Author's personal copy

Insect Biochemistry and Molecular Biology 42 (2012) 806e815

Contents lists available at SciVerse ScienceDirect

Insect Biochemistry and Molecular Biology journal homepage: www.elsevier.com/locate/ibmb

Truncated transcripts of nicotinic acetylcholine subunit gene Bda6 are associated with spinosad resistance in Bactrocera dorsalis Ju-Chun Hsu a, *, Hai-Tung Feng b, Wen-Jer Wu a, c, Scott M. Geib d, Ching-hua Mao a, John Vontas e, ** a

Department of Entomology, National Taiwan University, 27, Lane 113, Roosevelt Road, Sec. 4, Taipei 106, Taiwan Taiwan Agricultural Chemicals and Toxic Substances Research Institute, Council of Agriculture, 11, Kuang Ming Road, Wufeng 413, Taichung City, Taiwan c Research Center for Plant Medicine, National Taiwan University, Taipei, Taiwan d Tropical Crop and Commodity Protection Research Unit, USDA-ARS Pacific Basin Agricultural Research Center, 64 Nowelo Street, Hilo, HI 96720, USA e Faculty of Applied Biology and Biotechnology, Department of Biology, University of Crete, 71409 Heraklion, Greece b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 12 March 2012 Received in revised form 24 July 2012 Accepted 26 July 2012

Spinosad-resistance mechanisms of Bactrocera dorsalis, one of the most important agricultural pests worldwide, were investigated. Resistance levels to spinosad in a B. dorsalis strain from Taiwan were more than 2000-fold, but showed no cross resistance to imidacloprid or fipronil. Combined biochemical and synergistic data indicated that target-site insensitivity is the major resistance component. The gene encoding the nAChR subunit alpha 6 (Bda6), the putative molecular target of spinosad, was isolated using PCR and RACE techniques. The full-length cDNA of Bda6 from spinosad-susceptible strains had an open reading frame of 1467 bp and codes for a typical nAChR subunit. Two isoforms of exon 3 (3a and 3b) and exon 8 (8a and 8b), and four full-length splicing variants were found in the susceptible strain. All transcripts from the spinosad-resistant strain were truncated and coded for apparently non-functional Bda6. Genetic linkage analysis further associated spinosad-resistance phenotype with the truncated Bda6 forms. This finding is consistent with a previous study in Plutella xylostella. Small deletions and insertions and consequent premature stop codons in exon 7 were associated with the truncated transcripts at the cDNA level. Analysis of genomic DNA sequences (intron 2 and exons 3e6) failed to detect exon 5 in resistant flies. In addition, a mutation in Bda6 intron 2, just before the truncated/mis-splicing region and in same location with a mutation previously reported in the Pxyla6 gene, was identified in the resistant flies. RNA editing was investigated but was not found to be associated with resistance. While the demonstration of truncated transcripts causing resistance was outlined, the mechanism responsible for generating truncated transcripts remains unknown. Ó 2012 Elsevier Ltd. All rights reserved.

Keywords: Spinosad RNA editing Bactrocera dorsalis nAChRs Insecticide resistance Deletion

1. Introduction Tephritid flies are a group of poly-phytophagous flies which contain some of the most damaging fruit pests in the world. Among them, the oriental fruit fly Bactrocera dorsalis (Hendel) (Diptera: Tephritidae), which causes severe economic damage in a large variety of economic fruits (Christenson and Foote, 1960) is considered to be one of the most significant pests in the world. The female adults oviposit in a variety of economic fruits causing damage and fruit value loss and the flies are considered to be one of

* Corresponding author. Tel.: þ886 2 233665526; fax: þ886 2 33669910. ** Corresponding author. E-mail addresses: [email protected] (J.-C. Hsu), [email protected] (J. Vontas). 0965-1748/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.ibmb.2012.07.010

the most prominent quarantine pests in the world (Drew and Hancock, 1994). Use of insecticides in bait and cover spray applications is the most common control strategy (Roessler, 1989). Organochlorines, and organophosphates were initially used to control B. dorsalis prior to the introduction of pyrethroids, fipronil and spinosad (Vontas et al., 2011). Spinosad, a natural insecticide derived by the bacterium Saccharopolyspora spinosa (Sparks et al., 1995), was commercially introduced in 1997. It is effective against many insect pests including thrips, flies, beetles, psyllids and grasshoppers, as well as tephritid fruit flies such as Ceratitis spp., Bactrocera spp., Rhagoletis spp. and Dacus spp. ([BCPC] British Crop Protection Council, 2006). It has been used extensively for B. dorsalis control, particularly as an alternative to neurotoxic organophosphates in the last decade (Barry et al., 2006; Vargas et al., 2002, 2008). Spinosad primarily acts at the nicotinic acetylcholine receptors (nAChRs), but at

J.-C. Hsu et al. / Insect Biochemistry and Molecular Biology 42 (2012) 806e815

a different site than neonicotinoids. A secondary site of attack involves not only the g-amino butyric acid (GABA) receptors (Salgado, 1997), but also at a different molecular site than abamectin (Thompson et al., 2000). Due to its distinct mode of action, spinosad is effective against insect populations that have developed target-site resistance against other insecticide classes (Shono and Scott, 2003). However, several insects, such as the diamondback moth Plutella xylostella, the western flower thrips Frankliniella occidentalis, and the domestic fly Musca domestica, have developed high levels of spinosad resistance (Bielza et al., 2007; Kakani et al., 2010; Osorio et al., 2008; Wang et al., 2009; Zhao et al., 2002). Fast rates of development of spinosad resistance over short periods of time have been documented in B. dorsalis, with resistance levels scaling over 400-fold after only 8 generations of laboratory selection (Hsu and Feng, 2006; Shono and Scott, 2003; Wyss et al., 2003; Young et al., 2003). Spinosad resistance in various insect pests has been attributed to three common mechanisms: reduced insecticide penetration; increased rates of insecticide detoxification; and target-site insensitivity (Scott, 1998). Mutations of the nicotinic acetylcholine receptor nAChR alpha 6 subunit, the putative molecular target of spinosad in insects, have been shown to confer high levels of spinosad resistance in Drosophila melanogaster (Perry et al., 2007; Watson et al., 2010) and diamondback moths (Baxter et al., 2010; Rinkevich et al., 2010). In the diamondback moth P. xylostella, truncated Pxyla6 transcripts were associated with spinosad resistance (Baxter et al., 2010; Rinkevich et al., 2010). The nAChRs are members of a diverse super-family of ligandgated ion channels and can play an essential role in the fast excitatory neurotransmission in arthropods and vertebrate nervous systems (Karlin, 2002). Insects have fewer nAChRs numbers (from 10 to 12) (Jones et al., 2006; Sattelle et al., 2005) than vertebrates. However, the insect nAChRs can expand protein diversity through alternative splicing, exon exclusion and A-to-I pre-mRNA editing, mediated by adenosine deaminases (Seeburg, 2002). For example, the alpha 6 subunit in nAChR of D. melanogaster or Tribolium castaneum can produce various transcripts (from dozens to 30,000) by alternative splicing and RNA editing (Grauso et al., 2002; Rinkevich and Scott, 2009; Sattelle et al., 2005). These changes may influence the receptor function (Sattelle et al., 2005) and substantially reduce the affinity of insecticides acting on nAChR subunits with their target sites. In this study, we have obtained a highly spinosad-resistant B. dorsalis strain chosen from prolonged laboratory selection, and have characterized the underlying target-site resistance mechanism. A nAChR alpha 6 subunit (Bda6) that encodes the putative target site of spinosad was cloned. All transcripts from the spinosad-resistant strain, but none from the susceptible parental strain, were truncated and coded for apparently non-functional Bda6. Sequence analysis of cDNA and gDNA was used in order to investigate possible mechanisms responsible for generating the truncated transcripts in the resistant flies. 2. Materials and methods 2.1. Strains The parental (susceptible) strain was collected in Taiwan in 1994 and maintained without selection in the laboratory. The spi-sel strain was derived from the susceptible strain (Hsu and Feng, 2006) and was selected with spinosad for more than 30 consequent generations. The susceptibilities (LD50) to spinosad in both strains were checked every four generations. The susceptible strain still holds equivalent LD50 to wild strains, while the resistant strain (spi-sel) reduces the susceptibility after selection.

807

2.2. Bioassays Analytical and technical grade of spinosad (97% purity), imidacloprid (96%), and fipronil (96%) obtained from Riedel-de Haën Co. (Germany) and Dow AgroSciences (USA) were used. The stock solutions of insecticides were prepared in acetone. The synergists piperonyl butoxide (PBO, 95%, from Chem Services Inc.), an inhibitor of cytochrome P450 monooxygenases and carboxylesterases, S,S,Stributyl phosphorotrithioate (DEF, 98%, from Chem Services Inc.), an inhibitor of esterases and cytochrome P450 monooxygenases and diethyl maleate (DEM, 97%, from Aldrich Chemical Co.) an inhibitor of glutathione transferases (GSTs), were used to investigate the effect of inhibition of detoxification enzymes on spinosad resistance. Bioassays were performed by topical application in 3e5-d old adult flies as described in Hsu et al. (2004). One microliter of the synergist (1 mg/ml) or acetone was applied onto the dorsal thoracic tergum of adult flies 2 h before the spinosad application. All treated flies were maintained at a temperature of 24 2 C and in a 12:12 h (L:D) photoperiod. Five to six doses were tested with two replications of 20 individuals for each dose. Mortality was scored 24 h post-treatment and the data were analyzed by probit analysis (LeOra Software, 1987). Resistance ratio (RR) is given as the ratio of the resistant LD50:susceptible LD50. 2.3. Biochemical assays Dissected abdomens (500 mg) of 3e5-d old adult flies were homogenized, filtered and centrifuged at 10,000g for 10 min, and 100,000g for 1 h at 4 C, and the extract supernatant was used for esterase and GST assays. The re-suspension from the pellet was used for the mixed function oxidase (MFO) assay. The EST activity was measured using the Van Asperen (1962) method. One microgram total protein was incubated with 938 mM concentration of a- or b-naphthyl acetate and naphthol products were then measured in a Benchmark microplate reader (Bio-Rad; Hercules, CA). The GST activity was assessed following the methods described by Habig et al. (1974) with some modifications (Ahmed and Wilkins, 2002). The enzyme solution was incubated with 1.36 mM reduced glutathione and 1.80 mM CDNB or 0.60 mM DCNB. The change in the wavelength of 340 nm was measured kinetically in a Lambda 45 UV/VIS spectrophotometer (PerkinElmer Instruments). The O-deethylation of 7-ethoxy-4-trifluoromethylcoumarin by B. dorsalis cytochrome P450 monooxygenases was measured according to Stumpf and Nauen (2001), using 150 mg microsomal homogenates and 160 mM 7-ethoxycoumarin as substrate. The activity was detected on a fluorescence microplate reader (Thermo Labsystems, Waltham, MA). The protein concentration in the enzyme source was determined according to Bradford (1976), using bovine serum albumin as a standard, to normalize activities for protein concentration. All enzymatic assays were repeated five times. The mean activity values were compared between the resistant and the susceptible strains, by two-tailed Student’s t-test and differences were considered significant at a ¼ 0.05. 2.4. Extraction of RNA, cDNA synthesis, cloning of nAChR Bda6, and sequencing Total RNA was extracted from the heads of 15 flies (3e5 day old adults) from the susceptible strain, using a microscale total RNA extraction kit (RNA spin Mini Kit, GE Healthcare, Germany). One to five microgram of total RNA was used for first strand synthesis of poly(A) cDNA using the MMLV High Performance Reverse Transcriptase and an oligo(dT) primer (Epicenter, USA), according to the manufacturer’s instructions.

808


Partial cDNA of the nAChRa6 gene (Bda6) of B. dorsalis was amplified by PCR using primers designed on conserved regions of published cDNA sequences of nAChR a5e7 genes from other insects (D. melanogaster Dma5 e AF272778, Dma6 e AF321446, Dma7 e AJ554210, Apis mellifera Ama6 e DQ026036, M. domestica Mda5 e EF203213, Mda6 e DQ498129, and Myzus peri Mpa7 e AJ880086). The primer pairs are Bd6F1 and Bd6R1. The PCR amplification reaction consisted of 2 ml of the first strand cDNA reaction mix as a template, 1 ml of 10 mM of primers, 0.2 mM dNTPs, 1.5 mM MgCl2, and 1 units Platinum Taq DNA polymerases (Invitrogen) in a 50 ml reaction. Cycling conditions were 95 C for 5 min followed by 40 cycles of 95 C for 30 s, 55 C for 30 s and 72 C for 1.5 min and a final extension of 72 C for 7 min in a thermal cycler (Model 2720, AB). The amplified PCR products were ligated with T4 DNA ligase for subcloning into the Bluescript plasmid vector (Yeastern Biotech, Taiwan) and sequenced in both directions. On the basis of partial Bda6 fragment, as indicated by BLAST search, specific primers were designed. Partial fragments were BLASTn searched against a draft genome assembly of B. dorsalis (www.bactrobase.org) to assist in construction of primers to extend the sequence using 50 and 30 RACE (rapid amplification of cDNA ends) using the SMARTerÔ RACE cDNA Amplification kit (Clontech, Mountain View, CA) to amplify the cDNA with complete open reading frame.

PCR-based genotyping was performed using two primer pairs (Bd6F1d/Bd6R1d and Bd6FSS1/Bd6RSS1) (Table S1). The Bd6F1d and Bd6R1d primers bridge across the truncate region so the fulllength variant is capable of producing a larger PCR product than the truncated form. A second approach was also taken where a primer pair, Bd6FSS1 and Bd6RSS1, were designed within the Bda6 truncated region, to produce a PCR product only in the case of transcripts without the truncation. Pearson correlation was used to investigate the relationship between the LD50 to spinosad and the ratio of Bda6 gene truncated in the cross and reciprocal crosses populations. 2.7. Genomic sequences of Bda6 partial exons and RNA editing analysis Amplification of the genomic sequences of Bda6 intron 2 and exons 3e6 were performed using genomic DNA from individual flies as the template for PCR. Each exon was amplified by specific primer pairs which were designed from the Bda6 genomic data which were deposited at the latest stages of this study (www.bactrobase.org). The primers used are listed in Table S1. The A-to-I RNA editing was assayed by comparing the genomic DNA and cDNA sequences of Bda6, and recording the nucleotide changes (from A in genomic DNA to G in cDNA).

2.5. Sequences analysis 3. Results The nucleotide sequence similarity searches were performed using BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cg). ClustalW multiple sequence alignment (Thompson et al., 1994) with other insect nAChR subunits were performed with BioEdit software (Hall, 1999). Phylogenetic analysis was performed using the MEGA 3.1 software (Kumar et al., 2004). The analysis was done with the neighbor-joining method with Poisson correction and pairwise deletion. The bootstrap values were calculated from 1000 replications. The calculated molecular weight and isoelectric point of the putative protein encoded by Bda6 were predicated by Compute pI/Mw tool in ExpASY Server (http://web.expasy.org/compute_pi/). The N-terminal signal peptide was predicted by SignalP 4.0 (Petersen et al., 2011) and the putative N-glycosylation sites and the potential phosphorylation sites were predicted using Prosite (Sigrist et al., 2010). 2.6. Comparison of Bda6 sequences and test for genetic linkage between truncated forms and resistance to spinosad For comparison of the Bda6 transcripts between susceptible and resistant strains, total RNA was extracted from heads of single individual 3e5 d old adult flies and using the MMLV High Performance Reverse Transcriptase and an oligo(dT) primer (Epicenter, USA) to cDNA. The primer pair Bd6UTRF1 and Bd6UTRR1 was used for amplification of the full-length open reading frame of Bda6 gene. The amplified PCR products were then subcloned into the plasmid vector and two clones selected for each individual to identify the Bda6 sequence variants. To assess the association of different Bda6 forms with spinosad resistance, one hundred male flies of the spi-sel strain were crossed with 100 female of susceptible strain to produce a hybrid F1 strain. The hybrid F1 random mating resulted in a hybrid F2. The hybrid F1 males were backcrossed to both susceptible and spi-sel strains resulting in a BC-Susp and BC-Spi-sel, respectively. Individuals from the hybrid F1, F2, and backcrossed strains, BC-Susp and BC-Spi-sel, were used in bioassays and subsequently analyzed for the presence of a truncated Bda6 forms by PCR. Bioassay screens were performed with two “diagnostic” doses of spinosad (low dose 300 ng/fly; high dose 5000 ng/fly).

3.1. Characterization of spinosad resistance in the spi-sel strain The spi-sel selected strain exhibited more than 2000-fold resistance to spinosad compared to the susceptible parental strain (Table 1), after selection at the LD80 for more than 30 generations. Cross resistance against fipronil and imidacloprid was negligible (1.4 and 3.0 respectively (Table 1)). Inhibitors of COE, GSTs and P450 MFO did not significantly synergize spinosad resistance (Table 2), whilst COE and GST activities with several substrates were not significantly different in the resistant strain compared to the susceptible (Table 3). MFO activity was 1.67 times lower in the spi-sel strain compared to the susceptible (Table 3). 3.2. Cloning of the B. dorsalis nAChR subunit a6 gene Partial cDNA of the Bda6 was amplified using primers Bd6F1 and Bd6R1. The amplicon was cloned (>10 clones identical obtained) and sequenced. The insert length was four hundred and sixty Table 1 Toxicity of various insecticides in the spinosad-resistant strain (spi-sel) as compared to the susceptible strain (susp) of B. dorsalis. Insecticide strain

Spinosad Susp Spi-sel Imidacloprid Susp Spi-sel Fipronil Susp Spi-sel a

Regression parameters

RR

Slope SE

LD50 (95% FL) (ng/fly)

c2 b

N

2.37 0.26

48.2 (39.6e59.0) >100,000a

4.92 e

280 100

1.65 0.24 1.90 0.26

209 (156e273) 626 (472e796)

2.24 2.35

240 240

3.0

3.82 0.51 4.42 0.55

2.71 (2.36e3.05) 3.87 (3.47e4.34)

1.38 1.01

240 240

1.4

>2000

Mortality at 100,000 ng/fly was below 5% at 72 h post-treatment. A c2 (Chi-squared) test was used to assess how well the individual LD50 values observed in the bioassays agreed with the calculated linear regression strains (LeOra Software, 1987). b

J.-C. Hsu et al. / Insect Biochemistry and Molecular Biology 42 (2012) 806e815 Table 2 Effect of pre-exposure to synergists on susceptibility as a result of spinosad in susceptible (susp) and spinosad-resistant (spi-sel) strains. Synergista

None DEF DEM PBO

RRc

Susceptible strain LD50 (95% FL) (ng/fly)a

SRb

N

40.9 68.1 36.5 43.5

0.60 1.12 0.94

240 240 240 240

(33.6e49.2) (53.1e86.3) (29.1e44.5) (32.8e58.8)

>2445 >1468 >2740 >2299

a

Mortality at 100,000 ng/fly of spinosad to spi-sel strain was 5 5%, 8 7.6%, 8 6.7% and 7 5.7% (mean SD) of the treatments acetone (none), DEF, DEM and PBO at 72 h post-treatment, respectively (100 flies for each treatment). b The LD50 of spinosad in acetone alone/LD50 of insecticide plus synergist. c An RR value is given here as the resistant LD50/the susceptible LD50 with synergist or not.

nucleotides and showed closest homology to the nAChR subunit a6 gene of D. melanogaster. The full-length, 1467 bp open reading frame (Fig. 1) encoding a putative protein of 488 amino acids was amplified from cDNA

809

Table 3 The activities of esterases (EST) glutathione-S-transferase (GST) and mixed function oxidases (MFO) in the laboratory susceptible (susp) and the spinosad-resistance (spi-sel) B. dorsalis strains. MFO 103

Strains

EST

GST

a-naphthyl

b-naphthyl

CDNB

DCNB

7EC

Susp Spi-sel

173 3.8 173 21

150 60 161 13

670 39.9 726 42.4

1.09 0.192 1.31 0.219

12.9 0.588 7.72a 0.335

The results are presented as the means SD (n ¼ 5). The activities of enzymes are given in nmol/min/mg protein. a Significant differences from the susceptible strain by Student t-test (a < 0.05).

from the susceptible B. dorsalis strain by PCR (successful primer pair, among several ones tested: Bd6F1 and Bd6R1 and RACE techniques). This full-length sequence was deposited into GenBank (Bda6, accession no. JN560166). The putative Bda6 cDNA has 85% identity to the same gene in D. melanogaster (AJ554209), and 96% identity at the protein level (AAM13393). The Bda6 has all typical nAChR a subunit characteristics

Fig. 1. The coding sequence and deduced amino acid precursor sequence of nAChRa6 in Bactrocera dorsalis (GenBank Accession no. JN560166). The numbers on the right indicate the nucleotide (upper) and amino acid (lower) position. Exon positions are shown by the numbers following, indicated by the arrows. The predicted N-terminal signal peptide is shown with a dashed line and putative N-glycosylation is boxed. The potential phosphorylation sites are double underlined. The YxCC motif of nAChR a subunit is shaded and neurotransmitter-gated ion-channels signature of cysteines, separated by 13 amino acids, are each marked by inverted triangles. Six ligand-binding loops (D, A, E, B, F, C) are shown with deleted lines and the four transmembrane domains are underlined and labeled in TM1e4, respectively.

810


Fig. 2. Phylogenetic relationships of deduced amino acid sequences of Bda6 (GenBank Accession no. JN560166), Bda5 (partial, JQ973831) and Bda7 (partial, JQ973830) in Bactrocera dorsalis with nAChR subunits of Drosophila (10 subunits) and other insects (1e3 subunits) constructed by the neighbor-joining method. The abbreviation of insect species is as Dm for Drosophila melanogaster (a1: CAA30172; a2: CAA36517; a3: CAA75688; a4: CAB77445; a5: AAM13390; a6: AAM13392; a7: CAD86936; b1: CAA27641; b2: CAA39211; b3: CAC48166), Md for Musca domestica (a6: ABJ09668), Aa for Aedes aegypti (a6: XP 001658863), Bm for Bombyx mori (a6: ABV45518; a7: ABV72689), Px for Plutella xylostella (a6: ADD69773), Tc for Tribolium castaneum (a5: ABS86907; a6: NP 001107773; a7: ABV72697), Am for Apis mellifera (a6: AAY87894), and Nl for Nilaparvata lugens (a6: ACY82689). The partial sequences of Bda5 and Bda7 obtained using the primers Bda57F (50 -CCGCCGACGAGGGGTTTGACGGCAC-30 ) and Bda57R (ACCATGGCGGCGAATTTCCAATC), which were designed based on Dma5 and a7.

(Fig. 1). The mature protein has a calculated molecular weight of 55.48 kDa, an isoelectric point of 5.63, and it has 20 amino acids long N-terminal signal peptide. Two putative N-glycosylation sites and 15 potential phosphorylation sites (including casein kinase II, protein kinase C and cAMP- and cGMP-dependent kinase phosphorylation sites) were predicted. It has the characteristics of neurotransmittergated ion channels with a signature of two cysteines separated by 13 amino acids (Karlin, 2002) and four hydrophobic transmembrane domains (TM1-4) of conserved nAChRs (Le Novere and Changeux, 1995). The Bda6 protein also processes ACh-binding site-forming regions (6 loops, D, A, E, B, F, and C) and the alpha subunit character of YXCC motif (Kao et al., 1984). Insect nAChR a subunits show more sequence similarity to vertebrate neuronal than muscle nAChRs (Grauso et al., 2002). Seven alpha-type nAChR subunits are known to be present in Drosophila sp. and subunits 5e7 are more similar to one another

(from 63 to 71% similarity at the amino acid level) than to other D. melanogaster nAChR subunits (Grauso et al., 2002). In addition, the Bda6 gene shows higher similarity to the same subunit of other various species (from 76 to 96%) than the comparison of different subunits in same species. The phylogenetic relationship of the Bda6 with Insecta sequences is presented in an unrooted phylogenetic tree in Fig. 2. The Bda6 gene shows closest phylogenetic relation with D. melanogaster (96% identity at the amino acid level) and M. domestica (94%), and it is clearly orthologous to the a6 subunits of various other insects including Aedes aegypti (86%), Bombyx mori (84), P. xylostella (83%), T. castaneum (85%), A. mellifera (80%), and Nilaparvata lugens (76%). Based on subsequent BLAST against a draft assembly of the B. dorsalis genome, (www.bactrobase.org), the Bda6 gene has 12 exons. Two putative exon isoforms of exon 3 (3a and 3b) and exon 8

Fig. 3. The transcript structures with variants in Bactrocera dorsalis nAChRa6 from both susceptible and resistant strains. (A) Exon 3, showing 3 variants. (B) Exon 8, showing 2 variants. The underlined amino acid indicates a difference between the two variants.


811

Fig. 4. Summary of nAChRa6 splice variants in resistant and susceptible flies of Bactrocera dorsalis. A. (ieiv) Schematic of the four alternative full-length Bda6 transcripts with all four transmembrane domains (TM1, TM2, TM3 and TM4) from the susceptible strain (susp). Numbered boxes represent the exons of Bda6. (veix). Schematic of the truncated transcripts identified in the resistant flies. The black triangles indicate the approximate location of the premature stop codons. The inverted white triangles indicate the location of the exon 3 splice variant that adds 6 bp (TTTGAG). B. Alternative exons 3 and 8 present in susceptible and resistant B. dorsalis. The detection rate represented numbers of clones, out of ten tested. All the variants of Bda6 have been deposited in GenBank Accession no: JN560166 (i), JN560167 (ii), JN560168 (iii), JN560169 (iv), JN560170 (v), JN560171 (vi), JN560172 (vii), JN560173 (viii), and JN560174 (ix).

(8a and 8b) (Fig. 3) and four alternative full-length splicing variants (ieiv) were present in the susceptible strains (Fig. 4). 3.3. Identification of truncated Bda6 transcripts associated with spinosad resistance In contrast to the full-length variants obtained from all susceptible individuals, all Bda6 transcripts obtained from the spinosad-resistant flies were truncated (Fig. 5). Their length ranged from 1055 to 1100 bp and the deduced amino acid sequence was only 100e117 amino acids. All truncated transcripts (vieix) identified in the resistant flies lack exons 4e6, or 3e6 (Fig. 4), which putatively encode the six ligand-binding loops (Scott, 2008). Two isoforms of exon 3, the 3a and the 3av1 (insertion of 6 bp, TTTGAG) were found in the resistant insects. A deletion of 3a in conjunction with an insertion of 6 bp (TTTGAG) was found in additional transcripts (Fig. 4, vii). All the transcripts found in the resistant flies had premature stop codons in exon 7. To further investigate the association of truncated transcripts with spinosad resistance, we performed a number of crosses and backcrosses, and also developed and used a PCR assay to genotype individual flies for the expression of full vs truncated Bda6 transcripts.

A primer pair, Bd6F1d and Bd6R1d, was designed to span the truncated region in the Bda6 gene. Wild type susceptible individuals produced an amplification product of 740 bp, while resistant individuals a 340 bp respectively. A second approach was also employed using the primer pair, Bd6FSS1 and Bd6RSS1, which amplified a DNA fragment only in the susceptible but not the resistant flies. A number of crosses was performed and the frequencies of truncated forms were analyzed in individual flies after accessing their response to spinosad (Table 4). Survivors of the F1BC-Spi-sel cross (genotypes RS RR, LD50 ¼ 19,700 ng/fly, Table 4) after treatment with 5000 ng/fly spinosad showed a high enrichment of the truncated forms (86%), indicating that the presence of the truncated form is strongly associated with high levels spinosad resistance (Table 4). In contrast, all dead flies of the F1BCSusceptible (genotypes RS SS, LD50 ¼ 161 ng/fly, Table 4) after treatment with 300 ng/fly spinosad had full-length transcripts, indicating that the full-length form is strongly associated with susceptibility at low doses of spinosad. Analysis of the correlation of LD50 values to spinosad and the rates of truncated Bda6 in the several populations generated by the crossing and backcrossing experiments (Table 4) confirmed the strong association between spinosad resistance and truncated

812


Fig. 5. PCR analysis to detect the presence of the full-length or truncated nAChRa6 variants in individuals representing susceptible and resistant genotypes of Bactrocera dorsalis (see text for details of methodology used). A. Diagrammatic representation of the primer pairs locations in two types of variations. The black triangles indicate the approximate location of the premature stop codons. B. Lane 1. Size marker, Lanes 2, 4, 6 contain the products amplified by primer pairs of Bd6F1d/Bd6R1d; Lanes 3, 5, and 7 contain the products amplified by primer pairs of Bd6FSS1/Bd6RSS1; Lanes 2 and 3 contain the product from the homozygous full length of Bda6 (SS); Lanes 4 and 5 contain the product from the heterozygous full-length/truncated Bda6 (SR); Lanes 6 and 7 contain the product from the homozygous truncated Bda6 (RR).

Bda6 rate (Pearson’s correlation coefficient (r) 0.90 (df ¼ 4, P < 0.05)). 3.4. Analysis of gDNA sequences and RNA editing to investigate possible mechanisms responsible for generating the truncated transcripts Sequence analysis of gDNA was used in order to investigate differences and possible mechanisms responsible for generating truncated transcripts in the resistant flies. While no differences observed in exons 3, 4 and 6 (Fig. 6), exon 5 was not detected in resistant flies (amplification was attempted with three different primer pairs designed and tested successfully on gDNA from five susceptible flies), indicating that a deletion of a gDNA fragment might be an underlying factor responsible for the generation of truncated transcripts in the resistant flies. In addition, one mutation (A change to T, Fig. 7) was found in intron 2 of resistant flies, just before the truncated/mis-splicing region. A mutation in the

same location was previously reported in the Pxyla6 gene of highly resistant insects (Baxter et al., 2010). The A-to-I editing in exon 3e6 was also investigated. Only exons 5 and 6 in Bda6 of all tested individuals have A-to-I editing. Four editing sites exist in exon 5 (only present in susceptible flies) while only one exists in exon 6, which is present in both phenotypes (Fig. 7). 4. Discussion We investigated spinosad-resistance mechanisms in a highly resistant B. dorsalis strain from Taiwan (>2000-fold, compared to the parental). Combined bioassay and biochemical data indicated that spinosyns exerts their toxic effect through interactions with nACh receptors in B. dorsalis; target-site insensitivity is also the main mechanism of resistance. The full-length nAChR subunit alpha 6 (Bda6), the putative molecular target of spinosad, was obtained from the susceptible strain by PCR and RACE techniques. It contains a typical extracellular ACh-binding domain and four

Table 4 Truncated Bda6 genotype rates of B. dorsalis individuals used in the populations of cross and reciprocal crosses. Strains

Susp Spi-sel Hybrid F1 (100_ 100\) Hybrid F2 (F1 random mating) F1BC-susceptible (30_F1 100\ Susceptible)a Dead Poisoned Survivor F1BC-spi-sel (30_F1 100\ Spi-sel)a Dead Poisoned Survivor

LD50 (95% FL) ng/fly/RR

41.1 (31.6e66.3)/e >30,000/>730 521 (430e627)/12.7 1500 (1130e2040)/36.5 161 (93.0e242)/3.9

19,700 (10,400e57,800)/479

No

10 10 12 33 42 4 14 12 40 7 9 14

Rate of Bda6 form in cDNA (%) Full-length

Full-length/truncated

Truncated

100 0 0 24 43 100 64 0 0 0 0 0

0 0 100 61 57 0 36 100 50 100 78 14

0 100 0 15 0 0 0 0 50 0 22 86

a Thirty 3e5-d adult flies were randomly picked to treat with diagnostic dose of spinosad. The “diagnostic” dose for F1BC-susceptible population is 300 ng/fly and 5000 for F1BC-spi-sel population. At 24 h post-treatment, the dead flies refer to those that were upside down; the poisoned referred to those flies that still could stand or walk as in normal conditions but could not fly and walk after the cup had been shaken; the survivors were those flies that could still fly and walk normally after the cup had been shaken.


813

Fig. 6. Comparison of Bda6 genomic DNA sequences in intron 2, and exons 3e6 between susceptible and resistant (spi-sel) Bactrocera dorsalis strains. A. One point mutation exists in intron 2 of resistant flies. Intron 2 has 304 nucleotides; nucleotide at position 75 is A in the susceptible strain but T in the resistant strain. B. The size of exons 3, 4 and 6 was identical in both susceptible and resistant flies; exon 5 is absent in resistant flies.

transmembrane segments, and it has all typical nAChR subunit characteristics and high homology to other AChR a6 insect subunits. In contrast to susceptible flies where only full-length transcripts were present, all Bda6 transcripts from the spinosadresistant strain were truncated. No truncated transcripts were found in the spinosad-resistant Bda5 or a7 subunits (unpublished data). To further investigate the association of the truncated transcripts with spinosad resistance in B. dorsalis, we performed a number of crosses and genotyped the progenies after assaying their response to spinosad. A linkage between the full-length and truncated transcripts with spinosad sensitivity and resistance respectively was clearly illustrated. All Bda6 transcripts in the resistant strain coded for a short “predicted” protein (110e117 amino acids, instead of 488 in the susceptible) without any ligand-binding loops and TMs. This change is predicted to destroy the Bda6 protein structure and to result in the loss of the protein function. Our finding is consistent with earlier studies in D. melanogaster, where a truncated a6 variant lacking the TM3 and TM4 cytoplasmic loops, and the extracellular C-terminal tail domains resulted in >1000-fold levels of resistance against spinosad (Perry et al., 2007; Watson et al., 2010). Furthermore, our study is very much in line with the spinosad-resistance mechanism described in recent diamondback moth P. xylostella research, where Pxyla6 transcripts with premature stop codons were implicated in the resistant phenotype (Baxter et al., 2010; Rinkevich et al., 2010). This is the second insect pest where truncated a6 transcripts are associated with

spinosad resistance, and indicates that loss of function of spinosad target variants can be viable and cause strong resistance in insects. Twelve exons are found in the nAChRa6 subunit in most insect species (Baxter et al., 2010; Grauso et al., 2002; Jones et al., 2006), as well as in B. dorsalis. The Bda6 subunit has two variants of exon 3, in line with most known insect species (Grauso et al., 2002; Jin et al., 2007; Rinkevich and Scott, 2009; Sattelle et al., 2005) and two variants of exon 8, in contrast to D. melanogaster and T. castaneum, where three variants (a, b and d) are present (Grauso et al., 2002; Jin et al., 2007; Rinkevich and Scott, 2009). Four full and five truncated alternative transcripts were found in the susceptible and the resistant strains respectively. The role of alternative splicing on nAChR function has yet to be fully understood. However, it is possible that it may alter nAChR ligand-binding properties and ion channel characteristics (Sattelle et al., 2005). Analysis of genomic DNA sequences failed to detect exon 5 in resistant flies, possibly indicating that a deletion may be one of the underlying factors associated with the Bda6 truncated transcript variants and the resistance phenotype. In addition, a mutation in Bda6 intron 2 was discovered just before the truncated/misssplicing region was identified in resistant flies. Although the role/ association of this mutation (if any) with the miss-splicing/ truncated transcript events is not clear, it is interesting that a mutation in the same location was also identified in resistant P. xylostella insects, where resistance was also associated with truncated a6 forms (Baxter et al., 2010).

Fig. 7. Analysis of the A-to-I RNA editing in exons 3e6 of Bda6 in susceptible (susp) and spinosad-resistant (spi-sel) lines of Bactrocera dorsalis. No A-to-I editing was found in exons 3 and 4 in both lines. Numbers before the sequence indicate distance from start codon (Bda6 ORF cDNA). The A labeled in parenthesis is the editing sites in genomic nucleotide.

814


RNA A-to-I editing and alternative splicing are reported to occur in the a3ea7 subunits of insect nAChR (Grauso et al., 2002; Jones et al., 2006; Rinkevich and Scott, 2009; Sattelle et al., 2005). Alternative splicing which generates variable isoforms with functional specific and cause truncated transcripts whose exons are missing or where premature stop codons have been introduced (Grauso et al., 2002; Jones and Sattelle, 2010) are known to be regulated by A-to-I editing (Rueter et al., 1999; Seeburg, 2002). Five A-to-G editing sites are found in Bda6 exons 5 and 6 regions which have amino acids with functionally significant regions (Jones and Sattelle, 2010). The positions of 4 editing in exon 5 is reported in many insect species. D. melanogaster have all the 4 editing sites, and the last three editing sites exist in Heliothis virescens, B. mori and T. castaneum (Jin et al., 2007). Spinosad-resistance mechanisms are variable in insects and they have not been fully elucidated as yet (reviewed in Scott, 2008). The involvement of detoxification enzymes has been associated with spinosad resistance in some insects, such as M. domestica (Scott, 1998), Spodoptera exigua (Wang et al., 2006) and Helicoverpa armigera (Wang et al., 2009). Although the use of synergists and crude biochemical assays with general substrates did not indicate detoxification as a major resistance component in the spinosadresistant B. dorsalis strain, the possibility that detoxification or other mechanisms may also contribute to the main resistance mechanism of the spi-sel strain reported here cannot be excluded. In conclusion, we characterized spinosad resistance in a B. dorsalis strain from Taiwan. Truncated transcripts coding for nonfunctional Bda6 are strongly associated with the resistance phenotype. This finding is consistent with previous studies and confirms that loss of function of spinosad target variants is viable and cause resistance. Analysis of genomic DNA sequences indicated genetic changes (such as deletions and a point mutation in intron 2) that might be associated with the truncated transcripts, however the exact mechanism responsible for generating truncated transcripts and miss-splice variants remains unknown. The Bda6 truncated forms appear to be a prime target for developing molecular diagnostics for detecting/monitoring spinosad resistance in the field. Acknowledgments We thank the Journal editor and two anonymous reviewers for their helpful comments on this manuscript. We thank Dr. G-C Huang for his contributions to the phylogenetic analysis, Miss P. Liu and Miss G. Wang for rearing the materials, Mr. T. Kung and Mr. C-C Chang for performing the Bda6 variants PCR validation and Mr. D. Hou for performing the DNA exons genotypes and Y. Chen for performing the bioassays. This work was supported by the National Science Council of the Republic of China, Taiwan, for the financial support under the contract: 96-2313-B-225-001-MY3 and 1012321-B-225-001. Work performed by JV was supported from funds received by the Greek Ministry of Rural Development and Food. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.ibmb.2012.07.010. References Ahmed, S., Wilkins, R.M., 2002. Studies on some enzymes involved in insecticide resistance in fenitrothion-resistant and -susceptible strains of Musca domestica L. (Dipt, Muscidae). J. Appl. Entomol. 126, 510e516. Barry, J.D., Miller, N.W., Pinero, J.C., Tuttle, A., Mau, R.F.L., Vargas, R.I., 2006. Effectiveness of protein baits on melon fly and oriental fruit fly (Diptera: Tephritidae): attraction and feeding. J. Econ. Entomol. 99, 1161e1167.

Baxter, S.W., Chen, M., Dawson, A., Zhao, J.Z., Vogel, H., Shelton, A.M., Heckel, D.G., Jiggins, C.D., 2010. Mis-spliced transcripts of nicotinic acetylcholine receptor alpha 6 are associated with field evolved spinosad resistance in Plutella xylostella (L.). PLoS Genet. 6, e1000802. [BCPC] British Crop Protection Council, 2006. The e-Pesticide Manual, 14th ed. Bielza, P., Quinto, V., Contreras, J., Torne, M., Martin, A., Espinosa, P.J., 2007. Resistance to spinosad in the western flower thrips, Frankliniella occidentalis (Pergande), in greenhouses of south-eastern Spain. Pest Manag. Sci. 63, 682e687. Bradford, M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248e254. Christenson, L.D., Foote, R.H., 1960. Biology of fruit flies. Annu. Rev. Entomol. 5, 171e192. Drew, R.A.I., Hancock, D.L., 1994. The Bactrocera dorsalis Complex of Fruit Flies (Diptera: Tephritidae: Dacinae) in Asia. CAB International, Wallingford, Oxon, UK. Grauso, M., Reenan, R.A., Culetto, E., Sattelle, D.B., 2002. Novel putative nicotinic acetylcholine receptor subunit genes, Dalpha5, Dalpha6 and Dalpha7, in Drosophila melanogaster identify a new and highly conserved target of adenosine deaminase acting on RNA-mediated A-to-I pre-mRNA editing. Genetics 160, 1519e1533. Habig, W.H., Pabst, M.J., Jakoby, W.B., 1974. Glutathione S-transferases. The first enzymatic step in mercapturic acid formation. J. Biol. Chem. 249, 7130e7139. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95e98. Hsu, J.C., Feng, H.T., 2006. Development of resistance to spinosad in oriental fruit fly (Diptera: Tephritidae) in laboratory selection and cross-resistance. J. Econ. Entomol. 99, 931e936. Hsu, J.C., Feng, H.T., Wu, W.J., 2004. Resistance and synergistic effects of insecticides in Bactrocera dorsalis (Diptera: Tephritidae) in Taiwan. J. Econ. Entomol. 97, 1682e1688. Jin, Y., Tian, N., Cao, J., Liang, J., Yang, Z., Lv, J., 2007. RNA editing and alternative splicing of the insect nAChR subunit alpha6 transcript: evolutionary conservation, divergence and regulation. BMC Evol. Biol. 7, 98. Jones, A.K., Sattelle, D.B., 2010. Diversity of insect nicotinic acetylcholine receptor subunits. In: Thany, S.H. (Ed.), Insect Nicotinic Acetylcholine Receptors. Landes Bioscience and Springer Science þ Business Media, LLC, Texas, pp. 24e43. Jones, A.K., Raymond-Delpech, V., Thany, S.H., Gauthier, M., Sattelle, D.B., 2006. The nicotinic acetylcholine receptor gene family of the honey bee, Apis mellifera. Genome Res. 16, 1422e1430. Kakani, E.G., Zygouridis, N.E., Tsoumani, K.T., Seraphides, N., Zalom, F.G., Mathiopoulos, K.D., 2010. Spinosad resistance development in wild olive fruit fly Bactrocera oleae (Diptera: Tephritidae) populations in California. Pest Manag. Sci. 66, 447e453. Kao, P.N., Dwork, A.J., Kaldany, R.R., Silver, M.L., Wideman, J., Stein, S., Karlin, A., 1984. Identification of the alpha subunit half-cystine specifically labeled by an affinity reagent for the acetylcholine receptor binding site. J. Biol. Chem. 259, 11662e11665. Karlin, A., 2002. Emerging structure of the nicotinic acetylcholine receptors. Nat. Rev. Neurosci. 3, 102e114. Kumar, S., Tamura, K., Nei, M., 2004. MEGA3: an integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Brief. Bioinform. 5, 150e163. Le Novere, N., Changeux, J.P., 1995. Molecular evolution of the nicotinic acetylcholine receptor: an example of multigene family in excitable cells. J. Mol. Evol. 40, 155e172. LeOra Software, 1987. Polo-PC: A User’s Guide to Probit or Logit Analysis. LeOra Software, Berkeley, CA. Osorio, A., Martinez, A.M., Schneider, M.I., Diaz, O., Corrales, J.L., Aviles, M.C., Smagghe, G., Pineda, S., 2008. Monitoring of beet armyworm resistance to spinosad and methoxyfenozide in Mexico. Pest Manag. Sci. 64, 1001e1007. Perry, T., McKenzie, J.A., Batterham, P., 2007. A Dalpha6 knockout strain of Drosophila melanogaster confers a high level of resistance to spinosad. Insect Biochem. Mol. Biol. 37, 184e188. Petersen, T.N., Brunak, S., von Heijne, G., Nielsen, Henrik, 2011. SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat. Methods 8, 785e786. Rinkevich, F.D., Scott, J.G., 2009. Transcriptional diversity and allelic variation in nicotinic acetylcholine receptor subunits of the red flour beetle, Tribolium castaneum. Insect Mol. Biol. 18, 233e242. Rinkevich, F.D., Chen, M., Shelton, A.M., Scott, J.G., 2010. Transcripts of the nicotinic acetylcholine receptor subunit gene Pxyl alpha 6 with premature stop codons are associated with spinosad resistance in diamondback moth, Plutella xylostella. Invertebr. Neurosci. 10, 25e33. Roessler, Y., 1989. Insecticidal bait and cover sprays. In: Robinson, A.S., Hopper, G. (Eds.), Fruit Flies: Their Biology, Natural Enemies, and Control, vol. 3B. Elsevier Science Publishers, Amsterdam, pp. 329e336. Rueter, S.M., Dawson, T.R., Emeson, R.B., 1999. Regulation of alternative splicing by RNA editing. Nature 399 (6731), 75e80. Salgado, V.L., 1997. The modes of action of spinosad and other insect control products. Down to Earth 52, 35e43. Sattelle, D.B., Jones, A.K., Sattelle, B.M., Matsuda, K., Reenan, R., Biggin, P.C., 2005. Edit, cut and paste in the nicotinic acetylcholine receptor gene family of Drosophila melanogaster. Bioessays 27, 366e376. Scott, J.G., 1998. Toxicity of spinosad to susceptible and resistant strains of house flies, Musca domestica. Pestic. Sci. 54, 131e133.

J.-C. Hsu et al. / Insect Biochemistry and Molecular Biology 42 (2012) 806e815 Scott, J.G., 2008. Unraveling the mystery of spinosad resistance in insects. J. Pestic. Sci. 33, 221e227. Seeburg, P.H., 2002. A-to-I editing: new and old sites, functions and speculations. Neuron 35, 17e20. Shono, T., Scott, J.G., 2003. Spinosad resistance in the housefly, Musca domestica, is due to a recessive factor on autosome 1. Pestic. Biochem. Physiol. 75, 1e7. Sigrist, C.J., Cerutti, L., de Castro, E., Langendijk-Genevaux, P.S., Bulliard, V., Bairoch, A., Hulo, N., 2010. PROSITE, a protein domain database for functional characterization and annotation. Nucleic Acids Res. 38, D161eD166. Sparks, T.C., Thompson, G.D., Larson, L.L., Kirst, H.A., Jantz, O.K., Worden, T.V., Hertlein, M.B., Busacca, J.D., 1995. Biological characteristics of the spinosyns: a new and naturally derived insect control agent. In: Beltwide Cotton Conference. National Cotton Council, San Antonio, TX, pp. 903e907. Stumpf, N., Nauen, R., 2001. Cross-resistance, inheritance, and biochemistry of mitochondrial electron transport inhibitor-acaricide resistance in Tetranychus urticae (Acari: Tetranychidae). J. Econ. Entomol. 94, 1577e1583. Thompson, G.D., Dutton, R., Sparks, T.C., 2000. Spinosad e a case study: an example from a natural products discovery programme. Pest Manag. Sci. 56, 696e702. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL-W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673e4680. Van Asperen, K., 1962. A study of house fly esterases by means of a sensitive colorimetric method. J. Insect Physiol. 8, 401e416. Vargas, R.I., Miller, N.W., Prokopy, R.J., 2002. Attraction and feeding responses of Mediterranean fruit fly and a natural enemy to protein baits laced with two novel toxins, phloxine B and spinosad. Entomol. Exp. Appl. 102, 273e282.

815

Vargas, R.I., Stark, J.D., Hertlein, M., Neto, A.M., Coler, R., Pinero, J.C., 2008. Evaluation of SPLAT with spinosad and methyl eugenol or cue-lure for “attract-andkill” of oriental and melon fruit flies (Diptera: Tephritidae) in Hawaii. J. Econ. Entomol. 101, 759e768. Vontas, J., Hernandez-Crespo, P., Margaritopoulos, J.T., Ortego, F., Feng, H.T., Mathiopoulos, K.D., Hsu, J.C., 2011. Insecticide resistance in tephritid flies. Pestic. Biochem. Physiol. 100, 199e205. Wang, D., Qiu, X.H., Ren, X.X., Zhang, W.C., Wang, K.Y., 2009. Effects of spinosad on Helicoverpa armigera (Lepidoptera: Noctuidae) from China: tolerance status, synergism and enzymatic responses. Pest Manag. Sci. 65, 1040e1046. Wang, W., Mo, J., Cheng, J., Zhuang, P., Tang, Z., 2006. Selection and characterization of spinosad resistance in Spodoptera exigua (Hübner) (Lepidoptera: Noctuidae). Pestic. Biochem. Physiol. 84, 180e187. Watson, G.B., Chouinard, S.W., Cook, K.R., Geng, C.X., Gifford, J.M., Gustafson, G.D., Hasler, J.M., Larrinua, I.M., Letherer, T.J., Mitchell, J.C., Pak, W.L., Salgado, V.L., Sparks, T.C., Stilwell, G.E., 2010. A spinosyn-sensitive Drosophila melanogaster nicotinic acetylcholine receptor identified through chemically induced target site resistance, resistance gene identification, and heterologous expression. Insect Biochem. Mol. Biol. 40, 376e384. Wyss, C.F., Young, H.P., Shukla, J., Roe, R.M., 2003. Biology and genetics of a laboratory strain of the tobacco budworm, Heliothis virescens (Lepidoptera: Noctuidae), highly resistant to spinosad. Crop Prot. 22, 307e314. Young, H.P., Bailey, W.D., Roe, R.M., 2003. Spinosad selection of a laboratory strain of the tobacco budworm, Heliothis virescens (Lepidoptera: Noctuidae), and characterization of resistance. Crop Prot. 22, 265e273. Zhao, J.Z., Li, Y.X., Collins, H.L., Gusukuma-Minuto, L., Mau, R.F.L., Thompson, G.D., Shelton, A.M., 2002. Monitoring and characterization of diamondback moth (Lepidoptera: Plutellidae) resistance to spinosad. J. Econ. Entomol. 95, 430e436.