Blockade of Airway Inflammation and Hyperresponsiveness by ...

2 downloads 16 Views 2MB Size Report
May 15, 2009 - 2. ABSTRACT. BLT2 is a low-affinity receptor for leukotriene B4, a potent lipid mediator of inflammation generated from arachidonic acid via the ...

Page 1 of 43 AJRCMB Articles in Press. Published on May 15, 2009 as doi:10.1165/rcmb.2008-0445OC

Blockade of Airway Inflammation and Hyperresponsiveness by  Inhibition of BLT2, a Low‐affinity Leukotriene B4 Receptor     

Kyung‐Jin Cho1, Ji‐Min Seo1, YoungHyun Shin1, Min‐Hyuk Yoo2, Choon‐Sik Park3, Shin‐ Hwa Lee3, Yoon‐Seok Chang4, Sang‐Heon Cho4, and Jae‐Hong Kim1¶    Running title: The leukotriene B4 receptor, BLT2, in allergic airway disease    Key words: Allergy, Asthma, Lipid mediator, Inflammation, ROS, NF‐κB    1

School of Life Sciences and Biotechnology, Korea University, Seoul 136‐701; 2Center for 

Cancer Research, National Institutes of Health, Bethesda, MD 20892, USA;  3Division of  Allergy and Respiratory Diseases, Soonchunhyang University, Bucheon, 420‐767, Korea;  4

Department of Internal Medicine, Seoul National University College of Medicine, Seoul, 

110‐799    ¶

Correspondence and requests for reprints should be addressed to Jae‐Hong Kim, PhD, 

School of Life Sciences and Biotechnology, Korea University, 5‐1 Anam dong, Sungbuk‐ gu, Seoul, 136‐701, Korea.    E‐mail address: [email protected] Phone: 82‐2‐3290‐3452 Fax: 82‐2‐3290‐3938    Sources of Support: This work was supported by the New Drug Target Discovery grant,  the  Diseases  Network  Research  Program  grant,  and  the  KICOS  project  grant  (Bathel‐ Korea University) from the Korean Ministry of Education, Science and Technology. 

1

Copyright (C) 2009 by the American Thoracic Society.

Page 2 of 43

ABSTRACT    BLT2 is a low‐affinity receptor for leukotriene B4, a potent lipid mediator of inflammation  generated  from  arachidonic  acid  via  the  5‐lipoxygenase  (5‐LO)  pathway.  Unlike  BLT1,  a  high‐affinity  receptor  for  leukotriene  B4,  no  clear  physiological  function  has  yet  been  identified for BLT2, especially with regard to the pathogenesis of asthma. The aim of this  study  was  to  investigate  whether  BLT2  plays  a  role  in  the  pathogenesis  of  asthma.  A  murine  model  of  allergic  asthma  was  used  to  evaluate  the  role  of  BLT2  in  ovalbumin‐ induced  airway  inflammation  and  airway  hyperresponsiveness. The  levels  of  BLT2  mRNA  and  its  ligand,  leukotriene  B4,  in  the  lung  airway  were  highly  elevated  after  OVA  challenge,  and  downregulation  of  BLT2  with  antisense  BLT2  oligonucleotides  markedly  attenuated  airway  inflammation  and  airway  hyperresponsiveness.  Further  analysis,  aimed at identifying mediators downstream of BLT2, revealed that BLT2 activation led to  elevation  of reactive  oxygen species and subsequent activation  of  NF‐κB,  thus inducing  the expression  of VCAM‐1,  which is  known  to be involved  in eosinophil  infiltration  into  the lung airway. Together, our results suggest that BLT2 plays a pivotal, mediatory role in  the  pathogenesis  of  asthma,  acting  through  a  ‘reactive  oxygen  species‐NF‐κB’‐linked  inflammatory signaling pathway.                2

Page 3 of 43

INTRODUCTION    Leukotriene B4 (LTB4) is a key mediator of inflammatory processes, immune responses,  and  host  defense  against  infection  (1‐4).  It  stimulates  chemotaxis,  degranulation,  release of lysosomal enzymes, and the production of reactive oxygen species (ROS) (5‐ 7).  In  fact,  LTB4  is  one  of  the  most  potent  chemoattractants  known,  recruiting  granulocytes, monocytes, and effector CD4+ and CD8+ T lymphocytes to sites of acute  inflammation  (8‐15).  It  also  promotes  cell  adhesion  to  vascular  endothelial  cells  and  transmigration  (8,  16),  which  amplifies  inflammatory  early  responses.  Recently,  LTB4  was  shown  to  be  involved  in  a  number  of  human  inflammatory  diseases,  including  asthma  (17‐20),  a  chronic  inflammatory  disease  of  the  airway  characterized  by  eosinophilic infiltration, mucus hypersecretion and airway hyperresponsiveness (AHR).  Significantly  elevated  levels  of  LTB4  were  detected  in  the  airways  of  patients  with  asthma, as well as in experimental models of asthma (20).  LTB4 produces its biological effects via specific G protein‐coupled receptors known as  BLT1 and BLT2 (21‐24). To date, most studies of LTB4 receptors have focused on BLT1, a  high‐affinity LTB4 receptor expressed exclusively in leukocytes, with particular attention  to  its  role  in  inflammatory  responses  (22).  For  example,  early  recruitment  of  neutrophils  and  eosinophils  into  the  airways,  in  response  to  allergen  inhalation,  was  diminished in BLT1‐deficient mice (8, 25), suggesting a role for BLT1 in the chemotaxis  of granulocytes in allergic asthma. In addition, BLT1 is essential for allergen‐mediated,  early  recruitment  of  CD4+  and  CD8+  T  cells  into  the  lung  airways  and  for  the  development  of  allergen‐induced  AHR  and  inflammation  under  certain  experimental  3

Page 4 of 43

conditions (26, 27). In contrast to BLT1, BLT2 has a low affinity for LTB4 and is expressed  in a wide variety of tissues, with the highest levels in the spleen, leukocytes and ovary  (23). No clear physiological function has yet been identified for BLT2.    In this study, we investigated the role of BLT2 in the pathogenesis of asthma using a  murine  model.  By  using  a  BLT2  antagonist  or  antisense strategy  to  block  endogenous  BLT2  expression,  we  demonstrated  that  BLT2  plays  a  critical,  pathological  role  in  the  development  of  AHR  and  airway  inflammation.  In  addition, we  present  evidence  that  BLT2  can  cause  asthmatic  symptoms  by  stimulating  ROS  generation  and  subsequent  NF‐κB  activation.  Finally,  immunohistochemical  analysis  of  clinically  diagnosed  asthmatic  subjects  revealed  a  significant  elevation  in  BLT2  expression,  mainly  in  the  airway epithelial layers and in the microvascular endothelium. This pattern was similar  to that observed in the murine model of asthma.   

                   

4

Page 5 of 43

MATERIALS AND METHODS    Sensitization and Challenge of Mice  Female  BALB/c  mice  and  C57BL/6  mice  (7  weeks  old;  18  ‐  20  g)  were  obtained  from  Orientbion Inc. (Seoungnam, Korea). All experiments were performed with the BALB/c  mouse  model, except  for  antisense experiments,  which  were  done  using  the  C57BL/6  mouse model. Sensitization and challenge were carried out as described previously, but  with  some  modifications  (28).  Briefly,  female  C57BL/6  mice  were  immunized  by  intraperitoneal  (i.p.)  injection  of  200  μg  ovalbumin  (OVA)  emulsified  in  2.5  mg  of  adjuvant  aluminum  hydroperoxide  gel  (alum)  (Pierce,  Rockford,  IL).  A  second  i.p.  injection  of  20  μg  OVA  adsorbed  onto  alum  (2.5  mg)  was  administered  10  days  later.  After an additional 10 days, mice were exposed to an aerosol of 1% OVA in saline for 30  min  daily  on  3  consecutive  days.  On  day  25,  mice  were  finally  challenged  by  provocation  with  10%  OVA  aerosol.  For  inhibition  experiments,  sense  (5’‐ GGAATGAGACACTACTGAGC‐3') or antisense (5’‐GCTCAGTAGTGTCTCATTCC‐3’) BLT2 (1.6  mg/kg)  was  injected  intravenously  24  h  and  then  1  h  before  the  10%  OVA  challenge.  The  mice  were  then  killed  on  day  27  to  assess  asthmatic  phenotypes.  Alternatively,  BALB/c mice were sensitized on day 1 by i.p. injection of 20 μg OVA emulsified in 2.5  mg  of  alum  (Pierce,  Rockford,  IL),  followed  by  an  identical  booster  injection  administered on day 14. On days 21, 22 and 23 after initial sensitization, the mice were  challenged  for  30  min  with  an  aerosol  of  1%  OVA  using  an  ultrasonic  nebulizer.  LY255283  (5  mg/kg,  Cayman)  or  vehicle  control  (DMSO)  was  administered  intravenously  1  h  before  1%  OVA  challenge.  Mice  were  killed  on  day  25  to  assess  asthmatic  phenotypes.  All  experimental  animals  used  in  this  study  were  treated  5

Page 6 of 43

according to guidelines approved by the Institutional Animal Care and Use Committee  of Korea University.    Semiquantitative RT‐PCR  Total RNA was extracted using Easy BlueTM (Intron Company, Korea), after which 2 μg  of the extracted RNA was reverse‐transcribed using M‐MLV reverse transcriptase. For  the  semiquantitative  analysis  of  transcripts,  we  first  determined  the  optimal  PCR  conditions  for  the  linear  amplification  of  GAPDH.  The extracted  RNA  (1 μg)  was  then  reverse‐transcribed  for  1  h  at  42°C  and  amplified  by  PCR  with  specific  primers  for  mouse BLT2 5’‐CAGCATG TACGCCAGCGTGC‐3’(forward), 5’‐CGATGGCGCTCACCAGACG‐ 3’(reverse), or BLT1 5’‐GCATGTCCCTGTCTCTGTTG‐3’(forward), 5’‐CGGGCAAAGGCCTTA  GTACG‐3’(reverse).    Real‐time PCR  For real‐time PCR, total RNA was extracted from lungs using Easy‐blue RNA extraction  reagent (Intron). The extracted RNA was then reverse‐transcribed using M‐MLV reverse  transcriptase  (Invitrogen,  CA).  For  real‐time  PCR  reactions,  the  LightCycler  480  SYBR  Green  I  Master  (Roche,  Germany)  was  used  according  to  the  manufacturer’s  instructions.    In situ hybridization for BLT2 in mouse  The  cDNA  for  mouse  BLT2  was  amplified  by  PCR  with  the  mouse  BLT2  primers  and  confirmed  by  sequencing.  All  linearized  vectors  were  transcribed  with  T7  RNA 

6

Page 7 of 43

polymerase  and  digoxigenin  (DIG)  RNA  labeling  mix  (Roche,  Germany).  Embedded  mouse  lung  tissues  were  deparaffinized  with  xylene,  after  which  in  situ  hybridization  was carried out using an in situ hybridization detection kit (InnoGenex, CA), according  to the manufacturer’s protocol.      Quantification of LTB4    Levels  of  LTB4  were  quantified  with  the  leukotriene  B4  enzyme  immunoassay  (EIA)  BiotrakTM  system  (Amersham  Biosciences,  UK).  Briefly,  200  μl  bronchoalveolar  lavage  fluid  (BALF)  was  concentrated  by  freeze‐drying  for  12  h  and  reconstituted  in  assay  buffer. The sensitivity of the assay was 0.3 pg/ ml and was equivalent to 6 pg/ml.    BALF and histological analysis of lung  Inflammatory cells in the BALF were collected by centrifugation (1,000 g for 3 min) and  washed  once  in  PBS.  Cells  were  counted  using  a  hemocytometer,  and  viability  was  assessed by trypan blue dye exclusion. In addition, a cytospin was carried out for each  BALF  sample,  which  was  then  stained  with  Diff‐Quick  (Merck,  Dorset,  U.K.),  enabling  differential  cell  counts  to  be  made.  Multiple  paraffin‐embedded  6‐μm  sections  were  placed  on  0.5%  gelatin‐coated  slides,  deparaffinized,  and  stained  with  hematoxylin‐ eosin (H&E).    A  quantitative  analysis  of  histology  was  employed  to  measure  the  degree  of  inflammation  by  five  independent  blinded  investigators.  The  degree  of  peribronchial  and perivascular inflammation was evaluated on a subjective scale of 0∼3, as described  elsewhere (1, 2). Grade 0 was designated as ‘no inflammation detectable,’ grade 1 was 

7

Page 8 of 43

given  when  occasional  cuffing  with  inflammatory  cells  occurred,  grade  2  was  given  when most bronchi or vessels were surrounded by a thin layer (one to five cells thick)  of  inflammatory  cells,  and  grade  3  was  given  when  most  bronchi  or  vessels  were  surrounded by a thick layer (more than five cells thick) of inflammatory cells. Total lung  inflammation  was  defined  as  the  average  of  the  peribronchial  and  perivascular  inflammation scores. Images were acquired using a BX51 microscope (Olympus, Tokyo,  Japan) equipped with a DP71 digital camera (Olympus, Tokyo, Japan).      Determination of AHR in response to methacholine  AHR was measured in unrestrained, conscious mice 24 h after the final OVA challenge,  using  a  whole‐body  plethysmograph  as  previously  described  (29).  Aerosolized  methacholine in increasing concentrations (from 6.25 mg/ml‐50 mg/ml) was nebulized  through an inlet of the main chamber for 3 min. Readings were taken and averaged for  3  min  after  each  nebulization,  and  the  enhanced  pause  (Penh)  was  determined.  Additionally, airway function was also assessed by measuring changes in lung resistance  (RL)  and  dynamic  compliance  (Cdyn)  in  response  to  increasing  doses  of  inhaled  methacholine, as previously described (25).    Measurement of ROS levels in BALF  ROS  levels  in  BALF  were  measured  as  a  function  of  DCF  fluorescence,  as  described  previously (29).      Flow cytometric analysis of cells in BALF and measurement of cytokines 

8

Page 9 of 43

For  flow  cytometric  analysis,  the  cells  in  the  BALF  were  suspended  in  50  μl  of  PBS  containing  0.01%  sodium  azide  and  0.1%  BSA.  BAL  leukocytes  were  incubated  for  30  min with 2.4G2 anti‐FcγRIII/II receptor (BD Pharmingen) and stained for 30 min at 4°C  with  FITC‐conjugated  anti‐mouse  TCR‐β  chain,  PE‐Cy5  anti‐mouse  CD8a    and  PE‐ conjugated  rat  anti‐mouse  CD4,  as  well  as  with  isotype  controls  (BD  Pharmingen).  Cytofluorimetry was performed with a FACS CaliburTM (Becton Dickinson, Franklin Lakes,  NJ),  and  the  results  were  analyzed  with  CellQuest  software  (Becton‐Dickinson).  Cytokine  concentrations  in  the  BALF  supernatants  were  measured  by  enzyme‐linked  immunosorbent  assay  kits  (BioSource  International,  Camarillo,  CA)  according  to  the  manufacturer's instructions.       Bronchoscopy  Bronchial  biopsy  specimens  were  obtained  from  4  nonasthmatic  controls  (normal),  4  mild  bronchial  asthma  patients  and  5  moderate  bronchial  asthma  patients.  The  patients studied were recruited from the outpatient clinic of Soonchunhyang University  Hospital,  Korea.  The  subjects  in  the  nonasthmatic  control  group  had  no  history  of  broncho‐pulmonary disease and had a predicted FEV1 > 80% and an FEV1/FVC% > 70%.  The  mild  bronchial  asthmatic  group  had  an  FEV1  >  70%,  and  the  moderate  bronchial  asthmatic  group  had  an  FEV1 

Suggest Documents