Avian Pathology Typing infectious bronchitis virus

This article was downloaded by: [Ingenta Content Distribution (Publishing Technology)] On: 15 October 2014, At: 05:45 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK

Avian Pathology Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/cavp20

Typing infectious bronchitis virus strains using reverse transcription-polymerase chain reaction and restriction fragment length polymorphism analysis to compare the 3′ 7.5 kb of their genomes a

a

b

Karim Mardani , Amir H. Noormohammadi , Jagoda Ignatovic & Glenn F. Browning

a

a

Department of Veterinary Science , The University of Melbourne , Parkville, Victoria, 3010, Australia b

Australian Animal Health Laboratory , CSIRO Livestock Industries, Private Bag 24, Portarlington Rd, Geelong, Victoria, 3220, Australia Published online: 18 Jan 2007.

To cite this article: Karim Mardani , Amir H. Noormohammadi , Jagoda Ignatovic & Glenn F. Browning (2006) Typing infectious bronchitis virus strains using reverse transcription-polymerase chain reaction and restriction fragment length polymorphism analysis to compare the 3′ 7.5 kb of their genomes, Avian Pathology, 35:1, 63-69, DOI: 10.1080/03079450500465817 To link to this article: http://dx.doi.org/10.1080/03079450500465817

PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http:// www.tandfonline.com/page/terms-and-conditions

Avian Pathology (February 2006) 35(1), 63 /69

Typing infectious bronchitis virus strains using reverse transcription-polymerase chain reaction and restriction fragment length polymorphism analysis to compare the 3? 7.5 kb of their genomes Karim Mardani1*, Amir H. Noormohammadi1, Jagoda Ignatovic2 and Glenn F. Browning1

Downloaded by [Ingenta Content Distribution (Publishing Technology)] at 05:45 15 October 2014

1

Department of Veterinary Science, The University of Melbourne, Parkville, Victoria 3010, Australia, and 2CSIRO Livestock Industries, Australian Animal Health Laboratory, Private Bag 24, Portarlington Rd, Geelong, Victoria 3220, Australia

Typing infectious bronchitis virus (IBV) strains is useful for implementation of control measures and for understanding the epidemiology and evolution of IBV. The aim of the work reported here was to develop a rapid and sensitive method for typing isolates of IBV, if possible directly from tissues of infected birds. A procedure was developed for differentiation of IBV strains by restriction endonuclease fragment length polymorphism (RFLP) analysis of a 7.5 kb DNA fragment amplified from their genome by reverse transcription-polymerase chain reaction (RT-PCR). This fragment encompassed all of the genes encoding the structural proteins of the virus. Viral RNA was extracted either directly from tissues of diseased birds or from virus propagated in embryonated eggs, and was subjecte‘d to RT-PCR. Three different restriction endonucleases, AluI, Sau3AI and MnlI, were used to digest the 7.5 kb PCR product from different IBV strains and the resultant RFLP patterns were compared. Patterns obtained with all three enzymes grouped IBV strains belonging to the same serotype in the same cluster. These results show that the RT-PCR RFLP system described here can be used as a quick and inexpensive tool for differentiating IBV strains. /

Introduction Infectious bronchitis is an acute, highly contagious viral respiratory disease of chickens characterized by tracheal rales, coughing and sneezing. In addition, some strains cause nephritis and the disease may affect the reproductive system of laying hens, causing a drop in egg production and quality (Cavanagh & Naqi, 2003). Infectious bronchitis virus (IBV) contains four structural proteins, the spike (S), membrane (M), nucleocapsid (N) and small membrane (E) proteins. The S protein is responsible for the attachment of the virion to the host cells and for instigating the fusion of the virus envelope with the cell membrane. The M glycoprotein is essential for the production of coronavirus-like particles. The N protein plays a role in viral RNA replication, transcription and assembly, and in immunity to infection. The E protein plays an essential role in virion assembly (Lai & Cavanagh, 1997). The control of infectious bronchitis is based on vaccination with attenuated vaccines. Vaccine strains can spread in the field, however, making discrimination between vaccine and wild-type strains necessary. A further area where strain identification is important is definition of emerging strains that are not being controlled by current vaccines (Farsang et al., 2002). Minor differences (as little as 5%) between the S1 sequences of two IBV strains are sufficient to change the serotype, and there are a number of IBV serotypes

and there is poor cross-protection between them (Cavanagh, 2003; Cavanagh et al ., 2005). The choice of vaccine strains is important as outbreaks of infectious bronchitis still occur in vaccinated flocks, as the virus strains isolated are frequently from a different serotype to the vaccine strain used (Bijlenga et al., 2004; Liu & Kong, 2004). New serotypes may arise by recombination (Cavanagh et al., 1992a; Wang et al., 1993; Jia et al., 1995) as well as by spontaneous mutation (Wang & Khan, 2000). As they emerge, it is important to be able to rapidly identify them and differentiate them from the vaccine strains in use (Kwon et al., 1993). Typing IBV strains is useful for implementation of control measures, for research purposes, and for understanding the epidemiology and evolution of IBVs. Classification of strains is hampered by the lack of a standardized test and the highly variable nature of these viruses (De Wit, 2000). Traditionally, IBV serotypes have been identified using virus neutralization or haemagglutination inhibition tests. Monoclonal antibodies, oligonucleotide fingerprinting and sequencing have also been used to type IBV isolates (Ignjatovic & McWaters, 1991; Cavanagh et al., 1992b; Kwon et al., 1993; Sapats et al., 1996). However, all these methods are labour intensive, expensive, time consuming, and require isolation and culture of viruses (Kwon et al., 1993).

*To whom correspondence should be addressed. Tel: /61 3 8344 8095. Fax: /61 3 8344 7374. E-mail: [email protected] ISSN 0307-9457 (print)/ISSN 1465-3338 (online) # 2006 Houghton Trust Ltd DOI: 10.1080/03079450500465817


64 K. Mardani et al. Field specimens. Pieces of kidney, lung and trachea from 4-week-old to 5-week-old individual commercial broilers from five separate farms (with clinical signs) were submitted on ice for RNA extraction and analysis by RT-PCR /RFLP. Each submission contained tissues from three to five birds that had been vaccinated against IBV by spray at the hatchery and had pale and swollen kidneys at 4 to 5 weeks of age. In addition, kidneys of normal appearance and tracheas from three birds aged 4 to 5 weeks, from a single healthy flock that had been vaccinated against IBV by spray at the hatchery, were used as controls.

The use of reverse transcription-polymerase chain reaction (RT-PCR), in combination with restriction endonuclease fragment length polymorphism (RFLP) analysis (Lin et al., 1991; Kwon et al., 1993; Song et al., 1998) or with sequencing (Meulemans et al. , 2001; Yu et al., 2001; Farsang et al., 2002; Gelb et al., 2005), has been described for discrimination of different IBV strains or for phylogenetic analysis. However, in these reports only a partial sequence (about 1.8 kb) of the gene for the spike protein (S1) was used. Recombination events may occur in several places in the IBV genome, including sites outside the S1 gene (Brooks et al., 2004). Thus the examination of any single gene, such as the S1 gene, which encompasses a relatively small part of the IBV genome, may have limited sensitivity for distinguishing between different strains of IBV. The aim of this study was to develop and assess a method for RT-PCR and RFLP analysis that enabled comparison of most of the region of the genome encoding the structural genes of IBV.

Extraction of RNA. Kidney and lung tissues from diseased and healthy birds were prepared as 10 to 15% suspensions in Tris-buffered saline by repeated passage through a three-way tap or by grinding with a mortar and pestle. The luminal surfaces of the tracheas were scraped with a scalpel blade and the tissue then homogenized by passing through a three-way tap in Tris-buffered saline. Purification of RNA was performed using Rneasy kits (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Approximately 50 ml allantoic fluid or 100 ml homogenized tissue was used for each extraction, and RNA was eluted in 30 ml buffer. The extracted RNA was used as template in a RT reaction. Synthesis of cDNA. For synthesis of cDNA, 5 ml extracted RNA was denatured at 1008C for 1 min, cooled by placing on ice for 5 min and then mixed with 20 ml premix containing 10 ml diethyl pyrocarbonatetreated water, 0.5 mM oligo (dT) (Promega, Madison, Wisconsin, USA), 0.65 U RNAguard (Amersham Pharmacia Biotech, Sydney, Australia), 50 mM each of dATP, dTTP, dGTP and dCTP, 5 ml of 5 x reaction buffer (Promega), and 50 U Moloney murine leukaemia virus reverse transcriptase (Promega). The reaction mixture was incubated at 428C for 1 h and subsequently incubated at 1008C for 5 min to inactivate the reverse transcriptase. The resultant cDNA was immediately used in a PCR or stored at /708C for later use.

Materials and Methods IBV strains. The IBV vaccine strains Vic S, S, I and Armidale were obtained from the manufacturers (Fort Dodge Australia Pty Ltd, Intervet Australia Pty Ltd, Fort Dodge Australia Pty Ltd and Fort Dodge Australia Pty Ltd, respectively). Strains Vic S, S and I belong to the same serotype (B) by virus neutralization, and also to the same type by monoclonal antibody typing, while strain Armidale belongs to a different serotype (C) (Ignjatovic & McWaters, 1991). Six Australian reference strains, N3/62, V2/71, Q1/73, N2/75, N1/88 (Ignjatovic & McWaters, 1991) and V5/90 (Sapats et al. , 1996), were used, as well as four more recent isolates, Q1/99 (isolated in 1999 in Queensland from commercial broilers with upper respiratory tract disease), V1/02 (isolated in 2002 in Victoria from commercial broilers, with nephritis and 1 to 2% mortality), V2/02 (isolated in 2002 in Victoria from commercial broilers with nephritis) and N1/03 (isolated in 2003 in New South Wales from commercial broilers with upper respiratory tract disease), obtained from cases submitted to the School of Veterinary Science, The University of Melbourne and the Australian Animal Health Laboratories, Geelong. Tissue samples (for V1/02 and V2/02) or allantoic fluid from inoculated embryonated eggs (other strains) were used for RT-PCR. Table 1 presents the IBV strains used in this study and their tissue tropism and serotype, where it was known (Wadey & Faragher, 1981; Ignjatovic & McWaters, 1991; Ignjatovic et al., 2002).

Table 1. Isolate/strain Armidale S Vic S I N3/62 V2/71 Q1/73 N2/75 N1/88 V5/90 Q1/99 V1/02 V2/02 N1/03 a

Polymerase chain reaction. For the amplification reaction, two primers, XCE1/ (ACTGGTAATTTTTCAGATGG) and UTR11 / (GCTCTAACTCTATACTAGCCTA) (Cavanagh et al. , 2002), binding within the S1 gene and the 3?-untranslated region (UTR) of the genome, respectively, were initially used to amplify a fragment of approximately 6.5 kb of the IBV genome. However these primers were unable to amplify 6.5 kb fragments from a number of IBV strains, including N1/ 88 and N1/03. Thus, two other primers, POLY-F1 (GATTGTGCATGGTGGACAATG) and UTR-R1 (CTGTACCCTCGATCGTACTC), binding to the 3? end of the polymerase gene (nucleotides 20,070 to 20,090, Beaudette strain) and the 3? untranslated region (nucleotides 27,489 to 27,508, Beaudette strain) of the IBV genome, respectively, were designed and used to amplify a 7.5 kb fragment of the IBV genome that contains all the genes for the structural proteins (Figure 1a). The PCR reaction was carried out in 50 ml mixtures containing 50 mM each of dATP, dTTP, dGTP and dCTP, 0.5 mM each

IBV strains/isolates used in this study, their tissue tropism and virus neutralization serotype Tropism

Not determined Respiratory/nephrotropic Respiratory/nephrotropic Not determined Respiratory Respiratory Respiratory/nephrotropic Respiratory/nephrotropic Respiratory Respiratory Not determined Nephrotropica Nephrotropic Not determined

Serotype

References

C B B B J F E H L B N/D N/D N/D N/D

Wadey & Faragher (1981) Ignjatovic & McWaters (1991) Sapats et al. (1996) Ignjatovic & McWaters (1991) Ignjatovic & McWaters (1991) Ignjatovic et al. (2002), Wadey & Faragher (1981) Ignjatovic & McWaters (1991), Ignjatovic et al. (2002) Sapats et al. (1996), Wadey & Faragher (1981) Ignjatovic & McWaters (1991), Sapats et al. (1996) Sapats et al. (1996) This study This study This study This study

Determined by association with clinical signs and gross and histopathological lesions of nephritis but an absence of detectable signs or gross lesions of respiratory disease.


Rapid differentiation of IBV strains 65

Figure 1. 1a: A schematic representation of the IBV genomic structure (Cavanagh et al., 2002). The locations of the oligonucleotide primers POLY-F1 and UTR-R1 are shown with arrows. 1b: Electrophoresis of PCR products from 12 IBV strains in a 0.8% agarose gel. The molecular weight marker (MW) is phage lambda DNA digested with HindIII. primer, 5 ml of 10 x High Fidelity PCR buffer (Invitrogen, Carlsbad, California, USA), 2 mM magnesium sulphate, 1.5 U Platinum Taq High Fidelity DNA polymerase (Invitrogen) and 5 ml cDNA as template. Amplification was performed using 35 cycles of incubation at 948C for 30 sec, 578C for 30 sec and 688C for 8 min, with a final extension at 688C for 10 min. The resultant PCR products were separated in a 0.8% agarose gel and the gel photographed using ultraviolet transillumination. Purification of PCR product. PCR products were purified using a PCR purification kit (Ultra Clean PCR Clean-Up; Mo Bio Laboratories, Solana Beach, California, USA) according to the manufacturer’s instructions. Restriction endonuclease digestion of PCR products. Purified PCR products were digested separately with the restriction endonucleases Alu I, Sau 3AI or Mnl I using 5 ml purified PCR product and 10, 4 or 5 U Alu I, Sau 3AI or Mnl I, respectively, at 378C for 2 h. The enzymes chosen all recognized a 4 base pair sequence, increasing the number of fragments for comparison (Chang et al., 1997). After digestion, the resultant DNA fragments were separated in 15% polyacrylamide gels and stained with silver (Herring et al., 1982). Analyses of RFLP patterns and nucleotide sequences. RFLP patterns generated from different IBV strains were compared using Gel Compar II (Applied Maths, Sint-Martens-Latem, Belgium). Briefly, digital images of the polyacrylamide gels were converted into numeric data and the resultant data subjected to normalization based on the molecular weight markers. Cluster analysis was performed using the Dice coefficient. The dendrograms were generated by the unweighted pair group method using arithmetic averages (UPGMA). Alignment of the nucleotide sequences of the 3? 7.5 kb of five IBV strains */ Beaudette, p65, EP3, Cal99 and LX4 (GenBank accession numbers NC_001451, DQ001339, DQ001338, AY338732 and AY514485, respectively) */was performed using the program ClustalW, provided by the Australian National Genomic Information Service. Construction of phylogenetic trees and calculation of sequence similarities were performed using the programs DNAcomp and DNAdist, respectively, from the PHYLIP package, also provided by the Australian National Genomic Information Service.

Results Amplification of the structural gene region of IBV. Attempts to amplify a 6.5 kb region of the IBV genome

using oligonucleotide primers XCE1/ and UTR11 / and conventional Taq DNA polymerase were unsuccessful or resulted in amplification of smaller products than expected (results not shown). Hence PCR using Platinum Taq high-fidelity DNA polymerase was attempted and this resulted in amplification of 6.5 kb fragments from several, but not all, IBV strains. Subsequently, a second pair of primers, POLY-F1 and UTR-R1, were designed and used in similar PCR reactions, and this resulted in successful amplification of a 7.5 kb fragment, containing all the structural genes, from 14 different IBV strains (Figure 1a). The resultant PCR products for 12 strains are shown in Figure 1b. No major difference in size was detected between the PCR products from different IBV strains. Amplification of 3? 7.5 kb of IBV genome directly from tissues of diseased birds. Extracted RNA from the kidney, lung and tracheal tissues of 4-week-old to 5week-old diseased birds from three of five farms with clinical signs yielded 7.5 kb fragments when used as target in the RT-PCR procedure. To confirm the results from RT-PCR, virus isolation in embryonated chicken eggs, followed by RT-PCR, was attempted on the specimens from these three RT-PCR-positive flocks. However, only specimens from two farms were found to contain viable virus. The RFLP patterns of PCR products amplified directly from tissues and those of PCR products amplified from viruses in embryonated eggs were identical for each farm, and the RFLP patterns for these two field isolates (V1/02 and V2/02) were closely related to each other. Similar attempts to amplify a 7.5 kb PCR fragment using kidney and tracheal tissues from three 4-week-old to 5-week-old healthy birds, which had been vaccinated against IBV, did not result in a detectable PCR product. Restriction endonuclease digestion analysis. The RFLP patterns generated from 14 IBV strains by digestion with Alu I, Sau 3AI and Mnl I are shown in Figure 2, 3 and 4, respectively. Each enzyme produced about 14 to 24 easily distinguishable fragments in the range of 50 to 1500 base


66 K. Mardani et al.

Figure 2. Dendrogram generated by UPGMA clustering and corresponding normalized RFLP patterns generated using AluI. Normalization was performed using the same molecular weight standard in all gels. The clustering was based on the bands enhanced in the figure. The Dice similarity coefficient was used and the optimization feature was enabled. The strains are indicated on the right. The scale at the top shows the percentage similarity.

pairs. Patterns produced with all three enzymes grouped Vic S, S and I in the same cluster, with a pattern similarity of more than 85%. Patterns obtained with all three enzymes also placed Q1/99 and V5/90 in the same cluster as the vaccine strains Vic S, S and I. All these strains are known to belong to the same serotype (B), except for Q1/99, the serotype of which is unknown. RFLP patterns generated using Sau 3AI and Alu I for vaccine strains S and I were identical, and RFLP patterns generated using Alu I for V5/90 and Q1/99 were also identical. The strains V1/02 and V2/02, isolated in the same year (2002) and same state (Victoria), also fell within the same cluster using each of the three restriction endonucleases. The Armidale vaccine strain clustered with V1/02 and V2/02 using Mnl I and Sau3 AI. Regardless of the restriction endonuclease used, IBV strains N1/03, N2/75, Q1/73, N1/88 and N3/62 clustered separately from each other. Each of these strains was known to belong to a different serotype, except for N1/ 03, the serotype of which is unknown. N1/88, a strain

that was described as a novel Australian strain by Sapats et al . (1996), was grouped with Armidale as its nearest relative using Alu I (75% similarity) and Sau3A I (64% similarity) (Figure 2 and Figure 3) but was placed distantly from all other strains using Mnl I (Figure 4).

Similarities obtained with RT-PCR /RFLP are well correlated with nucleotide sequence similarity. To investigate whether similarities derived using Gel Compar were correlated with the actual nucleotide sequence similarities, the 3? 7.5 kb nucleotide sequences of five IBV strains (Beaudette, IBV-p65, IBV-EP3, Cal-99 and LX4) were used to perform simulated restriction endonuclease digestions with Alu I, Sau 3AI or Mnl I using the program GeneWorks 2.5 (IntelleGenetics, California, USA). The computer-generated RFLP patterns were scanned and analysed using Gel Compar (Figure 5a to c). The nucleotide sequences were also aligned and the similarities obtained were used to infer a phylogenic tree (Figure 5d). Both nucleotide sequence and RFLP pattern analyses clustered strains Beaudette, IBV-p65

Figure 3. Dendrogram generated by UPGMA clustering and corresponding normalized RFLP patterns generated using Sau3AI. Normalization was performed using the same molecular weight standard in all gels. The clustering was based on the bands enhanced in the figure. The Dice similarity coefficient was used and the optimization feature was enabled. The strains are indicated on the right. The scale at the top shows the percentage similarity.



Figure 4. Dendrogram generated by UPGMA clustering and corresponding normalized RFLP patterns generated using MnlI. Normalization was performed using the same molecular weight standard in all gels. The clustering was based on the bands enhanced in the figure. The Dice similarity coefficient was used and the optimization feature was enabled. The strains are indicated on the right. The scale at the top shows the percentage similarity.

and IBV-EP3 together, and strains Cal-99 and LX4 separately from these three and each other. Beaudette, IBV-p65 and IBV-EP3 are known to belong to the same serotype, while Cal-99 and LX4 to two other distinct serotypes. Using the similarities obtained from the simulated RFLP analyses using Alu I, Sau 3AI and Mnl I, an average similarity was calculated and compared with those obtained from nucleotide sequence similarities (Table 2). The average RFLP similarities were lower in all cases than the sequence similarities, but there was still a high correlation between the similarities obtained using the two methods.

Discussion Differentiation of IBV isolates using RT-PCR /RFLP analysis has been reported previously, but only the S1 gene was targeted (Lin et al., 1991; Kwon et al., 1993).

These procedures are likely to have limited sensitivity for discrimination of IBV vaccine strains and field isolates, as only a small part of the IBV genome is used. In addition, recombination is an important mechanism in the evolution of coronaviruses (Lai & Cavanagh, 1997) and can occur outside the S1 gene (Brooks et al., 2004), and viruses that differ as a result of recombination are less likely to be distinguished by examination of a single gene. In the present study, a large (7.5 kb) fragment of the IBV genome, including genes 2 (S), 3, 4 (M), 5 and 6 (N), was amplified and subjected to RFLP analysis using three different enzymes. All three endonucleases generated patterns that clustered IBV strains with same serotype in the same group, indicating that strains with same serotype had closely related genotypes. Mnl I was able to distinguish all IBV strains, while digestion with other enzymes indicated that some strains were closely related.

a 50

60

b 70

80

90

100

60

70

80

90

100

Beaudette

Beaudette

IBV-p65

IBV-p65

IBV-EP3

IBV-EP3

Cal-99

Cal-99

LX4

LX4

c 60

50

d 70

80

90

100

70

80

90

100

Beaudette

Beaudette

IBV-p65

IBV-p65

IBV-EP3

IBV-EP3

Cal-99

Cal-99

LX4

LX4

Figure 5. Comparison of the similarities obtained using simulated (5a) AluI, (5b) Sau3AI and (5c) MnlI RFLP patterns or (5d) nucleotide sequences of the 3? 7.5 kb of five IBV strains. Dendrograms for RFLP analyses were generated using the UPGMA method, and the phylogenetic trees based on sequence similarity were constructed using DNAcomp.

68 K. Mardani et al. Table 2. Percentage RFLP similarity of the 3? 7.5 kb of the genome of five IBV strains obtained by simulating digestion with AluI, Sau3AI and MnlI using known nucleotide sequences Strain Alu I LX4 Cal99 IBV-EP3 IBV-p65 Beaudette


Sau 3AI LX4 Cal99 IBV-EP3 IBV-p65 Beaudette Mnl I LX4 Cal99 IBV-EP3 IBV-p65 Beaudette

LX4

Cal99

EP3

100

59 100

59 65 100

59 65 92 100

59 65 92 98 100

100

50 100

50 60 100

50 60 96 100

50 60 96 100 100

100

68 100

68 73 100

68 73 92 100

68 73 92 96 100

59 100

59 66 100

59 66 93.3 100

59 66 93 98 100

82 100

82 88 100

82 88 99 100

82 88 99 99.5 100

Means of similarities using Alu I, Sau 3AI and Mnl I LX4 100 Cal99 IBV-EP3 IBV-p65 Beaudette Nucleotide sequence similarity LX4 Cal99 IBV-EP3 IBV-p65 Beaudette

100

The RT-PCR /RFLP assay described here was shown to have potential for use as a rapid test for direct examination of clinical samples. It is notable that the clinical samples examined in this study were from IBVvaccinated birds but that the viruses detected in these birds were distinct from the vaccine used in those flocks. That the virus detected was likely to be clinically significant was also suggested by the failure of attempts to obtain a PCR product from tissues of vaccinated birds that were apparently healthy. Although the possibility of co-infection of birds with two different virus strains cannot be ruled out, this was not detected in the limited series of cases examined in this study, as the sum of the predicted sizes of the major bands generated by each restriction enzyme approximated that of the undigested PCR product (7.5 kb). RFLP analysis generally overestimates the difference between sequences based on the number of nucleotide substitutions. However, it is a fast and inexpensive method for estimation of the distance between viruses and has been used for studying genetic differences within a single species or between closely related species (Nei & Kumar, 2000). Graven et al . (1995) reported that sequences belonging to a single RFLP haplotype were very similar evolutionarily and that inferred evolutionary relationships between RFLP haplotypes were in good agreement with those inferred from sequence data. Results from this study also revealed that similarities obtained using RT-PCR /RFLP data were in good agreement with sequence data. It was also found that the average similarity figures generated from Gel-Com-

p65

Beaudette

par using all three enzymes were lower than those obtained from nucleotide sequence comparisons. Therefore, it seems that the genetic diversity of the IBV strains is likely to have been exaggerated by the RT-PCR / RFLP technique used in our study. The computer-based analysis used in this study provides an advantage over manual classification of IBV strains by establishing digitized libraries for epidemiological comparisons. It is possible to create such a library for all IBV strains available in a geographic area and to perform identity searches for a new isolate in a relatively short period of time. Compared with the conventional immunological methods for differentiation of IBV strains, the RTPCR /RFLP technique described here is quick and relatively inexpensive. It does not require isolation and propagation of the viral isolates and could be performed directly on clinical samples, as well as previously isolated viruses. Reproducibility was not found to be a problem with this technique, as repeated (up to three times) testing of a number of the IBV isolates used in this study generated the same RFLP patterns. Further studies may be necessary to use the data presented in this study to develop a more rapid technique (e.g. RT-PCR) to immediately distinguish specific IBV strains.

Acknowledgements The senior author was supported by a scholarship from the Iranian Ministry of Science, Research and Technol-


ogy. The authors would like to thank Dr Philip Markham, Dr Sen Lin Tang, Dr P. Scott Chandry and Ms Denise O’Rourke for assistance with methods, and Dr Soy Rubite for providing clinical specimens.


References Bijlenga, G., Cook, J.K., Gelb, J., Jr. & Wit, J.J.D. (2004). Development and use of the H strain of avian infectious bronchitis virus from the Netherlands as a vaccine: a review. Avian Pathology, 33, 550 /557. Brooks, J.E., Rainer, A.C., Parr, R.L., Woolcock, P., Hoerr, F. & Collisson, E.W. (2004). Comparisons of envelope through 5B sequences of infectious bronchitis coronaviruses indicates recombination occurs in the envelope and membrance genes. Virus Research , 100, 191 /198. Cavanagh, D. (2003). Severe acute respiratory syndrome vaccine development: experiences of vaccination against avian infectious bronchitis coronavirus. Avian Pathology, 32, 567 /582. Cavanagh, D. & Naqi, S.A. (2003). Infectious Bronchitis. In Y.M. Saif, H.J. Barnes, J.R. Glisson, A.M. Fadly, L.R. McDougald & D.E. Swayne (Eds.), Diseases of Poultry, 11th edn (pp. 101 /119). Ames: Iowa State University Press. Cavanagh, D., Davis, P.J. & Cook, J.K. (1992a). Infectious bronchitis virus: evidence for recombination within the Massachusetts serotype. Avian Pathology, 21, 401 /408. Cavanagh, D., Davis, P.J., Cook, J.K., Li, D., Kant, A. & Koch, G. (1992b). Location of the amino acid differences in the S1 spike glycoprotein subunit of closely related serotypes of infectious bronchitis virus. Avian Pathology, 21, 33 /43. Cavanagh, D., Mawditt, K., Welchman Dde, B., Britton, P. & Gough, R.E. (2002). Coronaviruses from pheasants (Phasianus colchicus ) are genetically closely related to coronaviruses of domestic fowl (infectious bronchitis virus) and turkeys. Avian Pathology, 31, 81 /93. Cavanagh, D., Picault, J.P., Gough, R., Hess, M., Mawditt, K. & Britton, P. (2005). Variation in the spike protein of the 793/B type of infectious bronchitis virus, in the field and during alternate passage in chickens and embryonated eggs. Avian Pathology, 34, 20 /25. Chang, P.C., Lee, Y.L., Shien, J.H. & Shieh, H.K. (1997). Rapid differentiation of vaccine strains and field isolates of infectious laryngotracheitis virus by restriction fragment length polymorphism of PCR products. Journal of Virological Methods, 66, 179 /186. De Wit, J.J. (2000). Detection of infectious bronchitis virus. Avian Pathology, 29 , 71 /93. Farsang, A., Ros, C., Renstrom, L.H., Baule, C., Soos, T. & Belak, S. (2002). Molecular epizootiology of infectious bronchitis virus in Sweden indicating the involvement of a vaccine strain. Avian Pathology, 31, 229 /236. Gelb, J., Jr., Weisman, Y., Ladman, B.S. & Meir, R. (2005). S1 gene characteristics and efficacy of vaccination against infectious bronchitis virus field isolates from the United States and Israel (1996 to 2000). Avian Pathology, 34, 194 /203. Graven, L., Passarino, G., Semino, O., Boursot, P., SantachiaraBenerecetti, S., Langaney, A. & Excoffier, L. (1995). Evolutionary correlation between control region sequence and restriction poly-

morphisms in the mitochondrial genome of a large Senegalese Mandenka sample. Molecular Biology and Evolution , 12, 334 /345. Herring, A.J., Inglis, N.F., Ojeh, C.K., Snodgrass, D.R. & Menzies, J.D. (1982). Rapid diagnosis of rotavirus infection by direct detection of viral nucleic acid in silver-stained polyacrylamide gels. Journal of Clinical Microbiology, 16, 473 /477. Ignjatovic, J. & McWaters, P.G. (1991). Monoclonal antibodies to three structural proteins of avian infectious bronchitis virus: characterization of epitopes and antigenic differentiation of Australian strains. Journal of General Virology, 72, 2915 /2922. Ignjatovic, J., Ashton, D.F., Reece, R., Scott, P. & Hooper, P. (2002). Pathogenicity of Australian strains of avian infectious bronchitis virus. Journal of Comparative Pathology, 126, 115 /123. Jia, W., Karaca, K., Parrish, C.R. & Naqi, S.A. (1995). A novel variant of avian infectious bronchitis virus resulting from recombination among three different strains. Archives of Virology, 140, 259 /271. Kwon, H.M., Jackwood, M.W. & Gelb, J., Jr. (1993). Differentiation of infectious bronchitis virus serotypes using polymerase chain reaction and restriction fragment length polymorphism analysis. Avian Diseases , 37, 194 /202. Lai, M.M.C. & Cavanagh, D. (1997). The molecular biology of coronaviruses. Advances in Virus Research , 48, 1 /100. Lin, Z., Kato, A., Kudou, Y. & Ueda, S. (1991). A new typing method for the avian infectious bronchitis virus using polymerase chainreaction and restriction enzyme fragment length polymorphism. Archives of Virology, 116, 19 /31. Liu, S. & Kong, X. (2004). A new genotype of nephropathogenic infectious bronchitis virus circulating in vaccinated and non-vaccinated flocks in China. Avian Pathology, 33, 321 /327. Meulemans, G., Boschmans, M., Decaesstecker, M., Berg, T.P.V.D., Denis, P. & Cavanagh, D. (2001). Epidemiology of infectious bronchitis virus in Belgium broilers: a retrospective study, 1986 to 1995. Avian Pathology, 30, 411 /421. Nei, M. & Kumar, S. (2000). Molecular Evolution and Phylogenetics. New York: Oxford University Press. Sapats, S.I., Ashton, F., Wright, P.J. & Ignjatovic, J. (1996). Sequence analysis of the S1 glycoprotein of infectious bronchitis viruses: identification of a novel genotypic group in Australia. Journal of General Virology, 77, 413 /418. Song, C.S., Lee, Y.J., Kim, J.H., Sung, H.W., Lee, C.W., Izumiya, Y., Miyazawa, T., Jang, H.K. & Mikami, T. (1998). Epidemiological classification of infectious bronchitis virus isolated in Korea between 1986 and 1997. Avian Pathology, 27, 409 /416. Wadey, C.N. & Faragher, J.T. (1981). Australian infectious bronchitis viruses: identification of nine subtypes by a neutralisation test. Research in Veterinary Science, 30, 70 /74. Wang, L., Junker, D. & Collisson, E.W. (1993). Evidence of natural recombination within the S1 gene of infectious bronchitis virus. Virology, 192, 710 /716. Wang, X. & Khan, M.I. (2000). Use of reverse transcriptase-polymerase chain reaction-restriction fragment length polymorphism to examine the interation between infectious bronchitis strains Massachusetts 41 and JMK in ovo. Avian Pathology, 29, 441 /448. Yu, L., Wang, Z., Jiang, Y., Low, S. & Kwang, J. (2001). Molecular epidemiology of infectious bronchitis virus isolates from China and Southeast Asia. Avian Diseases , 45, 201 /209.

Avian Pathology (Feburary 2006) 35(1), 1 /2

Non-English Abstracts

Typing infectious bronchitis virus strains using reverse transcription-polymerase chain reaction and restriction fragment length polymorphism analysis to compare the 3? 7.5 kb of their genomes Karim Mardani1*, Amir H. Noormohammadi1, Jagoda Ignatovic2 and Glenn F. Browning1 Downloaded by [Ingenta Content Distribution (Publishing Technology)] at 05:45 15 October 2014

1

Department of Veterinary Science, The University of Melbourne, Parkville, Victoria 3010, Australia, and 2CSIRO Livestock Industries, Australian Animal Health Laboratory, Private Bag 24, Portarlington Rd, Geelong, Victoria 3220, Australia

Typage des souches de virus de la bronchite infectieuse en utilisant la transcription inverse et l’amplification en chaıˆne par polyme´rase ainsi que l’analyse du polymorphisme de taille des fragments de restriction pour comparer les fragments de 7,5 kb de leurs geńomes en 3? Le typage des souches de virus de la bronchite infectieuse (IBV) est utile pour l’exećution des mesures de controˆle et pour la compre´hension de l’e´pide´miologie et de l’e´volution des IBV. Le but de ce travail a e´te´ de de´velopper une me´thode rapide et sensible pour le typage des isolats d’IBV, si possible directement a` partir des tissus des animaux infecte´s. Une proce´dure a e´te´ de´veloppeé pour la diffe´renciation des souches d’IBV par l’analyse du polymorphisme de taille des fragments de restriction (RFLP) d’un fragment d’ADN de 7,5 kb amplifie´ a` partir de leur geńome en utilisant la transcription inverse et l’amplification en chaıˆne par polyme´rase (RT-PCR). Ce fragment contient tous les ge`nes codant les proteínes structurales du virus. L’ARN viral a e´te´ extrait soit directement des tissus des animaux malades, soit a` partir du virus multiplie´ sur œufs embryonne´s et soumis a` la RT-PCR. Trois endonucleáses de restriction, AluI, Sau3AI et MnlI, ont e´te´ utiliseés pour dige´rer le produit de PCR de 7,5 kb des diffe´rentes souches d’IBV et les profils RFPL obtenus ont e´te´ compare´s. Ainsi, avec les trois enzymes, il a e´te´ mis en e´vidence que les souches appartenaient au meˆme se´rotype du meˆme groupe. Ces re´sultats montrent que le syste`me RT-PCR-RFLP dećrit ici peut eˆtre utilise´ comme un outil rapide et bon marche´ pour la diffe´renciation des souches d’IBV. Typisierung von Sta¨mmen des infektio¨sen Bronchitisvirus mittels Reverse Transkriptase-Polymerasekettenreaktion und Restriktionsfragmentla¨ngen-polymorphismusanalyse zum Vergleich der 3‘7,5 kb ihrer Genome Die Typisierung von Sta¨mmen des infektio¨sen Bronchitisvirus (IBV) ist wichtig fu¨r die Durchfu¨hrung von Beka¨mpfungsmaßnahmen sowie fu¨r das Verta¨ndnis der Epidemiologie und Evolution von IBV. Das Ziel der hier beschriebenen Arbeit war es, eine schnelle und sensitive Methode fu¨r die Typisierung von IBV-Isolaten mo¨glichst direkt aus dem Gewebe infizierter Tiere zu entwickeln. Es wurde ein Verfahren etabliert fu¨r die Differenzierung von IBV-Sta¨mmen mittels Restriktionsendonukleasefragmentla¨ngenpolymorphismus (RFLP)-Analyse eines 7,5 kb-DNS-Fragments, das aus dem Genom durch Reverse TranskriptasePolymerasekettenreaktion (RT-PCR) amplifiziert worden war. Dieses Fragment umfasste alle Gene, die fu¨r die Strukturproteine des Virus kodierten. Die virale RNS wurde entweder direkt aus dem Gewebe erkrankter Tiere oder aus im embryonierten Hu¨hnerei angezu¨chtetem Virus extrahiert und der RT-PCR unterzogen. Drei verschiedene Restriktionsendonukleasen, AluI Sau3AI und MnlI, wurden fu¨r die Verdauung der 7,5 kB-PCR-Produkte aus den verschiedenen IBV-Sta¨mmen verwendet und die resultierenden RFLP-Muster wurden verglichen. Die mit allen drei Enzymen erhaltenen Muster fu¨hrten zur Eingruppierung von IBV-Sta¨mmen, die zu dem gleichen Serotyp geho¨rten, in das gleiche Cluster. Diese Ergebnisse zeigen, dass das hier beschriebene RT-PCR-RFLP-System als schnelle und kostengu¨nstige Methode zur Differenzierung von IBV-Sta¨mmen verwendet werden kann.

*To whom correspondence should be addressed. Tel: /61 3 8344 8095. Fax: /61 3 8344 7374. E-mail: [email protected] ISSN 0307-9457 (print)/ISSN 1465-3338 (online) # 2006 Houghton Trust Ltd DOI: 10.1080/03079450500465817


2 K. Mardani et al.

Tipificacioń de cepas de virus de bronquitis infecciosa mediante transcriptasa reversa-reaccioń en cadena de la polimerasa y ana´lisis del polimorfismo de la longitud de los fragmentos de restriccioń para comparar los 3’ 7.5 kb de sus genomas La tipificacioń de las cepas de virus de bronquitis infecciosa (IBV) es u´til para la implementacioń de medidas de control y para entender la epidemiologıá y la evolucioń de IBV. El objetivo del presente trabajo es desarrollar un me´todo ra´pido y sensible para tipificar aislados de IBV, si es posible directamente de tejidos provenientes de aves infectadas. Se desarrollo´ un procedimiento para diferenciar las cepas de IBV mediante ana´lisis del polimorfismo de la longitud de los fragmentos de restriccioń (RFLP) de un fragmento de ADN de 7.5 kb amplificado de su genoma con una tećnica de transcriptasa reversa-reaccioń en cadena de la polimerasa (RT-PCR). Este fragmento contenıá todos los genes que codificaban para las proteıńas estructurales del virus. El ARN vı´rico fue extraı´do directamente de tejidos de aves enfermas, o de virus propagado en huevos embrionados mediante la RT-PCR. Se utilizaron tres endonucleasas de restriccioń AluI, Sau3AI y MnlI, para digerir el producto de PCR de 7.5 kb de diferentes cepas de IBV y los patrones de RFLP resultantes fueron comparados. Los patrones obtenidos con los tres enzimas clasificaron las cepas de IBV pertenecientes al mismo serotipo en el mismo grupo. Estos resultados muestran que el sistema de RTPCR-RFLP descrito puede ser utilizado como una herramienta ra´pida y barata de diferenciar cepas de IBV.