Bactericidal effect of bovine lactoferrin and synthetic ... - Springer Link

Biometals (2014) 27:969–980 DOI 10.1007/s10534-014-9775-y

Bactericidal effect of bovine lactoferrin and synthetic peptide lactoferrin chimera in Streptococcus pneumoniae and the decrease in luxS gene expression by lactoferrin Nidia Leoń-Sicairos • Uriel A. Angulo-Zamudio • Jorge E. Vidal • Cynthia A. Lo´pez-Torres • Jan G. M. Bolscher • Kamran Nazmi • Ruth Reyes-Cortes • Magda Reyes-Lo´pez • Mireya de la Garza • Adrian Canizalez-Romań Received: 31 March 2014 / Accepted: 5 July 2014 / Published online: 23 July 2014 Ó Springer Science+Business Media New York 2014

J. G. M. Bolscher K. Nazmi Department of Oral Biochemistry ACTA, University of Amsterdam and VU University, Amsterdam, The Netherlands

of bovine lactoferrin (bLF) and the synthetic LFpeptides lactoferricin (LFcin17–30), lactoferrampin (LFampin265–284), and LFchimera against S. pneumoniae planktonic cells. The mechanism of damage was also investigated, as well as the impact of these peptides on the transcription levels of genes known to encode important virulence factors. S. pneumoniae planktonic cells were treated with bLF, LFcin17–30, LFampin265–284 and LFchimera at different time points. The viability of treated planktonic cells was assessed by dilution and plating (in CFU/ml). The interaction between LF and LF-peptides coupled to fluorescein was visualized using a confocal microscope and flow cytometry, whereas the damage at structural levels was observed by electron microscopy. Damage to bacterial membranes was further evaluated by membrane permeabilization by use of propidium iodide and flow cytometry, and finally, the expression of pneumococcal genes was evaluated by qRT-PCR. bLF and LFchimera were the best bactericidal agents. bLF and peptides interacted with bacteria causing changes in the shape and size of the cell and membrane permeabilization. Moreover, the luxS gene was downregulated in bacteria treated with LF. In conclusion, LF and LFchimera have a bactericidal effect, and LF down-regulates genes involved in the pathogenicity of pneumococcus, thus demonstrating potential as new agents for the treatment of pneumococcal infections.

M. Reyes-Lo´pez M. de la Garza Departamento de Biologıá Celular, CINVESTAV-IPN, Mexico, D.F., Mexico

Keywords Lactoferrin Peptides Bactericidal effect Planktonic cells Pneumococcus

Abstract Streptococcus pneumoniae (pneumococcus) is responsible for nearly one million child deaths annually. Pneumococcus causes infections such as pneumonia, otitis media, meningitis, and sepsis. The human immune system includes antibacterial peptides and proteins such as lactoferrin (LF), but its activity against pneumococcus is not fully understood. The aim of this work was to evaluate the bactericidal effect

N. Leoń-Sicairos (&) U. A. Angulo-Zamudio C. A. Lo´pez-Torres R. Reyes-Cortes A. Canizalez-Romań Unidad de Investigacioń, Facultad de Medicina, Universidad Autońoma de Sinaloa, Cedros y Sauces, Fracc. Fresnos., C.P. 80246 Culiacań, Sinaloa, Mexico e-mail: [email protected] N. Leoń-Sicairos Departamento de Investigacioń, Hospital Pedia´trico de Sinaloa, Culiacań, Sinaloa, Mexico J. E. Vidal Hubert Department of Global Health, Rollins School of Public Health, Emory University, Atlanta, GA, USA

123

970

Introduction Streptococcus pneumoniae is a human pathogen that colonizes the upper respiratory tract and causes lifethreatening diseases, such as pneumonia, bacteremia, and meningitis, throughout the world. Pneumococcal pneumonia is a major cause of infant mortality in developing countries, where it causes approximately 25 % of all preventable deaths in children under the age of 5 and more than 1.2 million infant deaths per year (Lynch and Zhanel 2010). In countries that have a high prevalence of HIV-1 infection, there has been a significant increase in the rate of pneumococcal pneumonia and associated bacteremia; this increase is higher in young adults (Nunes et al. 2013). The problem with treating pneumococcal infection is that the increase in resistance of S. pneumoniae to multiple classes of agents is becoming increasingly common. Globally, antimicrobial resistance among pneumococci spread rapidly in the 1990s, reflecting the dissemination of a few clones. Currently, the incidence of resistance varies considerably within different geographic regions and is influenced by patterns of antibiotic use, population density, and local prevalence of strains resistant to multiple antibiotics. The use of a specific class of antibiotics not only predisposes resistance to that class but may also facilitate the emergence of resistance to unrelated antibiotic classes. Following the use of pneumococcal conjugate vaccines (PCVs) in children, the incidence of invasive pneumococcal disease declined in both children and adults (reflecting herd immunity) (Lynch and Zhanel 2010). However, the emergence of serotypes not encompassed by PVCs is worrisome and may be associated with heightened antimicrobial resistance and virulence. Continued vigilance for the emergence of novel serotypes, the development of vaccines with expanded coverage and immunogenicity, and the development of new strategies will be critical for optimal prevention of pneumococcal infections (Lynch and Zhanel 2010; Nunes et al. 2013). Host defense proteins are cationic molecules that are part of the immune system of most multicellular organisms; they are a class of compounds that are being actively researched (Nijnik and Hancock 2009; Mookherjee and Hancock 2007). These compounds include the protein lactoferrin (LF) and the LF peptides. LF is an abundant iron-binding protein in

123

Biometals (2014) 27:969–980

milk, but it is also present in several other secreted bodily fluids and in the secondary granules of neutrophils (Vogel 2012). LF and its peptides exhibit antibacterial, antiparasitic, antifungal and antiviral activities in the intestine, in part through a direct effect on pathogens but also possibly by affecting the mucosal immune function. It has been documented that LF exert its bactericidal actions in two ways: indirectly by binding free iron with great affinity, thus limiting the amount of iron available for the metabolism of microorganisms, and directly by affecting the microbial membrane (Cavestro et al. 2002; Orsi 2004). Several other functions have been ascribed to this cationic protein, including the inhibiting action toward bacterial adhesion, invasion of target host cells, and the LF influence on bacterial aggregation and biofilm development (Valenti et al. 2004). These different LF functions can be attributed to the different physicochemical properties of the molecule, which include the aforementioned iron-binding capability, binding to anionic cell surfaces and molecules, and its serine protease activity. It has been reported that the region responsible for microbial activity is located at the N-terminus of the protein. Indeed, an antimicrobial peptide called lactoferricin B (LFcin) is released from the N-terminus of LF in the intestine (Tomita et al. 1991, 1994). Other peptides derived from bovine or human LF have been obtained. For example, a second putative antimicrobial domain was identified in the N1-domain of LF, designated lactoferrampin (LFampin) (van der Kraan et al. 2004). A chimerical structure containing LFcin amino acids 17–30 and LFampin amino acids 265–284 was designed and synthesized (Bolscher et al. 2009). The bactericidal activity of this LFchimera was found to be drastically stronger than that of the constituent peptides, as demonstrated by the reduction of the required concentration, shorter incubation time and decreased ionic strength dependency (Bolscher et al. 2009; Leon-Sicairos et al. 2009; Flores-Villasenor et al. 2010; Bolscher et al. 2012). The activity of LFchimera against Candida spp, Vibrio cholerae and parahaemolyticus, Staphylococcus aureus, enterotoxigenic and enterohaemorragic Escherichia coli, Entamoeba histolytica, and Leishmania pifanoi has been tested in vitro (Bolscher et al. 2009; Flores-Villasenor et al. 2010, 2012a; Silva et al. 2012; Leon-Sicairos et al. 2009). Recent studies in vivo in our laboratories found that LFchimera protected mice

Biometals (2014) 27:969–980

against a lethal challenge with enterohemorrhagic E. coli O157:H7 (Flores-Villasenor et al. 2012b). The aim of this work was to determine the antibacterial activity of bLF and the synthetic LF peptides LFcin17–30, LFampin265–284 and LFchimera on S. pneumoniae planktonic cells and the expression of virulence factors involved in the pathogenesis of pneumococcal infection.

Materials and methods Materials

971

measuring the viable cells by counting colony forming units/ml (CFU/ml) from serial tenfold dilutions prepared in BHI broth. Colonies were counted using an electronic counter (CountTM, Heathrow Scientific). Experiments were performed in triplicate, and Sigmaplot software was used to calculate the mean and standard deviation and to perform statistical analysis. Results were expressed as the percentage of viable cells; they were calculated relative to viable bacteria grown in BHI broth. Experiments were performed in triplicate, and the mean and standard deviation are indicated. Statistical significance was determined using a Student’s t test (P \ 0.05).

Bovine lactoferrin (bLF), approximately 30 % saturated with iron, was purchased from Sigma. Synthetic peptides LFcin17–30, LFampin265–284 and LFchimera were obtained by solid state peptide synthesis using F-moc chemistry, as described previously (Bolscher et al. 2009).

Statistical analyses

Strains and bacterial culture media

Measurement of bacterial viability and membrane permeabilization with a LIVE/DEADÒ BacLight kit and propidium iodide staining

Streptococcus pneumoniae strains utilized in this study included, genome sequenced, strain D39 (Avery et al. 1944; Lanie et al. 2007) and a D39 GFPexpressing derivative, SPJV01 (Vidal et al. 2011). The strains were cultured on blood agar plates (BAP), in brain hear infusion broth (BHI) or were grown in Todd Hewitt broth (THB) containing 0.5 % (w/v) yeast extract (THY). Where indicated, 2 % maltose (w/v), tetracycline (1 lg/ml) or erythromycin (1 lg/ml) was added to the culture medium. Growth inhibition in the presence of bLF and bLFpeptides To test for bactericidal activity, approximately 7.5 9 104 CFU/ml of S. pneumoniae D39 in BHI broth was incubated in 96-well microplates (Corning) with 10 and 40 lM bLF, 5 and 10 lM LFcin17–30, LFampin265–284, and LFchimera, respectively. Bacterial suspensions were used without addition of lactoferrins as a control for growth (positive control). Bacterial suspensions treated with 20 lM of erythromycin were additionally used to compare bactericidal activity of the antibiotic versus lactoferrins. Cultures were incubated at 37 °C with constant agitation for 1, 2 or 6 h, and bacterial viability was determined by

The difference was calculated with logarithmic transformation of bacterial counts followed by comparison by using Student’s t test. Cases in which the P values were \0.05 were considered to be statistically significant.

The viability of each treatment was measured with a LIVE/DEADÒ BacLight kit which includes a mixture of SYTO 9 and propidium iodide (PI) stains. Bacteria with intact cell membranes only retain the green fluorescent stain, whereas bacteria with damaged membranes stain fluorescently red. S. pneumoniae treated with LF and LFchimera (40 or 5 lM, respectively) were incubated at 37 °C for 2 h and then stained with the kit following instructions of the manufacturer (Molecular Probes, Invitrogen Technologies). Membrane permeabilization of each treatment was estimated by flow cytometry using the PI inclusion criterion. Bacteria were cultured in BHI broth as described above and washed three times with BHI broth. A suspension of approximately 107 bacteria per ml was incubated with 40 lM bLF or 10 lM of either LFcin17–30, LFampin265–284 or LFchimera at 37 °C for 1.5 h. Subsequently, bacteria were washed and incubated with PI (10 mg/ml) at 4 °C, for 10 min, washed five times with PBS (pH 7.4), and then fixed and analyzed with a FACScan (Becton–Dickinson). Control experiments were carried out with bacteria either without the addition of peptide (viability control) or with 0.5 % SDS (which permeabilizes

123

972

Biometals (2014) 27:969–980

bacterial membranes). All experiments were repeated at least twice in duplicate for each assay.

Table 1 Primers used in this study Name

Target

Sequence (50 –30 )

Electron microscopy

JVS1L

lytA

AGTTTAAGCATGATATTGAGAAC

JVS5L JVS6R

luxS

ACATCATCTCCAATTATGATATTC GACATCTTCCCAAGTAGTAGTTTC

JVS35L

16S rRNA

AACCAAGTAACTTTGAAAGAAGAC

JVS2R

Streptococcus pneumoniae D39 were grown on Columbia blood agar with 5 % sheep blood and BHI broth with 0.5 % yeast extract. Briefly, bacteria were incubated for 3 h to obtain 108 CFU/ml. Subsequently, cells were incubated for 2 h with 40 lM LFcin17–30, LFampin285-284 and LFchimera for 2 h at 37 °C in constant agitation. After, cells were harvested and washed four times in PBS buffer (pH 7.4). Next, bacterial samples were placed on 200-mesh Formvar-coated copper grids (3 %), post stained with phosphotungstic acid (0.5 % pH 7.2) 1 min and examined with a JEOL electron microscope JEM1400 at 40 kV.

TTCGTTGAAATAGTACCACTTAT

JVS36R JVS53L

AAATTTAGAATCGTGGAATTTTT comD

AACAGTATGAGAGGGATAGAGGAC

comC

ATGAAAAACACAGTTAAATTGGAA

pspA

CATAGACTAGAACAAGAGCTCAAA

gyrB

AATAGTTGGAGATACGGATAAAAC

JVS54R JVS55L

GATAAAGGTAGTCCTCGTCAAAAT

JVS56R JVS57L

TTGTAAAATAAAATCACGGAAGAA

JVS58R JVS33L JVS34R

CTACATTATTGTTTTCTTCAGCAG TATATTCAACGTAACTAGCAATCC

Confocal microscopy To analyze peptide internalization, S. pneumoniae D39 strains (107 CFU/ml) were incubated in BHI plus 0.5 % yeast extract broth containing 2 mM FITClabeled peptides (LFcin17–30, LFampin 265-284 and LFchimera) or 2 mM FITC-LF, for 30 min at 37 °C. Bacteria were centrifuged (5 min, 10,0009g), resuspended and fixed (4 % paraformaldehyde, pH 7.4, for 30 min at 37 °C), washed twice and analyzed by confocal microscopy. To analyze peptide binding to bacterial membranes, the bacteria were fixed, washed twice and incubated with 2 mM FITC-labeled peptides or 2 mM FITC-LF for 30 min at 37 °C. Afterward, the bacteria were washed, processed and analyzed. All samples were visualized using a confocal laser-scanning microscope (Leica, Heidelberg, Germany), and flow cytometry. Gene expression studies Strain SPJV01 was inoculated in 6-well plates and then either treated (with 40 or 10 lM of LF and LFchimera, respectively) or left untreated. Bacteria were incubated for 6 h and then planktonic cells were combined with an equal volume of RNA protect reagent (Qiagen Inc., Valencia, CA, USA), centrifuged 10 min at 12,0009g in a refrigerated centrifuge (Eppendorf), and the bacterial pellet was treated with lysozyme (0.2 mg/ml) for 20 min at 37 °C. Total

123

RNA was extracted with an RNeasy Mini Kit (Qiagen Inc., Valencia, CA, USA) and treated with 2 U of DNaseI (Promega, Madison, WI, USA) as previously described (Vidal et al. 2009). The integrity of the RNA preparations and the concentrations of the samples were assessed using a NanoDrop ND-1000 Spectrophotometer (Thermo Fisher Scientific, Wilmington, DE). Quantitative RT-PCR (qRT-PCR) was performed using an iScript One-Step RT-PCR kit with SYBR Green (Bio-Rad) and a CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). qRT-PCR reactions were performed in duplicate with 10 ng of total RNA, 500 nM concentration of each primer (Table 1) and the following conditions: 1 cycle at 50 °C for 20 min, 1 cycle at 95 °C for 10 min and 40 cycles at 95 °C for 15 s and at 55 °C for 1 min. Melting curves were generated by a cycle at 95 °C for 1 min, 55 °C for 1 min and 80 cycles at 55 °C with 0.5 °C increments. Relative quantitation of mRNA expression was normalized to the constitutive expression of the housekeeping 16S rRNA and gyrB genes and was calculated by the comparative CT (2-DDCT) method (Livak and Schmittgen 2001). Experiments were repeated at least twice. To simultaneously evaluate the effects of those treatments on pneumococcal biofilms, the remaining planktonic cells were removed and biofilms were twice washed with sterile PBS and then fixed with 2 % paraformaldehyde. Biofilms were analyzed and photographed using an

Biometals (2014) 27:969–980

973

Fig. 1 Growth inhibition of planktonic cultures of S. pneumoniae. 7.5 9 104 CFU/ml of the S. pneumoniae D39 strain were incubated in 96-well microplates (Corning) containing BHI broth with LF and LF-peptides solutions at final concentrations of 10 lM bLF and 5 lM LFcin17-30, LFampin265-284, and LFchimera (A–C, respectively); or 40 lM bLF and 10 lM LFcin17-30, LFampin265-284, and LFchimera (D–F, respectively). Bacteria grown in BHI broth were used as a control for growth. 20 lM of erythromycin was used as a control for growth

inhibition. Cultures were incubated at 37 °C with constant agitation for 1, 2 or 6 h and were monitored by enumerating viable cells in CFU/ml obtained from serial tenfold dilutions prepared in BHI. Percentage of viable cells was calculated relative to viable bacteria grown in BHI broth. Experiments were performed in triplicate, and the mean and standard deviation are indicated. Statistical significance was determined using a Student’s t test for P values \0.05

inverted Evos fl microscope (Advanced Microscopy Group).

and 10 lM of the LF peptides, LFcin17–30, LFampin265–284 and LFchimera (panels D, E, and F), was analyzed after 1, 2 and 6 h post-incubation. After 2 h of incubation, the 40 lM bLF and 10 lM LFchimera cultures were significantly reduced (from 1 9 107 to 1 9 105 and 3.3 9 103 CFU/ml, respectively, or up to 1 % growth inhibition relative to untreated bacteria) and were comparable to the bactericidal activity of erythromycin (Fig. 1E, 1.5 9 105 CFU/ml, or up to 18 % growth inhibition relative to untreated bacteria). In all treatments and for time incubations longer than 1 h, LFchimera completely killed planktonic pneumococci. This bactericidal activity of LFchimera was

Results Bovine LF and LF peptides inhibit the growth of S. pneumoniae Inhibition of the growth of S. pneumoniae cultures in the presence of 10 lM bLF and 5 lM of the LF peptides, LFcin17–30, LFampin265-284 and LFchimera (Fig. 1A–C), or in the presence of 40 lM bLF

123

974

Biometals (2014) 27:969–980

units of the green dye compared to those either untreated or treated with LFcin17–30 or LFampin265–284 (Fig. 2A). The green fluorescence was also visualized by microscopy analysis (Fig. 2B), which indicated that bacteria treated with erythromycin or bLF exhibited reduced levels of green florescence compared to untreated bacteria, whereas bacteria treated with LFchimera exhibited a drastic bactericidal effect, as demonstrated by the red fluorescence of the PI channel. Together, these experiments showed that bLF and LFchimera have bactericidal activity, with LFchimera having the highest bactericidal activity, even more effective than erythromycin (Ery). Bovine LF and LFchimera cause ultrastructural damage to Streptococcus pneumoniae cells

Fig. 2 Determination of bacterial viability and membrane permeabilization in planktonic cultures of S. pneumoniae treated with bLF and LF peptides. S. pneumoniae plus 40 lM LF, 20 lM erythromycin, or 5 lM LF peptides were incubated at 37 °C with constant agitation for 2 h and then samples were processed and stained with the live/dead baclight kit, and the viability was determined by measuring the green fluorescence in a Victor 3 fluorometer (A). Experiments were performed in triplicate, and the mean and standard deviation are indicated. Samples were processed and observed also by confocal microscopy (B)

stronger than that of bLF and the constitutive peptides LFcin17–30 and LFampin265–284. The viability of cultures treated with LF and LFderivative peptides was also assessed by using a live/ dead baclight kit (green fluorescence for viable bacteria and red fluorescence for dead bacteria). Cultures treated with LFchimera, bLF or erythromycin showed a statistically significant reduction in the fluorescence

123

To begin investigating the mechanism of bactericidal activity, S. pneumoniae cells were treated with bLF or the LF peptides, LFcin17–30, LFampin265-284 or LFchimera and changes at the ultraestructural level were visualized by electron microscopy. Bacteria treated with Triton X-100, LFcin17–30, LFampin265284 or LFchimera exhibited profound changes in cell morphology and the ultrastructure in comparison to untreated cells (Fig. 3). All treatments induced cell deformation of the wall, a thickened cell wall, and thickened septa with irregular features (arrows). Furthermore, bacteria treated with LFchimera showed atypical bubbles (arrows) and an increase in the fixation of the colorant suggesting a drastic membrane permeabilization. Lactoferrin and lactoferrin-derived peptides interact with Streptococcus pneumoniae Streptococcus pneumoniae cells were incubated with LF and the FITC-labeled LF peptides. All LF-peptides showed a clear shift in fluorescence intensity by flow cytometry, indicating that peptides were associated with the bacteria (Fig. 4A). The bacteria incubated with LFchimera showed the largest shift in fluorescence intensity. Moreover, the LFchimera-associated bacteria seem to contain two populations of different fluorescence intensities. Similar membrane association of FITC-labeled peptides with pneumococci was found by confocal microscopy either in unfixed, or fixed bacteria (Fig. 4B).

Biometals (2014) 27:969–980

975

Fig. 3 LF and LFchimera cause ultrastructural damage to planktonic S. pneumoniae. S. pneumoniae were grown on Columbia blood agar with 5 % sheep blood and BHI broth with 0.5 % yeast extract. Briefly, bacteria were incubated for 3 h to obtain 108 CFU/ml. Subsequently, cells were incubated for 2 h with 40 lM LFcin17-30, LFampin285-284 and LFchimera for

2 h at 37 °C in constant agitation. After, cells were harvested and washed four times in PBS buffer (pH 7.4). Next, bacterial samples were placed on 200-mesh Formvar-coated copper grids (3 %), post stained with phosphotungstic acid (0.5 % pH 7.2) 1 min and examined with a JEOL electron microscope JEM1400 at 40 kV

Lactoferrin up-regulates the expression of pspA transcripts but down-regulates the expression of luxS mRNA

demonstrates that treatment of planktonic pneumococci with LF decreased biofilms. In conclusion data here presented showed that LF and LFchimera have a bactericidal effect, and that LF down-regulates genes involved in the pathogenicity of pneumococcus, thus demonstrating potential as new agents for the treatment of pneumococcal infections.

We next investigated the expression of genes encoding a LF-binding protein PspA, which has been associated to virulence, and LuxS, a quorum sensing (QS) molecule required for the formation of biofilms by pneumococcal planktonic cells. Planktonic pneumococcal cells were treated with 40 lM LF or 10 lM of LFchimera and transcript levels were analyzed. In Fig. 5A, the pspA gene expression in bacteria treated with LF increased twofold, whereas that in bacteria treated with LFchimera was slightly decreased. In Fig. 5B, expression of the luxS gene decreased in pneumococci treated with LF, whereas pneumococci treated with LFchimera, luxS expression was unaffected. Since the LuxS/AI-2 QS system regulates in the pneumococcus the transition from planktonic cultures to biofilm cells, we would expect, if LF down-regulate the luxS transcript, the presence of pneumococcal biofilms would decrease. In agree with this theory, experiments shown in Fig. 5C, D

Discussion The increasing incidence of multidrug-resistant infections throughout the world and the alarmingly low rate of discovery of new antibiotics create an urgent need for alternative therapeutic strategies to treat bacterial infections due to S. pneumoniae and other human pathogens. In this work, we demonstrate that the protein LF and the synthetic LFchimera have bactericidal activity against S. pneumoniae. Furthermore, bLF down regulates the luxS gene that encodes a protein crucial for biofilm formation of S. pneumoniae. The antibacterial activity of human apo-LF on S. pneumoniae was demonstrated by Arnold and

123

976

Biometals (2014) 27:969–980

Fig. 4 Interaction of LF and LF peptides with planktonic Streptococcus pneumoniae cultures. The S. pneumoniae D39 strain (107 CFU/ml), either unfixed (A) or fixed (B), was incubated for 30 min in BHI plus 0.5 % yeast extract broth

containing 2 mM FITC-labeled peptide or 2 mM FITC-LF. Samples were processed to be analyzed by flow cytometry (A) or confocal microscopy (B)

colleagues (Arnold et al. 1980). According to their results, the susceptibility of S. pneumoniae to LF was different because when a LF-sensitive, avirulent strain of this bacterium was passed through mice, the resultant virulent isolate became resistant to LF. In our work, the LF used was partially iron-saturated (30 %), and all strains tested were susceptible to LF within the first hour of interaction. S. pneumoniae strains were also susceptible to the LFcin17–30 and LFampin265–284 peptides; however, this activity was remarkably lower, when it is compared to the effect of the antibiotic erythromycin (which was used as a negative control for growth) or to that of LF and LFchimera (Figs. 1, 2, respectively). Nevertheless, the LFcin17–30 and LFampin265-284 peptides may be bactericidal or bacteriostatic, due to their interactions with bacteria, damage and interactions with the membranes of S. pneumoniae at higher concentrations or longer incubations. The higher killing activity of LFchimera compared to that found after treatments with the native bLF and the LFcin17–30 and LFampin265–284 peptides was reported previously for other bacteria, as well as fungi

or parasites (Flores-Villasenor et al. 2010; LeonSicairos et al. 2009; Lopez-Soto et al. 2010; Silva et al. 2012; Bolscher et al. 2009, 2012). These differences could be due to the structure of LFchimera. Linking LFcin17–30 and LFampin265–284 peptides to LFchimera results in an artificial conformation that mimics their spatial arrangement in native LF; moreover, its calculated net charge is 12? at neutral pH, compared to 6? and 4? for LFcin17–30 and LFampin265–84, respectively (Bolscher et al. 2009). Because the main target of cationic antimicrobial peptides is the negatively charged plasma membrane, we postulate that LFchimera interacts with the negatively charged microbial membranes and permeabilizes it leading to microbial death. Indeed uptake of fluoroprobes and FITC-labeling peptides as analyzed by flow cytometry and microscopy indicate that permeabilization of the S. pneumoniae membrane and changes in morphology occur (Figs. 2, 3). Regarding the mechanism of action of native bLF and natural peptide LFcin, it has been reported that LF can directly interact with microbiological membranes; alter the membrane permeability through dispersion of

123

Biometals (2014) 27:969–980

977

Fig. 5 Gene expression of pspA and luxS genes in planktonic Streptococcus pneumoniae cultures treated with LF and LFchimera. Strain D39-GFP (approx. 7 9 105 CFU/ml) was inoculated into 24-well plates and treated with LF or LFchimera and then were incubated for 6 h at 37 °C with 5 % CO2. The supernatant was then removed, centrifuged for 10 min at 12,0009g in a refrigerated centrifuge (Eppendorf) and filter sterilized using a 0.2 lM syringe filter. This supernatant was

mixed, and total RNA was extracted with an RNeasy Mini Kit and treated with 2 U of DNaseI. Then, the RNA was mixed for qRT-PCR using SYBR Green to determine the expression of pspA (A) or luxS (B) genes in treated bacteria. C–E Once Planktonic cells were removed, biofilms were processed, analyzed and photographed using and inverted Evos fl microscope (Advanced Microscopy Group) (C–E)

membrane components, such as lipopolysaccharides (LPS) in Gram-negative bacteria or the negatively charged lipid matrix of the bacterial membrane in Gram-positive bacteria; and lead to the death of the organisms (Orsi 2004). Specifically for S. pneumoniae, Mirza et al. (2011) reported that killing by human apo-Lf is due to release of cationic antimicrobial peptides through the action of the neumococcal surface-associated serine protease (PrtA) (Mirza et al. 2011). Similar to other bactericidal cationic peptides, LLP are thought to exert antimicrobial activities through the disruption of bacterial membranes. This action of LLP can be explained by the amphipathic structure of these cationic peptides, which allows them to bind and disrupt the integrity of negatively charged bacterial membranes (Orsi 2004; Vogel 2012).

Silva et al. (2013) studied the structural diversity and modes of action on lipid membranes of LFcin17–30, LFampin265–284 and LFchimera. Apparently, LFcin17–30 only induces membrane segregation (two lamellar phases are apparent upon cooling from the fluid phase), whereas LFampin265–284 induces micellization of the membrane, and LFchimera leads to membrane destruction through the formation of two cubic phases in Candida (Silva et al. 2013). On the other hand, LFchimera strongly interacted with negatively charged model membranes, in comparison with its constituent peptides (Bolscher et al. 2009). This could explain in part some of the differences found in our work. The altered ultrastructure of pneumococci caused by LF and peptides could affect the adherence and virulence of pneumococci in vivo, but this effect has yet to be determined.

123

978

The confocal microscopy results demonstrate that LF (not shown) and the LFcin17–30, LFampin 265–284 and LFchimera peptides can either interact with bacterial membranes or be internalized inside the bacterial cell (Fig. 4A, B, respectively). Some studies have indicated that LFcin B leads to the depolarization of the cell membrane and does not lyse the cell. Moreover, it has been shown that LFcin B inhibits the macromolecular synthesis of cells, which suggests that intracellular targets of Lfcin B may exist (Ulvatne et al. 2004; Ho et al. 2011; Haukland et al. 2001). Our results from confocal microscopy of unfixed bacteria apparently show that peptides are able to penetrate or to translocate over the membrane. Certain proteins or enzymes displayed on the surface of Gram-positive organisms significantly contribute to pathogenesis and might be involved in the disease process caused by S. pneumoniae and other pathogens. Often, these proteins are involved in direct interactions with host tissues or in concealing the bacterial surface from the host defense mechanisms. S. pneumoniae is not an exception in this regard (Abraham 2006). The major autolysin (LytA) and the pneumococcal surface protein A (PspA) are important virulence factors of S. pneumoniae, both proteins have already shown significant promise for their use as vaccine candidates. The role of PspA, a protective antigen of pneumococci, appears to be protective against the host complement system (Domenech et al. 2013). In this work, we found that in S. pneumoniae treated with LF, pspA gene expression increased twofold, whereas that in bacteria treated with LFchimera was slightly diminished (Fig. 5A, B, respectively). This result is in agreement with the results reported by Shaper et al. (2004), whom found that PspA most likely blocks the active site(s) of apoLF, which is responsible for killing S. pneumoniae (Shaper et al. 2004). Since PspA has been shown as a LF binding protein, our data showing upregated expression of pspA post exposure to LF are in agreement to its role. Although regulation of pspA expression has not been clarified, perhaps some QSmediated downstream events lead to the increase in pspA gene expression observed in our study. On the other hand, PspA was unable to prevent the killing of S. pneumoniae by LF derived peptides (Shaper et al. 2004), thus corroborating our results in the slightly down-regulation of the pspA gene in S. pneumoniae treated with LFchimera (Fig. 5A).

123

Biometals (2014) 27:969–980

We also evaluated expression of luxS because the encoded product is crucial for formation of S. pneumoniae biofilms (Vidal et al. 2011, 2013). Biofilm formation has been linked to nasopharyngeal colonization and important pneumococcal diseases such as pneumonia and otitis media (Shak et al. 2013; Talekar et al. 2014). Moreover, *60 % of bacterial infections (and up to 80 % of chronic infections) are currently considered to involve microbial growth in biofilms (Moscoso et al. 2009). To form biofilms, bacteria must start a complex genetic program to switch from a planktonic phase to a sessile lifestyle. This switch starts with determination of their cell density, a process called QS, which is triggered by small, water soluble molecules, so called autoinducers (Abraham 2006). In this regards, biofilms in S. pneumoniae conduct QS, a cell-to-cell communication mechanism that uses molecules called autoinducers to regulate gene expression in response to environmental and cell density changes. In S. pneumoniae, LuxS is an enzyme that synthesizes autoinducer 2 (AI-2), which is required for such an event; thus, LuxS/AI-2 plays a major role in controlling early biofilm formation by the S. pneumoniae strain D39 (Vidal et al. 2011). Mutation of luxS in S. mutans caused a defect in biofilm formation, while disruption of this gene in S. pneumoniae resulted in reduced virulence in mouse infections (Cvitkovitch et al. 2003). In our results, we found that LF diminished luxS gene expression, whereas LFchimera slightly diminished pspA gene expression (Fig. 5B). The S. pneumoniae biofilms inhibition by LF and LFchimera were confirmed in the present work (Fig. 5D, E). Pneumococcal biofilms treated with LF and LFchimera showed a disruption in and a low amount of bacteria forming biofilms, compared to those pneumococcal biofilms untreated (Fig. 5C). These data confirm that LF and LFchimera either inhibit biofilm formation or disrupt the biofilms of S. pneumoniae. It has previously been reported that LF induces modifications in the motility and aggregation of bacteria, limits biofilm formation and inhibits bacterial adhesion to abiotic surfaces (Ammons and Copie 2013). Due to the role of luxS in S. pneumoniae biofilm formation, we now are investigating the ability of bLF and LF-peptides to disrupt or inhibit pneumococcal biofilm formation; moreover, we are investigating the expression of other genes involved in the QS of S. pneumoniae and other genes that participate in the virulence of S. pneumoniae.

Biometals (2014) 27:969–980

Taken together, our data show that LF and LFchimera kill S. pneumoniae whereas LF decreases levels of the luxS transcript leading to a decrease of the biofilm phenotype. We speculate that the mechanism of killing starts with membrane permeabilization, most likely through an intracellular mechanism in which the binding of the peptide to DNA could trigger events that allow for the disruption of gene expression. A recent study has suggested that LF and LF derived peptides could act via an intracellular mechanism that involves their binding to the DNA of the Streptococcus mutans bacterium (Huo et al. 2011). Thus, binding of LF and LFchimera to bacterial DNA could indirectly affect the expression of genes related to S. pneumoniae virulence factors, such as the luxS gene and others. In conclusion, these properties determined in the present work for LF and LFchimera are potentially very important for clinical applications because LF and LFchimera can be used to design possible points of intervention in S. pneumoniae treatments. Acknowledgments We thank to BS Lourdes Rojas-Morales and BS Sirenia Gonza´lez-Pozos for their technical assistance in the Microscopy Unit of CINVESTAV-IPN, Me´xico. Authors also thank Gideon Matzkin, Emory University, for his valuable support in some laboratory procedures. This work was supported by grants from CONACYT (CB-2009-133677) and PROFAPI-UAS (2012/087; 2013/093).

References Abraham WR (2006) Controlling biofilms of Gram-positive pathogenic bacteria. Curr Med Chem 13(13):1509–1524 Ammons MC, Copie V (2013) Mini-review: lactoferrin: a bioinspired, anti-biofilm therapeutic. Biofouling 29(4):443– 455. doi:10.1080/08927014.2013.773317 Arnold RR, Brewer M, Gauthier JJ (1980) Bactericidal activity of human lactoferrin: sensitivity of a variety of microorganisms. Infect Immun 28(3):893–898 Avery OT, Macleod CM, McCarty M (1944) Studies on the chemical nature of the substance inducing transformation of pneumococcal types: induction of transformation by a desoxyribonucleic acid fraction isolated from pneumococcus type III. J Exp Med 79(2):137–158 Bolscher JG, Adao R, Nazmi K, van den Keybus PA, van’t Hof W, Amerongen AVN, Bastos M, Veerman EC (2009) Bactericidal activity of LFchimera is stronger and less sensitive to ionic strength than its constituent lactoferricin and lactoferrampin peptides. Biochimie 91(1):123–132. doi:10.1016/j.biochi.2008.05.019 Bolscher J, Nazmi K, van Marle J, van’t Hof W, Veerman E (2012) Chimerization of lactoferricin and lactoferrampin peptides strongly potentiates the killing activity against Candida albicans. Biochem Cell Biol 90(3):378–388. doi:10.1139/o11-085

979 Cavestro GM, Ingegnoli AV, Aragona G, Iori V, Mantovani N, Altavilla N, Dal Bo N, Pilotto A, Bertele A, Franze A, Di Mario F, Borghi L (2002) Lactoferrin: mechanism of action, clinical significance and therapeutic relevance. Acta Biomed 73(5–6):71–73 Cvitkovitch DG, Li YH, Ellen RP (2003) Quorum sensing and biofilm formation in streptococcal infections. J Clin Invest 112(11):1626–1632. doi:10.1172/JCI20430 Domenech M, Ramos-Sevillano E, Garcia E, Moscoso M, Yuste J (2013) Biofilm formation avoids complement immunity and phagocytosis of Streptococcus pneumoniae. Infect Immun 81(7):2606–2615. doi:10.1128/IAI.00491-13 Flores-Villasenor H, Canizalez-Roman A, Reyes-Lopez M, Nazmi K, de la Garza M, Zazueta-Beltran J, Leon-Sicairos N, Bolscher JG (2010) Bactericidal effect of bovine lactoferrin, LFcin, LFampin and LFchimera on antibiotic-resistant Staphylococcus aureus and Escherichia coli. Biometals 23(3):569–578. doi:10.1007/ s10534-010-9306-4 Flores-Villasenor H, Canizalez-Roman A, de la Garza M, Nazmi K, Bolscher JG, Leon-Sicairos N (2012a) Lactoferrin and lactoferrin chimera inhibit damage caused by enteropathogenic Escherichia coli in HEp-2 cells. Biochimie 94(9):1935–1942. doi:10.1016/j.biochi.2012. 05.011 Flores-Villasenor H, Canizalez-Roman A, Velazquez-Roman J, Nazmi K, Bolscher JG, Leon-Sicairos N (2012b) Protective effects of lactoferrin chimera and bovine lactoferrin in a mouse model of enterohaemorrhagic Escherichia coli O157:H7 infection. Biochem Cell Biol 90(3):405–411. doi:10.1139/o11-089 Haukland HH, Ulvatne H, Sandvik K, Vorland LH (2001) The antimicrobial peptides lactoferricin B and magainin 2 cross over the bacterial cytoplasmic membrane and reside in the cytoplasm. FEBS Lett 508(3):389–393 Ho YH, Sung TC, Chen CS (2011) Lactoferricin B inhibits the phosphorylation of the two-component system response regulators BasR and CreB. Mol Cell Proteomics 11(4):M111-014720. doi:10.1074/mcp.M111.014720 Huo L, Zhang K, Ling J, Peng Z, Huang X, Liu H, Gu L (2011) Antimicrobial and DNA-binding activities of the peptide fragments of human lactoferrin and histatin 5 against Streptococcus mutans. Arch Oral Biol 56(9):869–876. doi:10.1016/j.archoralbio.2011.02.004 Lanie JA, Ng WL, Kazmierczak KM, Andrzejewski TM, Davidsen TM, Wayne KJ, Tettelin H, Glass JI, Winkler ME (2007) Genome sequence of Avery’s virulent serotype 2 strain D39 of Streptococcus pneumoniae and comparison with that of unencapsulated laboratory strain R6. J Bacteriol 189(1):38–51 Leon-Sicairos N, Canizalez-Roman A, de la Garza M, ReyesLopez M, Zazueta-Beltran J, Nazmi K, Gomez-Gil B, Bolscher JG (2009) Bactericidal effect of lactoferrin and lactoferrin chimera against halophilic Vibrio parahaemolyticus. Biochimie 91(1):133–140. doi:10.1016/j.biochi. 2008.06.009 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25(4):402–408 Lopez-Soto F, Leon-Sicairos N, Nazmi K, Bolscher JG, de la Garza M (2010) Microbicidal effect of the lactoferrin

123

980 peptides lactoferricin17–30, lactoferrampin265–284, and lactoferrin chimera on the parasite Entamoeba histolytica. Biometals 23(3):563–568. doi:10.1007/s10534-0109295-3 Lynch JP 3rd, Zhanel GG (2010) Streptococcus pneumoniae: epidemiology and risk factors, evolution of antimicrobial resistance, and impact of vaccines. Curr Opin Pulm Med 16(3):217–225. doi:10.1097/MCP.0b013e3283385653 Mirza S, Wilson L, Benjamin WH Jr, Novak J, Barnes S, Hollingshead SK, Briles DE (2011) Serine protease PrtA from Streptococcus pneumoniae plays a role in the killing of S. pneumoniae by apolactoferrin. Infect Immun 79(6):2440– 2450. doi:10.1128/IAI.00489-10 Mookherjee N, Hancock RE (2007) Cationic host defence peptides: innate immune regulatory peptides as a novel approach for treating infections. Cell Mol Life Sci 64(7–8):922–933. doi:10.1007/s00018-007-6475-6 Moscoso M, Garcia E, Lopez R (2009) Pneumococcal biofilms. Int Microbiol 12(2):77–85 Nijnik A, Hancock R (2009) Host defence peptides: antimicrobial and immunomodulatory activity and potential applications for tackling antibiotic-resistant infections. Emerg Health Threats J 2:e1. doi:10.3134/ehtj.09.001 Nunes MC, Shiri T, van Niekerk N, Cutland CL, Groome MJ, Koen A, von Gottberg A, de Gouveia L, Klugman KP, Adrian PV, Madhi SA (2013) Acquisition of Streptococcus pneumoniae in pneumococcal conjugate vaccine-naive South African children and their mothers. Pediatr Infect Dis J. doi:10.1097/INF.0b013e31828683a3 Orsi N (2004) The antimicrobial activity of lactoferrin: current status and perspectives. Biometals 17(3):189–196 Shak JR, Ludewick HP, Howery KE, Sakai F, Yi H, Harvey RM, Paton JC, Klugman KP, Vidal JE (2013) Novel role for the Streptococcus pneumoniae toxin pneumolysin in the assembly of biofilms. MBio 4(5):e00655-13. doi:10.1128/ mBio.00655-13 Shaper M, Hollingshead SK, Benjamin WH Jr, Briles DE (2004) PspA protects Streptococcus pneumoniae from killing by apolactoferrin, and antibody to PspA enhances killing of pneumococci by apolactoferrin [corrected]. Infect Immun 72(9):5031–5040. doi:10.1128/IAI.72.9.5031-5040.2004 Silva T, Abengozar MA, Fernandez-Reyes M, Andreu D, Nazmi K, Bolscher JG, Bastos M, Rivas L (2012) Enhanced leishmanicidal activity of cryptopeptide chimeras from the active N1 domain of bovine lactoferrin. Amino Acids 43(6):2265–2277. doi:10.1007/s00726-012-1304-0 Silva T, Adao R, Nazmi K, Bolscher JG, Funari SS, Uhrikova D, Bastos M (2013) Structural diversity and mode of action on

123

Biometals (2014) 27:969–980 lipid membranes of three lactoferrin candidacidal peptides. Biochim Biophys Acta 1828(5):1329–1339. doi:10.1016/j. bbamem.2013.01.022 Talekar SJ, Chochua S, Nelson K, Klugman KP, Quave CL, Vidal JE (2014) 220D-F2 from Rubus ulmifolius kills Streptococcus pneumoniae planktonic cells and pneumococcal biofilms. PLoS One 9(5):e97314. doi:10.1371/ journal.pone.0097314 Tomita M, Bellamy W, Takase M, Yamauchi K, Wakabayashi H, Kawase K (1991) Potent antibacterial peptides generated by pepsin digestion of bovine lactoferrin. J Dairy Sci 74(12):4137–4142. doi:10.3168/jds.S0022-0302(91) 78608-6 Tomita M, Takase M, Wakabayashi H, Bellamy W (1994) Antimicrobial peptides of lactoferrin. Adv Exp Med Biol 357:209–218 Ulvatne H, Samuelsen O, Haukland HH, Kramer M, Vorland LH (2004) Lactoferricin B inhibits bacterial macromolecular synthesis in Escherichia coli and Bacillus subtilis. FEMS Microbiol Lett 237(2):377–384. doi:10.1016/j. femsle.2004.07.001 Valenti P, Berlutti F, Conte MP, Longhi C, Seganti L (2004) Lactoferrin functions: current status and perspectives. J Clin Gastroenterol 38(6 Suppl):S127–S129 van der Kraan MI, Groenink J, Nazmi K, Veerman EC, Bolscher JG, Nieuw Amerongen AV (2004) Lactoferrampin: a novel antimicrobial peptide in the N1-domain of bovine lactoferrin. Peptides 25(2):177–183. doi:10.1016/j.peptides. 2003.12.006 Vidal JE, Ohtani K, Shimizu T, McClane BA (2009) Contact with enterocyte-like Caco-2 cells induces rapid upregulation of toxin production by Clostridium perfringens type C isolates. Cell Microbiol 11(9):1306–1328. doi:10.1111/j. 1462-5822.2009.01332.x Vidal JE, Ludewick HP, Kunkel RM, Zahner D, Klugman KP (2011) The LuxS-dependent quorum-sensing system regulates early biofilm formation by Streptococcus pneumoniae strain D39. Infect Immun 79(10):4050–4060. doi:10. 1128/IAI.05186-11 Vidal JE, Howery KE, Ludewick HP, Nava P, Klugman KP (2013) Quorum-sensing systems LuxS/autoinducer 2 and Com regulate Streptococcus pneumoniae biofilms in a bioreactor with living cultures of human respiratory cells. Infect Immun 81(4):1341–1353. doi:10.1128/IAI. 01096-12 Vogel HJ (2012) Lactoferrin, a bird’s eye view. Biochem Cell Biol 90(3):233–244. doi:10.1139/o2012-016