Oct 5, 1984 - of Gilman and Chamberlin (4) and Wong et al. ... JOURNAL OF BACTERIOLOGY, Jan. ..... Goldfarb, D. S., S.-L. Wong, T. Kudo, and R. H. Doi.
JOURNAL OF BACTERIOLOGY, Jan. 1985, p. 158-163
Vol. 161, No. 1
0021-9193/85/010158-06$02.00/0 Copyright 0 1985, American Society for Microbiology
Cloning of a Developmentally Regulated Element from Alkalophilic Bacillus subtilis DNA TOSHIAKI KUDO,* JUICHI YOSHITAKE, CHIAKI KATO, RON USAMI, AND KOKI HORIKOSHI
The Riken Institute, Wako-shi, Saitama 351-01, Japan Received 3 July 1984/Accepted 5 October 1984
An alkalophilic Bacilus DNA bank cloned in an expression probe plasmid, pGR71, was screened for the of developmentally regulated genetic elements. A 508-base pair Hindlll fragment isolated from this bank in plasmid pGR71-5 expressed plasmid-encoded chloramphenicol resistance only during the sporulation phase of a Bacillus subtilis host grown on Schaeffer medium. This developmentally regulated expression was altered in spoOE and spoOH mutants which had very low levels of chloramphenicol acetyltransferase activity relative to the wild type or other spoO mutants. We determined the nucleotide sequence of the entire 508-base pair fragment and located the site of regulated transcription initiation by high-resolution Si nuclease mapping of the in vivo transcript. The deduced promoter sequences upstream from this start site were 5'C-G-A-A-TC-A-T-G-A3' at -10 and 5' A-G-G-A-A-T-C3' at -35. This transcript was not detected in spoOE or spoOH mutants, indicating that the products of these genes control developmentally regulated chloramphenicol acetyltransferase expression at the level of transcription. presence
Bacillus subtilis possesses multiple forms of RNA polymerwith differing promoter specificities (3, 4, 10). Losick et al. have suggested that the minor forms of RNA polymerase are important in the control of sporulation (10, 15). In our laboratory, we have studied an alkalophilic Bacillus sp. strain which grows well under alkaline conditions (pH 9 to 11) (9). This strain sporulates well at pH 10 (11), which is also the optimum pH for germination of the spores (12). One approach to analyze the regulation mechanisms of sporulation is to clone elements that control developmental gene expression by using expression probe plasmids (5, 14). One of these plasmids is pGR71, which was constructed by Goldfarb et al. (5). In B. subtilis, expression of the chloramphenicol acetyltransferase (CAT) gene carried by pGR71 requires insertion of Bacillus promoters and ribosomal binding sites into the HindIII cloning site immediately upstream from the CAT gene (6, 7). In order to screen for insertionally activated and developmentally induced gene expression, we cloned fragments and examined their CAT activities during the vegetative and sporulation phases of growth. In this paper we describe the cloning of a developmentally controlled element from an alkalophilic Bacillus sp. DNA and the transcriptional regulation of expression of this element in B. subtilis. MATERIALS AND METHODS Media and strains used. We used the culture media described below throughout the experiments. Medium 2 x SSG (Modified Schaeffer medium) contained 16 g of nutrient broth (Difco Laboratories), 0.5 g of MgSO4 * 7H2O, and 2 g of KCl; after autoclaving, Ca(NO3)2, MnCl2, Fe2SO4, and glucose were added to concentrations of 1 mM, 0.1 mM, 1 ,uM, and 0.1%, respectively. Alkalophilic Bacillus was grown aerobically at 37°C to early log phase in alkaline medium II, which consisted of 1% soluble starch, 0.5% polypeptone, 0.5% yeast extract, 0.1% K2HPO4, 0.02% MgSO4 7H20, and 1% sodium carbonate (sterilized separately) (19). The strains and plasmid used are listed in Table 1.
Preparation of DNA. The alkalophilic Bacillus sp. strain aerobically to the early stationary phase at 37°C in the alkaline medium described above. Bacterial chromosomal DNA was purified by the method of Saito and Miura (17). Plasmids were purified by the method of Goldfarb et al. (6). Construction of recombinant plasmids. Chromosomal and plasmid DNAs were completely digested with HindIII at 37°C. After digestion, 1 pug of pGR71 and 3 ,ug of chromosomal DNA were ligated with T4 ligase overnight at room temperature. This ligation mixture was used to transform B. subtilis 1012 as previously described (2, 8). CAT assays. CAT was assayed spectrophotometrically (6, 20). The assays were performed in 3-ml volumes by using a Hitachi model 200-10 spectrophotometer equipped with a temperature-controlled cuvette carriage. Cells were harvested and washed in 0.1 M Tris-hydrochloride buffer (pH 7.8) containing 1.0 M KCl and 1 mM phenylmethylsulfonyl fluoride. The washed cells were pelleted, frozen, and stored at -70°C until they were assayed. Thawed cells were suspended in 0.1 M Tris-hydrochloride buffer (pH 7.8) containing 0.5 mM phenylmethylsulfonyl fluoride, broken by sonication, and then centrifuged for 10 min at 15,000 x g. The supernatants were assayed immediately; 1 U of activity was defined as 1 nmol of DTNB reduced per min per mg of total soluble protein. Protein concentrations were determined by the method of Bradford (1), using bovine serum albumin as the standard. S1 nuclease mapping. For Si nuclease mapping the method of Gilman and Chamberlin (4) and Wong et al. (21) was used, with slight modifications. RNA was isolated from 100 ml of cells (harvested after 24 h of cultivation at 37°C in medium 2 x SSG) by the procedure of Gilman and Chamberlin (4). End-labeling reactions were carried out in 100-,ul reaction mixtures containing 100 ,uCi of [-y-32P]ATP and 2 U of T4 polynucleotide kinase (5' end-labeling system; New England Nuclear Corp.). The reaction conditions and the labeled DNA recovery and strand separation procedures used were those described by the manufacturer. End-labeled, singlestranded hybrydization probes (10,000 to 30,000 cpm) were mixed with 50 ,ug of in vivo RNA and precipitated with
ase
*
was grown
Corresponding author. 158
ALKALOPHILIC B. SUBTILIS PROMOTER
VOL. 161, 1985
159
TABLE 1. Strains and vector used Strain or
Genotype or property
Source
Renfcer-
E
.-
0
Alkalophilic Bacillus sp. strain 38-2 B. subtilis NIG1121 NIG1131 NIG1132 NIG1133 NIG1134 NIG1139 NIG1140 NIG1135 NIG1136 NIG1137 NIG1138 IS17 IS22 IS24 1012 pGR71
Produces an alkaline amylase
Our laboratory
9
16 Y. Sadaie met his spo+ 16 Y. Sadaie met his spoOA34 16 Y. Sadaie met his spoOB136 16 Y. Sadaie met his spoOC7 16 Y. Sadaie met his spoOD8 16 Y. Sadaie met his spoOE81 16 Y. Sadaie met his spoOF221 16 Y. Sadaie met his spoOG14 16 Y. Sadaie met his spoOH17 16 Y. Sadaie met his spoOJ87 16 Y. Sadaie met his spoOK141 trpC2 pheAl spoOEll BGSCa trpC2 rpoB2 spoOH17 BGSC trpC2 pheAl spoOH81 BGSC 8 H. Honda leuA8 metB5 hsrMI Kmr 5 D.S. Goldfarb a BGSC, Bacillus Genetic Stock Center, Ohio State University, Columbus.
ethanol. The precipitated nucleic acids were washed with 70% ethanol, dried briefly under a vacuum, and dissolved in 25 ,ul of hybridization buffer containing 20 mM PIPES [piperazine-N, N'-bis(2-ethanesulfonic acid)] (pH 6.5), 0.4 M NaCl, and 80% formamide. The hybridization mixtures were incubated for 5 min at 90°C and then rapidly transferred to a 50°C water bath for 3 h. Hybridization was terminated by dilution into 500 ,ul of ice-cold Si digestion buffer (30 mM sodium acetate [pH 4.6], 0.25 M NaCl, 1 mM ZnSO4, 5% glycerol, 20 jig of sonicated denatured salmon sperm DNA per ml) containing 2,000 U of S1 nuclease (Boehringer Mannheim Biochemicals). After incubation for 30 min at 37°C, protected hybrids were recovered by ethanol precipitation, rinsed, and dissolved in 2 ,l1 of loading buffer (100% deionized formamide, 0.1% BPB, 0.1% XCFF). Samples were denatured for 2 mmn at 90°C, quick-chilled in ice water, and analyzed by electrophoresis in 6% acrylamide gels containing 8 M urea. DNA sequencing. Specific restriction fragments were cloned into mp8 or mp9 M13 vectors (13) and sequenced by using the dideoxy chain termination method of Sanger et al. (18). DNA was labeled with [ax-35S]dATPaS (catalog no. SJ304; Amersham Corp.) during dideoxy sequencing. RESULTS Screening of a developmentally regulated HindIII fragment from an alkalophilic Bacillus sp. Competent B. subtilis 1012 cells were transformed with the alkalophilic DNA bank carried in expression probe plasmid pGR71. After 90 min of incubation to allow expression of pGR71 kanamycin resistance, the cells were plated onto LB plates containing kanamycin (20 jig/ml). To analyze the CAT activity profile, we cultivated B. subtilis carrying the pGR71 derivatives in 2x SSG sporulation medium containing 10 ,ug of kanamycin per ml, sampled the culture at different stages of growth and sporulation, and assayed the cell extracts prepared by sonication for CAT enzyme activity. As shown in Fig. 1, the CAT activity profile of pGR71-5 indicated that CAT expression from the plasmid was induced after the cessation of vegetative growth and that CAT specific activity increased until late in sporulation. When the pGR71-5 HindIII inser-
._-
(.0 (.0 D
5000
ci
to
0
4000 v2
u
.3
-
3
0
1
3000 0. a In 2000 i-11
^
nf
1uu2 15 20 10 TIME ( hr) FIG. 1. CAT activity as a function of growth and sporulation in B. subtilis 1012 harboring plasmid pGR71-5. Symbols: 0, cell growth; *, CAT specific activity. One unit of CAT specific activity was defined as 1 nmol of DTNB reduced per min per mg of total soluble protein. O.D. 660nm, Optical density at 660 nm.
0
5
tion was recloned in a fresh pGR71 vector, the phenotype of the reconstituted plasmid was identical to that of pGR71-5 as originally isolated, indicating that the developmentally regulated gene expression was controlled by an insertion element. Analysis of the fragment. The HindlIl fragment inserted in the HindIII site of pGR71 was analyzed by using various restriction endonucleases. A restriction map and the molecular sizes are shown in Fig. 2. By using Southern blotting, we found that radioactively labeled pGR71-5 hybridized to the 508-base pair (bp) HindIII DNA fragment of alkalophilic Bacillus sp. strain 38-2 (Fig. 3). No sequence complementary to the fragment was detected in the B. subtilis DNA
fragments.
Effect of glucose and spoO mutations on CAT expression in B. subtilis carrying pGR71-5. 3oth glucose and early-blocked sporulation (spoO) mutations affect developmentally regulated gene expression in B. subtilis. As shown in Fig. 4, high levels of glucose repressed CAT expression in B. subtilis
carrying pGR71-5. To investigate the effect of 10 spoO mutations on CAT expression, plasmid pGR71-5 was introduced into isogenic spoO mutants (spoOA, spoOB, spoOC, spoOD, spoOE, spoOF, spoOG, spoOH, spoOJ, and spoOK) and their parent strain (spo+). The CAT specific activities in these mutants were assayed. The introduction of plasmid pGR71-5 into eight
EcoRI Hindl ECoR!
>AI
9 i
200
400
..-
bp
--->
FIG. 2. Restriction map of the pGR71-5 HindIll fragment. The of DNA sequence analysis. shows the location of the developmentally regulated promoter controlling CAT expression.
arrows indicate the direction and extent The arrow above the restriction map
160
KUDO ET AL.
J. BACTERIOL.
A 1 23 4 5
B
4 5
1 23
1:1.!'.I. .
f.%
."t.
,
i.
.i
1.
FIG. 3. Homology between cloned fragment and chromosomal DNAs. (A) Agarose (1%) gel electrophoresis df digests of various DNAs. Lane 1, A DNA digested with HindIIl (0.1 ,ug); lane 2, B. subtilis DNA digested with HindIll (3 pLg); lane 3, alkalophilic Bacillus sp. strain 38-2 DNA digested with HindIII (3 ,ug); lane 4, pGR71-5 digested with HindIII (0.1 ,ug); lane 5, pGR71-5 digested with SalI (0.1 ,ug). (B) Hybridization analysis of Southern transfer of the DNAs from the gel described above. 32P-labeled pGR71-5 was used as the probe. The lane contents were the same as those described above.
spoO mutants somewhat decreased the CAT specific activities compared with that of the wild-type (spo+) strain (Fig. 5). However, spoOE and spoOH mutant strains carrying pGR71-5 exhibited dramatically decreased CAT expression. When pGR71-5 was introduced into strains carrying other alleles of spoOE and spoOH (spoOEJ spoOHJ 7, or spoOH81), these strains also showed very low levels of CAT specific activity (data not shown). This loss of activity was a function of the host cell genotype and was not due to plasmid J,
A
C
0
~ -
2
> 4 -0-
> 1
-/
u
u %#
'a
5 4I.
0
0
QL 3
2 1I
___._,___-_.
I T-4
T0
T16
TI4TO
Tb
Tl 6
Time( hr ) FIG. 4. Effect of glucose concentration on CAT specific activities of B. subtilis cells harboring pGR71-5. B. subtilis cells harboring pGR71-5 were inoculated into 500-ml portions of medium 2x SSG containing different concentrations of glucose and were cultured at 37°C on a rotary shaker. The cells were collected at various growth stages and sonicated, and then the supernatants were used for CAT assays. (A) Medium 2x SSG without glucose. (B) Medium containing 0.1% glucose. (C) Medium containing 0.5% glucose. (D) Medium containing 1.0% glucose.
Time( hr FIG. 5. Effect of various spoO mutations on CAT expression. B. subtilis cells carrying pGR71-5 were inoculated into 500 ml of medium 2x SSG and cultured at 37°C on a rotary shaker. CAT activity was measured at different times during the growth and sporulation phases. (A) Strain NIG1131 (spoOA). (B) Strain NIG1132(spoOB). (C) Strain NIG1133 (spoOC). (D) Strain NIG1134 (spoOD). (E) Strain NIG1139 (spoOE). (F) Strain NIG1140 (spoOF). (G) Strain NIG1135 (spoOG). (H) Strain NIG1136 (spoOH). (I) Strain NIG1137 (spoOJ). (J) Strain NIG1138 (spoOK). (K) Strain NIG1121 (spo+).
*'-~ . Or_i2g1,n
ALKALOPHILIC B. SUBTILIS PROMOTER
VOL. 161, 1985
3 4 5
12
6
7
-Origin
i.*
Pro be 50p)_ * (405b)
161
506 b s-5~~~~~~~16,
^
221. 220b
-154 b
125b
P-
75 b
FIG. 6. Si nuclease mapping to locate the developmentally regulated promoter of pGR71-5. RNA was prepared from B. subtilis (spo+) harboring pGR71-5 after 24 h of incubation. The 508-bp Hindlll fragment (Fi: 2) was used for lanes 1 through 3. The 405-bp EcoRI-HindIll fragment (Fig. 2) was used for lanes 4 through 6. Lanes 1 and 4 contained untreated probe, lanes 2 and 5 contained no RNA, lanes 3 and 6 contained 50 ,ug of RNA, and lane 7 contained 32P-labeled Hinfl fragments of pBR322. b, Base pair.
12 3 4
*
6
5
',,, £
Probe 508b)
-.-5I6,5O6b
2220b
-154b
125b
FIG. 7. S1 nuclease protection assay of RNA prepared from B. subtilis spoO mutants harboring pGR71-5. Lane 1, Untreated probe; lane 2, no RNA; lane 3, strain 1012 (spo+); lane 4, strain NIG1139 (spoOE-81); lane 5, strain NIG1136 (spoOH17); lane 6, 32P-labeled Hinfl fragments of pBR322. b, Base pair. HindIII *
*
*
*
*
*
*
80 *
AAGCTTCAGGtCAGCCGTTATGAGAGCCGCCGCTCTCCGGCCTGGCAGAAGGTCATTAACTGGACCTTATGCCGAGGTGT
TTCGAAGTCCCGTCGGCAATACTCTCGGCGGCGAGAGGCCGGACCGTCTTCCAGTAATTGACCTGGAATACGGCTCCACA *
*
*
*
*
*
*
*
*
*
160
EcoRI *
*
*
*
*
*
TTATCACCGGGTACCGTAAGAACGAATTCGGGTGGCTGACTTCCGTGGTTACGGAGTCCGGCCGGCTGCGGCAACGGGTA AATAGTGGCCCATGGCATTCTTGCTTAAGCCCACCGACTGAAGGCACCAATGCCTCAGGCCGGCCGACGCCGTTGCCCAT *
*
*
*
*
*
*
*
240 *
*
*
*
*
*
*
*
TCGTTGAGCTGGGAGTGCCGCCGAAAGCCAAGCGAGCGTTCTATGGGGTGAGCAAGCAGCTTGTAACGGGTGAGGATAAG
AGCAACTCGACCCTCACGGCGGCTTTCGGTTCGCTCGCAAGATACCCCACTCGTTCGTCGAACATTGCCCACTCCTATTC * * * * * * * * 320 *
*
*
*
*
*
*
*
AATTTCGTCCACCTGGAGCCGCGGATTCGAGCGAGGGTAAAAACCCGGAACTGGACCAAGAAAGGCATGCTCGTCGCCGG TTAAAGCAGGTGGACCTCGGCGCCTAAGCTCGCTCCCATTTTTGGGCCTTGACCTGGTTCTTTCCGTACGAGCAGCGGCC *
*
*
*
*
*
*
-35
*
*
-10 *.
*
g
*
mRNA
*l
*
400 *
CGTTCGTTGAGTTTGTTGTTTGAATGGGAAATGCAGGAATCCCTTACTCGAATGTCGAATCATGATGTCAAAGGGGGTGT GCAAGCAACTCAAACAACAAACTTACCCTTTACGTCCTTAGGGAATGAGCTTACAGCTTAGTACTACAGTTTCCCCCACA *
*
*
*
*
*
*
*
480 *
*
*
*
*
*
*
TTGAGATAAAAGTAAAAGAATTGAATCTCGAAGTTCTTGGAGCAATGATGTTAAAAGTTGCTCCGATATCGAAGCAACTA
AACTCTATTTTCATTTTCTTAACTTAGAGCTTCAAGAACCTCGTTACTACAATTTTCAACGAGGCTATAGCTTCGTTGAT *
*
*
*
*
*
*
*
*
*
HindIII
AATCATAAGTGGCCAAAATCGACGATGGAAGCTT -----CAT GENE ---TTAGTATTCACCGGTTTTAGCTGCTACCTTCGAA *
*
*
FIG. 8. DNA sequence of the pGR71-5 HindlIl fragment. The arrow indicates the probable transcription initiation site. The putative -35 and -10 regions are indicated.
J. BACTERIOL.
KUDO ET AL.
162
A
pGR71-5 Hindull fragment 3' 55 EcoRI 5 3'
T T
EcoRl 3 pGR71-5 HindIll fragment
S
nrRNA-----
Hindlil
Hndi
--primer
Hybridizatlon 3
B
M13
Dideoxy-chaln tem,ntation
5'r 5
31
5I
SI nuclease
A z
z
I
+
A ..i
:....
C T
G
T
A G T A C T A C A G T
HIndlil 3'1----3
J Sequencing Gel Electrophoresis 4
m-RNA AC G T
I
_m-RNA
5-
3'
--
TCAAAGGGGGTGTTT - -_3' 5' AGTTTCCCCCACAAA
i
T C C
C C C A C A A A C
T C T A \T T T T
FIG. 9. High-resolution Si nuclease mapping of the in vivo transcript from the promoter of pGR71-5. (A) Scheme for high-resolution S1 nuclease mapping, using the dideoxy chain termination method of Sanger et al. rather than the method of Maxam and Gilbert as is usually done. (B) +RNA, In vivo RNA isolated from sporulating cells (T16) of B. subtilis carrying pGR71-5 was hybrydized with the 5'-end-labeled pGR71-5 HindIII fragment. After Sl nuclease digestion, the protected DNA fragment was analyzed by electrophoresis on an 8% acrylamide-8 M urea sequencing gel. The lanes labeled A,C,A+T,G, and T show A,C,A+T,G and T sequence ladders, respectively. The DNA sequence shown on the right corresponds to the transcribed strand of the promoter. The recombinant M13 mp9 was used as a template. After the dideoxy chain termination reactions, the reaction mixtures were restricted with HindlIl and loaded onto the sequencing gel. The arrowhead indicates the probable in vivo transcription initiation site for the promoter. rearrangement. When pGR71-5 was isolated from spoOE or spoOH strains carrying the plasmid and reintroduced into the
spo+ strain, the high CAT activity characteristic of the original pGR71-5 isolate was restored. Low-resolution Si mapping of in vivo developmental transcript. We located the in vivo transcription start site of the pGR71-5 fragment by Sl nuclease mapping (4, 21). We chose 50°C for Si mapping because the melting temperature of this DNA fragment was 45°C. A protected fragment about 125 nucleotides long was obtained by using the 508-bp HindIII fragment as a probe (Fig. 6). To analyze whether this transcript controlled CAT expression, we determined the direction of transcription by using the 405-bp EcoRI-HindIII fragment for Si mapping. With this truncated template, the 125-base transcript was not affected (Fig. 6), indicating that the transcript initiating 125 bp upstream from the CAT gene was responsible for CAT expression (Fig. 2). Figure 7 shows that the 125-base transcript was observed in spo+ cells after 20 h of cultivation, but no transcript was detected from spoOE or spoOH cells after 20 h of cultivation.
Nucleotide sequence of pGR71-5 HindIlu fragment and transcriptional start site. We determined the DNA sequence of the pGR71-5 HindIlI fragment by the dideoxy chain termination method of Sanger et al. (18), using the strategy shown in Fig. 2. The 508-nucleotide sequence is shown in Fig. 8. As shown in Fig. 6 and 7, the transcript specific for CAT expression was initiated 125 bases upstream from the HindIII site near the CAT gene (Fig. 2). Figure 9 shows the results obtained from high-resolution Si nuclease mapping. ,From these results, the promoter sequences were deduced to be 5'C-G-A-A-T-C-A-T-G-A3' at -10 and 5'A-G-G-A-AT-C3' at -35. DISCUSSION A developmentally regulated element which acted as a promoter for the CAT gene of pGR71 was isolated from an alkalophilic Bacillus strain. A cloned promoter fragment (pGR71-5) showed developmental induction of Cmr gene expression in B. subtilis. CAT expression by pGR71-5 was strongly repressed by the addition of excess glucose or in
VOL. 161, 1985
strains carrying spoOE or spoOH lesions. Sporulation genes (spoO) are considered to be regulatory loci because mutants altered in these genes cannot initiate sporulation and often fail to express sporulation-associated phenomena. Other investigators have shown that the spoO gene products affect developmental gene expression at the level of transcription. Zuber and Losick (22) described the fusion of the promoter for the spore gene designated spoVG to the lacZ gene of Escherichia coli. When the fusion was recombined into the B. subtilis chromosome, lacZ expression was shown to be controlled by the spoVG promoter. Four spoO genes (the spoOA, spoOB, spoOH, and spoOK genes) were essential for spoVG-directed expression of P-galactosidase. By contrast, the spoOJ gene was not required for lacZ expression. Mutations in spoOC, spoOE, and spoOF permitted a partial increase in lacZ expression at T2 h. Mongkolsuk and Lovett reported that the function of at least six spoO genes was necessary for cat-86 expression (14). Gilman and Chamberlin also reported that two Esigma28-specific transcripts were absent in spoOA, spoOB, spoOE, and spoOF mutants (4). It is interesting to analyze the possible role of spoO mutations on the pGR71-5 fragment. CAT expression by pGR71-5 was strikingly reduced in the spoOE and spoOH mutants but only slightly affected in spoOA, spoOB, spoOC, spoOD, spoOF, spoOG, spoOJ, and spoOK mutants. Si nuclease mapping of an in vivo transcript indicated that the transcript responsible for CAT expression was not present in spoOE or spoOH mutants carrying plasmid pGR71-5. It is not clear whether the spoOE or spoOH gene products modulate expression of the pGR71-5 promoter directly or indirectly and what the roles of spoOE or spoOH gene products are compared with those of other spoO gene products. Although pGR71-5 is a high-copy-number plasmid, it does not detectably interfere with host sporulation (unpublished data). We observed that CAT specific activity increased until 16 h. These results suggest that the pGR71-5 promoter is under developmental control but is not related to sporulation directly. High-resolution Si nuclease mapping of the in vivo transcript driving pGR71-5 CAT expression suggested that the promoter sequences were 5'C-G-A-A-T-C-A-T-G-A3' at -10 and 5'A-G-G-A-A-T-C3' at -35. The -35 region was similar to that reported for the -35 recognition site of the sigma-37 form of RNA polymerase, but the -10 region was different from the consensus sequence (10, 21). However, such sequence comparisons are difficult to interpret because we do not yet know which form of RNA polymerase transcribes the pGR71-5 fragment and the cloned fragment originated in an alkalophilic Bacillus sp. of uncertain affinity to B. subtilis. In conclusion, the HindIII fragment of pGR71-5 was developmentally regulated in sporulation medium in B. subtilis and was controlled by the spoOE and spoOH loci. We think that it is significant that the deduced promoter obtained from the alkalophilic Bacillus strain resembled the promoters recognized by Esigma37 of B. subtilis and that this promoter was under glucose and spoO control in a heterologous organism. ACKNOWLEDGMENTS We thank R. H. Doi and C. W. Price for reading the manuscript and for many useful discussions. We are grateful to Y. Kobayashi and Y. Sadaie for providing strains.
ALKALOPHILIC B. SUBTILIS PROMOTER
163
This work was supported in part by a Science Research Grant from the Science and Technology Agency, Japan. LITERATURE CITED 1. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254. 2. Chang, S., and S. N. Cohen. 1979. High frequency transformation of Bacillus subtilis protoplasts by plasmid DNA. Mol. Gen. Genet. 168:111-115. 3. Doi, R. H. 1982. Multiple RNA polymerase holoenzymes exert transcriptional specificity in Bacillus subtilis Arch. Biochem. Biophys. 214:772-781. 4. Gilman, M. Z., and M. J. Chamberlin. 1983. Developmental and genetic regulation of Bacillus subtilis genes transcribed by sigma28-RNA polymerase. Cell 35:285-293. 5. Goldfarb, D. S., R. H. Doi, and R. L. Rodriguez. 1981. Expression of Tn-9 derived chloramphenicol resistance in Bacillus subtilis. Nature (London) 293:309-311. 6. Goldfarb, D. S., R. L. Rodriguez, and R. H. Doi. 1982. Translation block to expression of the Escherichia coli Tn-9-derived chloramphenicol-resistance gene in Bacillus subtilis. Proc. Natl. Acad. Sci. U.S.A. 79:5886-5890. 7. Goldfarb, D. S., S.-L. Wong, T. Kudo, and R. H. Doi. 1983. A temporally regulated promoter from Bacillus subtilis is transcribed only by an RNA polymerase with a 37,000 dalton sigma factor. Mol. Gen. Genet. 191:319-325. 8. Honda, H., C. Kato, T. Kudo, and K. Horikoshi. 1984. Cloning of leucine genes of alkalophilic Bacillus no. 221 in E. coli and B. subtilis. J. Biochem. (Tokyo) 95:1485-1490. 9. Horikoshi, K., and T. Akiba. 1982. Alkalophilic microorganisms. Springer-Verlag, New York. 10. Johnson, W. C., C. P. Moran, Jr., and R. Losick. 1983. Two RNA polymerase sigma factors from Bacillus subtilis discriminate between overlapping promoters for a developmentally regulated gene. Nature (London) 302:800-804. 11. Kudo, T., and K. Horikoshi. 1979. The environmental factors affecting sporulation of an alkalophilic Bacillus species. Agric. Biol. Chem. 43:2613-2614. 12. Kudo, T., and K. Horikoshi. 1983. Effect of pH and sodium ion on germination of alkalophilic Bacillus species. Agric. Biol. Chem. 47:665-669. 13. Messing, J. 1983. New M13 vectors for cloning. Methods
Enzymol. 101:20-78.
14. Mongkolsuk, S., and P. S. Lovett. 1984. Selective expression of a plasmid cat gene at a late stage of Bacillus subtilis sporulation. Proc. Natl. Acad. Sci. U.S.A. 81:3457-3460. 15. Ollington, J. F., W. G. Haldenwang, T. V. Huynh, and R. Losick. 1981. Developmentally regulated transcription in a cloned segment of the Bacillus subtilis chromosome. J. Bacteriol. 147:432-442. 16. Sadaie, Y., and T. Kada. 1983. Formation of competent Bacillus subtilis cells. J. Bacteriol. 153:813-821. 17. Saito, H., and K. Miura. 1963. Preparation of transforming DNA by phenol treatment. Biochim. Biophys. Acta 72:619-629. 18. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. U.S.A. 74:5463-5467. 19. Sashihara, N., T. Kudo, and K. Horikoshi. 1984. Molecular cloning and expression of cellulase genes of alkalophilic Bacillus sp. strain N-4 in Escherichia coli. J. Bacteriol. 158:503-506. 20. Show, W. V. 1975. Chloramphenicol acetyltransferase from chloramphenicol-resistant bacteria. Methods Enzymol. 43: 737-755. 21. Wong, S.-L., C. W. Price, D. S. Goldfarb, and R. H. Doi. 1984. The subtilisin E gene of Bacillus subtilis is transcribed from a sigma-37 promoter in vivo. Proc. Nati. Acad. Sci. U.S.A.
81:1184-1188.
22. Zuber, P., and R. Losick. 1983. Use of lacZ fusion to study the role of the spoO genes of Bacillus subtilis in developmental regulation. Cell 35:275-283.
