Autosomal Recessive Chronic Granulomatous ...

Autosomal Recessive Chronic Granulomatous Disease With Absence of the 67-kD Cytosolic NADPH Oxidase Component: Identification of Mutation and Detection of Carriers By Martin de Boer, Petra M. Hilarius-Stokman,Johann-Peter Hossle, Arthur J . Verhoeven, Norbert Graf, Richard T. Kenney, Reinhard Seger, and Dirk Roos Chronic granulomatous disease (CGD) is characterized by the failure of phagocytic leukocytes to kill certain bacteria and fungi. This is caused by deficiencies in one of the components of NADPH oxidase, the enzyme in phagocytic leukocytes that generates superoxide. In a rare,autosomal recessive form of CGD, a 67-kD cytosolic component of NADPH oxidase (p67-phox) is missing. Until now, mutations in thegene coding for this protein have not been identified. We nowreport on a 10-year-old girl with lymph node and liver abscesses who wasrecognized as an A67' CGD patient by lack of NADPH oxidase activity in her granulocytes, a cytosolic defect in a cell-free oxidase system, and lack of immunoreactive material with an antiserum against the p67-phox protein. mRNA for this protein was present

in normal amounts in her monocytes. This p67-phox mRNA was reverse-transcribed, and the coding region was amplified by polymerase chain reaction in six overlapping fragments and was sequenced. The patient appeared to be homozygous for a G-233 + A mutation, resulting in a nonconservative amino acid change (78Gly -* Glu). This mutation was also found in the genomic DNA of this patient butnot in that of 3 8 normal donors. Both parents and a sister proved to be carriers of the disease, as deduced from the mutation only in one allele. The carrier state was also manifested by intermediate superoxide production by their intact granulocytes and in the cell-free system. 0 1994 by The American Society of Hematology.

C

type of CGD (A47' CGD),3.6.7with an estimated incidence of about 30%. Finally, absence of the 67-kD protein (p67phox) is found in the rare A67' subtype of CGD,3,8,9constituting about 5% of the patients. Although the mRNAnucleotide sequence of p67-phox has been published," mutations in patients with A67' CGD have not been reported so far. We have now identified for the first time a mutation in p67phox in a patientwith A67' CGD. Moreover, two polymorphisms inthe p67-phox mRNA are described.

HRONIC GRANULOMATOUS disease (CGD) is a rare syndrome clinically characterized by recurrent, life-threatening pyogenic infections, with bacteria and fungi, of subcutaneous tissues, upper airways, lungs, bones, spleen, liver and lymph nodes.' This disease is caused by the inability of the patients' phagocytes (neutrophilic granulocytes, eosinophilic granulocytes, monocytes, and macrophages) to generate superoxide, aprecursor of reactive oxygen metabolites essential for the killing of various microorganisms. In normal phagocytes, the enzyme NADPH oxidase starts to produce superoxidewhen the cells are activated, eg, by phagocytosis of microorganisms. This enzyme is composed of several subunits, someof which are localized in the plasma membrane and others (in resting cells) in the cytosol.* During phagocytosis, the cytosolic components translocate to theplasma membrane andintegrate with the membrane-bound components into anenzymatically active complex. Defects inany of the four NADPH oxidase components cause inactivity of the enzyme, thus leading to CGD.3 The two membrane-bound components of NADPH oxidase are the a and p subunits of cytochrome 6 5 5 8 , a flavocytochrome involved in the reduction of molecular oxygen to superoxide with electrons derived from NADPH?%5Mutations in the p subunit of cytochrome b558 (gp9 l -&x) lead to X-linked CGD,3 the most common form of this disease, which is found in about 60% of the patients. Depending on the presence of normal or decreased levels of the gp9 I -phox protein, or on thetotal absence of this protein, this formof CGD is designated X9 l+, X9 I-, or X9 1' CGD, respectively. Mutations in the a subunit of cytochrome 6 5 5 8 (p22-phox) lead to a rare, autosomal recessive form of CGD. This subtype is found in about 5% of the patients and exists in the A22+ and theA22' form.3 The 47-kD andthe 67-kD cytosolic components of NADPH oxidase probably function by inducing a conformational change in cytochrome 6558, required for enzymatic activity. Mutations in the gene encoding the 47-kD protein (p47-phox) lead to the common autosomal recessive Blwd, Vol83, No 2 (January 15). 1994: pp 531-536

CLINICAL HISTORY

N.K., a girl, was born in 1982 after an uneventful delivery from nonconsanguineous, healthy parents. An older brother ofN.K. died at the age of 6 years from bilateral pneumonia with a history of recurrent lymph node abscesses and failure to thrive. At autopsy, multiple granulomas and pigmented histiocytes were found. N.K. had disseminated pyoderma after birth. After two cervical lymph node abscesses at 13 and 2 l months ofage, and a single liver abscess (right lobe) at 33 months of age, the diagnosis of CGD was confirmed in the dystrophicchild by completely absent nitrobluetetrazolium (NBT) reduction and Oi formation by her granulocytes. Under continuouscotrimoxazole prophylaxis, no further infections

From the Central Laboratory ofthe Netherlands Red Cross Blood Transfusion Service and Laboratoryfor Experimentaland Clinical Immunology of the University of Amsterdam, Amsterdam, The Netherlands; the Division for Immunology/Haematology. University Children2 Hospital, Zurich, Switzerland; the Department of Hematology/Oncology, University Children 2 Hospital, Homburg/ Saar, Germany;and the Laboratory of Host Defenses, National Institute for Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD. Submitted May 4,1993;accepted September IO, 1993. Address reprint requests to Dirk Roos, PhD, Plesmanlaan 125, 1066 CXAmsterdam, TheNetherlands. The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with18 U.S.C. section I734 solely to indicate thisfact. 0I994 by The American Society of Hematology. 0006-4971/94,/8302-0004$3.00/0 53 1

532

DEBOERET

Table 1. Detection of Heterozygotes 0;Productionby Intact PMN' PMA (10 ng/mL)

PMA/FMLPt

Controls(n=4) 8 . 3 ~ 0 . 3 18.621.5 Mother 3.56.4.46 11.0, 11.8 Father 2.16 9.8 Sister 2.24 12.0

Ratio*

2.15t0.12 2.64.3.09 4.35 5.38

CB/FMLP§

13.8~2.7 13.7 11.8 12.9

0; Productionby Cell-Free Svstemll Controls (n = 3) Mother Father Sister

28.8 rt 4.6 15.4 16.5 15.4

In nanomoles perlo6neutrophils per minute;controls, mean ? SD. t First addition, PMA(10 ng/mL); second addition, FMLP (1 pmol/L). t Ratio between activity found with PMA FMLP and activity found with PMA alone. 5 First addition, CB (5 pg/mL); secondaddition, FMLP (1 pmol/L). 11 In nanomoles per milligram of cytosolic protein per minute;controls, mean L SD.

+

occurred; recombinant human y-interferon was administered at a dose of 50 pg/m2 3 times per week subcutaneously for I year, but then had to be stopped for discomfort. MATERIALS AND METHODS

Purification of granulocytes. Blood was drawn in acid-citratedextrose (USP formula A) and transported at ambienttemperature. Within 6 hours after blood collection, granulocytes were purified as described previously." Granulocytes (>90% neutrophils and 2% to 10% eosinophils) were suspended in incubationmedium(132 mmol/L NaCI, 6 mmol/L KCI, I .2 mmol/L Na2HP04,1.O mmol/ L CaCI,, 1.0 mmol/L MgSO,, 20 mmol/L HEPES, 5.5. mmol/L glucose, and 0.5% [wt/vol], human albumin [pH7.41). Functional tests. The NBT slide test was performed as previously described.12From eachdonor, 400 cells stained with nuclear fast red wereexamined and scored as formazan-negative or formazan-positive. Superoxide generation was measured by cytochrome c reduction of granulocytes ( 106/mL) in incubation medium containing 60 pmol/L femcytochrome cand 2 mmol/L azide.13Maximal rates of cytochrome c reduction were determined in a Perkin Elmer spectrophotometer (model Lambda 2; Perkin Elmer, Nonvalk, CT). The contents of each cuvette (0.8 mL) were stirred and kept at 37°C. When combinations of stimuli were used (Table l), the second stimulus was administered about 3 minutes after the first stimulus. Maximal rates of cytochrome c reductionwere measured after each addition. Further details are found in Verhoeven et al." The NADPH oxidase activity was also measured in the cell-free activation system.I4 Purified plasma membranes (6 pg of protein) and cytosol ( I 20 pg of protein) from sonicated granulocytes were incubated at 28°C in 800 pL of oxidase buffer containing 75 pmol/ L NaCI, 10 mmol/L HEPES, I pmol/L MgCI2,0.5 pmol/L EGTA, 60 pmol/L ferricytochrome, 2 mmol/L azide, and 10 pmol/L GTPy-S (pH 7.0). The assembly of oxidase components was initiated by the addition of 20 pL of sodium dodecyl sulfate (SDS) to a final concentration of 100 pmol/L. Three minutes later, NADPH was added to a final concentration of 250 pmol/L. The NADPHoxidase activity was determined after the slope of the absorbancechange at

AL

550 nm hadbecomeconstant (between 1 and 2minutesafter NADPH addition). Determination of' NADPH oxidase components. Cytochrome bSssheme spectrum was measured in a Triton X- 100lysate of granulocytes as described previo~sly.'~ The presence ofcytochrome bsss on the surface of intact cells was determined by fluorescence-activated cell sorter (FACS) analysis after bindingof monoclonal antibody 7D5I6and fluorescein isothiocyanate (FITC)-conjugated goatantimouse Ig. The presence of p47-phox and p67-phox was determined on Western blots with antisera specific for either p47-phox or p67phox. These antisera were obtained after immunization of rabbits with synthetic peptides coupled to KLH,containing the C-terminal part of these proteins (SESTKRKLASAV and ATTLESTRREV, respectively). Preparation ($RNA and DNA. Mononuclear leukocytes were purified from 20 to 100 mL of citrated blood by isopycnic centrifugation for 20 minutes at 1,OOOg at 20°C on an isotonic Percoll suspension (Pharmacia Fine Chemicals, Uppsala, Sweden) with a specific gravity of 1.076 g/mL. The cell layer on top of the Percoll suspension was collected and washed twice with phosphate-buffered saline (PBS). The numberof monocytes was calculated from a sizedistribution pattern (Coulter Counter; Coulter,Hialeah, FL). RNA was isolated by dissolving the mononuclear cells in 4 mol/L guanidine thiocyanate and by centrifugation through 5.7 mol/L cesium chloride." Genomic DNA was isolated from circulating bloodleukocytes." Cloning o/p6 7-phox cDNA. RNA was obtained from mononuclear leukocytes of six healthy donors. This RNAwas revernetranscribed, and the cDNA of p67-phox was amplified by PCR in one fragment, using primers 1 and 6 (Table 2) and VentR DNA polymerase (Biolabs New England, Beverly, MA) according to the manufacturer's recommendations. The polymerase chain reaction (PCR) product was digested with EcoRI and Hind111and cloned in the PGEX-2T expression vector. The sequence of the productwas identical to thatreported by Leto et a1,''except for a Gat nucleotide position 983 instead ofthe published A-983 (see Results). Northern blot analysis. RNA corresponding to IO' monocytes

Table 2. PCR OligonucleotidePrimers Used in This Study 1. 2.' 3. 4.' 5. 6.' 7.' 8. 9.' NT779 10. 11 .* 12. 13. 14.' 15. 16.' 17. 18.'

NT6 NT696 NT593 NT1334 NT1244 NT2026 NT360 NT266 NT1170 NT1584 NT1500 IVS2 IVS3 IVS9 IVS10 lVSl0 lVSl1

5-gatgaattcTAATCATGTCCCTGGTGG-3 5-tagtaagcttTTCGGTCTGGGTGGAG-3 5-tactggatccTAGCCAAGGCGACGGTCGTGGCAT-3' 5-tagtaagcttTTTCATTTCCTTGGG-3' 5-tactggatccAGGTGAAAAACTACTG-3 5'-tagtaagcttACTCCTTGGGCCTGGACTTG-3 5'-GGCAAACAGCTTGAACTGGAGC-3 5'-GGCTATCAAAGACCTTAAAGAAGC-3 5-AGTGTGTTCCAGCCGGAGCT-3' 5-GGTCATGCCAGGGAACATTGT-3 5-CATCCTAGACTTCTCTCCGAGTGC-3 5-GGGAAGGTGGGCATTTTCCCCAAAG-3' 5-CTCTCCTCAGGCCTTTACCA-3 5'-AACCACTTACTTCTCTGTCT-3 5'-TGCACTGCAGAAGGGGCTTG-3 5'-ACCTGGGGCTGCTGCTG-3 5-TTGCCTTCAGGAGGAAAGCT-3 5'-GACCACTCACCTGGTGACAG-3

The lowercase letters indicate EcuRI, BamHI, and Hindlll restriction sltes to facilitate cloning of the PCR fragments. Primers 7 through 12 are nested primers that were used in a second, nested PCR together with primers 1 through 6, respectively. * Antisense primer.

533

MUTATION IN A p67-DEFICIENTCGDPATIENT

was submitted to electrophoresis in 1.2% (wt/vol) agarosegclsin thc presence of formaldehyde and was blotted onto GcncScrcen Plus membrane filters." Blots were hybridized with a p67-pl10,v cDNA probe containing the total coding rcgion and labeled by random priming. Hybridization with a probe for m-actin was used as a control for the quantificationand intcgrity of the RNA. Arnp/$cu/ion und .scJ4r1cncingc?/DA!4. For analysis of mRNA sequences. first-strand cDNA was synthesized from mononuclear cell RNA. The p67-p/10.r cDNA coding rcgion was amplified by PCR in six overlapping fragments under conditions described by Bolscher et al." The oligonucleotide primers arc listcd in Table 2. For PCR amplification of fragments I and 2. primcrs I and 2 were used. followed by nestcd PCR with primers I and 7 (fragment I )and primers2 and8 (fragment 2).The otherfragmentswcre amplified in a similar way (see legend to Table 2).The PCR products were purified with the GeneclcanI1 kit (BIO 101. Inc. La Jolla. CA) to remove the primers and nucleotides. Two hundred nanograms of the purified DNA samples was anncaled with 40 ng of one of the primers used for amplification by first being heated for 3 minutes at 100°C and then being chilled on ice water in thc presence of 10%dimethylsulfoxide. Direct sequence analysis was performed with the Sequenase version 2.0 kit (US Biochemical Corp. Cleveland. OH). In genomic DNA. the mutations were identified in a similar way. / ' ~ ~ / ~ ~ ~ t o r p h i . s rThe , r s . mutation found in thc patient and her relatives was excluded from being a polymorphism with the restriction enzyme Fok I (Biolabs) acting on a 103-bp PCR fragment from genomic DNA containing exon 3 plus boundary sequcnces(primers I3 and 14, Table 2). All control alleles were cleaved into fragments of 82 25 bp. whereas the PCR figment obtained from genomic DNA of the patient remained intact. In the material from the patient's relatives. the original fragment as well as the cleavage products were dctected. Similarly, the frequency of one polymorphism found at nucleotide position 983 and onedifference with thc published sequence at nucleotide position 895 (numbered with respect to the published cDNA sequence") was determined in a similar way by PCR amplification of exon I I (96 bp: primers 17 and 18) and exon 10 (91 bp: primers I5 and 16) and cleavage by thc restriction cnzymes Bhs I (23 + 77 bp) and Rs/7 I I (40 + 55 bp). respectively.

+

RESULTS

Identijcicntion of ,/le CGD subtype. The patient was identified as a CGD patient by complete lack of NBT reduction by her granulocytes with either phorbol myristate acetate (PMA) orserum-treated zymosan (STZ) as the stimulus. In contrast. the mother showed a completely normal NBT slide test. Superoxide production measured by cytochrome c reduction was also totally absent in the patient's granulocytes stimulated with either PMA or PMA + fMLP. deficiency as the cause of To exclude a cytochrome hSsR the disease, the heme content of the granulocytes was measured. The patient showed a value of 5.4pmol/106 cells and her mother 6.7 pmol/106 cells (normal range. 6.3 to 7.5 pmol/106 cells, n = 6). In the FACS assay with monoclonal 7D5,99.9% of the patient's granulocytes were shown to express cytochrome hSsx at the cell surface (mother, 99.9%: normal range. 98.5'70 to 99.9%: n = IO). In the cell-free activation system. the cytosol of the patient's granulocytes did not support NADPH oxidase activity of membranes from an A47" CGD patient (0. I pmo102/ min), whereas cytosol from normal granulocytes did (7.8 pmol 02/min).However, the addition of 40 pg of p67-p/m-

d

(v

Y

5

. I

c,

Q

a

p67-ph0~-> p47-ph0~-- >

Fig 1. Western blot analysis of cytosol fractions derived from CGD and control neutrophils. Cytosol was subjected to SDS-polyacrylamide gel electrophoresis, blotted onto nitrocellulose, and probed with rabbit antibodies against p47-phox and p67-phox. The antibodies on the blot were detected with alkaline phosphataseconjugated goat-antirabbit lg and Nitro-blue tetrazolium 5-bromo4-chloro-3-indolyl-phosphate (NBT-BCIP) as substrate. Patient 1, patient N.K.; patient 2, A47'CGD patient.

protein purified from normal neutrophil cytos01'~corrected the reaction of the patient's cytosol to 5.9 pmol Odmin. On Western blots after SDS polyacrylamide gel electrophoresis, p47-p/io.u was clearly present in the granulocyte cytosol from the patient. but p67-ph0,~was not detectable (Fig l ) . Thus. the patient suffers from the A67" subtype of CG D. Ichwtificution (!fthc nmtution. The mRNA of the patient's monocytes contained p67-pho.u mRNA, as detected on Northern blot (not shown). mRNA ofapparently normal size andamount (in comparison to e-actin p67-phox mRNA) was found. The p67-phm mRNA of the patient was converted to cDNA and amplified in six overlapping fragments. Electrophoresis on agarose gel showed that theamplified fragments from the patient had a size similar to that of fragments obtained from normal control cells. Sequence analysis of the first fragment showed a G-233 + A transition, predicting a nonconservative "Gly + Glu substitution (Fig 2). The other PCR fragments had the same compositionas those of control cells. The G-233 + A mutation was also found in the genomicDNA of the patient. as shown in a PCR-amplified fragment of exon 3 plus boundary sequences (Fig 3). We observed the normal nucleotide sequence neither in the cDNA nor in the genomic cDNA of the patient. Thus, the patient appears to be homozygous for this mutation. Both parents and the sister of the patientwere found to be heterozygotes for this mutation (Fig3).

DE BOER ET AL

534

Genomic Intron 2 Exon 3

Intron 3

control

......ctctcctcaglGCC TTT -. CAACGA

patient

......ctctcctcaglGCC TTT ... CAACGAGAGATGCTC .-GAG AAIgtaagtggtt._..

GGG ATGCTC

.- GAG AAlgtaagtggtt......

Intron 2 Exon 3

Intron 3

l Fig 2. Mutation found in the p67-phox gene, 3 with flanking intron causing A67OCGD.Exon boundaries is shown of control and patient genomic DNA, aswell as the cDNA sequenceand predicted amino acid sequences. Capital letters indicate coding sequences and lowercase letters indicate intron sequences. Exon sequences in genomic DNA are shown within boxes. Arrow indicates the mutation in the patient. The amino acid numbering is according toLet0 et

cDNA 76

Gln Arg Gly Met Leu CAA CGA GGG ATG CTC

control

...

patient

... CAA CGA GAG ATG CTC ...

Gln

Arg

...

Glu Met Leu

t

To investigate whether this mutation represents a polymorphism, PCR fragments obtained from genomic DNA, containing exon3 plus boundary sequences, were subjected to Fok I restriction enzyme digestion (see the Materials and Methods). The results again showedthe patient to be homozygous for themutation and the family members to be carriers. However, this mutation was not found in 38 normal donors, rendering it unlikely that the G-233 + A mutation is polymorphic.

control

W

0

@

ACGTACGTACGTACGTACGT I

I

I

I

T

C T

C Q T A

Q Q- A Q A Q C A A C C T

I

I

I

I

Fig 3. Sequence analysis of PCR-amplifiedexon 3 plus flanking intron boundaries from p67-phox genomic DNA of patient N.K., her sister, and her parents. Arrow points t o the mutation. Control and patient sequences are indicated. The parents and the sister show both thenormal and the mutatedsequence.

We found one polymorphism, ie, at A-983 G, changing AAA (coding for lysine) into AGA (coding for arginine). The frequency of this polymorphism was established by restriction enzyme analysis (see the Materials and Methods). Of 38 normal donors tested, none was homozygous for A983,36 were homozygous for G-983,and 2 were heterozygous for both nucleotides. Moreover, in contrast to the published sequence," we found in 38 normal donors C-895 instead of T-895. This mutation changes TTG into CTG, both coding for 2991eucine. Probably, this is also a polymorphism, .because T-895 was found in multiple clonesfrom a cDNA library and in a genomic library froma different person." Carrier detection. The camer state of the family members was also detectablein the NADPH oxidase activityof their neutrophils. The oxygen consumption (not shown) and the superoxide production (Table1) of these cells after activation with PMA was only 25% to 50%of normal. However, when activated by FMLP subsequently to PMA, the cells displayed a normal oxygen consumption (not shown) and 60% to 65% ofthe normal superoxide production(Table l). Similarly, with STZ (not shown) or cytochalasin B (CB) plus FMLP,the cells showed 80%to 100% ofnormal NADPH oxidase activity (Table I). Apparently, p67-phox is only rate-limiting for the NADPH oxidase activity of intact neutrophils when the cellsare activated with PMA. In the cell-free activation system, activated by SDS in the presence ofGTP-7-S, the heterozygousstate was also clearly detectable (Table I). DISCUSSION

CCD caused by a mutation in the NCF-2 gene encoding p67-phox is extremely rare, probably causing less than 5% of all known cases CCD. of Until now, only five A67'CCD patients have been reported in the l i t e r a t ~ r e . ~ "In ~ *each '~ of these, mRNA was presentat apparently normalsize and amount, whereas protein detectable on Western blot with specific antisera against p67-phox was ~ n d e t e c t a b l e . ~ - ~ ~ * ' ~ The gene structure of NCF-2 has recently been published in

535

MUTATION INA P~~-DEFICIENT CGD PATIENT

detail." We are now able to identify the mutation thatmost probably causes the instability of p67-phox in one previously unreported A67' CGD patient. Remarkably, this patient was found to be homozygous for a G-233 + A missense mutation, although the parents are not known to be related to each other. Nevertheless, this mutation was found in all family members but not in the genomic DNA of 38 control individuals. The G-233 + A mutation predicts a nonconservative 78Gly-P Glu replacement. How this amino acid change decreases the stability of the p67-phox protein is not known. It has been reported" that p67-phox is present in the cytosol of resting neutrophils in a complex with p47-phox.Perhaps the 78Gly"t Glu replacement has affected the binding site on p67-phox for p47-phox, thus decreasing the stability of the p67-phox protein. Decreased protein stability caused by one amino acid replacement has also been found in other components of the NADPH o ~ i d a s e . ' ~ , ~ ~ ~ ~ ~ The functions of 47-phox and p67-phox are not known. Recently, indications have been found that cytochrome bSs8 may be a flavocyt~chrorne.~.~ Thus, this protein maybe both the acceptor of electrons from NADPH and the donor of electrons to molecular oxygen. If this is true, cytochrome bSs8may be the NADPH oxidase sensu stricto, and p47phox and p67-phox may be activity-regulating proteins of this enzyme, together with one or more low molecular weight GTP-binding proteins.24325 It is known that p47-phox and p67-phox translocate to cytochrome b558 in the plasma membrane on activation of neutrophils. This translocation may be induced by phosphorylation of p47-phox in intact cells26and by SDS or arachidonic acid in the cell-free system,*' but the details of this process and the regulation of NADPH oxidase activity are not yet known. Thus, it is impossible to even speculate on the need for p67-phox in this regulatory process. In neutrophils with subnormal amounts of p67-phox, we found that this protein is rate-limiting for NADPH oxidase activity only under certain conditions. When PMA was used as the activating agent, carriers for the p67-phox deficiency wereeasily detected, but with other (combinations of) agents this proved to be impossible. Incontrol neutrophils, PMA induced already near-maximal rates of oxygen consumption, whereas in neutrophils from A67' CGD carriers, this rate was significantly enhanced by subsequent addition of FMLP. Similar resultswerepreviously obtained with neutrophils from autosomal CGD carriers," later identified as A47' CGD camers(De Boer and Roos, unpublished results). Perhaps phosphorylation of p47-phox by protein kinase C (activated by PMA) is a relatively weak signal for p47-phox and p67-phox translocation to cytochrome b558. FMLP and STZ, which may induce this reaction through another signal transduction p a t h ~ a y , ~may ~ . ' ~be stronger stimuli of this reaction. In this way, FMLP and STZ might be able to induce normal NADPH oxidase activity in the presence of decreased amounts of p47-phox or p67-phox. The mutations found in X91' CGD and in A22' CGD are very heterogeneous, whereas those found in A47' CGD always involve one particular dinucleotide deletion, in either one or both alleles.22 Inaddition, only four polymor-

phisms have been detected in ~22-phox,*~ none at all in gp91-phox, but at least a dozen in p47-phox (S. Chanock, personal communication, December 1992). In p67-phox, two polymorphisms have now been recognized, of which one is silent. Apparently cytochrome b5,, is a protein in which nearly allamino acids are critical for its stability and/ or function, whereas p47-phox and perhaps also p67-phox are less sensitivein this respect. REFERENCES 1. Tauber AI, Borregaard N, Simons E, Wright J: Chronic gran-

ulomatous disease: A syndrome of phagocyte oxidase deficiencies. Medicine 62:286, I983 2. Segal AW: The electron transport chain of the microbicidal oxidase of phagocytic cells and its involvement in the molecular pathology of chronic granulomatousdisease. J Clin Invest 83: 1785, 1989 3. Smith RM, CurnutteJT: Molecular basis of chronic granulomatous disease. Blood 77:673, 1991 4. Segal AW, West I, Wientjes F, Nugent JHA, Chavan AJ, Haley B, Garcia RC, Rosen H, Scrace G: Cytochrome b245is a flavocytochrome containing FAD and the NADPH binding site of the microbicidal oxidase of phagocytes. Biochem J 284:78 I , 1992 5. Rotrosen D, Yeung CL, Let0 TL, Malech HL, Kwong CH: Cytochrome &: The flavin-binding component of the phagocyte NADPH oxidase. Science 256: 1459, 1992 6. Casimir CM, Bu-Ghanim HN, Rodaway ARF, Bentley DL, Rowe P, Segal AW: Autosomal recessive chronic granulomatous disease caused by deletion at a dinucleotide repeat. Proc Natl Acad Sci USA 88:2753, 1991 7. Volpp BD, Lin Y: In vitro molecular reconstitutionofthe respiratory burst in B lymphoblasts from p47-phox-deficient chronic granulomatous disease. J Clin Invest 9 I :201, 1993 8. Volpp BD, Nauseef WM, Clark RA: Two cytosolic neutrophil oxidase components absent in autosomal chronic granulomatous disease. Science 242: 1295, I988 9. Nunoi H, Rotrosen D, Gallin JI, Malech HL: Two forms of autosomal chronic granulomatous disease lack distinct neutrophil cytosol factors. Science 242: 1298, 1988 10. Let0 TL, Lomax W, Volpp BD, Nunoi H, Sechler JMG, Nauseef WM, Clark RA, Gallin JI,Malech HL: Cloning of a 67-kD neutrophil oxidase factor with similarity to a non-catalytic region of p60,.,. Science 248:727, 1990 1 1. Verhoeven AJ, Van Schaik MW, Roos D, Weening R S Detection of camers of the autosomalform of chronic granulomatous disease. Blood 71505, 1988 12. Meerhof W, Roos D: Heterogeneity in chronic granulomatous disease detected with an improved nitroblue tetrazolium slide test. J Leukoc Biol39:699, 1986 13. Newburger PE, Chovaniec ME, Cohen HJ: Activity and activation ofthe granulocyte superoxide-generating system. Blood 55: 85, 1980 14. Bolscher BGJM, Denis SW, Verhoeven AJ, Roos D: The activity of one soluble component of the cell-free NADPH:02 oxidoreductase of human neutrophilsdepends on guanosine 5'-0-(3thio)-triphosphate. J Biol Chem 265: 15782, 1990 15. Lutter R, van Zwieten R, Weening RS, Hamers MN, Roos D Cytochrome b, flavins and ubiquinone-50 in enucleated human neutrophils(polymorphonuclear leukocyte cytoplasts). J Biol Chem 259:9603, 1984 16. Mizuno Y, Hara T, Nakamura M, Ueda K, Minakami S, Take H: Classification of chronic granulomatous disease on the basis ofmonoclonal antibody-defined surface cytochrome b deficiency. J Pediatr I 13:458, 1988

536

17. Bolscher BGJM, De Boer M, De Klein A, Weening RS, Roos D Point mutations in the P-subunit of cytochrome bSssleading to X-linked chronic granulomatous disease. Blood 77:2482, 1991 18. Sambrook J, Fritsch E, Maniatis T: Molecular Cloning: A Laboratory Manual (ed 2). Cold Spring Harbor, NY, Cold Spring Harbor Laboratory, 1989 19. Clark RA, Malech HL, Gallin JJ, NunoiH, Volpp BD, Pearson DW, Nauseef WM, Curnutte JT: Genetic variants of chronic granulomatous disease: Prevalence of deficiencies of two cytosolic components ofthe NADPH oxidase system. N Engl J Med 32 I :647, I989 20. Kenney RT, Malech HL, Epstein ND, Roberts RL,Let0 TL: Characterization of the p67phox gene: Genomic organization and RFLP analysis for prenatal diagnosis in chronic granulomatousdisease. Blood (in press) 2 1. Heyworth PG, Tolley JO, Smith RM, Curnutte JT: Thecytosolic components of the NADPH oxidase system exist as two complexes in the unstimulated neutrophil. Blood 76: 183a, I990 (abstr, suppl l ) 22. Roos D: The molecular basis of chronic granulomatous disease, in Griscelli C, Gupta S (eds): New Concepts in Immunodeficiency Disease. Chichester, UK, Wiley, 1993, p 31 1 23. De Boer M, De Klein A, Hossle J-P, Seger R, Corbeel L, Weening RS, Roos D: Cytochrome b5,*-negative, autosomal reces-

DE BOER ET AL

sive chronic granulomatous disease: Two new mutations in the cytochrome b5sslight chain of the NADPH oxidase (p22-phox). Am J Hum Genet5 I :1 127, 1992 24. Abo A, Pick E, Hall A, Totty N, Teahan CC,Segal AW: Activation of the NADPH oxidase involves the small GTP-binding protein p2lrucl. Nature 353:668, 1992 25. Knaus UG, Heyworth PG, Evans T, Curnutte JG, Bokoch GM: Regulation of phagocyte oxygen radical production by the GTP-binding protein Rac2. Science 254: 15 12, 199 I 26. Nauseef WN, Volpp BD, MC Cormick S, Leidal KG, Clark RA: Assembly of the neutrophil respiratory burst oxidase: Protein kinase C promotes cytoskeletal and membrane association of cytolic oxidase components. J Biol Chem 26659 1 1, l99 1 27. Doussikre J, Pilloud M-C, Vignais PV: Cytosolic factor in bovine neutrophil oxidase activation. Partial purification and demonstration of translocation to a membrane fraction. Biochemistry 29:2225, 1990 28. Kessels GCR, Roos D,Verhoeven A: FMLP-induced activation of phospholipase D in human neutrophils: Dependence on changes in cytosolic free Ca2+concentration and relation with respiratory burst activation. J Biol Chem 266:23 152. 1991 29. Koenderman L, Tool A, Roos D, Verhoeven A: 1.2-Diacylglycerol accumulation in human neutrophilsdoesnot correlate with respiratory burst activation. FEBS Lett 243:399, 1989