JOURNAL OF BACTERIOLOGY, May 2011, p. 2510–2516 0021-9193/11/$12.00 doi:10.1128/JB.00171-11 Copyright © 2011, American Society for Microbiology. All Rights Reserved.
Vol. 193, No. 10
Biosynthesis and Regulation of Grisemycin, a New Member of the Linaridin Family of Ribosomally Synthesized Peptides Produced by Streptomyces griseus IFO 13350䌤 Jan Claesen† and Mervyn J. Bibb* Department of Molecular Microbiology, John Innes Centre, Norwich Research Park, Norwich NR4 7UH, United Kingdom Received 7 February 2011/Accepted 9 March 2011
Our recent identification and genetic analysis of the biosynthetic gene cluster for production of the ribosomally synthesized and posttranslationally modified peptide cypemycin revealed a new class of peptide natural products, the linaridins. Here we describe the identification and characterization of grisemycin, a linaridin produced by a previously unidentified gene cluster in Streptomyces griseus IFO 13350. Mass spectrometric analysis revealed that grisemycin possesses at least three of the modifications found in cypemycin, as well as an analogous leader peptidase cleavage site. Expression of putative grisemycin biosynthetic genes in a Streptomyces coelicolor A3(2) derivative, combined with deletion of the gene encoding the grisemycin precursor peptide, confirmed the identity of the grisemycin gene cluster. Both grisemycin and cypemycin depend on the transcriptional activator AdpA for wild-type levels of production. translational modifications found in cypemycin, and we identify the grisemycin biosynthetic gene cluster. We also show that the production of both grisemycin and cypemycin is regulated by the transcriptional activator AdpA, a master regulatory protein that links ␥-butyrolactone signaling to the expression of natural product gene clusters—and morphological differentiation—in many streptomycetes (8).
Although the ribosomal translational machinery generally uses only the 20 genetically encoded amino acids for protein and peptide synthesis, nature has invented several mechanisms to expand on this structural repertoire by posttranslational modification of the constituent amino acids. Several new classes of posttranslationally modified peptides have been identified based on recent advances in microbial genome sequencing, biochemistry, and genetics. Examples include the thiopeptides (9, 15, 17, 26), patellamides (24), linear heterocyclized toxins (13), and linaridins (3). Interest in these compounds stems from the identification of previously undescribed peptides with potentially interesting biological properties and the discovery and characterization of new types of modification enzymes. Such enzymes could well play a role in rational peptide engineering (22). A ribosomally synthesized and modified peptide is typically encoded as a prepropeptide that consists of a propeptide that is subject to posttranslational modifications and a leader sequence that is thought to serve as a recognition signal for biosynthetic and/or transporter proteins and as a means of sequestering the compound in an inactivate form while it is inside the cell (21). Our work on the posttranslationally modified peptide cypemycin revealed a new family of linear, dehydrated peptides, the linaridins (3). Several previously unrecognized linaridin gene clusters were identified bioinformatically in different bacterial phyla and even in the Archaea. Here we describe the identification of grisemycin as the product of a previously unidentified linaridin gene cluster found in Streptomyces griseus IFO 13350. We show that grisemycin contains at least three of the post-
MATERIALS AND METHODS Bacterial strains, media, and growth conditions. S. griseus IFO 13350 was obtained from the NITE Biological Resource Center (NBRC), Japan. Yasuo Ohnishi kindly provided the S. griseus ⌬adpA mutant (20) and the complemented strain. Streptomyces coelicolor M1146, a derivative of the A3(2) strain, was described previously (5), and Micrococcus luteus ATTC 4698 was obtained from Novacta Biosystems. The plasmids used in this study were pSET152 (4), SuperCosI (Stratagene), and pIJ10702 (3). Medium compositions, culture conditions, antibiotic concentrations, and general Escherichia coli and Streptomyces manipulations were as described previously (10). Enzymes were purchased from Roche Diagnostics, and chemicals and oligonucleotide primers were purchased from Sigma-Aldrich. Genetic and cloning techniques and bioassays. Standard DNA manipulations and PCR techniques were performed as described previously (23). Streptomyces genomic DNA extraction and conjugative plasmid transfer were performed as described previously (10), and PCR targeting procedures were also performed as described previously (6). To clone the grisemycin biosynthetic gene cluster, S. griseus genomic DNA was isolated, digested with NotI, and separated in a 0.8% agarose gel. DNA fragments between approximately 10.1 kb and 11.2 kb were excised, purified, and ligated with NotI-digested pSET152 (4). The ligation mixture was introduced into E. coli DH5␣ by transformation, and 56 transformants were analyzed by colony PCR, using primers grmA T1 and grmA T2 (for the sequences of the primers used in this study, see Table 1). This primer set amplified a 960-bp region containing grmA from two of the DH5␣ transformants, which were presumed to contain the putative grisemycin biosynthetic gene cluster cloned in pSET152. The two recombinant plasmids were isolated and verified by restriction digestion analysis and by two different diagnostic PCRs, using primer sets Gris F1 T1/Gris F1 T2 and Gris F2 T1/Gris F2 T2. One of the plasmids was designated pIJ12474, introduced into the DNA methylation-deficient E. coli strain ET12567/pUZ8002 (16) by electroporation, and transferred into the engineered heterologous host S. coelicolor M1146 (5) by conjugation, yielding strain M1457. To generate an S. griseus ⌬grmA::[oriT-aac(3)IV] replacement mutant, pIJ12474 was digested with NotI to liberate the 10.6-kb insert, which was cloned into NotI-digested SuperCosI (Kanr), yielding pIJ12475. grmA was replaced in pIJ12475 with an apramycin resistance cassette by PCR targeting
* Corresponding author. Mailing address: Department of Molecular Microbiology, John Innes Centre, Norwich Research Park, Norwich NR4 7UH, United Kingdom. Phone: 44-1603-450776. Fax: 44-1603450778. E-mail:
[email protected]. † Present address: Department of Bioengineering and Therapeutic Sciences, University of California, 1700 4th Street, Byers Hall 309, Box 2530, San Francisco, CA 94158. 䌤 Published ahead of print on 18 March 2011. 2510
VOL. 193, 2011
BIOSYNTHESIS AND REGULATION OF GRISEMYCIN TABLE 1. Primers used in this study
Oligonucleotide
Sequence (5⬘–3⬘)
grmA T1 .....................AGGAGCGGGCCTTGCTC grmA T2 .....................CGCCGCGAGTGTCACC Gris F1 T1 .................ACCCTGGGCGAGATACC Gris F1 T2 .................CACCGGCGTCTCATGG Gris F2 T1 .................TCAGGGTGTCCAGGGTC Gris F2 T2 .................GGTCGGCCATGTGCTG grmA F........................TTTCGCTCAGCATAGGTTCCGAGGAAG GACAGCGAAATGACTAGTATTCCGG GGATCCGTCGACC grmA R .......................AGGGCGGACCCCTCCGACACGCGAGT CAGCCCACCATCAACTAGTTGTAGGC TGGAGCTGCTTC grmA F........................ACTTCGCCAACAGTGTTCT grmA R .......................TCAGCAGACGAGACAGATG grmH F .......................ACTTCCTCCAGATCCAGGT grmH R.......................ATCGAGTTGATGACGTTCC gri hrdB F ...................CACCAAGGGCTACAAGTTCT gri hrdB R ..................CGAGCTTGTTGATGACCTC cypA F.........................GCAGGACTTTGCGAACAC cypA R ........................TCAGCAGACCAGGCAGAT cypH F ........................CTCACCGGAATCTACGAGT cypH R........................GACCGAGTTGACGATGTTC coe hrdB F..................GAGTCCGTCTCTGTCATGG coe hrdB R .................CGTCACACCCTCTTCCTC
using primers grmA F and grmA R (6). The resulting construct, pIJ12476, was introduced into S. griseus by conjugation. Double-crossover recombinants were identified by their Aprr Kans phenotype and were verified by PCR analysis (using primers grmA T1 and grmA T2). The resulting S. griseus ⌬grmA::[oriT-aac(3)IV] mutant strain was designated M1458. For bioassays, strains were grown for 3 days in cypemycin production medium (11), and culture supernatants were separated from the mycelium by centrifugation and extracted with CHCl3. The solvent was evaporated and the residual pellet dissolved in 5% formic acid for matrix-assisted laser desorption ionization–time of flight (MALDI-TOF) analysis or in methanol (MeOH) for use in an M. luteus paper disc bioassay (3). MS analysis. CHCl3 was evaporated from 1 ml of production culture extract, and the resulting pellet was dissolved in 50 l 5% formic acid. Samples (⬃0.8 l) were spotted onto a prespotted AnchorChip MALDI target plate (Bruker Daltonics) and washed with 8 l 5% formic acid. After drying, the samples were analyzed by MALDI-TOF mass spectrometry (MALDI-TOF MS) on a Bruker Ultraflex TOF/TOF instrument. The instrument was calibrated using prespotted standards (⬃200 laser shots). Samples were analyzed using a laser power of ⬃25%, and spectra were summed from ⬃20 ⫻ 20 laser shots. For quantitative TOF (Q-TOF) MS analysis, the peptide was infused directly into a QToF II instrument (Waters) and analyzed with MassLynx 4.1 (Waters UK, Elstree, United Kingdom). The sample was diluted into 30% methanol–30% acetonitrile–1% acetic acid and applied with a GlassTip (New Objective) by nanoelectrospray. Full MS scan analysis was performed with standard settings, and fragmentation was achieved by increasing the collision energy to 40. qRT-PCR. S. griseus and S. coelicolor strains used for transcriptional analysis were grown at 30°C for 18 h in an SOC (superoptimal broth with catabolite repression) seed culture, after which they were diluted in fresh SOC to an optical density at 600 nm (OD600) of ⬃0.05. Five-hundred-microliter aliquots of the diluted seed cultures were used to inoculate duplicate 25-ml production cultures, which were subsequently grown for 24 h at 30°C. Two milliliters of RNAprotect bacterial reagent (Qiagen) was added to 1 ml production culture sample and mixed by vortexing. After leaving the mixture at room temperature for 5 min, the cells were pelleted by centrifugation (3,000 ⫻ g for 5 min), decanted, and frozen overnight at ⫺20°C. After thawing, cell pellets were resuspended in 200 l Tris-EDTA (TE) buffer containing 15 mg/ml lysozyme and incubated at room temperature for 60 min. RNA extraction was carried out using an RNeasy Midi kit (Qiagen) according to the manufacturer’s instructions, with an additional phenol-chloroform treatment after sonication. After purification, RNA quality and quantity were assessed spectrophotometrically, and 2.5 g was subjected to RNase-free DNase I treatment (Invitrogen) in a 25-l reaction mix according to the manufacturer’s instructions. Eight microliters of the resulting RNA was used as a template for cDNA synthesis, using SuperScript III first-strand synthesis supermix (Invitrogen) according to the manufacturer’s directions, in a total
2511
volume of 20 l. The cDNA was treated with RNase H and then diluted 1:100 with water. A total of 2.5 l diluted cDNA was used for each quantitative real-time PCR (qRT-PCR), using SYBR Greener qRT-PCR supermix (Invitrogen) according to the manufacturer’s instructions, in a total volume of 25 l containing 3 l 40% dimethyl sulfoxide and 200 nM (each) forward and reverse primers. A typical qRT-PCR program started at 50°C for 2 min and then 95°C for 10 min, followed by 40 cycles of 95°C (15 s) and 58°C (60 s) on a Chromo4 machine (Bio-Rad). A standard curve was generated from different dilutions of genomic DNA which were run in parallel on the same 96-well plate for each analyzed gene. All determinations were performed in triplicate and analyzed using Opticon 2 Monitor software (MJ Research). To correct for differences in the amounts of template RNA, samples were normalized using the transcript levels of the vegetative sigma factor gene hrdB. Analysis of control samples (cDNA synthesis reaction mixtures without added reverse transcriptase) indicated that the analyzed RNA samples were not contaminated with genomic DNA. For the sequences of the primers used, see Table 1.
RESULTS Bioinformatic analysis of the putative linaridin gene cluster of S. griseus IFO 13350. We previously identified a putative linaridin gene cluster in the genome sequence of S. griseus IFO 13350 (3, 18). The 6.4-kb S. griseus cluster closely resembles the cypemycin biosynthetic gene cluster of Streptomyces sp. OH4156 and contains seven genes (SGR_6365.2 [not annotated] through SGR_6360) that are presumed orthologs of cypA through cypP (Fig. 1A). A homolog of cypI (SGR_2560; 67% amino acid identity), the eighth gene of the cypemycin gene cluster, was identified elsewhere in the S. griseus genome. The S. griseus gene cluster was predicted to encode a linaridin, which we describe here as grisemycin. The SGR_6365.2 through SGR_6360 genes were therefore designated grmA through grmP, analogous to their counterparts in the cypemycin gene cluster (Fig. 1A). The flanking regions on either side of the grisemycin biosynthetic cluster are not in synteny with the regions adjacent to the cypemycin gene cluster. The grisemycin gene cluster is flanked by a putative modular type I polyketide synthase (PKS) gene cluster upstream of grmA and a cluster of genes of unknown function downstream of grmP (18). In contrast, genes predicted to be involved in mycothiol detoxification are found upstream of the cypemycin gene cluster, and genes encoding rodlins and a chaplin—components of the hydrophobic sheath of the aerial mycelium of Streptomyces—lie downstream (3). Directly upstream of grmA and transcribed divergently is SGR_6366, encoding a protein whose N-terminal half closely resembles members of the Streptomyces antibiotic regulatory protein (SARP) family (reviewed in reference 1). The product of SGR_6366 does not resemble the product of orf1 that lies adjacent to cypA. Since deletion of orf1 had no apparent effect on cypemycin biosynthesis (3), extrapolation suggests that SGR_6366 is not required for grisemycin production but could instead be involved in regulating expression of the adjacent type I PKS gene cluster. The propeptide sequence of GrmA is shorter than that of CypA, by three amino acids, Thr-Pro-Thr, corresponding to positions 5 to 7 of cypemycin (Fig. 1B). All other residues in both propeptides are identical. Comparison of the GrmA and CypA leader sequences also showed a high degree of conservation. One of the proposed functions of the leader sequences of posttranslationally modified peptides is to act as a recognition signal for the biosynthetic enzymes (reviewed in reference 21). Based on the enzymes encoded by the grisemycin gene
2512
CLAESEN AND BIBB
J. BACTERIOL.
FIG. 1. (A) Comparison of the biosynthetic gene clusters for grisemycin and cypemycin biosynthesis. The locations of the NotI sites flanking the grisemycin gene cluster that were used to construct pIJ12474 are indicated. Genes for which a partial ORF is present in the subcloned fragment are indicated with asterisks. Only part of SGR_6359 is shown in the figure. (B) Alignment of the sequences of the precursor peptides CypA and GrmA. The leader peptidase cleavage site for both peptides is indicated by a vertical line. (C) Schematic representation of grisemycin and cypemycin. Posttranslationally modified amino acid residues are depicted in gray. Note that it still remains to be established whether the two Ile residues (light gray) in grisemycin are modified to allo-Ile.
cluster, GrmA was assumed to be modified in a similar way to CypA in cypemycin biosynthesis (Fig. 1C) (3). GrmH and/or GrmL (74% and 77% amino acid identity to CypH and CypL, respectively) was predicted to dehydrate the two Thr residues of the GrmA propeptide to form (Z)-2,3-didehydrobutyrine (Dhb) and to dethiolate the internal Cys to 2,3-didehydroalanine (Dha). The N-terminal Ala would be dimethylated by the S-adenosyl methionine (SAM)-dependent methyltransferase GrmM (76% identity to CypM). S-[(Z)-2-Aminovinyl]-D-cysteine (AviCys) is predicted to form after oxidative decarboxylation of the C-terminal Cys by the homo-oligomeric flavincontaining Cys-decarboxylase (HFCD) GrmD (76% identity to CypD) and subsequent addition of the resulting enethiolate onto Dha (12). The predicted ABC transporter GrmTP is assumed to be involved in translocation of grisemycin across the cytoplasmic membrane (GrmT and GrmP share 74% and 62% amino acid sequence identity with CypT and CypP, respectively). Identification of grisemycin and structural verification. To identify the product of the putative grisemycin gene cluster, S. griseus was grown under conditions similar to those used for cypemycin production by Streptomyces sp. OH-4156 (3). After 3 days of growth, culture supernatant was assessed for antibiotic activity by use of a Micrococcus luteus paper disc bioassay. No activity was observed, even after concentration of the supernatant (data not shown). If grisemycin was modified in a
similar fashion to cypemycin, the compound would be shorter by three residues (Dhb-Pro-Dhb) (Fig. 1C), and its mass would be smaller by 263 Da. MALDI-TOF analysis of the S. griseus supernatant extracts revealed a set of three peaks with the following masses: [M ⫹ H]⫹ ⫽ 1,833 Da, [M ⫹ Na]⫹ ⫽ 1,855 Da, and [M ⫹ K]⫹ ⫽ 1,871 Da (Fig. 2A). These are in perfect agreement with the predicted mass for grisemycin based on the observed mass peaks for cypemycin: [M ⫹ H]⫹ ⫽ 2,096 Da, [M ⫹ Na]⫹ ⫽ 2,118 Da, and [M ⫹ K]⫹ ⫽ 2,134 Da (3). To verify that the compound observed in the MALDI-TOF spectrum was indeed grisemycin, the compound corresponding to the mass peak [M ⫹ K]⫹ (1,871 Da) was subjected to Q-TOF mass spectrometric analysis (Table 2). The analysis showed that both Thr residues had been dehydrated to Dhb. N-terminal dimethylation of grisemycin was inferred from the 183.12-Da b ion, which corresponds to Me2-Ala-Dhb (in good agreement with the calculated mass of 183.11 Da), and the 1,771.92-Da y ion (calculated mass, 1,771.90 Da). The presence of the C-terminal AviCys residue was inferred from the 395.17-Da y ion (calculated mass, 395.15 Da). No mass peak corresponding to the calculated mass for a b ion was observed for the grisemycin fragment lacking AviCys. This was probably due to a progressively decreasing signal intensity of the b ion peaks at higher masses in the grisemycin Q-TOF spectrum. At present, it is uncertain whether grisemycin contains allo-Ile
VOL. 193, 2011
BIOSYNTHESIS AND REGULATION OF GRISEMYCIN
2513
FIG. 2. MALDI-TOF MS spectra of CHCl3-extracted supernatants of production cultures of wild-type S. griseus (A), an S. griseus ⌬grmA mutant (B), S. coelicolor M1146 containing empty pSET152 (C), and S. coelicolor M1146 containing pIJ12474 (D). Grisemycin is characterized by the following mass peaks: [M ⫹ H]⫹ ⫽ 1,833 Da, [M ⫹ Na]⫹ ⫽ 1,855 Da, and [M ⫹ K]⫹ ⫽ 1,871 Da. a.u., arbitrary units.
residues, since this modification cannot be identified by mass spectrometric analysis. Cloning and heterologous expression of the grisemycin gene cluster. The likely boundaries of the grisemycin biosynthetic gene cluster were deduced by comparison with the cypemycin gene cluster (Fig. 1A) (3). Sequence analysis identified a NotI restriction site on either side of this set of genes. Excision of the 10.6-kb NotI fragment from genomic DNA would result in truncation of open reading frames (ORFs) SGR_6359 and SGR_6368, leaving only SGR_6367 (encoding a putative oxidoreductase) and SGR_6366 (encoding the SARP-like pro-
TABLE 2. Q-TOF analysis of grisemycina Mass (Da) of b ion Position
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16
Mass (Da) of y ion
Residue
Me2-Ala Dhb Pro Ala Val Ala Gln Phe Val Ileb Gln Gly Ser Dhb Ileb AviCys
Calculated
Observed
Calculated
Observed
100.08 183.11 280.17 351.20 450.27 521.31 649.37 796.44 895.50 1,008.59 1,136.65 1,193.67 1,280.70 1,363.74 1,476.82 ND*
ND 183.12 280.18 351.22 450.29 521.33 649.38 796.46 895.54 1,008.63 1,136.61 ND ND 1,363.76 ND ND
1,871.97 1,771.90 1,688.86 1,591.81 1,520.77 1,421.70 1,350.66 1,222.61 1,075.54 976.47 863.39 735.33 678.31 591.27 508.24 395.15
ND 1,771.92 1,688.87 1,591.82 ND 1,421.71 1,350.71 1,222.65 1,075.58 976.51 863.42 735.36 ND 591.29 ND 395.17
a Fragmentation of the modified linear peptide allowed determination of the amino acid sequence and the nature and locations of modified residues. Calculated and observed masses are represented for both the b and y ions. The amino acid sequence between Dhb2 and the AviCys residue (which does not fragment into easily interpretable masses 关indicated as ND*兴) could be discerned readily. ND, calculated mass was not detected. b Ile and allo-Ile residues have the same mass.
tein), which are unlikely to be involved in grisemycin production, in the fragment (Fig. 1A). The 10.6-kb NotI fragment was cloned into NotI-digested pSET52 (4), yielding pIJ12474, which was then introduced into S. coelicolor M1146 (5) by conjugation to give strain M1457. Upon introduction into a Streptomyces host, pSET152 derivatives integrate stably at the C31 attB site, obviating the need for continued antibiotic selection and thus facilitating bioactivity assays. Although bioassays with culture supernatants failed to reveal activity against M. luteus, heterologous production of grisemycin was confirmed by MALDI-TOF analysis of CHCl3-extracted supernatant from a culture of M1457 grown in cypemycin production medium (Fig. 2D). This indicated that the reduced gene set present in pIJ12474 (Fig. 1A) contained all of the genes required for grisemycin production. To confirm that these genes were indeed involved in grisemycin production, an S. griseus ⌬grmA::[oriT-aac(3)IV] replacement mutant, M1458, was constructed. M1458 was grown in cypemycin production medium, and the culture supernatant was extracted with CHCl3. MALDI-TOF analysis failed to reveal the [M ⫹ H]⫹ (1,833 Da), [M ⫹ Na]⫹ (1,855 Da), and [M ⫹ K]⫹ (1,871 Da) mass peaks characteristic of grisemycin (Fig. 2B), thus confirming that grmA is the structural gene for grisemycin biosynthesis in S. griseus. Regulation of grisemycin and cypemycin biosynthesis. A recent microarray study of an S. griseus ⌬afsA mutant revealed that expression of the grisemycin biosynthetic operon was activated by the extracellular signaling molecule A factor (2isocapryloyl-3-R-hydroxymethyl-␥-butyrolactone) (7). Moreover, nucleotide sequences extending 187 bp upstream of grmA bound AdpA in a competitive electrophoretic mobility shift assay (EMSA) (7). AdpA is a transcriptional activator of the AraC/XylS family, and adpA is the sole target of the A-factor receptor protein ArpA (8). AdpA thus acts as the master regulator downstream of A factor signaling and activates the
2514
CLAESEN AND BIBB
transcription of genes involved in secondary metabolism and morphological differentiation (19). This led us to analyze the nucleotide sequences upstream of grmA and cypA. Putative AdpA binding sites were located at positions ⫺134 to ⫺125 upstream of the grmA start codon (5⬘-TTGCGGGATT-3⬘) and positions ⫺409 to ⫺400 upstream of the cypA start codon (5⬘-TGGCCGGATG-3⬘). Both conformed to the consensus AdpA binding site sequence (5⬘TGGCSNGWWY-3⬘) (27). We thus set out to confirm the regulatory role of AdpA in grisemycin biosynthesis and to investigate its possible involvement in the regulation of cypemycin production. We first carried out a qRT-PCR analysis of the grisemycin gene cluster, using S. griseus IFO 13350, a ⌬adpA mutant (20), and a complemented ⌬adpA strain (containing the integrative vector pTYM19 with cloned adpA) (Y. Ohnishi, personal communication). Total RNAs were extracted from these strains after 24 h of growth in cypemycin production medium, and grmA and grmH transcript levels were analyzed using primer pair grmA F and grmA R and primer pair grmH F and grmH R, respectively (Table 1). grmA and the downstream genes encoding the grisemycin biosynthetic enzymes are likely to be cotranscribed, but transcript levels were expected to differ since bioinformatic analysis had identified a putative transcriptional attenuator immediately downstream of grmA, analogous to one in the cypemycin gene cluster (3). To account for differences in the quantities of template RNA used for qRT-PCR, raw data were normalized using the transcript levels of hrdB, which encodes the vegetative sigma factor of S. griseus (primers used were gri hrdB F and gri hrdB R). Comparison of grmA transcript levels in the wild type and the ⌬adpA mutant confirmed the previous observation (7) that regulation of grisemycin biosynthesis is at least partially dependent on AdpA (Fig. 3A). Expression was restored to wild-type levels in the complemented strain. grmH transcript levels exhibited a similar pattern (Fig. 3B). The qRT-PCR analysis revealed an approximately 10-fold reduction in the amount of grmH transcript compared to that for grmA, presumably indicative of the putative attenuator located between the two genes. To investigate the effect of AdpA on cypemycin biosynthesis, pIJ12421 (a pSET152 construct harboring the cypemycin gene cluster [3]) was introduced by conjugation into S. coelicolor M145 [a plasmid-free derivative of the A3(2) wild-type strain] and its derived ⌬adpA mutant, M851 (25). A similar qRT-PCR analysis was performed with the resulting strains to determine the transcript levels of cypA and cypH, using primer pair cypA F and cypA R and primer pair cypH F and cypH R, respectively. The raw data were normalized using the expression levels of S. coelicolor hrdB (primers coe hrdB F and coe hrdB R). cypA and cypH transcript levels were clearly higher in the wild-type strain than in the ⌬adpA mutant (Fig. 3C and D). The drop in transcript levels between cypA and cypH (about 50-fold) was even more pronounced than that observed for grmA and grmH, again indicating a stronger transcriptional attenuator downstream of cypA. Taken together, these results indicate that cypemycin production, like that of grisemycin, is at least partly under the regulatory control of AdpA.
J. BACTERIOL.
FIG. 3. Transcriptional analysis of grisemycin and cypemycin biosynthetic gene expression in adpA⫹ and ⌬adpA strains. Expression levels were normalized by using the number of copies of transcripts of the housekeeping gene hrdB in each strain. (A and B) grmA and grmH expression in wild-type S. griseus (WT), the ⌬adpA mutant (adpA), and the complemented ⌬adpA mutant (comp). (C and D) cypA and cypH expression from the heterologously expressed cypemycin gene cluster in S. coelicolor M145 (wild type) and M851 (⌬adpA).
DISCUSSION Several cryptic linaridin gene clusters have been identified by bioinformatic analysis (3). The linaridin gene cluster most closely related to the characterized cypemycin cluster was found in the genome sequence of S. griseus IFO 13350 (18). An additional putatively orthologous gene cluster was later identified in the draft genome sequence of Streptomyces sp. ACT-1 (SACT1DRAFT_6362 through SACT1DRAFT_6368). Here
VOL. 193, 2011
BIOSYNTHESIS AND REGULATION OF GRISEMYCIN
2515
FIG. 4. Alignment of partial nucleotide sequences of cypH and grmH. cypH contains a rare UUA leucine codon (the DNA sequence is depicted in bold), while the S. griseus ortholog grmH does not. The Leu residue is conserved in the two proteins (boxed).
we have identified and characterized grisemycin, the product of the S. griseus gene cluster. Grisemycin is a close structural analog of cypemycin, although it remains to be determined whether it also contains allo-Ile residues. Posttranslational introduction of allo-Ile residues does not result in a mass difference, and we did not succeed in obtaining sufficient purified grisemycin for further structural studies. While a cypI homolog occurs in the S. griseus genome sequence, it is not located in the grisemycin gene cluster. The presence or absence of this unusual modification in grisemycin will require subsequent experimental verification. In contrast to the case for cypemycin, we could not detect antimicrobial activity against M. luteus in culture supernatants of S. griseus or of S. coelicolor expressing the grisemycin gene cluster, although the peptide could be identified readily by MALDI-TOF mass spectrometry. Although we do not have quantitative data, this suggests that the compound may not possess potent antibacterial activity. It might also indicate that the antibacterial activity of cypemycin and similar linaridins depends on peptide length (grisemycin is shorter than cypemycin, by three amino acid residues). The mechanism of action of cypemycin is not known, but it could exert its activity by forming pores in the bacterial cytoplasmic membrane. A shorter peptide such as grisemycin might not be long enough to span the phospholipid bilayer. A study of the in vivo mode of action of pore-forming lantibiotics revealed that the poreforming ability of gallidermin depended on membrane thickness (2). It was speculated that the greater susceptibility to pore formation of micrococci than that of lactobacilli could reflect, in part, their relatively thinner phospholipid bilayer. The lack of antimicrobial activity observed for grisemycin and the very narrow spectrum reported for cypemycin (11) suggest that these two compounds might serve different roles in the biology of their producing Streptomyces organisms, for example, as signaling molecules. The mechanism by which cypemycin biosynthesis is regulated has not been determined previously. Indeed, no obvious candidate regulatory gene could be identified in the cluster, and the involvement of the upstream orf1 has been eliminated (3). The microarray study of Hara et al. (7) linked expression of the grisemycin biosynthetic operon to the transcriptional regulator AdpA, which is the master regulator targeted by A factor. Our qRT-PCR analyses confirmed that grisemycin production is indeed regulated by AdpA in S. griseus and demonstrated similar regulation of the cypemycin gene cluster in S. coelicolor. The presence of putative AdpA binding sites upstream of both grmA and cypA and the EMSA analysis of the grmA promoter region of Hara et al. (7) suggest but do not prove that regulation is likely to be mediated directly by AdpA. Interestingly, the grisemycin and cypemycin gene clusters are
still transcribed in the absence of adpA, albeit at reduced levels. Possibly, the promoters of the biosynthetic genes drive a basal level of expression in the absence of AdpA, or other regulatory factors may elicit their transcription. Interestingly, the cypH transcript contains the rare leucine codon UUA (Fig. 4). This suggests that cypemycin biosynthesis could be under the regulatory control of bldA, which encodes the tRNA for this codon (14). There is no corresponding UUA codon in the mRNA of the S. griseus ortholog grmH. S. coelicolor does not produce A factor, but one of the targets of its bldA gene is adpA (25). Thus, even if Streptomyces sp. OH-4156 does not have a ␥-butyrolactone signaling system, cypemycin production may still be controlled developmentally through bldA regulation of its adpA ortholog and of cypH. ACKNOWLEDGMENTS We are grateful to Yasuo Ohnishi for providing the S. griseus ⌬adpA mutant and complemented strains, to Eriko Takano for the S. coelicolor ⌬adpA mutant, to Gerhard Saalbach and Mike Naldrett for mass spectroscopy analysis, to Stephen Bornemann, Arjan Narbad, and Keith Chater for useful discussions, and to David Hopwood for comments on the manuscript. J.C. was supported by Marie Curie Actions Early Stage Training Programme grant MEST-CT-2005-019727 to the John Innes Centre, and M.J.B. was supported by a grant to the John Innes Centre from the Biotechnology and Biological Sciences Research Council (BBSRC). REFERENCES 1. Bibb, M. J. 2005. Regulation of secondary metabolism in streptomycetes. Curr. Opin. Microbiol. 8:208–215. 2. Bonelli, R. R., T. Schneider, H. G. Sahl, and I. Wiedemann. 2006. Insights into in vivo activities of lantibiotics from gallidermin and epidermin modeof-action studies. Antimicrob. Agents Chemother. 50:1449–1457. 3. Claesen, J., and M. Bibb. 2010. Genome mining and genetic analysis of cypemycin biosynthesis reveal an unusual class of post-translationally modified peptides. Proc. Natl. Acad. Sci. U. S. A. 107:16297–16302. 4. Flett, F., V. Mersinias, and C. P. Smith. 1997. High efficiency intergeneric conjugal transfer of plasmid DNA from Escherichia coli to methyl DNArestricting streptomycetes. FEMS Microbiol. Lett. 155:223–229. 5. Gomez-Escribano, J. P., and M. J. Bibb. 2011. Engineering Streptomyces coelicolor for heterologous expression of secondary metabolite gene clusters. Microb. Biotechnol. 4:207–215. doi:10.1111/j.1751-7915.2010.00219.x. 6. Gust, B., et al. 2004. Lambda red-mediated genetic manipulation of antibiotic-producing Streptomyces. Adv. Appl. Microbiol. 54:107–128. 7. Hara, H., Y. Ohnishi, and S. Horinouchi. 2009. DNA microarray analysis of global gene regulation by A-factor in Streptomyces griseus. Microbiology 155:2197–2210. 8. Kato, J. Y., I. Miyahisa, M. Mashiko, Y. Ohnishi, and S. Horinouchi. 2004. A single target is sufficient to account for the biological effects of the A-factor receptor protein of Streptomyces griseus. J. Bacteriol. 186:2206–2211. 9. Kelly, W. L., L. Pan, and C. Li. 2009. Thiostrepton biosynthesis: prototype for a new family of bacteriocins. J. Am. Chem. Soc. 131:4327–4334. 10. Kieser, T., M. J. Bibb, M. J. Buttner, K. F. Chater, and D. A. Hopwood. 2000. Practical Streptomyces genetics. The John Innes Foundation, Norfolk, United Kingdom. 11. Komiyama, K., et al. 1993. A new antibiotic, cypemycin. Taxonomy, fermentation, isolation and biological characteristics. J. Antibiot. (Tokyo) 46:1666– 1671. 12. Kupke, T., et al. 2000. Molecular characterization of lantibiotic-synthesizing enzyme EpiD reveals a function for bacterial Dfp proteins in coenzyme A biosynthesis. J. Biol. Chem. 275:31838–31846.
2516
CLAESEN AND BIBB
13. Lee, S. W., et al. 2008. Discovery of a widely distributed toxin biosynthetic gene cluster. Proc. Natl. Acad. Sci. U. S. A. 105:5879–5884. 14. Leskiw, B. K., E. J. Lawlor, J. M. Fernandez-Abalos, and K. F. Chater. 1991. TTA codons in some genes prevent their expression in a class of developmental, antibiotic-negative, Streptomyces mutants. Proc. Natl. Acad. Sci. U. S. A. 88:2461–2465. 15. Liao, R., et al. 2009. Thiopeptide biosynthesis featuring ribosomally synthesized precursor peptides and conserved posttranslational modifications. Chem. Biol. 16:141–147. 16. MacNeil, D. J., et al. 1992. Analysis of Streptomyces avermitilis genes required for avermectin biosynthesis utilizing a novel integration vector. Gene 111: 61–68. 17. Morris, R. P., et al. 2009. Ribosomally synthesized thiopeptide antibiotics targeting elongation factor Tu. J. Am. Chem. Soc. 131:5946–5955. 18. Ohnishi, Y., et al. 2008. Genome sequence of the streptomycin-producing microorganism Streptomyces griseus IFO 13350. J. Bacteriol. 190:4050–4060. 19. Ohnishi, Y., H. Yamazaki, J. Y. Kato, A. Tomono, and S. Horinouchi. 2005. AdpA, a central transcriptional regulator in the A-factor regulatory cascade that leads to morphological development and secondary metabolism in Streptomyces griseus. Biosci. Biotechnol. Biochem. 69:431–439. 20. Ohnishi, Y., S. Kameyama, H. Onaka, and S. Horinouchi. 1999. The A-factor regulatory cascade leading to streptomycin biosynthesis in Streptomyces
J. BACTERIOL.
21.
22. 23.
24.
25.
26.
27.
griseus: identification of a target gene of the A-factor receptor. Mol. Microbiol. 34:102–111. Oman, T. J., and W. A. van der Donk. 2010. Follow the leader: the use of leader peptides to guide natural product biosynthesis. Nat. Chem. Biol. 6:9–18. Pag, U., and H. G. Sahl. 2002. Multiple activities in lantibiotics—models for the design of novel antibiotics? Curr. Pharm. Des. 8:815–833. Sambrook, J., E. F. Fritch, and T. Maniatis. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Schmidt, E. W., et al. 2005. Patellamide A and C biosynthesis by a microcinlike pathway in Prochloron didemni, the cyanobacterial symbiont of Lissoclinum patella. Proc. Natl. Acad. Sci. U. S. A. 102:7315–7320. Takano, E., et al. 2003. A rare leucine codon in adpA is implicated in the morphological defect of bldA mutants of Streptomyces coelicolor. Mol. Microbiol. 50:475–486. Wieland-Brown, L. C., M. G. Acker, J. Clardy, C. T. Walsh, and M. A. Fischbach. 2009. Thirteen posttranslational modifications convert a 14-residue peptide into the antibiotic thiocillin. Proc. Natl. Acad. Sci. U. S. A. 106:2549–2553. Yamazaki, H., A. Tomono, Y. Ohnishi, and S. Horinouchi. 2004. DNAbinding specificity of AdpA, a transcriptional activator in the A-factor regulatory cascade in Streptomyces griseus. Mol. Microbiol. 53:555–572.
