Page 1 of 43 AJRCMB Articles in Press. Published on May 15, 2009 as doi:10.1165/rcmb.2008-0445OC
Blockade of Airway Inflammation and Hyperresponsiveness by Inhibition of BLT2, a Low‐affinity Leukotriene B4 Receptor
Kyung‐Jin Cho1, Ji‐Min Seo1, YoungHyun Shin1, Min‐Hyuk Yoo2, Choon‐Sik Park3, Shin‐ Hwa Lee3, Yoon‐Seok Chang4, Sang‐Heon Cho4, and Jae‐Hong Kim1¶ Running title: The leukotriene B4 receptor, BLT2, in allergic airway disease Key words: Allergy, Asthma, Lipid mediator, Inflammation, ROS, NF‐κB 1
School of Life Sciences and Biotechnology, Korea University, Seoul 136‐701; 2Center for
Cancer Research, National Institutes of Health, Bethesda, MD 20892, USA; 3Division of Allergy and Respiratory Diseases, Soonchunhyang University, Bucheon, 420‐767, Korea; 4
Department of Internal Medicine, Seoul National University College of Medicine, Seoul,
110‐799 ¶
Correspondence and requests for reprints should be addressed to Jae‐Hong Kim, PhD,
School of Life Sciences and Biotechnology, Korea University, 5‐1 Anam dong, Sungbuk‐ gu, Seoul, 136‐701, Korea. E‐mail address:
[email protected] Phone: 82‐2‐3290‐3452 Fax: 82‐2‐3290‐3938 Sources of Support: This work was supported by the New Drug Target Discovery grant, the Diseases Network Research Program grant, and the KICOS project grant (Bathel‐ Korea University) from the Korean Ministry of Education, Science and Technology.
1
Copyright (C) 2009 by the American Thoracic Society.
Page 2 of 43
ABSTRACT BLT2 is a low‐affinity receptor for leukotriene B4, a potent lipid mediator of inflammation generated from arachidonic acid via the 5‐lipoxygenase (5‐LO) pathway. Unlike BLT1, a high‐affinity receptor for leukotriene B4, no clear physiological function has yet been identified for BLT2, especially with regard to the pathogenesis of asthma. The aim of this study was to investigate whether BLT2 plays a role in the pathogenesis of asthma. A murine model of allergic asthma was used to evaluate the role of BLT2 in ovalbumin‐ induced airway inflammation and airway hyperresponsiveness. The levels of BLT2 mRNA and its ligand, leukotriene B4, in the lung airway were highly elevated after OVA challenge, and downregulation of BLT2 with antisense BLT2 oligonucleotides markedly attenuated airway inflammation and airway hyperresponsiveness. Further analysis, aimed at identifying mediators downstream of BLT2, revealed that BLT2 activation led to elevation of reactive oxygen species and subsequent activation of NF‐κB, thus inducing the expression of VCAM‐1, which is known to be involved in eosinophil infiltration into the lung airway. Together, our results suggest that BLT2 plays a pivotal, mediatory role in the pathogenesis of asthma, acting through a ‘reactive oxygen species‐NF‐κB’‐linked inflammatory signaling pathway. 2
Page 3 of 43
INTRODUCTION Leukotriene B4 (LTB4) is a key mediator of inflammatory processes, immune responses, and host defense against infection (1‐4). It stimulates chemotaxis, degranulation, release of lysosomal enzymes, and the production of reactive oxygen species (ROS) (5‐ 7). In fact, LTB4 is one of the most potent chemoattractants known, recruiting granulocytes, monocytes, and effector CD4+ and CD8+ T lymphocytes to sites of acute inflammation (8‐15). It also promotes cell adhesion to vascular endothelial cells and transmigration (8, 16), which amplifies inflammatory early responses. Recently, LTB4 was shown to be involved in a number of human inflammatory diseases, including asthma (17‐20), a chronic inflammatory disease of the airway characterized by eosinophilic infiltration, mucus hypersecretion and airway hyperresponsiveness (AHR). Significantly elevated levels of LTB4 were detected in the airways of patients with asthma, as well as in experimental models of asthma (20). LTB4 produces its biological effects via specific G protein‐coupled receptors known as BLT1 and BLT2 (21‐24). To date, most studies of LTB4 receptors have focused on BLT1, a high‐affinity LTB4 receptor expressed exclusively in leukocytes, with particular attention to its role in inflammatory responses (22). For example, early recruitment of neutrophils and eosinophils into the airways, in response to allergen inhalation, was diminished in BLT1‐deficient mice (8, 25), suggesting a role for BLT1 in the chemotaxis of granulocytes in allergic asthma. In addition, BLT1 is essential for allergen‐mediated, early recruitment of CD4+ and CD8+ T cells into the lung airways and for the development of allergen‐induced AHR and inflammation under certain experimental 3
Page 4 of 43
conditions (26, 27). In contrast to BLT1, BLT2 has a low affinity for LTB4 and is expressed in a wide variety of tissues, with the highest levels in the spleen, leukocytes and ovary (23). No clear physiological function has yet been identified for BLT2. In this study, we investigated the role of BLT2 in the pathogenesis of asthma using a murine model. By using a BLT2 antagonist or antisense strategy to block endogenous BLT2 expression, we demonstrated that BLT2 plays a critical, pathological role in the development of AHR and airway inflammation. In addition, we present evidence that BLT2 can cause asthmatic symptoms by stimulating ROS generation and subsequent NF‐κB activation. Finally, immunohistochemical analysis of clinically diagnosed asthmatic subjects revealed a significant elevation in BLT2 expression, mainly in the airway epithelial layers and in the microvascular endothelium. This pattern was similar to that observed in the murine model of asthma.
4
Page 5 of 43
MATERIALS AND METHODS Sensitization and Challenge of Mice Female BALB/c mice and C57BL/6 mice (7 weeks old; 18 ‐ 20 g) were obtained from Orientbion Inc. (Seoungnam, Korea). All experiments were performed with the BALB/c mouse model, except for antisense experiments, which were done using the C57BL/6 mouse model. Sensitization and challenge were carried out as described previously, but with some modifications (28). Briefly, female C57BL/6 mice were immunized by intraperitoneal (i.p.) injection of 200 μg ovalbumin (OVA) emulsified in 2.5 mg of adjuvant aluminum hydroperoxide gel (alum) (Pierce, Rockford, IL). A second i.p. injection of 20 μg OVA adsorbed onto alum (2.5 mg) was administered 10 days later. After an additional 10 days, mice were exposed to an aerosol of 1% OVA in saline for 30 min daily on 3 consecutive days. On day 25, mice were finally challenged by provocation with 10% OVA aerosol. For inhibition experiments, sense (5’‐ GGAATGAGACACTACTGAGC‐3') or antisense (5’‐GCTCAGTAGTGTCTCATTCC‐3’) BLT2 (1.6 mg/kg) was injected intravenously 24 h and then 1 h before the 10% OVA challenge. The mice were then killed on day 27 to assess asthmatic phenotypes. Alternatively, BALB/c mice were sensitized on day 1 by i.p. injection of 20 μg OVA emulsified in 2.5 mg of alum (Pierce, Rockford, IL), followed by an identical booster injection administered on day 14. On days 21, 22 and 23 after initial sensitization, the mice were challenged for 30 min with an aerosol of 1% OVA using an ultrasonic nebulizer. LY255283 (5 mg/kg, Cayman) or vehicle control (DMSO) was administered intravenously 1 h before 1% OVA challenge. Mice were killed on day 25 to assess asthmatic phenotypes. All experimental animals used in this study were treated 5
Page 6 of 43
according to guidelines approved by the Institutional Animal Care and Use Committee of Korea University. Semiquantitative RT‐PCR Total RNA was extracted using Easy BlueTM (Intron Company, Korea), after which 2 μg of the extracted RNA was reverse‐transcribed using M‐MLV reverse transcriptase. For the semiquantitative analysis of transcripts, we first determined the optimal PCR conditions for the linear amplification of GAPDH. The extracted RNA (1 μg) was then reverse‐transcribed for 1 h at 42°C and amplified by PCR with specific primers for mouse BLT2 5’‐CAGCATG TACGCCAGCGTGC‐3’(forward), 5’‐CGATGGCGCTCACCAGACG‐ 3’(reverse), or BLT1 5’‐GCATGTCCCTGTCTCTGTTG‐3’(forward), 5’‐CGGGCAAAGGCCTTA GTACG‐3’(reverse). Real‐time PCR For real‐time PCR, total RNA was extracted from lungs using Easy‐blue RNA extraction reagent (Intron). The extracted RNA was then reverse‐transcribed using M‐MLV reverse transcriptase (Invitrogen, CA). For real‐time PCR reactions, the LightCycler 480 SYBR Green I Master (Roche, Germany) was used according to the manufacturer’s instructions. In situ hybridization for BLT2 in mouse The cDNA for mouse BLT2 was amplified by PCR with the mouse BLT2 primers and confirmed by sequencing. All linearized vectors were transcribed with T7 RNA
6
Page 7 of 43
polymerase and digoxigenin (DIG) RNA labeling mix (Roche, Germany). Embedded mouse lung tissues were deparaffinized with xylene, after which in situ hybridization was carried out using an in situ hybridization detection kit (InnoGenex, CA), according to the manufacturer’s protocol. Quantification of LTB4 Levels of LTB4 were quantified with the leukotriene B4 enzyme immunoassay (EIA) BiotrakTM system (Amersham Biosciences, UK). Briefly, 200 μl bronchoalveolar lavage fluid (BALF) was concentrated by freeze‐drying for 12 h and reconstituted in assay buffer. The sensitivity of the assay was 0.3 pg/ ml and was equivalent to 6 pg/ml. BALF and histological analysis of lung Inflammatory cells in the BALF were collected by centrifugation (1,000 g for 3 min) and washed once in PBS. Cells were counted using a hemocytometer, and viability was assessed by trypan blue dye exclusion. In addition, a cytospin was carried out for each BALF sample, which was then stained with Diff‐Quick (Merck, Dorset, U.K.), enabling differential cell counts to be made. Multiple paraffin‐embedded 6‐μm sections were placed on 0.5% gelatin‐coated slides, deparaffinized, and stained with hematoxylin‐ eosin (H&E). A quantitative analysis of histology was employed to measure the degree of inflammation by five independent blinded investigators. The degree of peribronchial and perivascular inflammation was evaluated on a subjective scale of 0∼3, as described elsewhere (1, 2). Grade 0 was designated as ‘no inflammation detectable,’ grade 1 was
7
Page 8 of 43
given when occasional cuffing with inflammatory cells occurred, grade 2 was given when most bronchi or vessels were surrounded by a thin layer (one to five cells thick) of inflammatory cells, and grade 3 was given when most bronchi or vessels were surrounded by a thick layer (more than five cells thick) of inflammatory cells. Total lung inflammation was defined as the average of the peribronchial and perivascular inflammation scores. Images were acquired using a BX51 microscope (Olympus, Tokyo, Japan) equipped with a DP71 digital camera (Olympus, Tokyo, Japan). Determination of AHR in response to methacholine AHR was measured in unrestrained, conscious mice 24 h after the final OVA challenge, using a whole‐body plethysmograph as previously described (29). Aerosolized methacholine in increasing concentrations (from 6.25 mg/ml‐50 mg/ml) was nebulized through an inlet of the main chamber for 3 min. Readings were taken and averaged for 3 min after each nebulization, and the enhanced pause (Penh) was determined. Additionally, airway function was also assessed by measuring changes in lung resistance (RL) and dynamic compliance (Cdyn) in response to increasing doses of inhaled methacholine, as previously described (25). Measurement of ROS levels in BALF ROS levels in BALF were measured as a function of DCF fluorescence, as described previously (29). Flow cytometric analysis of cells in BALF and measurement of cytokines
8
Page 9 of 43
For flow cytometric analysis, the cells in the BALF were suspended in 50 μl of PBS containing 0.01% sodium azide and 0.1% BSA. BAL leukocytes were incubated for 30 min with 2.4G2 anti‐FcγRIII/II receptor (BD Pharmingen) and stained for 30 min at 4°C with FITC‐conjugated anti‐mouse TCR‐β chain, PE‐Cy5 anti‐mouse CD8a and PE‐ conjugated rat anti‐mouse CD4, as well as with isotype controls (BD Pharmingen). Cytofluorimetry was performed with a FACS CaliburTM (Becton Dickinson, Franklin Lakes, NJ), and the results were analyzed with CellQuest software (Becton‐Dickinson). Cytokine concentrations in the BALF supernatants were measured by enzyme‐linked immunosorbent assay kits (BioSource International, Camarillo, CA) according to the manufacturer's instructions. Bronchoscopy Bronchial biopsy specimens were obtained from 4 nonasthmatic controls (normal), 4 mild bronchial asthma patients and 5 moderate bronchial asthma patients. The patients studied were recruited from the outpatient clinic of Soonchunhyang University Hospital, Korea. The subjects in the nonasthmatic control group had no history of broncho‐pulmonary disease and had a predicted FEV1 > 80% and an FEV1/FVC% > 70%. The mild bronchial asthmatic group had an FEV1 > 70%, and the moderate bronchial asthmatic group had an FEV1