Author’s copy
provided for non-commercial and educational use only
I SS N $ 1 8 7 6 )2 8 8 3
No material published in Beneficial Microbes may be reproduced without first obtaining written permission from the publisher. The author may send or transmit individual copies of this PDF of the article, to colleagues upon their specific request provided no fee is charged, and furtherprovided that there is no systematic distribution of the manuscript, e.g. posting on a listserve, website or automated delivery. However posting the article on a secure network, not accessible to the public, is permitted. For other purposes, e.g. publication on his/her own website, the author must use an author-created version of his/her article, provided acknowledgement is given to the original source of publication and a link is inserted to the published article on the Beneficial Microbes website (DOI at the Metapress website).
For additional information please visit
www.BeneficialMicrobes.org.
Koen Venema, TNO Quality of Life, Department of Biosciences, the Netherlands
r animal nutrition r processing and application r medical and health applications r regulatory and safety aspects r food, nutrition and health
Isaac Cann, University of Illinois at Urbana-Champaign, USA Knut Heller, Max-Rubner-Institute, Germany Ger Rijkers, Utrecht University, the Netherlands Mary Ellen Sanders, Dairy and Food Culture Technologies, USA Koen Venema, TNO Quality of Life, the Netherlands
Alojz Bomba, Pavol Jozef Šafárik University, Slovakia; Robert-Jan Brummer, Örebro University, Sweden; Michael Chikindas, Rutgers University, USA; James Dekker, Fonterra Co-operative Group, New Zealand; Leon Dicks, University of Stellenbosch, South Africa; Margareth Dohnalek, PepsiCo, USA; George C. Fahey, Jr., University of Illinois, USA; Benedicte Flambard, Chr. Hansen, Denmark; Melanie Gareau, University of Toronto, Canada; H. Rex Gaskins, University of Illinois at Urbana-Champaign, USA; Audrey Gueniche, L’Oreal, France; Dirk Haller, Technical University München, Germany; Arland Hotchkiss, USDA-ARS, ERRC, USA; Kikuji Itoh, The University of Tokyo, Japan; David Keller, Ganeden Biotech, USA; Dietrich Knorr, Technical University Berlin, Germany; Lee Yuan Kun, National University of Singapore, Singapore; Irene Lenoir-Wijnkoop, Danone research, France; Baltasar Mayo, CSIC, Spain; Eveliina Myllyluoma, Valio Ltd., Finland; Peter Olesen, ActiFoods ApS, Denmark; Maria Rescigno, European Institute of Oncology, Italy; Ryuichiro Tanaka, Yakult Central Institute, Japan; David Topping, CSIRO Human Nutrition, Australia; Roel Vonk, University of Groningen, the Netherlands; Barbara Williams, University of Queensland, Australia Daniel Barug, Ranks Meel, the Netherlands; Helena Bastiaanse, Bastiaanse Communication, the Netherlands Beneficial Microbes: ISSN 1876-2883 (paper edition); ISSN 1876-2891 (online edition) Subscription to ‘Beneficial Microbes’ (4 issues, calendar year) is either on an institutional (campus) basis or a personal basis. Institutions receive online access to the journal as well as a printed copy. Personal subscribers only receive the printed copy. Prices are available upon request from the Publisher or from the journal’s website (www.BeneficialMicrobes.org). Subscriptions are accepted on a prepaid basis only and are entered on a calendar year basis. Subscriptions will be renewed automatically unless a notification of cancelation has been received before the 1st of December. Issues are send by standard mail. Claims for missing issues should be made within six months of the date of dispatch. Further information about the journal is available through the website www.BeneficialMicrobes.org. http://mc.manuscriptcentral.com/bm
P.O. Box 179 3720 AD Bilthoven The Netherlands
[email protected] Tel: +31 30 2294247 Fax: +31 30 2252910
P.O. Box 220 6700 AE Wageningen The Netherlands
[email protected] Tel: +31 317 476516 Fax: +31 317 453417
L.M.M. Dalmacio1, A.K.J. Angeles2, L.L.H. Larcia3, M.P. Balolong2 and R.C. Estacio1 1University
y p
of the Philippines Manila, College of Medicine; 547 Pedro Gil St. Ermita, 1000 Manila, Philippines; of the Philippines Manila, College of Arts and Sciences, Padre Faura St. Ermita, 1000 Manila, Philippines; 3University of the Philippines Manila, College of Pharmacy, Taft Av., cor. Pedro Gil St. Ermita, 1004 Manila, Philippines;
[email protected] 2University
o c
Received: 23 July 2011 / Accepted: 8 November 2011 © 2011 Wageningen Academic Publishers
s 'r
The bacterial population in several Philippine fermented food preparations was assessed by PCR-denaturing gradient gel electrophoresis (PCR-DGGE) of the 16S rRNA gene (16S rDNA). Genomic DNA was isolated directly from alamang (fermented shrimp paste), burong isda (fermented fish and rice), burong hipon (fermented shrimp and rice), burong mustasa (fermented mustard leaves), tuba (sugar cane wine), suka (vinegar) and sinamak (spiced vinegar) using one of two protocols, namely – MoBio DNA Extraction Kit procedure and a cetyltrimethylammonium bromide-based method. Samples recalcitrant to both methods underwent enrichment in three culture broths prior to DNA isolation. Isolated DNA was amplified using nested primer pairs targeting the bacterial 16S rDNA. PCR products were subjected to DGGE to elucidate the bacterial diversity in each fermented food. 16S rDNA sequence analyses revealed that lactic acid bacteria (LAB) and acetic acid bacteria (AAB) were dominant in the food samples. The LAB identified were Lactobacillus fermentum, Lactobacillus plantarum, Lactobacillus panis, Lactobacillus pontis and Weissella cibaria. Identified AAB were Acetobacter pomorum, Acetobacter ghanensis, Acetobacter orientalis, and Acetobacter pasteurianus. Among these, L. fermentum, L. plantarum and W. cibaria are established probiotic bacteria, while L. panis and L. pontis are potential probiotic bacteria. This finding would increase the appeal and significance of local fermented foods to consumers. Furthermore, the majority of the identified bacteria in the study have not been reported before in culture-dependent studies of similar food preparations. As such, some of the bacterial 16S rDNA obtained were cloned to have an initial partial bacterial 16S rDNA library for Philippine fermented foods.
t u
o h
Keywords: 16S rDNA, lactic acid bacteria, acetic acid bacteria, DNA sequencing, probiotics
A
Each region in the Philippines has its own unique food preparation technique that gives rise to distinct flavours (Sanchez, 2008). One technique used to enhance and lengthen the shelf life of food is fermentation (Steinkraus, 1996). Traditional fermented foods are common in Philippine culinary arts. Some of these traditional fermented food products are fermented fish paste and sauces (bagoong and patis), rice wine (tapuy), coconut gel (nata), fermented shrimp (alamang), fermented shrimp and rice (balao-balao
or burong hipon), vinegar (suka), palm wine (tuba), distilled coconut wine (lambanog), fermented rice cake (puto), fermented mustard leaves (burong mustasa), fermented fish and rice (burong isda), and surgarcane wine (basi). Fermented green mango (burong mangga), fermented crab (burong talangka), and fermented native sausage (longganisa) are included as well (Sanchez, 1981). Despite the popularity of fermented foods, research and development in this area is thin on the ground. Most of the traditional food fermentation industries are rural, seasonal,
labour intensive, informal, and capital deficient. Fermented foods are commonly sold and consumed in the areas where they are produced. Processing methods were developed in homes and improvements were based on the observations of the practitioners. Fermentation processes are normally handed down from generation to generation and most of these processes are conducted on a trial-and-error basis. It has been documented that consumption of fermented foods has greatly increased since 1970 (Sanchez, 2008). One of the reasons for the increase in consumption is the positive perception of consumers – they consider these foods to be healthy and natural, which may be attributed to the probiotics present in fermented foods (Matijasic and Rogelj, 2006). Probiotics are good bacteria normally found in the human intestine. They are essential in aiding normal digestion and as a first line of defence against invading viruses, yeasts, parasites and pathogenic bacteria. Moreover, scientific investigations have proved that probiotic organisms protect the gut and colon against certain cancers (Moreira et al., 2005). Due to these health-promoting properties of probiotics, there has been a proportional expansion of the probiotic product market (Temmerman et al., 2003). Most probiotics currently identified are lactic acidproducing bacteria (LAB) including Lactobacillus and Bifidobacterium, which have been shown to be therapeutically beneficial. Two of the most important probiotic Lactobacillus strains are L. acidophilus and L. bulgaricus, while the two major Bifidobacterium strains are B. bifidum and B. infantis. These LAB were found to be present in the fermentation of different food products (Hutkins, 2006).
t u
o h
Traditionally, bacterial species present in fermented products are identified by microbiological techniques involving species and strain characterisation by physiological and biochemical tests and phenotypic identification methods – all of which exhibit biases that result in incomplete representation of microbial diversity (Pulido et al., 2005). With the introduction of molecular techniques, the isolation and identification of potential probiotic bacteria missed by traditional culture-dependent methods have now become possible (Ercolini, 2003).
A
At present, the most commonly used gene for taxonomic studies of bacteria is the 16S rRNA gene (16S rDNA). Not only can this gene be used for comparison among bacteria, it can also be compared with the 16S rDNA of archaebacteria and the 18S rDNA of eukaryotes. The advent of 16S rDNA identification and phylogenetic placement of prokaryotes paved the way for the discovery of numerous unculturable, as well as novel microorganisms (Clarridge, 2004).
State-of-the-art application of molecular microbiology involves the development of molecular tools and techniques in monitoring and identifying microbial diversities in various environments. In particular, denaturing gradient gel electrophoresis (DGGE) of PCR-amplified 16S rDNA has been applied in these studies. This method can characterise fermentation microbiota economically and in a relatively short space of time compared with conventional physiological and biochemical methods, particularly within LAB, due to an increasing number of species that vary in only a few traits (Meroth et al., 2003). Identification of microorganisms in a system should not be confined to the dominant organisms because other microbes found in lower numbers might have an important function in the process. In addition, the technique provides a profile representing the genetic diversity of a microbial community. As such, PCR-DGGE is a most advantageous tool in microbial diversity studies. It also has the potential to detect constituents which represent 1% of the total population (Muyzer et al., 1993).
o c
y p
In the search for health-promoting probiotics, this study determined the bacterial population in several Philippine fermented foods using molecular techniques. This study does not intend to compare the bacterial diversity between different fermented food preparations.
s 'r
Fermented seafood, fermented vegetables, and wine were obtained from Manila and from the northern, central and southern regions of the Philippines. Such an approach is expected to identify not only potential probiotic bacteria but also bacterial pathogens that might have been missed by previous documentations using traditional microbiological culture methods. Additionally, a partial database of 16S rDNA from dominant bacteria found in some Philippine fermented foods was also established.
Traditionally prepared fermented foods ready for consumption (i.e. at the end-state of the fermentation process) were purchased from wet markets in Manila, provinces in Central Luzon (Bataan, Zambales and Tarlac), Southern Luzon, Visayas (Iloilo, Negros Occidental), and Mindanao (Bukidnon). The samples included burong mustasa, alamang, burong isda, burong hipon, sinamak, suka, and tuba wine. The food products were naturally fermented without the addition of mother cultures. The samples were kept in their original containers at 4 °C until use. Table 1 lists the origin of each fermented food preparation.
contained 1× PCR buffer (Vivantis Technologies, Sha, Malaysia), Buffer S: 160 mM (NH4)2SO4, 500 mM TrisHCl, 17.5 mM MgCl 2 and 0.1% Triton™X-100), each primer at a final concentration of 0.5 μM, 800 μM each deoxynucleoside triphosphate (Vivantis Technologies), 1.25 U Taq polymerase (Vivantis Technologies, 5 U/μl) and 1:50 dilution of DNA template (≥50 ng/μl). Template DNA was denatured at 94 °C for 5 min. Thirty-five cycles of denaturation (1 min at 94 °C), annealing (1 min at 53 °C), and extension (1 min at 72 °C) were performed. The tubes were then incubated for 30 min at 72°C (final extension). PCR products with the desired length (1.5 kb) were analysed by agarose gel electrophoresis in 0.5× Tris-acetate-EDTA (TAE) buffer.
Due to complex matrices of some of the samples that made direct DNA isolation from these foods difficult, nutrient broth (NB), lactose broth (LB) and deMan, Rogosa and Sharpe (MRS) broth were used for enrichment of the microorganisms present in alamang, burong isda, and burong hipon (Tarlac sample). NB (BD Difco, Franklin Lakes, NJ, USA), LB (0.3% beef extract, 0.5% peptone, 0.5% lactose) and MRS media (BD Difco) would cultivate non-fastidious mesophilic bacteria, lactose fermenting bacteria and lactic acid bacteria, respectively. Briefly, 25 g of fermented food sample was inoculated into 225 ml of each broth media. Prior to genomic DNA isolation, an aerobic culture condition was maintained at 37 °C for 24 h.
t u
o h
Aseptic technique was observed from the time the fermented food products were procured up to preparation of samples for DNA isolation. 5 ml of fermented food liquid or enrichment culture was centrifuged at 12,000 rpm for 1 min in a microcentrifuge. The resulting pellet was used for extraction of bacterial DNA using the MoBio DNA Extraction Kit (MoBio Laboratories Inc., Carlsbad, CA, USA) following the manufacturer’s instructions or a cetyltrimethylammonium bromide-based protocol described by Doyle and Doyle (1987).
A
Amplification of bacterial DNA from each food sample was done using an Analytikjena SpeedCycler (Analytik Jena AG, Jena, Germany). The first round of amplification, to be used as template for the second, nested PCR, employed the bacterial 16S rDNA primer pair 8f (5’ AGAGTTTGATCCTGGCTCAG 3’) and 1492r (5’ GGTTACCTTGTTACGACTT 3’). This would amplify the entirety of the 1.5 kb 16S rDNA. Each PCR mixture
o c
y p
An additional round of amplification was required to truncate the 16S rDNA amplicons for successful resolution in DGGE (Nakatsu, 2000). This second amplification was also a means of attaching a GC clamp to the PCR product. The clamp would prevent complete melting of the double-stranded DNA in the highly denaturing condition of the subsequent electrophoresis. The same temperature profile and reagent concentrations were used as described. Only the primer pair was replaced with gc341f (5’ CGCCCGCCGCGCCCCGCGCCCGTCCCG CCGCCCCCGCCCGCCTACGGGAGGCAGCAG 3’) and 926r (5’ CCGTCAATTCCTTTGAGTTT 3’) which amplifies the internal V3 region of the bacterial 16S rDNA.
s 'r
DGGE was facilitated using a Bio-Rad DCode Universal Mutation Detection System (Bio-Rad, Hercules, CA, USA). At least 20 μl of PCR product from the V3 region amplification was loaded in 8% (w/v) polyacrylamide discontinuous gel in 0.5× TAE buffer using a denaturing gradient of 30-70% (where 100% denaturant consists of 7 M urea and 40% formamide). The electrophoresis was carried out at 100 V for 10 min to initiate the migration of DNA into the stacking gel. The voltage was decreased to 60 V for 15 h, maintaining the buffer temperature at 60 °C. After the run, the gel was stained with ethidium bromide and viewed under UV light (Gel Doc XR; Bio-Rad).
Intense and distinct bands were excised from the DGGE gel using a sterile scalpel. Excised bands were placed in microfuge tubes containing 50 μl HPLC grade water. Amplicons were eluted by macerating the gel with a sterile pipette tip. The gel-water mixture was incubated at 37 °C for 30 min and centrifuged at 10,000 rpm for 1 min. The supernatant was used as a template for re-amplification using the gc341f-926r primer pair and parameters previously described with the annealing temperature changing from
53 °C to 55 °C. The success of re-amplification was verified by agarose gel electrophoresis in 0.5× TAE buffer. The reamplified products were purified using UltraClean® PCR Clean-up Kit (MoBio Laboratories, Inc.) following the manufacturer’s protocol. Purified re-amplification products were quantified by spectrophotometry at 260 nm (Jenway; Bibby Scientific Limited, Stone, UK). At least 750 ng of DNA were shipped for sequencing to Macrogen, Inc. in South Korea. Bacterial species that had the highest homology with the partial 16S rDNA sequences obtained were determined by performing sequence alignments in public data libraries using the BLAST algorithm. Band similarities between lanes of the same gel, indicating similar species, were analysed using QuantityOne software package (Bio-Rad).
The purified PCR products from DGGE bands were cloned using the pGEM®-T Cloning Kit (Promega, Madison, WI, USA). The kit used chemically-competent Escherichia coli cells for transformation. The transformants were analysed by blue-white screening of colonies. Ten positive transformants from each food sample were picked and transferred to fresh Luria-Bertani broth (BD Difco). Glycerol stocks were prepared from these plasmid-containing clones. Subsequently, the stocks were stored at -80 °C. The plasmids containing a segment of the V3 region of bacterial 16S rDNA were isolated and the inserts were verified through sequencing.
t u
o h
The DGGE electropherogram showed unique banding patterns of amplicons from each sample, whether bacterial DNA was isolated from enrichment cultures (Figure 1) or directly from the samples (Figure 2). In the enriched cultures, 11 bands were resolved in the alamang lanes, 13 in burong isda and 13 in burong hipon. These values were determined through assignment of unique bands by the QuantityOne software. The banding profiles represent the number of cultivable bacteria in these food samples using nutrient, lactose and MRS broths.
A
The bacteria in the food preparations were identified by sequencing distinct bands. In a common denaturing gel, bands migrating the same distance are considered to have an equivalent sequence. A summary of the microorganisms identified through 16S rDNA sequencing is presented in Table 2. Some of the matched partial 16S rDNA sequences were also cloned to obtain an initial bacterial 16S rDNA library for Philippine fermented foods (Table 2). The sequences acquired in this study will be submitted to GenBank to
s 'r
o c
y p
A
t u
o h
s 'r
o c
y p
add to the existing database and facilitate easier reference and comparison with similar investigations in the future.
PCR-DGGE is based on the separation of PCR products of the same size but with different sequences. Analysis of bacterial diversity using PCR-DGGE can be done qualitatively by comparing the fingerprint profiles to determine whether communities differ with respect to the number and identities of bacterial species found in a particular sample (Beek and Priest, 2001; Ben Omar and Ampe, 2000; Camu et al., 2007; Cleenwerck et al., 2002). Relatedness of bands can also be verified such that two bands are common if they migrated the same distance on the same gel (Nakatsu et al., 2000). Thus, it is possible to see at once the diversity of the microbiota present in the fermented food samples without undertaking tedious phenotype-based microbial identification tests. Likewise, DGGE band intensities can give a quantitative description of the relative richness of each microorganism present (Ercolini, 2003). This study, however, only focused on the qualitative aspect of the analysis, which is to identify bacterial species found in popular Philippine fermented foods. Attempts to isolate DNA directly from the food samples were done using two extraction methods as described. However, despite numerous trials that included variations in the amount of sample, the number of chloroform:isoamyl extractions and addition of a sodium acetate purification step to specifically remove polysaccharides, some food preparations (i.e. alamang, burong isda and burong hipon from Tarlac) remained recalcitrant to these techniques. This highlights the complexity of food samples as matrices in DNA isolation.
t u
o h
Instead of neglecting these samples, enrichment cultures were prepared using three media: nutrient broth, to culture non-fastidious mesophilic bacteria; lactose broth, to culture lactose fermenters; and MRS broth, to culture lactic acid bacteria (Ben Omar and Ampe, 2000). Cultivation in different media is critical; using only one would severely underestimate the diversity due to the inherent bias of a medium to certain types of microorganisms. The enriched cultures were incubated in aerobic conditions as fermentative bacteria are mostly aerotolerant (Tannock, 2004). Obligate anaerobes would understandably be outside the scope of the study for the samples that were cultured.
A
A potential probiotic (Chatterjee et al., 2010), Weisella cibaria, was detected in burong mustasa. Weisella was established in 1993 as a lactic acid-producing genus and was also found in kimchi, a Korean fermented vegetable (Choi et al., 2002). Remarkably, culture-dependent studies on
burong mustasa did not show the presence of this bacterium (Sanchez, 1989). Lactobacillus panis, found to be present in burong mustasa, alamang and burong hipon, is a heterofermentative LAB which can also be isolated from fermented sourdoughs (Jay et al., 2005; Wiese et al., 1996). Heterofermentative LAB produce ethanol and acetic acid, in addition to lactic acid. DGGE patterns showed that this microorganism is cultivable in all three media used. In addition, three distinct bands were identified as L. panis. This might be due to strain variability within the samples.
y p
Lactobacillus pontis, found to be present in burong mustasa, alamang, burong hipon and burong isda, is similarly a heterofermentative LAB (Pendersen et al., 2004) that is also commonly isolated from sourdough fermentations. Although L. panis and L. pontis are evidently culturable, it is likely that these species were underestimated in the culture-dependent study (Sanchez, 2008) due to minute variations in phenotype among the Lactobacillus genus (Ercolini, 2003).
s 'r
o c
Lactobacillus fermentum was another LAB found in burong mustasa, alamang, burong hipon and suka. Interestingly, this bacterium, found in all three cultures of burong hipon and in the nutrient broth culture of alamang, has only 90% sequence homology (e-value = e-146) with the L. fermentum 16S rDNA sequence in the database (Accession no. AF522394). Two bands in the burong isda MRS medium were most closely matched to two unique 16S rDNA sequences obtained from a study on the enhancement of bacterial diversity in porcine gut by fermented liquid feed (Tajima et al., 2010). The closest known reference sequence to both bands was Lactobacillus plantarum C21-41, a homofermentative LAB commonly found in sauerkraut (Jay et al., 2005), cheese (Martin-Platero et al., 2008), caper berries (Pulido et al., 2005), Italian sausage (Cocolin et al., 2001), Mexican pozol (Ben Omar and Ampe, 2000), and Thai tea leaves (Srikanjana et al., 2008) fermentations. These similarities strongly suggest that the two 16S rDNA partial sequences might belong to fermentative bacteria significant to food fermentation processes. Likewise, L. plantarum was also found in burong mustasa. An acetic acid bacteria (AAB) found in the fermented food samples was Acetobacter pomorum, which was identified in burong mustasa, burong hipon, tuba wine and suka. This species was also reportedly found in cider vinegar fermentations (Cleenwerck et al., 2002). Another AAB, Acetobacter orientalis, was only found in alamang but is also reportedly found in tofu curd and tempeh from Indonesia, in vinegar fermentations and in Caucasian yoghurt from Japan (Kiryu et al., 2009).
Acetobacter ghanensis found in burong mustasa and sinamak is another member of AAB and was previously found present in cocoa bean fermentation in Ghana. Acetobacter pasteurianus, identified in tuba wine, was reportedly found in vinegar and Ghanaian cocoa bean fermentation (Cleenwerck et al., 2007). A soil-dwelling Bacillus species was identified to be present in alamang and burong isda. This finding suggests that artisanal food fermentation processes, and in particular, the methods used in the production of the alamang and burong isda samples, might not be aseptic. The results presented underline the complexity of the microflora in traditional fermented foods. This is, in fact, expected because artisanal fermentation products are processed non-aseptically and sources of the developed microbial community in the food are the surfaces of the raw material used, the fermentation vessels, and are affected by other factors related to the preparation, handling and transportation of the products (Pulido et al., 2005). In a culture-dependent study of Sanchez (2008) on burong isda, potentially pathogenic bacteria such as Salmonella and Pseudomonas sp. were found, but not in this study. In the culture-dependent study of various vinegars in the Philippines (suka), the isolated bacteria were of the genera Leuconostoc, Lactobacillus, and Streptococcus. In tuba wine, the genera of isolated bacteria from culture-dependent methods included Acetobacter, Leuconostoc, Lactobacillus, and Streptococcus (Sanchez, 2008). In most of these culturedependent studies, the bacteria were identified only through their genera and not up to the species level. The discrepancy between the results of Sanchez and the current study might stem from the low DNA amplification of the targeted gene in the food samples, which may have presented as faint bands in the DGGE gel and thus were not sequenced and identified. Additionally, bias through selection of cultivation media in culture-dependent studies would also cause particular species to flourish more than others, resulting in variations in the identified predominant bacteria.
A
t u
o h
The ability of lactic acid bacteria to produce organic acids (i.e. acetic or lactic acid) helps in the prevention of spoilage on fermented products. Recent observations suggest that metabolites like acetic acid (an end-product of heterofermentative bacteria) pose antimicrobial properties that make lactic fermented products safe for consumption. This antimicrobial activity contributes to fermented products by lowering the number of pathogenic bacteria during the fermentation process (Yeung et al., 2002). In particular, L. plantarum has been shown in humans to increase the defensive barrier of the colon, as well as to reduce mucosal inflammation by lowering the number of gram-negative bacteria which secrete endotoxins (Molin, 2003).
Members of AAB were also found to be among the dominant bacteria of fermented foods like burong mustasa, sinamak, suka, tuba wine and burong hipon. These bacteria can oxidise ethanol to acetic acid under neutral and acidic (i.e. pH 4.5) conditions. As a result, AAB are often used in the production of fermented foods, either in a beneficial (e.g. chocolate products, coffee, vinegar, nata de coco and specialty beers) or detrimental (e.g. spoilage of beers, wines and ciders) fashion (Cleenwerck et al., 2007). A. orientalis was reported as the primary bacterium present on Caspian sea yoghurt and was responsible for the production of lactobionic acid which is stable at low pH. This bacterium was further studied as a means of mass producing edible lactobionic acid (Kiryu et al., 2009). This particular Acetobacter species was among those identified in alamang in this study.
o c
y p
Fermented foods are generally documented to contain both lactic acid (e.g. Lactobacillus) and acetic acid bacteria (e.g. Acetobacter). Local fermented food products under study were also found to have the same type of microflora. As many LABs have probiotic potential (Molin, 2001), fermented products can be a source of these beneficial microbes. Once it has been established that the fermented foods tested in this study contain such health-promoting bacteria, the appeal and significance of these products to consumers will increase, compounding their economic and cultural significance. As we have already identified the members of the bacterial community in some of these preparations, the next phase is to isolate and verify the probiotic potential of these microorganisms.
s 'r
Although PCR-DGGE may not fully describe the microbial community of an environment – due to difficulties in DNA isolation from complex food matrices and restrictions posed by the inherent bias in DNA amplification through PCR resulting in faint bands in the DGGE gel that were difficult to re-amplify and sequence – it still has tremendous potential in food microbiology. It is an alternative to traditional methods of microbial identification such as physiological, biochemical and other phenotype-dependent tests (Ben Omar and Ampe, 2000; Ercolini, 2003; Pulido et al., 2005). These tests are uncertain, complicated and timeconsuming especially in identification of LAB, since many of them present similar characteristics (Ercolini, 2003). We have also shown that this technique is useful for the initial screening of potential probiotics in food samples. Once a potential probiotic species has been identified through general 16S rDNA PCR-DGGE sequencing, it can then be subjected to targeted isolation by inoculating onto selective media for maintenance and further testing and characterisation. It is noteworthy that almost all of the sequences obtained corresponded to bacterial species not identified in previous studies using conventional microbiological techniques
(Sanchez, 2008). Using PCR-DGGE, it was possible to enumerate in situ bacteria in a variety of Philippine fermented food preparations (e.g. animal and plant-based preparations) accurately until the species level. The results discussed in this paper have also prompted us to study particularly the fermentation of burong mustasa (fermented mustard leaves) in more detail. This is described in the accompanying paper by Larcia et al. (2011). Assessment of the microbial diversity not only enumerates the members of the microbial community but can also help identify potentially pathogenic or probiotic bacteria. The majority of the isolated and identified bacteria in this study have never been reported before in culture-dependent studies of similar food preparations. Several uncultured bacterial strains were also documented. This suggests that traditional fermented foods may be a reservoir of novel bacterial species. In time, the true identity of these bacteria will be revealed through the various genomic databases. For now, the amplified bacterial 16S rDNA were cloned with the aim of establishing an initial partial bacterial 16S rDNA library for Philippine fermented foods.
We would like to thank Francis Delos Reyes for the DGGE apparatus, as well as Asuncion Raymundo for the molecular biology laboratory facilities at the University of the Philippines Los Baňos. Our thanks also go to Nacita Lantican for the helpful discussion on DGGE and Gedeon Yebron for the gel documentation system. This study has been supported by the University of the PhilippinesNational Institutes of Health grant 2006-004.
t u
o h
Clarridge III., J.E., 2004. Impact of 16S rRNA gene sequence analysis for identification of bacteria on clinical microbiology and infectious diseases. Clinical Microbiology Reviews 17: 840-862. Cleenwerck, I., Vandemeulebroecke, K., Janssens, D. and Swings, J., 2002. Re-examination of the genus Acetobacter, with descriptions of Acetobacter cerevisiae sp. nov. and Acetobacter malorum sp. nov. International Journal of Systematic and Evolutionary Microbiology 52: 1551-1558. Cleenwerck , I., Camu, N., Engelbeen, K., De Winter, T., Vandemeulebroecke, K., De Vos, P. and De Vuyst, L., 2007. Acetobacter ghanensis sp. nov., a novel acetic acid bacterium isolated from traditional heap fermentations of Ghanaian cocoa beans.
y p
International Journal of Systematic and Evolutionary Microbiology 57: 1647-1652. Cocolin, L., Manzano, M., Cantoni, C. and Comi, G., 2001. Denaturing gradient gel electrophoresis analysis of the 16S rRNA gene V1
o c
region to monitor dynamic changes in the bacterial population during fermentation of Italian sausages. Applied and Environmental Microbiology 67: 5113-5121. Doyle, J.J. and Doyle, J.L., 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19: 11-15. Ercolini, D., 2003. PCR-DGGE fingerprinting: novel strategies for detection of microbes in food. Journal of Microbiological Methods 56: 297-314. Hutkins, R.W., 2006. Microbiology and technology of fermented foods. Blackwell Publishing, Ames, IO, USA. Jay, J.M., Loessner, M.J. and Golden, D.A., 2005. Modern food microbiology. Springer Science and Business Media, Inc., New York, NY, USA. Kiryu, T., Kiso, T., Nakano, H., Ooe, K., Kimura, T. and Murakami, H., 2009. Involvement of Acetobacter orientalis in the production of lactobionic acid in Caucasian yogurt (‘Caspian Sea yogurt’). Journal of Dairy Science 92: 25-34. Larcia, L.L.H, Estacio, R.C. and Dalmacio, L.M.M., 2011. Bacterial diversity in Philippine fermented mustard (burong mustasa) as revealed by 16S rRNA gene analysis. Beneficial Microbes 2: 263-271.
s 'r
Beek, S. and Priest, F.G., 2001. Evolution of the lactic acid bacterial community during malt whisky fermentation: a polyphasic study. Applied and Environmental Microbiology 68: 297-305. Ben Omar, N. and Ampe, F., 2000. Microbial community dynamics during production of the Mexican fermented maize dough pozol.
Martin-Platero, A.M., Valdiva, E., Maqueda, M., Martin-Sanchez, I. and Martinez-Bruno, M., 2008. Polyphasic approach to bacterial dynamics during the ripening of Spanish farmhouse cheese, using culture-dependent and -independent methods. Applied and Environmental Microbiology 74: 5662-5673.
Applied and Environmental Microbiology 66: 3664-3673. Camu, N., De Winter, T., Verbrugghe, K., Cleenwerck, I., Vandamme, P., Takrama, J.S., Vancanneyt, M. and Vuyst, L.C., 2007. Dynamics and biodiversity of populations of lactic acid bacteria and acetic acid
Matijasic, B.B. and Rogelj, I., 2006. Demonstration of suitability of probiotic products. Agro Food Industry Hi-Tech 17: 38-40. Meroth, C.B., Walter, J., Hertel, C., Brandt, M.J. and Hammes, W.P., 2003. Monitoring the bacterial population dynamics in sourdough
bacteria involved in spontaneous heap fermentation of cocoa beans in Ghana. Applied and Environmental Microbiology 73: 1809-1824. Chatterjee, A., Bhattacharya, H. and Kandwal, A., 2010. Probiotics in periodontal health and disease. Journal of Indian Society of
fermentation processes by using PCR-denaturing gradient gel electrophoresis. Applied and Environmental Microbiology 69: 475-482. Molin, G., 2001. Probiotics in foods not containing milk or milk
Periodontology 15: 23-18. Choi, H.J., Cheigh, C.I., Kim, S.B., Lee, J.C., Lee, D.W., Choi, S.W., Park, J.M. and Pyun, Y.R., 2002. Weissella kimchii sp. nov., a novel lactic acid bacterium from kimchi. International Journal of Systematic
constituents, with special reference to Lactobacillus plantarum 299v. The American Journal of Clinical Nutrition 73 Suppl. 2: 380S-385S. Moreira, J.L.S., Mota, R.M., Horta, M.F., Teixeira, S.M.R., Neumann, E., Nicoli, J.R. and Nunes, A.C., 2005. Identification to the species
A
and Evolutionary Microbiology 52: 507-511.
level of Lactobacillus isolated in probiotic prospecting studies of human, animal or food origin by 16S-23S rRNA restriction profiling. BMC Microbiology 5: 15.
Muyzer, G., De Waal, E.C. and Uitterlinden, A.G., 1993. Profiling
Sanchez, P., 2008. Philippine fermented foods: principles and
of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Applied and Environmental Microbiology 59: 695-700.
technology. The University of the Philippines Press, Quezon City, Philippines, pp. 266-270. Srikanjana, K., Viernstein, H., Sirithunyalug, J. and Okonogi, S., 2008. Probiotic properties of lactobacilli isolated from Thai traditional
Nakatsu, C.H., Torsvik, V. and Øvreås, L., 2000. Soil community analysis using DGGE of 16S rDNA polymerase chain reaction products. Soil Science Society of America 64: 1382-1388.
food. Scientia Pharmaceutica 76: 485-503. Steinkraus, K.H., 1996. Handbook of indigenous fermented foods. 2nd ed., Marcel Dekker Inc., New York, NY, USA.
Pendersen, C., Jonsson, J., Lindberg, J.E. and Roos, S., 2004. Microbiological characterization of wet wheat distillers’ grain, with focus on isolation of Lactobacilli with potential as probiotics. Applied and Environmental Microbiology 70: 1522-1527.
Tajima, K., Ohmori, H., Aminov, R.I., Kobashi, Y. and Kawashima, T., 2010. Fermented liquid feed enhances bacterial diversity in piglet intestine. Anaerobe 16: 6-11. Tannock, G.W., 2004. A special fondness for Lactobacilli. Applied and
Pulido, R.P., Omar, N.B., Abriouel, H., Lopez, R.L., Canamero, M.M. and Galvez, A., 2005. Microbiological study of lactic acid fermentation of caper berries by molecular and culture-dependent methods. Applied and Environmental Microbiology 71: 7872-7879.
Environmental Microbiology 70: 3189-3194. Temmerman, R., Scheirlinck, I., Huys, G. and Swings, J., 2003. Cultureindependent analysis of probiotic products by denaturing gradient gel electrophoresis. Applied and Environmental Microbiology 69:
Sanchez, P., 1981. Studies on the traditional sugarcane wine (basi) production in the Philippines. Philippine Journal of Crop Science
220-226. Wiese, B.G., Strohmar, W., Rainey, F.A. and Diekmann, H., 1996.
6: 108-116. Sanchez, P., 1989. Microbial interactions in Philippine fermented foods. In: Proceedings of the 5th international symposium on microbial ecology, 27 August-1 September 1989, Kyoto, Japan, pp. 6-7.
Lactobacillus panis sp. nov., from sourdough with a long fermentation period. International Journal of Systematic Bacteriology 46: 449-453. Yeung, P., Sanders, M.E., Kitts, C.L., Cano, R. and Tong, P.S., 2002. Species-specific identification of commercial probiotic strains. Journal of Dairy Science 85: 1039-1051.
A
t u
o h
s 'r
o c
y p
A
t u
o h
s 'r
o c
y p
