Blockade of amiloride-sensitive sodium channels ...

Visual Neuroscience ~2005!, 22, 143–151. Printed in the USA. Copyright © 2005 Cambridge University Press 0952-5238005 $16.00 DOI: 10.10170S0952523805222034

Blockade of amiloride-sensitive sodium channels alters multiple components of the mammalian electroretinogram

LAURA M. BROCKWAY,1 DALE J. BENOS,2 KENT T. KEYSER,1 and TIMOTHY W. KRAFT 1,3 1

Vision Science Research Center, University of Alabama at Birmingham, Birmingham Department of Physiology and Biophysics, University of Alabama at Birmingham, Birmingham 3 Department of Physiological Optics, University of Alabama at Birmingham, Birmingham 2

(Received June 14, 2004; Accepted December 21, 2004!

Abstract Retinal neurons and Müller cells express amiloride-sensitive Na⫹ channels ~ASSCs!. Although all major subunits of these channels are expressed, their physiological role is relatively unknown in this system. In the present study, we used the electroretinogram ~ERG! recorded from anesthetized rabbits and isolated rat and rabbit retina preparations to investigate the physiological significance of ASSCs in the retina. Based upon our previous study showing expression of a-ENaC and functional amiloride-sensitive currents in rabbit Müller cells, we expected changes in Müller cell components of the ERG. However, we observed changes in other components of the ERG as well. The presence of amiloride elicited changes in all major components of the ERG; the a-wave, b-wave, and d-wave ~off response! were enhanced, while there was a reduction in the amplitude of the Müller cell response ~slow PIII!. These results suggest that ASSCs play an important role in retinal function including neuronal and Müller cell physiology. Keywords: Retina, Müller cell, Slow PIII, Epithelial sodium channel, Acid-sensing ion channel

cellular K⫹ concentration ~@K⫹# o ! at the outer nuclear layer ~ONL! ~Oakley & Green, 1976; Dick & Miller, 1985! due to the reduction of K⫹ efflux at photoreceptor cell bodies ~Yan & Matthews, 1992!. Müller cells respond with a K⫹ efflux near the photoreceptors distally and an extracellular current flow is established with a source at the outer limiting membrane ~OLM! and sink at the inner limiting membrane ~ILM!, creating a corneal negative ERG component of the c-wave. In addition, light causes an increase in @K⫹# o at the inner plexiform layer ~IPL! due to responses of depolarizing neurons ~Dick & Miller, 1985; Frishman & Steinberg, 1989!. Müller cells also respond to this K⫹ change through spatial buffering. We previously demonstrated the expression of amiloridesensitive Na⫹ channels ~ASSCs! in Müller cells and neurons of the rabbit retina ~Brockway et al., 2002!. ASSCs are a superfamily of nonvoltage-gated Na⫹ channels that include the mammalian epithelial Na⫹ channels ~ENaCs! and acid-sensing ion channels ~ASICs! ~Review-Kellenberger & Schild, 2002!. Despite extensive expression in the retina, their function in this system is unclear. Ettaiche et al. ~2004! recorded ERGs on ASIC2 knockout mice and observed augmented a-wave and b-wave compared to normal mice. This suggests ASIC2-containing channels are involved in photoreceptor function. In this study, we sought a better understanding of the physiological importance of ENaCs and ASICs in the retina using the ERG technique in both anesthetized rabbit and isolated retinal preparations using amiloride to block channel activity. We focused primarily on Müller cell components of the ERG c-wave due to our

Introduction The electroretinogram ~ERG! measures the light-induced field potential generated by the electrical responses of retinal cells and is characterized by three major waves, the a-wave, b-wave, and c-wave. The ERG is a clinical and diagnostic tool used in the assessment of visual function; therefore, many investigations have focused on deducing cellular mechanisms responsible for producing the ERG. Although some uncertainties exist about the underlying mechanisms for some components of the ERG, generally, it is agreed that the origin of the corneal negative a-wave ~fast PIII! arises in the photoreceptors ~Penn & Hagins, 1969!, and that activity of ON-bipolar cells underlies the corneal positive b-wave ~Stockton & Slaughter, 1989; Gurevich & Slaughter, 1993; Green & Kapousta-Bruneau, 1999!. The c-wave is a combination of K⫹ currents carried by the retinal pigment epithelium ~RPE! ~Oakley & Green, 1976! and Müller cells ~slow PIII!. There are additional minor components of the ERG, including the d-wave ~off response!, M-wave, and oscillatory potentials. Müller cell activity contributes to major portions of the ERG through K⫹ spatial buffering that redistributes extracellular K⫹ from areas of high to low concentration areas ~Newman et al., 1984; Karwoski et al., 1989!. Light elicits a decrease in extra-

Address correspondence and reprint requests to: Timothy W. Kraft, 924 18th Street South, Worrell Building, Birmingham, AL 35294-4390, USA. E-mail: [email protected]

143

144

L.M. Brockway et al.

previous study of ASSCs in these cells ~Brockway et al., 2002!. After amiloride exposure, we observed changes in the c-wave and slow PIII as well as changes in the a-wave, b-wave, and d-wave, indicating ASSCs have widespread physiological roles in the retina. Materials and methods RNA extraction and reverse transcription-polymerase chain reaction (RT-PCR) Animal care and use followed guidelines set forth by the Institutional Animal Care and Use Committee ~IACUC!, the American Physiological Society, and the Society for Neuroscience. All protocols used in these experiments were reviewed and approved by the University of Alabama at Birmingham ~UAB! IACUC. Eyes were enucleated from rats killed by an overdose of sodium pentobarbital ~Socumb; Butler, Columbus, OH!. Freshly enucleated rat eyes were quickly submerged in RNAlater ~Ambion, Austin, TX! and the retinas isolated while minimizing the amount of RPE. Subsequent RNA isolation was performed using Stratagene’s Absolutely RNA RT-PCR Miniprep kit ~LaJolla, CA!, omitting liquid nitrogen freezing. RT-PCR was performed with a one-step RT-PCR kit from Qiagen ~Valencia, CA! using subunit specific ENaC and ASIC primers ~Life Technologies, Carlesbad, CA! described in Table 1. Each reaction mixture consisted of 1–2 µg RNA, 400 µM deoxyribonucleotide triphosphates, 5–10 units RNAsin ~Promega, Madison, WI!, 2 µl enzyme solution, and 0.6 µM of each primer. The reactions were amplified with the GeneAmp PCR System 2400 ~Perkin Elmer, Boston, MA!. Reverse transcription was carried out at 508C for 30 min followed by amplification of the cDNA at 958C for 15 min followed by 35 cycles of 948C for 1 min ~denaturing!0 52– 638C for 1.5 min ~annealing!0728C for 2 min ~extension! followed by a 728C final extension for 20 min. The RT-PCR products were run on a 2% agarose gel with ethidium bromide ~Sigma, St. Louis, MO! and imaged with Eagle Eye II ~Stratagene, La Jolla, CA!. cDNA extraction was performed from the gels using QIAquick Gel Extraction Kit ~Qiagen, Valencia, CA! and sequencing was performed at the University of Alabama at Birmingham Center for AIDS Research DNA Sequencing Facility. Immunohistochemistry Eyecups were prepared by removing cornea, lens, iris, and vitreous then fixed with 2% paraformaldehyde in 0.1 M phosphate buffer ~PB! at 48C for 4 h. Retinas were then cryoprotected with 30%

sucrose-PB and embedded in 50% optimum cutting temperature ~OCT! solution ~Tissue-Tek, Torrance, CA! and 50% Aquamount ~Lerner Laboratories, Pittsburgh, PA! and cryosectioned in 10-µm slices. Slides were stored at ⫺208C until use. Sections were warmed on a warming tray for 30 min and mounting medium was removed with 3 ⫻ 5 min rinses of 0.1 M phosphate buffered saline ~PBS!. Nonspecific sites were blocked with a solution of 10% normal serum from the hosts of the secondary antibodies-PBS-0.3% Triton X-100 ~Sigma! for 1 h at room temperature ~RT!. Slides were incubated overnight at 48C in anti-a-hENaC or anti-b-hENaC antibodies ~Brockway et al., 2002! diluted 1:200 in PBS-Triton X-100 and 5% normal serum from the secondary antibodies. Fluorescein isothiocyanate ~FITC! conjugated goat anti-rabbit IgG secondary antibody ~Jackson ImmunoResearch, West Grove, PA! was diluted 1:200 in PBS-Triton X-100 with a 1 h incubation at RT. Slides were washed with PBS between steps and before coverslipping with Permafluor ~Immunon, Pittsburgh, PA!. Sections were viewed with a Leica TCS SP confocal laser scanning microscopy. Images were imported into Adobe Photoshop for figure modification. Corneal electroretinograms Rabbits were first anesthetized with xylazine ~10 mg0kg intramuscularly! and ketamine ~50 mg0kg intramuscularly! then intubated to administer a constant dose of 3% isoflurane ~Attane; Minrad, Inc., Bethlehem, PA!. Rabbits were kept warm by a heating pad ~Braintree Scientific, Braintree, MA! during recording. They were dark adapted for at least 45 min before recording. Corneas were anesthetized with 0.5% proparacaine ~Bausch and Lomb, Tampa, FL! and pupils dilated with topical 2.5 % phenylephrine HCl ~Bausch and Lomb! and 1% tropicamide ~Alcon Laboratories, Inc., Fort Worth, TX!. In addition, a solution of 2.5% methylcellulose ~Goniosol, CIBA Vision Corp., Duluth, GA! was used during and after the recording session to keep the corneas moist until the animal recovered from anesthesia and 0.3% gentamicin sulfate ointment ~Gentak, Akorn, Inc., Buffalo Grove, IL! was also applied to the eyes after the recording session. 24 µl of 5 mM amiloride ~Sigma! dissolved in distilled, deionized water was injected in the right eye using a microsyringe attached to a 26-gauge needle. Assuming a vitreal volume of 1.2 ml ~Dong & Hare, 2002!, and a uniform distribution within this volume, the final stirred vitreal concentration of amiloride would have been 100 µM. 100 µM amiloride was chosen in all ERG experiments based on our previous study showing this was the most consistently effective concentration to block inward currents in Müller cells ~Brockway et al., 2002!. To serve as a control, the right eye

Table 1. Primers used for RT-PCR

Subunit

Coding region

Product ~bp!

Sense primer ~5 ' –3 ' !

Antisense Primer ~5 ' –3 ' !

a b g ASIC1 ASIC2 ASIC3 ASIC4

258–588 758–1323 1274–1834 381–727 1040–1464 219–811 1030–1363

331 566 561 346 424 592 333

ttctgcaacaacaccaccat ctgcagtcatcggaacttca ctaccagcaacaccccaact cagatggctgatgaaaagca cggtctactggcagaaaagg taagaccaccctggatgagc tctgcccgccaaatatctac

cctggcgagtgtaggaagag acatgctgaggcaggtctct aggcgcatagcagaggtaaa gcttcgaaggatgtctcgtc agtggtttggcattgtgtca gctgctgacaggacacaaaa atgctagccccaatgaacag

ERG analysis of amiloride-sensitive channels

Fig. 1. Diagram of the rabbit ERG electrode. The back end of the electrode was hollowed out to receive a fiber optic. A platinum wire loop was glued to the circumference of the Plexiglas cone. The vertical post is used to position the electrode perpendicular to optical axis of the eye. All dimensions are given in centimeters.

was injected in the same manner with 24 µl water. ERGs were recorded preinjection and 1–2 h postinjection and the animals were allowed to recover from anesthesia and returned to the animal facility. After 3 days, ERGs were again recorded and, subsequently, they were killed with an overdose of sodium pentobarbitol. An electrode designed after that described by Lyubarsky and Pugh ~1996! was placed on both eyes. Because of the large diameter of the electrode contacting the cornea ~0.8 cm!, an internal radius was added to act as a diverging lens ~Fig. 1!. A platinum wire loop was affixed to the tapered end of a Plexiglas rod that had been hollowed out to receive the fiber optic that delivered the light stimulus. This arrangement was designed to ensure a constant distance between the fiber optic and the eye and to act as a diffusing element. A second identical setup was placed on the other eye and served as the neutral electrode. To record the ERG from the control eye, the fiber optic was simply removed from one electrode holder and placed into the other. Responses were amplified 5000⫻ under D.C. conditions using an amplifier ~Astro-med CP122W; Grass Telefactor, W. Warwick, RI!. The ERG voltage and stimulus-monitor signals were digitized with hardware ~MIO16! and software ~LabView! from National Instruments ~Austin, TX!. Data were digitized at 1000 Hz.

Isolated retinal preparation Rabbits and rats were dark adapted for at least 45 min prior to the start of the experiment and all steps of the experiments were carried out in the dark using infrared ~IR! image converters ~Dark Invader, BE Meyers Inc., Redmond, WA! attached to the dissecting microscope eyepieces. Rats were killed using carbon dioxide asphyxiation and rabbits using an overdose of sodium pentobarbital. Eyes were enucleated using IR-sensitive goggles ~AN0PVS-5 Nightvision Goggles!, eyecups were prepared in Leibovitz L-15 medium ~Gibco, Invitrogen Corp., Carlesbad, CA! as described above, and neural retinas teased away from the RPE. Retinas were placed into an Ussing chamber ~World Precision Instruments, Sarasota, FL! with the ganglion cell layer ~GCL! side facing a 0.2-µm filter and photoreceptor side facing the light source. The chamber was modified to receive the fiber optic at one end. The Ussing chamber was attached to a perfusion system that

145 allowed a flow of warm, bubbled ~95% O2 05% CO2 ! Ames’ medium at a rate of approximately 1 ml0min. Medium was maintained at physiological temperature using water jacketed beakers ~Radnoti, Glass Technology Inc., Monrovia CA! heated using a power supply ~VWR Scientific Products, Suwanee, GA! connected to a heated delivery line ~Topward Electronic Instruments Co., Ltd., San Jose, CA!. The temperature was calibrated at the retina location to 378C. Electrodes connected to the Ussing chamber consisted of Ag0 AgCl pellets. Two perfusion lines were fed to the Ussing chamber. One line delivered control medium at the photoreceptor side and a second line fed to the ganglion cell side could be switched between control medium and medium containing amiloride. After recording baseline responses, test medium containing 100 µM amiloride was perfused onto the ganglion cell side of the tissue and responses recorded. Subsequently, the perfusate was switched back to control solution and washout responses were recorded. We performed two types of experiments, the first looking at the a-wave, b-wave, slow PIII, and d-wave components of the ERG. In a second set of experiments, synaptic transmission was blocked specifically to examine the PIII component. Synaptic transmission was blocked from photoreceptors to second-order neurons by adding 7.5 mM aspartate to the medium. In these cases, retinas not used immediately were stored in a light-tight chamber at 48C. Due to their larger size, rabbit retinas were cut into several pieces. Rat tissue was used in experiments without aspartate and these retinas were always used immediately. Statistical significance was tested using t-test assuming equal variances. In experiments without aspartate, comparisons were made from baseline. In experiments with aspartate, comparisons were made between amiloride-treated tissue and control tissue at each time point. Stimulus The light source was a 100-W tungsten-halogen lamp focused onto one end of a fiber optic. Stimulus duration was controlled with a shutter with a 6-mm aperture ~Uniblitz; Vincent Associates, Rochester, NY!. We used a 505-nm ~35-nm bandwidth! stimulus that was determined by a three-cavity interference filter ~Andover Co., Salem, NH!. The energy output of the flashes was calibrated daily. Stimulus strength was controlled by a set of calibrated inconel neutral-density filters that allowed attenuation in steps of approximately 0.3 log units up to a maximum of 6.9 log units attenuation. The unattenuated stimulus was calibrated daily with an optical power meter ~Graseby Optronics, Orlando, FL!. In the anesthetized rabbit ERG experiments, a stimulus set consisted of two responses, interstimulus interval ~isi! 1 min to 505-nm, 4-s step of light of zero attenuation. In the isolated retinal preparation, several stimuli were used. The a-wave, b-wave, slow PIII, and d-wave were elicited using using a 505-nm, 4-s dim step of light; two responses were averaged per trial ~isi 14 s!. Dim and moderate intensity and 2-ms flashes ~isi 4.2 s! elicited a-wave and b-waves and the Müller cell component of the c-wave. In experiments using aspartate, PIII was elicited using a 505-nm, 2-ms bright flash of light of zero attenuation and two responses per trial were averaged ~isi 10 s!. The energy of the light stimulus was converted to stimulus strength ~photons0µm 2 ! incident at cornea or isolated sheet of retina. For the isolated tissue experiments the number of photoisomerizations, R*, is given by the product of the of stimulus strength, i ~photons per square micrometer at l max !, and A c , the

146


effective collecting area of the outer segment, calculated using the equation by Baylor et al. ~1984! and Zhang et al. ~2003!: A c ⫽ VOS Qisom f 2.303a, where VOS is the volume of the outer segment; Qisom is the quantum efficiency of photoisomerization ~0.67! ~Dartnall, 1972!; f is a factor allowing for the use of unpolarized light entering the outer segment perpendicular to its long axis ~ f ⫽ 1 for end-on stimulus!; and a is the specific pigment density ~0.016 µm⫺1 ! ~Bowmaker et al., 1980!. Based on volume measures from singlecell recordings, rat rods have an A c of 0.492 ~D. Niculescu & T.W. Kraft, personal communication!. The volume of the rabbit rod outer segments was calculated as 27.2 µm 3 using the length of 15.4 µm reported by Tucker et al. ~1982! and assuming a diameter of 1.5 µm, giving an A c of 0.672 for rabbit rods. Results

anesthetized rabbits before and after intravitreal injections of amiloride in one eye and water in the contralateral eye using the electrode setup diagramed in Fig. 1. The D.C. recording was optimized to observe the slower components, the b-wave and c-wave. Fig. 4 shows results demonstrating the effects of 100 µM amiloride on the ERG response to bright steps of light. The c-wave amplitude was calculated from baseline to the highest point on the c-wave trace. In two rabbits, the c-wave of the corneal ERG was reduced in amplitude 1–2 h after amiloride injection. After 3 days, the c-wave was diminished substantially to approximately 50% of the preinjection baseline. In the control eye injected with water, there was no significant change in ERGs. In a third rabbit, the c-wave was reduced after 2 h but it recovered to baseline after 3 days. For all three animals, the b-wave increased in amplitude to 121% in the amiloride-treated eye after 2 h, whereas the b-wave declined in all of the control eyes to 88%. Overall, the data indicated that the introduction of amiloride into the vitreous of rabbits was associated with dramatically diminished c-wave amplitude and an enhancement of the b-wave amplitude.

RT-PCR reveals the expression of ASSCs in the rat retina In this study, both rabbit and rat retinas were used in ERG experiments, therefore, we carried out experiments to confirm that rat retina also expresses ASSCs. RT-PCR using rat retina RNA and subunit specific primers demonstrated mRNA expression of a-, b-, and g-ENaC and ASICs 1– 4. Fig. 2 shows the agarose gel of the RT-PCR products for each subunit. Direct DNA sequencing of the RT-PCR products for a-, b-, and g-ENaC and ASICs 1– 4 confirmed their identities. Anti-a-ENaC localized to Müller cells and anti-b-ENaC localized to retinal neurons Fig. 3 illustrates the distribution of a-ENaC and b-ENaC immunoreactivity. Consistent with the expression pattern in rabbit retina, a-ENaC labeling was specific for Müller glia while b-ENaC localized to neurons ~Brockway et al., 2002!. b-ENaC labeling was strongest in the GCL with weaker labeling in the inner nuclear layer ~INL! and photoreceptor outer segments. However, the secondary antibody control showed some immunoreactivity in the photoreceptor outer segments. Effects of intravitreal 100 mM amiloride on the rabbit ERG Whole-animal experiments were used to test the effects of amiloride on the in vivo c-wave. D.C. ERGs were recorded from

Fig. 2. Rat retina expresses mRNA for ASSC subunits. Agarose gel of RT-PCR products for a-, b-, and g-ENaC and ASICs 1– 4 using rat retinal RNA. Products were sequenced to confirm their identity.

Effects of 100 mM amiloride on the ERG a-wave, b-wave, d-wave, and slow PIII The isolated retinal preparation was used in order to characterize the effects of amiloride on the ERG in a situation that allowed more control of the concentration and wash-out of the drug. We used the isolated rat retinal tissue preparation to study the effects of short-term exposure of 100 µM amiloride on major components of the ERG. Both dim steps and dim or moderate flashes were used as stimuli. Using a 4-s, 505-nm, dim step of light eliciting 12.5 photoisomerizations ~R*!0s0rod, we were able to elicit the a-wave, b-wave, d-wave, and slow PIII. The c-wave is not present in the isolated retina preparation because the RPE has been removed; instead the Müller cell derived slow PIII is revealed. The a-wave was measured from baseline to the peak, and the b-wave from the peak of the a-wave to the peak of the b-wave. The slow PIII was measured from baseline to the peak of the trace. The d-wave was measured from the peak of the slow PIII to the peak of the d-wave. As the representative experiment shown in Fig. 5A demonstrates, 5 min of amiloride perfusion caused changes in all four ERG components. Two retinas from each of two rats were used and these retinas were subjected to two trials each. One retina did not produce a measurable a-wave in response to the dim steps of light, but an a-wave was observed in responses to bright flashes of light. Fig. 5B summarizes the data using the dim steps of light. On average, amiloride produced a significant increase in the a-wave amplitude ~162% SD 9%, P ⫽ 0.011, n ⫽ 2!, b-wave amplitude ~225% SD 83%, P ⫽ 0.024, n ⫽ 4!, and the d-wave ~348% SD 101%, P ⫽ 0.003, n ⫽ 4!. A smaller but significant decrease was observed in the slow PIII amplitude. This component was reduced after amiloride exposure ~72% SD 12%, P ⫽ 0.003, n ⫽ 4!. We calculated the time constant of recovery ~t! for slow PIII; t was increased after amiloride ~134% SD 16%, P ⫽ 0.025, n ⫽ 4! and recovered ~119% SD 23%, P ⫽ 0.191, n ⫽ 4!. In all cases, an average of 12 min of washout allowed the responses to recover to baseline. Therefore, not only does amiloride cause a reduction in slow PIII but major changes also occur in the a-wave, b-wave, and d-wave. The responses to dim and moderate intensity flashes verified the effects of amiloride on the a-wave and b-wave in the isolated

ERG analysis of amiloride-sensitive channels

147

Fig. 3. Localization of a-ENaC and b-ENaC in the rat retina by immunofluorescence. Anti-a-hENaC was immunoreactive to Müller cells while anti-b-hENaC localized to neurons predominately in the GCL. The secondary antibody ~28! displayed minor immunoreactivity to the outer segments. Retinal layers are labeled for reference: photoreceptor outer segments ~OS!, outer nuclear layer ~ONL!, outer plexiform layer ~OPL!, inner nuclear layer ~INL!, inner plexiform layer ~IPL!, and ganglion cell layer ~GCL!. Scale bar ⫽ 40 µm.

tissue. Both the a-wave and b-wave responses to brief, dim flashes ~eliciting 0.33 R*0rod0flash! were increased approximately 40% and 60%, respectively, in the presence of amiloride. Similarly, moderate intensity flashes ~eliciting 11 R*0rod0flash! produced larger amplitude a- and b-waves in the presence of amiloride, 20% and 200%, respectively. Thus, every application of amiloride produced an increase in the a-wave and b-wave, and as the responses to steps of light show, amiloride increased the d-wave and reduced the slow PIII.

100 mM amiloride decreased the amplitude of PIII in the isolated retinal ERG In a second set of retinal tissue ERGs, aspartate was used to isolate PIII by inhibiting synaptic transmission from photoreceptors to second-order neurons. This left the combined a-wave ~fast PIII! and slow PIII responses intact. 2-ms bright flashes of light elicited 190–390 R*0rat rod and 260–530 R*0rabbit rod recorded under D.C. conditions. This rod-saturating stimulus was used to produce

Fig. 4. The effects of 100 µM amiloride on the rabbit ERG. Representative ERG traces recorded 1–2 h postinjection and 3 days postinjection from a rabbit eye stimulated by a fiber optic delivering 505-nm, 4-s bright step of light consisting of 2.8 ⫻ 10 7 photons0µm 20s. One eye was injected intravitreally to produce a final concentration of 100 µM amiloride ~A! and the contralateral eye was injected with water ~B!. Amiloride elicited a decrease in the amplitude of the c-wave after 1 h and a further reduction in 3 days to approximately 50%. No significant change in the ERG in the water-injected eye. Each trace is an average of 4–7 responses. Bottom bar indicates the duration of the light stimulus.

148


Fig. 5. 100 µM amiloride caused an increase in the amplitudes of the ERG a-wave, b-wave, and d-wave and a reduction in the amplitude of the slow PIII in isolated rat retinal preparations. A: ERG traces from a rat retina exposed to 5 min of 100 µM amiloride. Each trace is an average of two responses to a 4-s dim step of light eliciting 12.5 R*0s0rod in this isolated tissue. The ERG shows the reduced slow PIII amplitude ~thin grey trace! after amiloride exposure that returns to baseline ~thick grey trace! after washout. The insets below the graph show the a-wave, b-wave, and d-wave on an expanded time axis. The a-wave, b-wave, and d-wave were augmented after exposure to amiloride and recovered to baseline after washout. B: Summary of the data. Amiloride produced an increase in a-wave amplitude by 162% SD 9%, an increase in b-wave by 225% SD 83%, and an increase in the d-wave by 348% SD 101% compared to baseline. The c-wave amplitude was reduced to 72% SD 12% of baseline. *: P ⬍ 0.05

ERG analysis of amiloride-sensitive channels a large and distinct slow PIII whose recovery time constant could easily be measured. Responses were recorded after 15 and 30 min of amiloride exposure and 15–30 min of washout with control medium. Perfusion of 100 µM amiloride decreased the PIII response amplitude after 15 min ~81% SD 13%, P ⫽ 0.069, n ⫽ 8!. A significant reduction was observed at 30 min of amiloride ~71% SD 17%, P ⫽ 0.035, n ⫽ 5! as shown in Fig. 6A ~light grey trace!. There was no recovery of slow PIII amplitude after washout ~Fig. 6A, dark grey trace!. After 15 min of washout, PIII amplitude remained diminished ~73% SD 13%, P ⫽ 0.011, n ⫽ 6! and also at 30 min of washout ~75% SD 15%, P ⫽ 0.188, n ⫽ 3!. Measurements of t showed a small but significant increase after 30 min of amiloride ~111% SD 10%, P ⫽ 0.042, n ⫽ 6! and t recovered after 30 min of washout ~101% SD 5%, P ⫽ 0.699, n ⫽ 4!. Control tissue that was never exposed to amiloride gave constant amplitude responses over the 60–90 min recording period ~Fig. 6B!. Thus, retinas exposed to 100 µM amiloride for greater than 15 min produced a slower and smaller PIII response. After 30 min of washout the time constant of the PIII had reverted, but the amplitude was unchanged.

Fig. 6. 100 µM amiloride reduced the amplitude of the isolated PIII response in the retinal tissue preparation. ERG responses were elicited by brief ~2 ms!, bright flashes. A: Tissue exposed to amiloride; the stimulus produced 260 R*0s0rod. B: In control experiments of the same duration, amplitudes were unchanged over time ~284 R*0s0rod!.

149 Discussion The aim of this work was to assess the physiological significance of amiloride-sensitive Na⫹ channels in the retina using ERG analysis. We show here that ASSCs do, in fact, play significant roles in retinal function. We previously demonstrated extensive expression of ASSC mRNA and protein in the rabbit retina as well as functional amiloride-sensitive currents in Müller glia ~Brockway et al., 2002!. In this study both rabbit and rat retinas were used, therefore, we confirmed that rat retinal neurons and glia express ASSCs. The immunohistochemical data revealed that the expression patterns of a-ENaC and b-ENaC in rat retina are similar to rabbit ~Brockway et al., 2002!. Specifically, a-ENaC expression was observed in Müller glia in both species. This pattern of a-ENaC immunoreactivity differs from Mirshahi et al. ~1999! and may be due to differences in antibodies or tissue fixation. We previously demonstrated the specificity of our antia-ENaC antibody through biochemical experiments using in vitro translated a- and b-ENaC protein as well as abg-ENaC-expressing Madin-Darby canine kidney ~MDCK! cells ~Brockway et al., 2002!. In addition, Müller cell expression of a-ENaC was also shown by Golestaneh et al. ~2001!. Strong b-ENaC immunoreactivity was found in the GCL and to a lesser extent in the INL. There also appears to be immunoreactivity in photoreceptor outer segments. We also show evidence for mRNA expression in rat retina for a-, b-, and g-ENaC and ASICs 1– 4. Recently, Lilley et al. ~2004! also demonstrated mRNA for ASICs 1– 4 in rat retina. Amiloride produced profound changes in the major components of the ERG in both rabbit and rat retinas. In one set of experiments, intravitreal injection of amiloride was used to assess the role of ASSCs, specifically on the slow components of the ERG. We found that a vitreal concentration of 100 µM amiloride produced an irreversible reduction in the amplitude of the ERG c-wave. Amiloride continued to have effects on retinal function after several days, perhaps due to irreversible damage to cells or an exceptionally slow clearance of amiloride from the vitreous cavity. There is general agreement that K⫹ currents carried by Müller cells and RPE together produce the c-wave; therefore, amiloride could be affecting both of these cell types. Amiloride may be affecting K⫹ channels directly as shown in studies of glioma cells ~unpublished observations!. Some ASSCs show a small permeability to K⫹ ~Waldmann et al., 1997; Chen et al., 2002; de Weille & Bassilana, 2001!. However, in whole-cell patch-clamp experiments with cultured rabbit Müller cells, outward currents were unaffected by 100 µM amiloride ~Brockway et al., 2002!, suggesting that this hypothesis may be unlikely. Nevertheless, amiloride produced a significant reduction in the ERG c-wave in vivo. In the isolated retina preparation from rat, using a 4-s dim light step, we were able to elicit the a-wave, b-wave, slow PIII, and d-wave. We observed significant and reversible effects of amiloride after several minutes of drug perfusion on all of these components. Several studies have provided evidence for the expression of ASSCs in photoreceptors ~Matsuo, 1998; Mirshahi et al., 1999; Ettaiche et al., 2004!. In our experiments, the amiloride-induced augmentation of the a-wave parallels results observed in ASIC2 knockout mice ~Ettaiche et al., 2004!. Photoreceptors respond to light with graded hyperpolarizations and a reduction in glutamate release. Therefore, the light responses of photoreceptors could be enhanced if amiloride hyperpolarizes these cells even further by blocking inward Na⫹ currents. The augmentation of the a-wave and b-wave amplitudes after amiloride exposure was verified using dim and moderate flashes of light.

150 Amiloride caused a decrease in the amplitude of slow PIII in the isolated rat ERG. The slow PIII reflects K⫹ currents carried by Müller cells in response to the distal decrease in @K⫹# o generated by light-induced photoreceptor activity. The slow PIII component was reduced after amiloride despite the increased photoreceptor response that would normally have increased Müller cell K⫹ buffering currents. In fact, the b-wave to slow PIII ratio for the responses to our stimuli increased from 0.7 under control conditions to 2.0 when amiloride was present. Blocking inward ASSC Na⫹ currents would hyperpolarize cells and, according to Newman ~1985!, hyperpolarization should increase K⫹ currents through Kir channels. Our results show just the opposite; the Müller cell-based slow PIII is reduced by amiloride. There are alternative mechanisms that could account for our result. First, amiloride may be affecting K⫹ channels directly, as suggested previously. Second, other than the expression of a-ENaC in Müller cells, the particular subunit composition of ASSC channels is unknown and they may carry a significant amount of K⫹. Na⫹-dependent processes may also be affected by blocking ASSCs. For example, the activity of the Na⫹–K⫹ pump may be reduced if inward Na⫹ movement through ASSCs is blocked and result in a reduction in K⫹ movement into the cell that may, in turn, affect K⫹ channel activity. Lastly, the increased hyperpolarization produced by blocking inward Na⫹ currents with amiloride may affect the Na⫹-HCO⫺ 3 cotransporter and change intracellular pH and intracellular pH has been shown to affect Kir activity ~Yang & Jiang, 1999!. We showed that amiloride produced a significant change in Müller cell K⫹ currents, a major function for these cells. Amiloride also caused a dramatic increase in b-wave and d-wave amplitude in our experiments. The most obvious explanation for that result is that increased light responses of photoreceptors would, in turn, increase the activity of bipolar cells. Therefore, the increased b-wave and d-wave may reflect increased synaptic activity between rods to bipolar cells and not a direct effect on bipolar cells themselves. However, electrophysiological recordings of individual bipolar cells would be necessary to determine if amiloride affects bipolar cells directly or indirectly through photoreceptor activity. Aspartate allowed the isolation of the PIII response in the outer retina by blocking synaptic transmission in the isolated retinal preparation. Perfusion of 100 µM amiloride produced a reduction in the PIII amplitude at times greater than 15 min that was not reversed by 30 min of perfusion with control solution. In control experiments, PIII amplitude remained stable in Ames’ medium during the 60-min recording period, confirming that the change we observed in retinas exposed to amiloride was not simply due to time-dependent changes in the physiology of the isolated retina preparation. In this study, our aim was to investigate the physiological significance of ASSCs in the retina using the ERG. Retinal Müller cells function in various important capacities in the retina including regulating the extracellular environment, particularly @K⫹# o . K⫹ buffering mechanisms underlie several ERG components; particularly the slow PIII that was affected by amiloride. Profound effects occurred in all major components of the ERG after retinas were exposed to amiloride, including augmentation of the a-wave, b-wave, and d-wave as well as the decrease in slow PIII. Our study provides clear demonstration of the physiological significance of ASSCs in the retina and provides insights into the contribution of these channels to the ERG. Several diseases are caused by genetic mutations in ENaCs such as hypertension ~Review; Warnock, 2001! and psuedohyperaldosteronism ~Chang et al.,

L.M. Brockway et al. 1996! and it would be interesting to know if the ERGs are abnormal in these individuals. Acknowledgments The authors would like to thank Margot Andison, Ph.D., Bob Baker, D.V.M., Sharon Tyra, and Deidre Isbell for assistance in rabbit care and development of experimental protocols in the rabbit corneal ERG experiments. We also thank Jerry Millican for making the rabbit corneal ERG electrode holder. This work was supported by National Institutes of Health grants EY10573 ~T.W.K.!, DK37206 ~D.J.B.!, and EY07845 and P30 EY03039 ~K.T.K.!.

References Baylor, D.A,. Nunn, B.J. & Schnapf, J.L. ~1984!. The photocurrent, noise, and spectral sensitivity of rods of the monkey Macaca fascicularis. Journal of Physiology ~London! 357, 575– 607. Bowmaker, J.K., Dartnall, H.J. & Mollon, J.D. ~1980!. Microspectrophotometric demonstration of four classes of photoreceptor in an old world primate, Macaca fascicularis. Journal of Physiology ~London! 298, 131–143. Brockway, L.M., Zhou, Z.H., Bubien, J.K., Jovov, B., Benos, D.J. & Keyser, K.T. ~2002!. Rabbit retinal neurons and glia express a variety of ENaC0DEG subunits. American Journal of Physiology—Cell Physiology 283, C126–C134 Chang, S.S., Grunder, S., Hanukoglu, A., Rosler, A., Mathew, P.M., Hanukoglu, I., Schild, L., Lu, Y., Shimkets, R.A., NelsonWilliams, C., Rossier, B.C. & Lifton, R.P. ~1996!. Mutations in subunits of the epithelial sodium channel cause salt wasting with hyperkalaemic acidosis, pseudohypoaldosteronism type 1. Nature Genetics 12, 248–253. Chen, C.C., Zimmer, A., Sun, W.H., Hall, J. & Brownstein, M.J. ~2002!. A role for ASIC3 in the modulation of high-intensity pain stimuli. Proceedings of the National Academy of Sciences of the U.S.A. 99, 8992–8997. Dartnall, H.J.A. ~1972!. Photosensitivity. In Handbook of Sensory Physiology: Photochemistry of Vision, ed. Dartnall, H.J.A., pp. 122–145. New York: Springer-Verlag. de Weille, J. & Bassilana, F. ~2001!. Dependence of the acid-sensitive ion channel, ASIC1a, on extracellular Ca 2⫹ ions. Brain Research 900, 277–281. Dick, E. & Miller, R.F. ~1985!. Extracellular K⫹ activity changes related to electroretinogram components. I. Amphibian ~I-type! retinas. Journal of General Physiology 85, 885–909. Dong, C.-J. & Hare, W.A. ~2002!. GABAc feedback pathway modulates the amplitude and kinetics of ERG b-wave in a mammalian retina in vivo. Vision Research 42, 1081–1087. Ettaiche, M., Guy, N., Hofman, P., Lazdunski, M. & Waldmann, R. ~2004!. Acid-sensing ion channel 2 is important for retinal function and protects against light-induced retinal degeneration. Journal of Neuroscience 24, 1005–1012. Frishman, L.J. & Steinberg, R.H. ~1989!. Intraretinal analysis of the threshold dark-adapted ERG of cat retina. Journal of Neurophysiology 61, 1221–1232. Golestaneh, N., de Kozak, Y., Klein, C. & Mirshahi, M. ~2001!. Epithelial sodium channel and the mineralcorticoid receptor in cultured rat Müller glial cells. Glia 33, 160–168. Green, D.G. & Kapousta-Bruneau, N.V. ~1999!. A dissection of the electroretinogram from the isolated rat retina with microelectrodes and drugs. Visual Neuroscience 16, 727–741. Gurevich, L. & Slaughter, M.M. ~1993!. Comparison of the waveforms of the ON bipolar neuron and the b-wave of the electroretinogram. Visual Neuroscience 33, 2431–2435. Karwoski, C.J., Lu, H.K. & Newman, E.A. ~1989!. Spatial buffering of light-evoked potassium increases by retinal Muller ~glial! cells. Science 244, 578–580. Kellenberger, S. & Schild, L. ~2002!. Epithelial sodium channel0 degenerin family of ion channels: A variety of functions for a shared structure. Physiological Reviews 82, 735–767. Lilley, S., LeTissier, P. & Robbins, J. ~2004!. The discovery and characterization of a proton-gated sodium current in rat retinal ganglion cells. Journal of Neuroscience 24, 1013–1022.

ERG analysis of amiloride-sensitive channels Lyubarsky, A.L. & Pugh, E.N., Jr. ~1996!. Recovery phase of the murine rod photoresponse reconstructed from electroretinographic recordings. Journal of Neuroscience 16, 563–571. Matsuo, T. ~1998!. Expression of amiloride-sensitive sodium channel in rat eye. Acta Medica Okayama 52, 279–283. Mirshahi, M., Nicolas, C., Mirshahi, S., Golestaneh, N., d’Hermies, F. & Agarwal, M.K. ~1999!. Immunohistochemical analysis of the sodium channel in rodent and human eye. Experimental Eye Research 69, 21–32. Newman, E.A. ~1985!. Membrane physiology of retinal glial ~Muller! cells. Journal of Neuroscience 5, 2225–2239. Newman, E.A., Frambach, D.A. & Odette, L.L. ~1984!. Control of extracellular potassium levels by retinal glial cell K⫹ siphoning. Science 225, 1174–1175. Oakley, B. & Green, D.G. ~1976!. Correlation of light-induced changes in retinal extracellular potassium concentration with c-wave of the electroretinogram. Journal of Neurophysiology 39, 1117–1133. Penn, R.D. & Hagins, W.A. ~1969!. Signal transmission along retinal rods and the origin of the electroretinographic a-wave. Nature 223, 201–204. Stockton, R.A. & Slaughter, M.M. ~1989!. B-wave of the electroretinogram. A reflection of ON bipolar cell activity. Journal of General Physiology 93, 101–122.

151 Tucker, G.S., Hamasaki, D.I., Labbie, A. & Bradford, N. ~1982!. Physiologic and anatomic development of the photoreceptors of normallyreared and dark-reared rabbits. Experimental Brain Research 48, 263–271. Waldmann, R., Bassilana, F., de Weille, J., Champigny, G., Heurteaux, C. & Lazdunski, M. ~1997!. Molecular cloning of a noninactivating proton-gated Na⫹ channel specific for sensory neurons. Journal of Biological Chemistry 272, 20975–20978. Warnock, D.G. ~2001!. Genetic forms of human hypertension. Current Opinion in Nephrology and Hypertension 10, 493– 499. Yan, K. & Matthews, G. ~1992!. Blockers of potassium channels reduce the outward dark current in rod photoreceptor inner segments. Visual Neuroscience 8, 479– 481. Yang, Z. & Jiang, C. ~1999!. Opposite effects of pH on open-state probability and single channel conductance of Kir4.1 channels. Journal of Physiology 520, 921–927. Zhang, X., Wensel, T.G. & Kraft, T.W. ~2003!. GTPase regulators and photoresponses in cones of the eastern chipmunk. Journal of Neuroscience 23, 1287–1297.