Bacilysin overproduction in Bacillus amyloliquefaciens FZB42 markerless derivative strains FZBREP and FZBSPA enhances antibacterial activity Liming Wu, Huijun Wu, Lina Chen, Ling Lin, Rainer Borriss & Xuewen Gao
Applied Microbiology and Biotechnology ISSN 0175-7598 Appl Microbiol Biotechnol DOI 10.1007/s00253-014-6251-0
1 23
Your article is protected by copyright and all rights are held exclusively by SpringerVerlag Berlin Heidelberg. This e-offprint is for personal use only and shall not be selfarchived in electronic repositories. If you wish to self-archive your article, please use the accepted manuscript version for posting on your own website. You may further deposit the accepted manuscript version in any repository, provided it is only made publicly available 12 months after official publication or later and provided acknowledgement is given to the original source of publication and a link is inserted to the published article on Springer's website. The link must be accompanied by the following text: "The final publication is available at link.springer.com”.
1 23
Author's personal copy Appl Microbiol Biotechnol DOI 10.1007/s00253-014-6251-0
BIOTECHNOLOGICALLY RELEVANT ENZYMES AND PROTEINS
Bacilysin overproduction in Bacillus amyloliquefaciens FZB42 markerless derivative strains FZBREP and FZBSPA enhances antibacterial activity Liming Wu & Huijun Wu & Lina Chen & Ling Lin & Rainer Borriss & Xuewen Gao
Received: 23 September 2014 / Revised: 16 November 2014 / Accepted: 18 November 2014 # Springer-Verlag Berlin Heidelberg 2014
Abstract Bacillus amyloliquefaciens strains FZBREP and FZBSPA were derived from the wild-type FZB42 by replacement of the native bacilysin operon promoter with constitutive promoters PrepB and Pspac from plasmids pMK3 and pLOSS, respectively. These strains contained two antibiotic resistance genes, and markerless strains were constructed by deleting the chloramphenicol resistance cassette and promoter region bordered by two lox sites (lox71 and lox66) using Cre recombinase expressed from the temperature-sensitive vector pLOSS-cre. The vector-encoded spectinomycin resistance gene was removed by high temperature (50 °C) treatment. RT-PCR and qRT-PCR results indicated that PrepB and especially Pspac significantly increased expression of the bac operon, and FZBREP and FZBSPA strains produced up to 170.4 and 315.6 % more bacilysin than wild type, respectively. Bacilysin overproduction was accompanied by enhancement of the antagonistic activities against Staphylococcus aureus (an indicator of bacilysin) and Clavibacter michiganense subsp. sepedonicum (the causative agent of potato ring rot). Both the size and degree of ring rot-associated necrotic tubers were decreased compared with the wild-type strain, which
Liming Wu and Huijun Wu contributed equally to this work. Electronic supplementary material The online version of this article (doi:10.1007/s00253-014-6251-0) contains supplementary material, which is available to authorized users. L. Wu : H. Wu : L. Chen : L. Lin : X. Gao Department of Plant Pathology, College of Plant Protection, Nanjing Agricultural University, Nanjing, China L. Wu : H. Wu : L. Chen : L. Lin : X. Gao (*) Key Laboratory of Monitoring and Management of Crop Diseases and Pest Insects, Ministry of Education, Nanjing, China e-mail:
[email protected] R. Borriss ABiTEP GmbH, Berlin, Germany
confirmed the protective effects and biocontrol potential of these genetically engineered strains. Keywords Bacillus amyloliquefaciens . Bacilysin . Promoter replacement . Markerless . Antibiotic overproduction . Antibacterial
Introduction The plant growth-promoting rhizobacteria (PGPR) Bacillus amyloliquefaciens FZB42 is an environmental strain that is distinguished from the domesticated model organism B. subtilis 168 by its prominent ability to stimulate plant growth and to suppress plant pathogens (Chen et al. 2006; Chen et al. 2007; Chen et al. 2009a). Analysis of the FZB42 genome revealed an array of very large gene clusters involved in the synthesis of a vast array of secondary metabolites that suppress competitive bacteria and fungi within the plant rhizosphere. To date, gene clusters for 4′-phosphopantetheine transferase (Sfp)-dependent antimicrobial lipopeptides surfactin, bacillomycin D, and fengycin, and three polyketide antibiotics (bacillaene, difficidin, and macrolactin) have been identified (Koumoutsi et al. 2004; Scholz et al. 2011). Both lipopeptides and polyketides are wellcharacterized secondary metabolites possessing antifungal, antibacterial, immunosuppressive, antitumor, or other physiologically relevant bioactivities. Sfp-dependent peptides play a key role in biocontrol of plant diseases. Additionally, FZB42 can produce antibiotics via Sfpindependent pathways, of which the dipeptide bacilysin is a typical example. Bacilysin is a dipeptide consisting of a nonproteinogenic L-anticapsin and an N-terminal L-alanine and is one of the simplest known peptide antibiotics (Kenig and Abraham 1976). It has been reported that this dipeptide is synthesized by the bacABCDEFG gene cluster and generated independently of the Sfp pathway (Steinborn et al. 2005;
Author's personal copy Appl Microbiol Biotechnol
Parker and Walsh 2013). Bacilysin possesses a strong antagonistic activity against a wide range of gram-positive and gram-negative bacteria and also the fungus Candida albicans (Kenig and Abraham 1976; Chen et al. 2009b). Antimicrobial activity depends on transport into susceptible cells by a distinct peptide permease system, followed by hydrolysis to anticapsin, and subsequent inhibition of glucosamine synthetase and bacterial peptidoglycan or fungal mannoprotein biosynthesis, which results in protoplasting and lysis (Kenig et al. 1976; Steinborn et al. 2005). Potential applications are restricted by low productivity, and there have been many attempts to increase bacilysin production. Ozcengiz et al. (1990)) reported that the nitrogen source is the major controller of bacilysin biosynthesis, and aspartate was better than glutamate as the sole nitrogen source. Inaoka and Ochi (2011)) showed that addition of scandium to the growth medium stimulated the production of bacilysin at the transcriptional level. Most experimental approaches to date have focused on changing the composition of the medium, although it has been demonstrated that production of secondary metabolites in Bacillus such as mycosubtilin (Leclère et al. 2005) and surfactin (Sun et al. 2009) can be improved using genetic engineering methods. In this study, a genetic engineering approach was applied for enhancing bacilysin production. The native promoter from the B. amyloliquefaciens FZB42 bacilysin operon was replaced by the strong constitutive promoters PrepB and Pspac from plasmids pMK3 and pLOSS, respectively. The Cre/lox system was used to eliminate the selection marker to generate the marker-free derivatives FZBREP and FZBSPA. Transcription from the bac cluster was measured by reverse transcription PCR (RT-PCR) and quantitative RT-PCR (qRT-PCR), and bacilysin production was compared using highperformance liquid chromatography (HPLC). Antibacterial activities against S. aureus and the potato ring rot pathogen C. michiganense subsp. sepedonicum were assessed.
Materials and methods Bacterial strains, plasmids, and growth conditions The bacterial strains and plasmids used in this study are described in Table 1. Bacillus, E. coli, and S. aureus were cultivated routinely on Luria broth (LB) medium solidified with 1.5 % agar. Nutrient agar (NA) medium was used to culture C. michiganense subsp. sepedonicum. For general bacilysin production, B. amyloliquefaciens FZB42 and derivatives were grown in Perry and Abraham (PA) medium (Parker and Walsh 2013) at 30 °C for 48 h. When required, antibiotics were added to the following final concentrations: ampicillin (Amp) 100 μg mL−1, chloramphenicol (Cm) 5 μg mL−1, spectinomycin (Spc) 100 μg mL−1.
Bacilysin purification and determination Bacilysin from B. amyloliquefaciens FZB42 and derivatives in PA medium were adsorbed from culture filtrates onto Dowex 50WX8-200 (Sigma, America) resin, washed with water, and eluted with 4 % ammonium hydroxide (aqueous). Eluates were lyophilized and dissolved in H2O for liquid chromatography-mass spectrometry (LC-MS) detection using parameters as previously described (Chen et al. 2009b; Parker and Walsh 2013). Bacilysin (retention time=4.087 min) was collected and lyophilized. The linear relationship between peak area and concentration was obtained using pure bacilysin from the wild-type FZB42. For quantitative assays, the areas under the bacilysin peaks were calculated using the auto integrate function in the Agilent operating software. DNA manipulation and transformation Isolation and manipulation of recombinant DNA were performed using standard techniques. Genomic DNA was extracted from Bacillus spp. as described by Hoflack et al. (1997). Plasmids were extracted from E. coli and Bacillus spp. using an Omega plasmid miniprep kit (Omega Bio-Tek, USA), except that Bacillus spp. were resuspended in solution I and treated with 10 mg mL−1 lysozyme (Sigma, pH 8.0) at 37 °C for 20 min. E. coli and B. amyloliquefaciens were transformed as described by Sambrook and Russell (2001) and Spizizen (1958), respectively. Spe I and Bmt I enzymes were purchased from New England Biolabs Inc. (Beijing, China), and all other chemicals used in this study were from TaKaRa Bio Inc. (Dalian, China). Construction of plasmids for B. amyloliquefaciens FZB42 derivatives In order to replace the native promoter of the bacilysin operon of B. amyloliquefaciens FZB42, two promoter exchange vectors pMDrep and pMDspac were constructed as follows. Firstly, the lox71-cm-lox66 cassette was amplified by PCR from plasmid pAD43-25 using primer pair lox71-cm-F/ lox66-cmR. Lox71 and lox66 sites, recognized by Cre recombinase, were introduced using forward and reverse primers. PCR products were cloned into the pMD19-T vector using a TA cloning kit (TaKaRa, Japan) to generate pMD7c6. The 640-bp fragment which was used as the left arm of the double crossover was then amplified from B. amyloliquefaciens FZB42 chromosomal DNA using primers ywfA-F/ywfA-R and cloned into the Hind III and Sal I sites of plasmid pMD7c6 to generate pMD7c6-Y. The promoters PrepB and Pspac were amplified from plasmids pMK3 (primers Prep-F/Prep-R) and pLOSS (primers Pspac-F/ Pspac-R) and fused with the fragment amplified from FZB42 chromosomal DNA (using primers bac-rep-F or bac-spac-F/ bac-R) by overlap extension PCR. The resulting fragments
Author's personal copy Appl Microbiol Biotechnol Table 1
Bacterial strains and plasmids used in this study
Strain or plasmid
Relevant genotype or characteristic
Source or reference
Wild type, produces lipopeptides, polyketides, and bacilysin FZB42 derivative overproducing bacilysin, bac operon under control of the promoter PrepB FZB42 derivative overproducing bacilysin, bac operon under control of the promoter Pspac
BGSC 10A6 This study
FΦ80dlacZ ΔM12 minirecA1
TaKaRa Bio Inc.
An indicator strain sensitive to bacilysin
Hilton et al. (1988)
Causative agent of potato ring rot
CGMCC 9643
Cloning vector, Ampr Containing the cat cassette encoding Cm acetyl transferase, Cmr Carrying the PrepB promoter Temperature-sensitive vector carrying the Pspac promoter, Spcr Containing the Cre recombinase gene
TaKaRa Bio Inc. From BGSC From BGSC From BGSC Yang and Hughes (2001)
pMD19-T carrying the PrepB promoter and the cat cassette, Ampr Cmr pMD18-T carrying the Pspac promoter and the cat cassette, Ampr Cmr Expression of cre in B. amyloliquefaciens, Spcr
This study This study This study
Strains B. amyloliquefaciens FZB42 FZBREP FZBSPA
This study
E. coli DH5α S. aureus ATCC 9144 C. michiganense subsp. sepedonicum Plasmids pMD19-T pAD43-25 pMK3 pLOSS pBS185 pMDrep pMDspac pLOSS-cre
Ampr ampicillin resistance, Cmr chloramphenicol resistance, Spcr spectinomycin resistance, BGSC Bacillus Genetic Stock Center, CGMCC China General Microbiological Culture Collection Center
were restricted with BamH I and Sac I and inserted into the corresponding sites of pMD7c6-Y to generate the final native promoter replacement vectors pMDrep and pMDspac. To delete the Cm resistance cassette, plasmid pLOSS-cre was constructed as follows. The cre gene was amplified from pBS185 using primer pair cre-F/cre-R, and the Spe I-/Bmt Idigested PCR product was cloned into the corresponding sites of the temperature-sensitive vector pLOSS containing the Spcr gene (Claessen et al. 2008). The specific primers used above are listed in Table 2. RT-PCR and qRT-PCR analysis The mRNA expression levels of bac cluster genes from the mutants FZBREP and FZBSPA were measured and compared with wild-type B. amyloliquefaciens FZB42 using RT-PCR and qRT-PCR. Bacillus spp. cells were cultured at 30 °C for 12 or 24 h in PA medium. Total RNA was extracted using the Bacterial RNA Kit (Omega Bio-Tek, USA) according to the manufacturer’s instructions. First-strand complementary DNA (cDNA) was synthesized using reverse transcription (TaKaRa Bio Inc, Dalian, China) with random hexamer primers. The resulting cDNA was used as template for subsequent PCR amplification. RT-PCR products were resolved on an agarose gel to determine the expression levels of the target
genes. Subsequently, qRT-PCR was performed with SYBR Premix Ex Taq (TaKaRa Bio Inc, Dalian, China) on a 7500 Fast Real-Time PCR Detection System. Gene 16S rRNA was the internal reference for normalization. Primers for genes are shown in Table 2.
Antibacterial activity against C. michiganense subsp. sepedonicum When cultures of C. michiganense subsp. sepedonicum reached an OD600 of 1, cultures were diluted 1:50 in NA medium solidified with 1.5 % agar. Filtrates from 5 μl of B. amyloliquefaciens FZB42 and derivative cultures grown in PA medium were used in the agar diffusion test. Nacetylglucosamine (Sigma, USA), a known specific antagonist of bacilysin/anticapsin activity (Kenig and Abraham 1976), was used to verify bacilysin activity. A system for testing potato tuber was established to investigate the capacity for biological control against potato ring rot. Tubers were cut and sprayed with a 500 μl suspension of C. michiganense subsp. sepedonicum (106 CFU/mL). One hundred microliters of the B. amyloliquefaciens filtrates were sprayed on the sections 1 h after inoculation. PA medium was used as a control. After incubation at 28 °C for 5 days, tubers
Author's personal copy Appl Microbiol Biotechnol Table 2
Oligonucleotide primers used in this study
Name
Sequence (5′–3′)
Construction of mutants lox71-cm-F lox66-cm-R ywfA-F ywfA-R Prep-F Prep-R Pspac-F Pspac-R bac-rep-F bac-spac-F bac-R yb-R yb-F cre-F cre-R cm-F
TACCGTTCGTATAGCATACATTATACGAAGTTATTTGATACACAAGGCTTTGACCT TACCGTTCGTATAATGTATGCTATACGAAGTTATGTTTTCACCGTCATCACCGAAA AAGCTTGATAAAACAGAAGAGGAAAACGGAC (Hind III) GTCGACTTACCGATACAATGTTTGGTCGGCC (Sal I) GCGGATCCAATAAAAAAAGCACCTGAAAAGGTGTCTTT (BamH I) TCCAATATAATCATGAGCACCAACTATTTAGTTATTTGTTTAGTCA GCGGATCCATAATTCTACACAGCCCAGTCCAGACTATT (BamH I) TCCAATATAATCATGAGCACCAAAGTAGTTCCTCCTCTTAGCTAGC TGACTAAACAAATAACTAAATAGTTGGTGCTCATGATTATATTGGA GCTAGCTAAGAGGAGGAACTACTTTGGTGCTCATGATTATATTGGA GAGCTCTCAGTTTTCATCATGAATCTCTCCTTTTCCGA (Sac I) TCTTACTCCGTTATCCCATTC GAGCGTCCCGAGAATCAG GCTAGCTAAGAGGAGGAACTACTATGTCCAATTTACTGACCGTACACC (Bmt I) ATAACTAGTTTAATCGCCATCTTCCAGCAGGCGCACCATTGCC (Spe I) TGATACACAAGGCTTTGA
cm-R GTGACATTAGAAAACCGA RT-PCR and qRT-PCR analysis 16S-F CTAACCCGCCGCCCTTAT 16S-R CTGCGAATGATTTCCAAC bacA-F TTTCCGAATAATGACCAGC bacA-R TAAGAAAGCAGAACTTCCGTAT bacB-F TAAGAAAGCAGAACTTCCGTAT bacB-R ATAGAATGGGATAACGGAGT bacC-F GTGTATCCACCGTCTGCG bacC-R CTCGGCAAGCCTGAAGAA
bacD-F bacD-R bacE-F bacE-R bacF-F bacF-R bacG-F bacG-R
CTCGCCAGATATGTAGGC GTGACGACGTTGGAAGAT TCACATCCGTCCACAGCA GCAGTATTCCGATGGTGTTT TCAGACGCTCCGTATGCT CAGGCGGTCAATGAGTTT TCGTCGGAAACCTATGGA AGCTGAATGGCGATGTTT
Restriction sites are underlined
were cut close to the site of inoculation to observe the incidence of potato ring rot. Statistical analysis At least three independent replicates were performed for each experiment. Data were analyzed by ANOVA followed by Fisher’s least significant difference test (P=0.05 or 0.01) using SPSS software (SPSS Inc. Chicago).
Results Construction of FZBREP and FZBSPA mutant strains In order to construct the marker-free B. amyloliquefaciens FZB42 bac promoter enhanced mutants, a PCR-based strategy and the Cre/lox system were used (see Experimental
procedures for details). Firstly, promoter exchange vectors pMDrep and pMDspac were used to transform B. amyloliquefaciens competent cells, and Cmr transformants were selected. Two primers (yb-F/yb-R) amplified the segment containing the ywfA and bacA genes to facilitate identification of positive transformants. Fragments in FZBREP-C and FZBSPA-C were larger than those obtained from FZB42 WT (Fig. 1b), which indicated that the promoters PrepB/Pspac and the cat cassette had been successfully inserted into the genome via double homologous recombination. Secondly, FZBREP-C and FZBSPA-C strains were transformed with the plasmid pLOSS-cre, and transformants with both Cm and Spc resistance at 30 °C were identified. The pLOSS-cre plasmids extracted from FZBREP-C and FZBSPA-C were digested by Spe I and Bmt I and shown to be identical to the positive control (Fig. 1c). To remove the resistance markers, FZBREP-C and FZBSPA-C containing pLOSS-cre were transferred onto LB agar (Spc, 1 mM IPTG) and incubated for 12 h. Resulting colonies were then patched on LB agar
Author's personal copy Appl Microbiol Biotechnol Fig. 1 Construction of B. amyloliquefaciens FZB42 derivatives FZBREP and FZBSPA. a Schematic diagram of the construction; b–d gel electrophoresis of mutants FZBREP and FZBSPA. M1 DNA Marker DL10,000; M2 DNA Marker DL2000; Lane 1 segment including genes ywfA and bacA from FZB42 WT; Lane 2 segment including genes ywfA, bacA, PrepB, and the cat cassette from FZBREP-C; Lane 3 segment including genes ywfA, bacA, Pspac, and the cat cassette from FZBSPA-C; Lane 4 plasmid pLOSS-cre (Spe I and Bmt I) extracted from FZBREP-C; Lane 5 plasmid pLOSS-cre (Spe I and Bmt I) extracted from FZBSPA-C; Lane 6 plasmid pLOSS-cre (Spe I and Bmt I); Lane 7 cat cassette of FZBREP-C; Lane 8 cat cassette of FZBSPA-C; Lane 9 no cat cassette is evident in FZBREP; Lane 10 no cat cassette is evident in FZBSPA
(Spc, Cm) and LB agar (Spc), and candidates which displayed Spc resistance and Cm sensitivity were verified using primers cm-F/cm-R (Fig. 1d). These results strongly indicated that the Cre recombinase had deleted the cat cassette from the chromosomal DNA. Finally, for elimination of pLOSS-cre from B. amyloliquefaciens, colonies were patched onto Spc-free LB agar and incubated at 50 °C. Resulting colonies that were sensitive to Spc showed that pLOSS-cre had been eradicated, and confirmed that the marker-free FZBREP and FZBSPA strains had been successfully generated. Detection of expression of the bac gene cluster The bac gene cluster, which includes the seven genes bacABCDEFG in producing Bacillus strains, is responsible for bacilysin production (Steinborn et al. 2005; Parker and Walsh 2013). To detect gene expression at the transcription level, RT-PCR and qRT-PCR were performed. Gene expression was tested at 12 and 24 h (Figs. 2 and 3). During the exponential growth phase (12 h of cultivation), expression of bacABCDEFG was relatively low in FZBREP, FZBSPA, and
FZB42, but was significantly higher in FZBREP and FZBSPA compared with the wild-type FZB42, with the highest expression in FZBSPA. During stationary phase (24 h of cultivation), relative expression levels of the bac genes remained higher in FZBREP and FZBSPA than in FZB42. The genes bacC and bacD were most obviously upregulated, by more than sixfold. These genes encode enzymes that function late in bacilysin biosynthesis and encode an NAD+-dependent oxidoreductase and a promiscuous dipeptide ligase, respectively (Parker and Walsh 2013). Therefore, FZBREP and FZBSPA, containing the promoters PrepB and Pspac, clearly exhibited enhanced expression of the bac gene cluster. Bacilysin overproduction by FZBREP and FZBSPA Staphylococcus aureus ATCC 9144 is sensitive to the antibiotic bacilysin (Hilton et al. 1988). To demonstrate the bacilysin production of FZBREP and FZBSPA, their antagonistic properties were investigated using S. aureus as an indicator strain. Filtrates from FZBREP and FZBSPA resulted in a significantly greater inhibition zone than did that of the
Author's personal copy Appl Microbiol Biotechnol
Fig. 2 RT-PCR analysis of expression of the bac gene cluster in B. amyloliquefaciens derivatives FZBREP and FZBSPA. Wild-type strain FZB42 was used as control. The 16S rRNA gene was used as an internal standard
Fig. 4 Detection of antagonistic action against S. aureus by paper-disk agar diffusion assay. FZB42 WT, FZBREP, and FZBSPA were grown in PA medium for 48 h. Five-microliter culture filtrates obtained after centrifugation and filtration were applied to paper disks (5 mm diameter) placed on LB agar inoculated with S. aureus ATCC 9144. PA medium was used as control. The inhibition zone (mm) includes the paper disk diameter. Asterisks indicate a highly significant difference compared with FZB42 WT at P
