Asakura, H. Kobori, and Y. Morimoto. 1999. Detection of Esherichia coli O157:H7 from Musca domestica (Diptera: Muscidae) at a cattle farm in Japan. J. Med. Entomol. 36: 108 Ð112. Jones, C. J. 1995. Recreation, tourists and (yuck) bugs. Wing Beats Spring: 17Ð20. Jones, C. J., J. A. Hogsette, R. S. Patterson, D. E. Milne, G. D. Propp, J. F. Milio, L. G. Rickard, and J. P. Ruff. 1991. Origin of stable ßies (Diptera: Muscidae) on west Florida beaches: electrophoretic analysis of dispersal. J. Med. Entomol. 28: 787Ð795. Jones, C. J., S. A. Isard, and M. R. Cortinas. 1999. Dispersal of synanthropic Diptera: lessons from the past and technology for the future. Ann. Entomol. Soc. Am. 92: 829 Ð 839. Jones, C. J., R. S. Patterson, and D. E. Milne. 1987. Electrophoretic comparisons of isozymes from selected popula-

60


tions of Stomoxys calcitrans (Diptera: Muscidae). J. Med. Entomol. 24: 54 Ð 60. Jones. C. J., and R. A. Weinzierl. 1997. Geographical and temporal variation in pteromalid (Hymenoptera: Pteromalidae) parasitism of stable ßy and house ßy (Diptera: Muscidae) pupae collected from Illinois cattle feedlots. Environ. Entomol. 26: 421Ð 432. Meyer, J. A., B. A. Mullens, T. L. Cyr, and C. Stokes. 1990. Commercial and naturally occurring ßy parasitoids (Hymenoptera: Pteromalidae) as biological control agents of stable ßies and house ßies (Diptera: Muscidae) on California dairies. J. Econ. Entomol. 83: 799 Ð 806. Petersen, J. J., and J. A. Meyer. 1985. Evaluation of methods presently used for measuring parasitism of stable ßies and house ßies (Diptera: Muscidae) by Pteromalid wasps (Hymenoptera: Pteromalidae). J. Kans. Entomol. Soc. 58: 84 Ð90. Post, R. J., P. K. Flook, and A. L. Millest. 1993. Methods for the preservation of insects for DNA studies. Biochem. Syst. Ecol. 21: 85Ð92. Propp, G. D., and P. B. Morgan. 1983. Multiparasitism of house ßy, Musca domestica L., pupae by Spalangia endius Walker and Muscidifurax raptor Girault & Sanders (Hymenoptera: Pteromalidae). Environ. Entomol. 12: 1232Ð 1238. Ratcliffe, S. T. 1995. rRNA identiÞcation of select calliphorid and sarcophagid ßy species of forensic importance in determining postmortem interval (PMI). M.S. thesis, University of Illinois at Urbana-Champaign. Ratcliffe, S. T. 1999. Assessment of parasitism of house ßy and stable ßy pupae (Diptera: Muscidae) by Pteromalid (Hymenoptera: Pteromalidae) parasitoids using polymerase chain reaction (PCR). Ph.D. dissertation, University of Illinois at Urbana-Champaign. Rueda, L. M., and R. C. Axtell. 1985. Guide to common species of pupal parasites (Hymenoptera: Pteromalidae) of the house ßy and other muscoid ßies associated with poultry and livestock manure. Technical Bulletin 278. North Carolina Agricultural Research Service, North Carolina State University, Raleigh, NC. SAS Institute. 1994. SASÕs userÕs guide: statistics. SAS Institute, Cary, NC. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning. A laboratory manual, 2nd ed., vol. 3. Cold Spring Harbor Laboratory Press, Plainview, NY.

Vol. 39, no. 1

Schlotterer, C., and D. Tautz. 1994. Chromosomal homogeneity of Drosophila ribosomal DNA arrays suggest intrachromosomal exchanges drive concerted evolution. Curr. Biol. 4: 777Ð783. Seymour, R. C., and J. B. Campbell. 1993. Predators and parasitoids of house ßies and stable ßies (Diptera: Muscidae) in cattle conÞnements in west central Nebraska. Environ. Entomol. 22: 212Ð219. Sheppard, D. C., and J. B. Kissam. 1981. Integrated control of house ßies on poultry farms: treatment of house ßy resting surfaces with dißubenzuron plus releases of parasitoid Muscidifurax raptor. J. Ga. Entomol. Soc. 15: 219 Ð 222. Skoda, S. R., and G. D. Thomas. 1992. The stable ßy as a pest of humans, pp. 21Ð24. In G. D. Thomas and S. R. Skoda (eds.), The stable ßy: a pest of humans and domestic animals. Thomas Say Publication. Entomological Society of America, Lanham, MD. Tan, S. W., K. L. Yap, and H. L. Lee. 1997. Mechanical transport of rotavirus by the legs and wings of Musca domestica (Diptera: Muscidae). J. Med. Entomol. 34: 527Ð 531. Taylor, D. B., and A. L. Szalanski. 1999. IdentiÞcation of Muscidifurax spp. by polymerase chain reaction-restriction fragment length polymorphism. Biol. Control. 15: 270 Ð273. Vogler, A. P., and R. DeSalle. 1994. Evolution and phylogenetic information content of the ITS-1 region in the tiger beetle Cicindela dorsalis. Mol. Biol. Evol. 11: 393Ð 405. Weinzierl, R. A., and C. J. Jones. 1998. Releases of Spalangia nigroaenea and Muscidifurax zaraptor (Hymenoptera: Pteromalidae) increase rates of parasitism and total mortality of stable ßy and house ßy (Diptera: Muscidae) pupae in Illinois cattle feedlots. J. Econ. Entomol. 91: 1114 Ð1121. Wylie, H. G. 1971. Oviposition restraint of Muscidifurax zaraptor adult females (Hymenoptera; Pteromalidae) on parasitized house ßy pupae. Can. Entomol. 103: 1537Ð 1544. Received for publication 13 February 2001; accepted 21 June 2001.