Book of Conference Proceedings

Book of Conference Proceedings

The 16th FOOD INNOVATION ASIA CONFERENCE 2014 12 -13 June 2014, BITEC Bangna, Bangkok, Thailand

Food Innovation Asia Conference 2014 Science and Innovation for Quality of Life

i


Book of Conference Proceedings

ii


Contents

Page

List of Food Innovation Asia Conference 2014 Committee

iv

Contents of the Conference Proceedings

vii

Proceedings of Oral Presentation

1

OA : Food Health and Nutrition

1

OB : Food Processing and Engineering

10

OC : Food Microbiology, Food Safety and Quality

34

OD : Food Chemistry and Analysis

44

OE : Food Product Development and Ingredient Innovations

76

OG : Food & Agricultural Packaging Technology & Innovations

112

OH : Food Supply Chain Management

138

Proceedings of Poster Presentation

175

PA : Food Health and Nutrition

175

PB : Food Processing and Engineering

277

PC : Food Microbiology, Food Safety and Quality

376

PD : Food Chemistry and Analysis

436

PE : Food Product Development and Ingredient Innovations

610

PF : Sensory and Consumer Research

779

PG : Food & Agricultural Packaging Technology & Innovations

788

PH : Food Supply Chain Management

841

PI : Food Security and Sustainability

859

Author Index

877

List of Reviewers

881

iii


List of Food Innovation Asia Conference 2014 Committee Organizing Committee Tanaboon Sajjaanantakul

Assistant Professor

Kasetsart University

Suntaree Suwonsichon

Associate Professor


Wannee Jirapakkul

Assistant Professor


Vanee Chonhenchob

Associate Professor


Namfone Lumdubwong

Assistant Professor


Patcharee Tungtrakul

Director, Institute of Food Research and Product Development


Anuvat Jangchud

Associate Professor


Tunyarut JinKarn

Assistant Professor


Suttipun Keawsompong

Assistant Professor


Parthana Parthanadee

Assistant Professor


Korntip Watcharapanyawong Techametheekul

Assistant Professor


Hathairat Rimkeeree

Associate Professor


Pravate Tuitemwong

Associate Professor

AOAC Thailand, King Mongkut's University of Technology Thonburi

Saiwarun Chaiwanichsiri

Associate Professor

Chulalogkorn University

Matchima Naradisorn

Lecturer

Mae Fah Luang University

Utai Klinkesorn

Assistant Professor


Secretariat

Shisa Wiboonchat

Manager

FoSTAT

Secretariat

FoSTAT

Secretariat

Nantawan Rungsawat

iv

Chair


Scientific Committee Suntaree Suwonsichon

Associate Professor


Chair

Wannee Jirapakkul

Assistant Professor


Vice-chair

Vanee Chonhenchob

Associate Professor


Vice-chair

Sanguansri Charoenrein

Associate Professor


Chockchai Theerakulkait

Associate Professor


Kamolwan Jangchud

Associate Professor


Ngamtip Poovarodom

Associate Professor


Panuwat Suppakul

Associate Professor


Namfone Lumdubwong

Assistant Professor


Withida Chantrapornchai

Assistant Professor


Walairut Chantarapanont

Assistant Professor


Amporn Sane

Assistant Professor


Parthana Parthanadee

Assistant Professor


Pathima Udompijitkul

Lecturer


Kriskamol Na Jom

Lecturer


Prakit Sukyai

Lecturer


Utai Klinkesorn

Assistant Professor


Secretariat

Thepkunya Harnsilawat

Lecturer


Secretariat

v


International Scientific Committee Bruce R. Harte

Professor

Michigan State University

USA

S. Paul Singh

Professor


USA

Janice Harte

Associate Professor


USA

Delores H. Chambers

Professor

Kansas State University

USA

Edgar IV Chambers

Professor

Kansas State University

USA

Witoon Prinyawiwatkul

Professor

Louisiana State University

USA

University of California Davis

USA

Diane M. Barrett Gordon L. Robertson

Professor

University of Queensland

Australia

Harry Wichers

Professor

Wageningen University

The Netherlands

Jochen Weiss

Professor

Universität Hohenheim

Germany

Katsuyoshi Nishinari

Professor

Osaka City University

Japan

Yumiko Yoshie-Stark

Professor

Toyo University

Japan

Mika Fukuoka

Associate Professor

Tokyo University of Marine Science and Technology

Japan

Tomoaki Hagiwara

Associate Professor

Tokyo University of Marine Science and Technology

Japan

Nuri Andarwulan

Professor

Bogor Agricultural University

Indonesia

Weibiao Zhou

Professor

National University of Singapore

Singapore

Peter K.C. Ong

Associate Professor

National University of Singapore

Singapore

vi


Contents of the Conference Proceedings Code

Title

Page

ORAL PRESENTATIONS A : Food Health and Nutrition OA 1 Raw and Processed Cowpea (Vigna unguiculata L. Walp.) Incorporated Experimental Diets Modulate Serum Cholesterol and Serum Antioxidant Activity in Wistar Rats (Rattus norvegicus) B : Food Processing and Engineering OB 2 Effect of Soaking Condition on Total Anthocyanin Content and Physical Properties of Brown Rice cv. Riceberry Cooked by Microwave Oven

1

10

OB 3

Effect of Microwave Wattage, Infrared Temperature, and Puffing Time on the Moisture Content, Expansion Ratio and Color of Puffed Rice Cracker

18

OB 5

Oil Deterioration during Frying of Salted Gourami under Atmospheric and Vacuum Conditions

26

C : Food Microbiology, Food Safety and Quality OC 3 Use of Crude and Commercial Papain for the Hydrolysis of Catfish (Clarias gariepinus) Protein to Reduce Allergenicity

34

D : Food Chemistry and Analysis OD 1 Effect of Genistein on the Reduction of Maillard Reaction in Heated Mixed Protein-lactose Suspension

44

OD 2

Collagenolytic Trypsin from Hepatopancreas of Jack-Knife Shrimp (Haliporoides sibogae): Characteristics and Biochemical Properties

51

OD 4

Impact of Paddy Drying on Volatile Compounds of Organic Red Fragrant Rice (cv. Hom Daeng)

67

E : Food Product Development and Ingredient Innovations OE 3 Effects of Different Emulsifiers on the Quality of Bread with Pineapple Pomace Fiber

76

OE 4

The Effect of Coconut Pulp (Cocos nucifera L.) Addition to Cassava based Analogue Rice Characteristics

85

OE 5

Dehydration of Maize (Zea mays) Core and Its Utilization as Source of Dietary Fiber in Muscle Food Systems

103

G : Food & Agricultural Packaging Technology & Innovations OG 1 Effect of C3F6 Plasma Treatment on Water Resistance of Recycled Paper

112

OG 2

Development of Food Consumption Database for Exposure Assessment to Migrating Substances from Food Contact Papers

120

OG 3

Behavior Study and Grip Postures on Openability of Thai Elders for Pharmaceutical Packaging with Child-Resistant Closure

130

H : Food Supply Chain Management OH 1 Profit Efficiency of Hybrid Rice in Central Vietnam OH 2 OH 3

A Goal Programming for Production Planning: A Case of Herbal Drink Producers at Yogyakarta, Indonesia Risk Management Approach for Equipment Maintenance at Sugar Cane Factory (Study at PG Madukismo, Yogyakarta)

vii

138 148 156


Code

Title

ORAL PRESENTATIONS OH 4 Supply Chain Risk Management and Logistics Cost Structure Analysis of Corn (Zea mays L.) to Reduce the Negative Effects of Mycotoxins Growth

Page 167

POSTER PRESENTATIONS A : Food Health and Nutrition PA 16 Production of Fructosyltransferase Recombinant Enzyme from Kaentawan (Helianthus tuberosus L.) by Pichia Pastoris X-33

175

PA 17

A Comparison between the In Vitro Carbohydrate Digestibility and the Glycemic Response of Chinese Starchy Foods

182

PA 18

Effect of Reduced Particle Size of Edible Bird Nest on the Physicochemical Properties and Lipid Oxidation of Chicken Patty

190

PA 19

Effects of Frying on Content of Tocopherols and Tocotrienols in Chicken Nuggets Blended with Red Palm Oil

199

PA 20

Proximate Analysis and Amino Acid Composition in Selected Edible Bird’s Nest

208

PA 21

Evaluation of Mutagenic and Antimutagenic Activities of Hot Water Extract from Ganoderma Lucidum (FR.) Karst in Ames Test and Drosophila Somatic Mutation and Recombination

216

The Effect of Cultivated Locations on Antioxidant Capacities and Total Phenolic Contents in

226

PA 23

The Effect of Fortified Inulin in Dry Yogurt on Femur Bone Strength in Calcium-Deficient Rats

234

PA 24

Effect of Enzymatic Hydrolysis on the Antioxidant Activity of Edible Bird Nest

245

PA 25

Grain Characteristics of Common Rice Varieties in Indonesia

254

PA 26

Effects of Size Reduction on Antioxidant Property and Effective Concentration of Edible Bird Nest Drink

268

Test (SMART) PA 22

Pandanus amaryllifolius Leaves

B : Food Processing and Engineering PB 18 A Pulse Electric Field System for Enhancement of Brown Rice Germination

277

PB 19

Effect of Steaming on GABA and Physico-Chemical Properties of Hang Hice

285

PB 20

Effects of Pretreatments on Color and Antioxidant Activities of Dehydrated Purple, Orange and White -Fleshed Sweet Potatoes

293

PB 21

Use of Artificial Neural Network for Predicting Qualities of Dried Chilli Undergoing FarInfrared Assisted Microwave-Vacuum Drying

303

PB 22

Characterization of Direct Expanded and Third Generation Products from Purple Sweet Potato, Rice, Soy Flours and Tapioca Starch Mixtures by Twin Screw Extruder

315

PB 23

Effect of Pretreatments by Blanching and Chemical Soaking on Quality of Dried Winter Mushroom

324

PB 24

Influence of Cooking Conditions and Drying Temperatures on Physical and Functionality of Adzuki Bean and Flour

332

viii


Code

Title

POSTER PRESENTATIONS PB 27 Factors Affecting Bread Baking by a Microwave-Infrared Continuous System

Page 340

PB 28

Effect of Cooking Methods and Rice Grain Sizes on the Vacuum Impregnation Parameters of Cooked Jasmine Rice

348

PB 29

Effect of Milling Processes on Physicochemical Properties of Rice Flour (Oryza sativa L.) cv. Sang Yod

360

C : Food Microbiology, Food Safety and Quality PC 22 Effect of Lemongrass Oil on Shelf Life of Chilled Shrimp under Modified Atmosphere Packaging Condition PC 23

367

Screening for Inulinase Producing Fungi from Kaentawan Rhizophere

378

The Effect of Ozonated water, Microbubble Water and Ozone-Microbubble Water on

385

PC 25

Effects of Freeze Drying on Cell Viability of Candida tropicalis and Lactobacillus plantarum Starter Culture

393

PC 26

Shiitake Extract: an Attractive Alternative Control Approach for Fusarium spp.

402

PC 27

Effect of Sorbic Acid on Aflatoxin Concentration of Ready-to-Eat Chili Paste

410

PC 28

Isolation of Cellulose-Producing Bacteria from Toddy Palm

419

PC 29

Production and Secretion of Bacillus subtilis Chitosanase using a Food-Grade Expression System

428

PC 24

Escherichia coli and Salmonella Typhimurium Decontamination in Fresh Produce

D : Food Chemistry and Analysis PD 23 Characteristics of Acid Soluble- and Pepsin Soluble-Collagens from Swim Bladder of Yellowfin Tuna (Thunnus Albacares)

436

PD 24

Chemical Compositions and Muddy Compounds of the Muscle and Protein Hydrolysates from Nile Tilapia and Broadhead Catfish

446

PD 25

Properties of Phatthalung Sungyod Rice as Influenced by Degree of Milling and Storage Time

458

PD 26

Extraction and Biochemical Properties of Proteinases from Liver of Albacore Tuna (Thunnus Alalunga)

469

PD 27

Effects of Yanang Leave (Tiliacora Triandra) Powder on Quality and Oxidative Stability of Tilapia Emulsion Sausage

479

PD 28

Rapid and Nondestructive Determination of the Quality Indices of Deep-Fried Taro Chips Using Near-Infrared Spectroscopy

497

PD 29

Effect of Sample Temperature Variation on the Determination of Chemical Composition of Longan Honey by Near-Infrared Spectroscopy

505

PD 30

The Effect of Germination of Brown Rice on the Physicochemical Properties of Flour Prepared Using Two Milling Processes

514

PD 31

Chemical Analysis of Red Fermented Soybean Curds Using Near-Infrared Spectroscopy

522

PD 32

Volatile Compounds and Antioxidant Capacity of Fresh and Dried Star Fruits

529

PD 33

Chemical and Color Analysis of Brown, White and Parboiled Rice Using Visible-ShortWavelength Near-Infrared (VIS-SW-NIR) Spectroscopy

538

ix


Code

Title

POSTER PRESENTATIONS PD 34 Changes in Chemical and Physiochemical Properties of Phatthalung Sungyod Broken Rice During Storage

Page 547

PD 35

Shelf-Life Assessment and Quality Changes in Coriander During Storage under Low Temperature

557

PD 36

Contents of Total Polyphenol, Microorganisms and Antioxidant Capacities of Pickled Tea (Miang) Commercially Available in Chiang Rai, Thailand

567

PD 40

Storage Effects on Antioxidant, Tyrosinase Inhibitory Capacity and Anthocyanin of Black Rice Bran

576

PD 42

Classification of Vietnamese and Thai Fish Sauce Based on Total Nitrogen Content and Volatile Compounds

589

PD 43

The Relation of Antioxidant Activity, Oxidative Stability and pH to Maturity Stage Defined by Skin Colour of Cherry Tomato (Lycopersicon esculentum Mill.)

599

E : Food Product Development and Ingredient Innovations PE 11 Product Development of Seasoning Sauce from Sweet Corncob

610

PE 12

Beverages Made from Dried Roselle Shoots of Three Roselle Varieties (Hibiscus sabdariffa var. UKMR-1, UKMR-2 AND UKMR-3)

620

PE 13

Quality Characteristics of Cookies Prepared from Azuki Bean Flour

628

PE 14

Development of Thai dessert “Kanom Kleeb-lam-duan” from Germinated Brown Rice

640

PE 15

Retention of Probiotics in Dehydrated Tomato Products: Impact of Freeze Drying and Hot Air Drying

648

PE 16

Effect of Emulsifiers and Heating Process on Physical Properties and Stability of Coconut Milk

659

PE 17

Feasibility Study of Drinking Coconut Milk: Effects of Types and Concentration of Stabilizing Agents

668

PE 18

Development of Healthy Bread Using Resistant Brown Rice Flour

676

PE 19

Effect of Whey Protein and Guar Gum on Qualities of Cake with RD31 Brown Rice Flour

685

PE 20

Product Development of Cake Made with Sapodilla Paste

695

PE 21

Product Development of Low Sugar Purple Sweet Potato Paste

705

PE 22

Effects of Baking Power Concentrations on the Texture and Sensory Evaluation of Shrimp Cassava Cracker-Contained Oil Puffed by Microwave Technique

715

PE 23

The Development of Instant Soup from Germinated Legumes by Microwave and Drum Drying

726

PE 24

Effects of Nitrogen Source on Characteristics of Nata from Mandarin Orange (Citrus suhuiensis Hort. ex Tan. cv. limau langkat) Juice Characteristics of Nata from Sugarcane (Saccharum officinarum) Juice as Affected by

735

PE 25 PE 27 PE 28

Addition of Nitrogen Sources

744

Effect of Commercially Defatted Rice Bran Extract Powder and Its Combination with AntiBrowning Agents on Browning of Potato Puree

753

Enhancement of Acetic Acid Production from Coconut Pulp by Mixed Culture of Acetobacter

767

cerevisiae and Acetobacter aceti

x


Code

Title

Page

POSTER PRESENTATIONS F : Sensory and Consumer Research PF 3 Preference Mapping of Pandan Noodles for Thai Lod-Chong

779

G : Food & Agricultural Packaging Technology & Innovations PG 6 Effect of Packaging Films on The Quality and Shelf Life of “Khao Tan”

788

PG 7

Influence of Lipids on Water Barrier and Mechanical Properties of Rice Starch Films Reinforced with Starch Nanocrystal

796

PG 8

Properties of Biodegradable Rice Starch Films Reinforced with Oil Palm Empty Fruit Bunch’s Lignin

818

PG 9

Structural Effects of Modified Zeolite on Mechanical and Oxygen Permeability Properties of Polypropylene Film

832

H : Food Supply Chain Management PH 1 Development of Traditional Food at Traditional Market as a Culinary Tourism Products (Case Study at Bali Province) PH 2

Development of Risk Parameter on Groundnut (Arachys hypogaea L) Supply Chain to Reduce the Negative Effects of Mycotoxin through Risk Management Approach

I : Food Security and Sustainability PI 1 Optimization of Legowo Row Cropping System in Rice Paddy Cultivation PI 2

Proteomic Map of Banana Shrimp (Fenneropenaeus merguiensis) with Different Extracting Conditions

xi

841 851

859 867


Raw and Processed Cowpea (Vigna unguiculata L. Walp.) Incorporated Experimental Diets Modulate Serum Cholesterol and Serum Antioxidant Actvity in Wistar Rats (Rattus norvegicus) Perera, O.S.1, 2,*, Liyanage, R.1, Weththasinghe, P.2, Jayawardana, B.C.3, Vidanaarachchi, J.K.3, Fernando, P.4, Sivakanesan, R.5 1

Food Science and Nutrition Unit, Institute of Fundamental Studies, Hantana Road, Kandy, Sri Lanka. 2

Postgraduate Institute of Agriculture, University of Peradeniya, Sri Lanka.

3

Department of Animal Science, Faculty of Agriculture. University of Peradeniya, Sri Lanka. 4

Veterinary Research Institute, Gannoruwa, Peradeniya, Sri Lanka.

5

Department of Biochemistry, Faculty of Medicine, University of Peradeniya, Sri Lanka. *

Corresponding author: ([email protected])

Abstract Legume consumption appears to lower serum lipids and reduce the risk of developing many non-communicable diseases. Cowpea is one of the major grain legumes which is considered as a potential dietary source that could reduce the serum lipids. This study was carried out to investigate the in vivo effect of raw and processed cowpea incorporated experimental diets on serum lipids and serum antioxidant capacity in Wistar rats. Seven weeks old male Wistar rats were fed with raw and processed cowpea powder (Bombay Raw; BR, Bombay boiled; BB, Bombay sprouted; BS, MI 35 raw; MR and MI 35 Boiled; MB) incorporated high fat diets and a control high fat diet (HFD) for six weeks. The serum Total Cholesterol (TC), High Density Lipoprotein Cholesterol (HDL-C), Non-High Density Lipoprotein Cholesterol (Non-HDL-C), and Triacylglycerol (TAG) concentrations were measured at the beginning and at the end of the study using assay kits. Serum antioxidant activity was measured using Ferric Reducing Antioxidant Power (FRAP) method. The TC concentration in serum was lower (p 0.05). Despite increasing volatile oxidation products related to off-flavors, fluidized bed drying at 115C did not significantly decrease consumer acceptability of the cooked rice. This method may thus be alternative to traditional sun drying. Keywords: Organic red fragrant rice, SPME/GC-MS, Volatile compounds, Paddy drying Introduction Moisture content of freshly harvested paddy ranges between 20-30% wb, (Brooker and others 1975; IRRI, 2014). This high moisture level easily induces the deterioration by mold and insect growth, respiratory heat buildup, and enzymatically induced reactions. In order to reduce the rate of those biological and biochemical changes, reduction of the paddy moisture content to 14% wb is required. Paddy with this moisture content is also suitable for milling. While sun drying is a

67


routine method used in most tropical countries due to its simplicity and low production cost, fluidized bed drying may be more appropriate for paddy drying due to various advantages. It offers faster reduction of moisture in fresh paddy to 18% wb. This helps retard quality deterioration especially from mold growth and grain yellowing, provides dried paddy with more uniform qualities and may help increase head rice yield of milled rice (Soponronnarit 1999, Tirawanichakul and others 2004). Moreover, this drying method may help demolish insect pests and their eggs which may contaminate with the organic paddy. However, thermally-induced changes in rice qualities after fluidization drying, usually operated at high temperature (~100 - 150C), might occur. Aroma of the fragrant rice is a critical attribute that greatly influence its consumer acceptability. Unique aroma of cooked rice composed of a numerous odor-active compounds (Maga 1984). However, only a few volatile compounds were monitored to evaluate the effects of postharvest treatment on rice aroma. In case of paddy drying, previous studies indicated that drying at elevated temperature could lead to a decrease in 2-AP, the desirable aroma compound for cooked fragrant rice, with an increase in some volatile lipid oxidation products (Wongpornchai and others 2004, Sunthonvit and others 2005, Borompichaichartkul and others 2007). Arrays of the volatile compounds should be monitored to gain an insight into the changes of rice aroma under different drying conditions. However, study on the effects of paddy drying on the series of volatile compounds in rice is still limited. The aim of this study were to evaluate the changes in the key volatile compounds as resulting from different paddy drying methods. Shade drying, sun drying and fluidized bed drying were selected as a control method, a traditional and advanced drying technique, respectively. Results from this study would partly suggest the appropriate postharvest handling of organic fragrant rice. Materials and Methods Materials. Organic red fragrant rice (Oryza sativa L.) cv. Hom Daeng, a long-grained Thai indica, was cultivated in Ubon Ratchathani Province, Thailand. The paddy was sun-dried by local farmers, packed in gunny sacks and transported to Department of Food Technology, Chulalongkorn University, Bangkok, not more than 2 weeks after harvesting. The initial moisture content was approximately 14% wb.

68


Paddy Drying. Prior to drying treatment, rewetting was done by adding calculated amount of water to the paddy in order to increase its moisture content to 26-30% wb. During the rewetting, the paddy sample was stored in a cold room (4-5C) with occasionally mixing for 7 days to get uniform moisture. Before each drying treatment, the rewetted paddy was placed in an ambient temperature for 8 hours. The sample was then divided into 3 sets. Each set was randomly assigned to either shade drying, sun drying or fluidized bed drying. Shade drying was conducted at ambient temperature (27-33C) for 7 days or until moisture content reached 13-14% wb. Sun drying was done for 6 hours. For fluidized bed drying, the rewetted paddy was firstly dried in a batch fluidized bed dryer at 115C, air velocity of 2.0 m/s, to get the moisture content of 18-20% wb. Short drying time was obtained under this temperature (215 s for 1.8 kg of paddy per batch). The pre-dried paddy was then shade dried at ambient temperature for 2 days or until the targeted moisture content was reached. For all drying treatment, the targeted final moisture content of the paddy was 13-14% wb. Dried paddy was dehusked using a rubber roll husk (JIRCAS, Japan). The freshly hulled rice samples

from

each

drying

method

were

suddenly

packed

in

oriented

polypropylene/aluminum/linear low density polyethylene pouches (100 m thickness) and kept at 18C until used for the volatile analysis. SPME technique and GC-MS analysis. SPME method and GC-MS analysis used in this study were similar to those of Tananuwong and Lertsiri (2010). Briefly, each vial contained 7.000 grams of the hulled rice powder spiked with 1 L of the internal standard solution (1000 ppm of 2,4,6-trimethylpyridine in 2-propanol). The vial was incubated at 120C for 15 min. Headspace volatiles was then adsorbed for 15 min using a 1 cm 50/30 m DVB/CarboxenTM/PDMS Stable FlexTM SPME fiber (Supelco, Bellefonte, PA). Desorption was performed by inserting the SPME fiber into the splitless injection port of the GC–MS instrument (200C) for 5 min. GC–MS (Agilent 6890 Plus GC/HP 5973 MSD) was equipped with an HP-FFAP capillary column (25 m  0.32 mm i.d.  0.50 m film thickness; Hewlett-Packard Co.) Injection port temperature was 200C. Column temperature program started at 45C upon injection, increased at 2C/min to 80C, then at 4C/min to 120C, and finally at 10C/min to 230C. Carrier gas was helium with flow rate of 1.5 mL/min. For the mass spectrometer, MSD capillary direct-interface temperature was 250C. Ionization energy was 70 eV. Mass range was 20–350 a.m.u. Electron multiplier (EM) voltage was obtained

69


from autotune, and scan rate was 4.33 scan/s. All analyses were done in triplicate. Each compound was identified via its Kovats retention indices (RI) and mass spectra using Wiley 275.L mass spectral database (Hewlett-Packard Co.). Peak integration was done on HP chemstation software (Hewlett-Packard Co.). Ratio of the integrated area of each compound to that of the internal standard was reported as semi-quantitative measurement of the compound. Sensory analysis of cooked rice. Affective test on aroma and overall acceptance of cooked hulled red fragrant rice were evaluated on five-point hedonic scale by 31 local consumers consisting of 20-44 years old males and females. The cooked hulled rice samples were prepared by cooking hulled rice kernels in an automatic rice cooker using rice to water ratio of 1:2 w/w. Five-gram portion of each cooked sample was served. Temperature of each served sample was approximately 40-50C. Statistical analysis. Completely randomized design was assigned to GC-MS experiments. Randomized complete block design was used for sensory analysis. Analysis of variance was performed and the differences among means were reported at 5% significance level using Duncan’s new multiple range test. Results and Discussions Considering the chromatographic data of freshly shade-dried hulled rice sample (control method), fifteen well-resolved odorants consisting of seven aldehydes, three alcohols, three aromatics, one ketone and one N-containing compound were identified as the important volatile compounds isolated from organic hulled red fragrant rice cv. Hom Daeng (Table 1). All of these compounds except 1-nonanol and naphthalene were reported as the key volatile compounds in this rice cultivars (Tananuwong and Lertsiri, 2010). Among the volatile compounds isolated, all of the aldehydes, 1-octen-3-ol, octanol, and 2-pentylfuran were previously reported as lipid oxidation products (Lam and Proctor 2003, Mildner-Szkudlarz and others 2003, Frankel 2005). As shown in Table 1, paddy drying at elevated temperature led to changes in the relative amount, indicated from the area ratio, of the volatiles detected. In comparison with shade-dried samples as the control, significant increase in hexanal, 2,4-nonadienal, and 2-pentylfuran was found for the fluidized bed-

70


dried samples (p  0.05). However, the volatile oxidation products, except hexanal, isolated from sun-dried samples were not significantly different from those of the control (p > 0.05). Generally, sun drying is done under warm air, with approximate air temperature of 40-60C (Inprasit and Noomhorm 2001). In this research, sun-drying was done for 6 hours. In case of the two steps fluidization drying technique, the first step of batch fluidized bed drying at 115C raised the paddy temperature to approximately 72C. According to the results, drying at high temperature-short time in the fluidized bed dryer led to larger extent of lipid oxidation comparing to the low temperaturelong time used in sun drying. The results also implied that ultraviolet rays from sunlight did not dramatically enhance autooxidation of lipids in the paddy. This might be due to the present of rice husk as a protection layer, which could limit the exposure of lipids in hulled rice to the ultraviolet rays. As for other odorants, different drying methods did not significantly influence the relative amount of the volatile aliphatic alcohols, naphthalene, 2-AP, geranyl acetone and 4-vinyl guaiacol (p > 0.05). The GC-MS results indicated some significant influences of drying methods on the volatile compounds from hulled red fragrant rice. Fluidized bed drying led to greater formation of some volatile oxidation products, which might relate to off-flavors and eventually influence consumer acceptability of the cooked rice. However, according to the affective test (Table 2), different drying methods did not significantly affect hedonic scores of aroma and overall acceptance of the cooked rice (p > 0.05). Moreover, the hedonic scores of every tested sample were greater than three, based on the 5-point scale, indicating that all samples were accepted by consumers. Although fluidized bed drying caused greater change in some volatile compounds isolated from the hulled rice samples, the extent was too little to influence the overall rice aroma perceived by consumers.

71


Table 1. Area ratio of the important volatile compounds in hulled red fragrant rice subjected to different drying methods. Area ratioa,b after drying RI

Compound

Shade drying

Sun drying

Fluidized bed drying

Aliphatic aldehydes 1116

Hexanal

0.018c

±

0.006

0.036b

±

0.005

0.054a

±

0.010

1181

Heptanal ns

0.037

±

0.019

0.033

±

0.021

0.035

±

0.002

1281

Octanal ns

0.051

±

0.025

0.065

±

0.029

0.060

±

0.025

1408

Nonanal ns

1.150

±

0.052

1.051

±

0.109

0.919

±

0.123

1517

Decanal ns

0.160

±

0.028

0.182

±

0.022

0.194

±

0.017

1548

2-Nonenal ns

0.076

±

0.017

0.107

±

0.043

0.129

±

0.028

1708

2,4-Nonadienal

0.014b

±

0.007

0.026ab

±

0.001

0.035a

±

0.008

Aliphatic alcohols 1483

1-Octen-3-ol ns

0.069

±

0.028

0.077

±

0.020

0.076

±

0.008

1570

1-Octanol ns

0.266

±

0.026

0.305

±

0.022

0.274

±

0.037

1641

1-Nonanol ns

0.185

±

0.073

0.154

±

0.020

0.090

±

0.007

Aromatics 1216

2-Pentylfuran

0.032b

±

0.015

0.044b

±

0.010

0.086a

±

0.016

1765

Naphthalene ns

0.142

±

0.005

0.131

±

0.021

0.117

±

0.012

2256

4-vinyl guaiacol ns

0.154

±

0.024

0.158

±

0.012

0.157

±

0.104

0.022

±

0.007

0.026

±

0.005

0.021

±

0.004

0.120

±

0.018

0.136

±

0.039

0.130

±

0.023

N-containing compound 1344

2-Acetyl-1-pyrroline ns Aliphatic ketone

1933 a

Geranyl acetone ns

Area ratio was calculated based on the peak area of the internal standard and reported as a mean ± standard deviation

from mean (n = 3). b

Means with the different letters within the row are significantly different (p≤0.05).

72

The 16th FOOD INNOVATION ASIA CONFERENCE 2014 12 -13 June 2014, BITEC Bangna, Bangkok, Thailand ns

Means within the row are not significantly different (p>0.05)

Table 2. Hedonic scores for aroma and overall acceptance of cooked hulled red fragrant rice prepared from the samples pre-dried by different methods Drying method

a

Sensory Characteristicsa Aromans

Overall acceptancens

Shade drying

3.4  1.0

3.7  0.9

Sun drying

3.6  0.9

3.8  0.7

Fluidized bed drying

3.5  0.9

3.9  0.8

Mean  standard deviation of the data in 5-point hedonic scale, obtained from 31 consumers.

ns

Means within the column are not significantly different (p>0.05)

Conclusions Fifteen odorants comprising of seven aldehydes, three alcohols, three aromatics, one ketone and one N-containing compound were categorized as important volatile compounds in organic hulled red fragrant rice cv. Hom Daeng. Significant impact of various drying methods on these compounds was found. Significant increase in volatile oxidative products, particularly hexanal, was evidenced in sun-dried and fluidized bed-dried samples (p  0.05). However, change in these compounds possibly related to off-flavor did not significantly influence consumer acceptance of the cooked samples (p > 0.05). Regardless of the operational cost, fluidized bed drying done at a temperature around 115C may thus be more beneficial than traditional sun drying, and can be recommended as a part of appropriate postharvest handling of organic rice.

73


Acknowledgement The authors would like to thank Dr. Somchart Soponronnarit, School of Energy and Materials, King Mongkut‘s University of Technology Thonburi, Thailand for providing an access to fluidized bed drying facilities. References Borompichaichartkul C, Wiset L, Tulayatun V, Tuntratean S, Thetsupamorn T, Impaprasert R, Waedalor I. 2007. Comparative study of effects of drying methods and storage conditions on aroma and quality attributes of Thai jasmine rice. Drying Technol 25:1185–1192. Brooker DB, Bakker-arkema FW, Hall CW. 1975. Drying Cereal Grains. 2nd ed. Connecticut, USA: AVI Publishing Company. 265 p. Frankel EN. 2005. Lipid Oxidation. 2nd ed. Bridgewater, UK: Oily Press. 470 p. Inprasit C, Noomhorm A. 2001. Effect of drying air temperature and grain temperature of different types of drying and operation on rice quality. Drying Technol 19:389-404. IRRI. 2014. Rice Knowledge Bank: Drying. Los Baños, Philippines: International Rice Research Institute. Available from http://www.knowledgebank.irri.org/step-by-stepproduction/postharvest/drying. Accessed May, 11, 2014. Lam HS, Proctor A. 2003. Milled rice oxidation volatiles and odor development. J Food Sci 68:2676-2681. Maga JA. 1984. Rice product volatiles: a review. J Agric Food Chem 32:964-970. Mildner-Szkudlarz S, Jelen HH, Zawirska-Wojtasiak R, Wasowicz E. 2003. Application of headspace - solid phase microextraction and multivariate analysis for plant oils differentiation. Food Chem 83:515-522. Soponronnarit S. 1999. Fluidised-Bed Paddy Drying. Science Asia 25:51-56.

74


Sunthonvit N, Srzednicki G, Craske J. 2005. Effects of high temperature drying on the flavor components in Thai fragrant rice. Drying Technol 23:1407-1418. Tananuwong K, Lertsiri S. 2010. Changes in volatile aroma compounds of organic fragrant rice during storage under different conditions. J Sci Food Agric 90:1590-1596. Tirawanichakul S, Prachayawarakorn S, Tungtrakul P, Varanyanond W, Soponronnarit S. 2004. Effect of fluidized bed drying temperature on various quality attributes of paddy. Drying Technol 22:1731-1754. Wongpornchai S, Dumri K, Jongkaewwattana S, Siri B. 2004. Effects of drying methods and storage time on the aroma and milling quality of rice (Oryza sativa L.) cv. Khao Dawk Mali 105. Food Chem 87:407-414.

75


Effects of Different Emulsifiers on The Quality of Bread with Pineapple Pomace Fiber 1

Phantipha Chareonthaikij*, 1Janjira Jaifua, 1Chanticha Methakullawat and 2

Tanat Uan-On

1

Faculty of Agricultural Product Innovation and Technology, Srinakharinwirot University 114 Sukhumvit 23, North Kloengtey Wattana, Bangkok 10110, Thailand 2

Department of Biotechnology, Faculty of Agro-Industy, Kasetsart University 50 Pahonyothin Chatuchak, Bangkok 10900, Thailand *

Corresponding author: [email protected]

Abstract The previous study showed that pineapple pomace fiber (PF) affected the volume and textural quality of composite bread. Emulsifiers were widely used to improve those qualities. The objective of this study was to evaluate effects of different emulsifiers on physical and sensory properties of bread made with pineapple pomace fiber-wheat mixed flour. Diacetyl tartaric acid esters of monodiglycerides (DATEM) and sodium stearoyl-2-lactylate (SSL) were applied in bread made with 5% PF (w/w) [PF bread] at the level of 0, 0.3, 0.6% (w/w) using full factorial 3 x 3 in CRD experimental design. Quality of all bread was measured for loaf volume by the rapeseed displacement method, texture profiles by the AACC 2000 and sensory evaluation using a 9-point hedonic scale compared with wheat bread without any emulsifiers (Control). A response surface methodology (RSM) was used to demonstrate the effect of different emulsifiers on the quality of bread. The incorporation of DATEM and SSL affected the quality of PF bread. Increasing the level of DATEM alone or mixed DATEM and SSL resulted in greater specific volume (P < 0.05) of PF bread than that of the control. DATEM had significant effects on softening the texture of bread than SSL. With respect to sensory quality, the addition of DATEM/SSL at 0.6/0.6 (w/w) significantly affected softness and overall liking of PF bread compared to the control (P < 0.05). In conclusion, this study indicated that the incorporation of DATEM and SSL at the highest level (0.6/0.6) could improve PF bread with more acceptable in terms of volume, hardness, and overall liking than the control. Keywords: Bread, Pineapple fiber, Emulsifiers, Physical property, Sensory evaluation Introduction Pineapple pomace fiber contained high amount of dietary fiber which is very useful to apply in bread making as the source of fiber. However, the use of different fibers impacts on the physical and sensory properties of bread such as lower loaf volume, darker crumb color and given different flavor profiles from wheat bread. The addition of various hydrocolloids, emulsifiers, or enzymes

76


(Gujral & Rosell, 2004; Renzetti & Arendt, 2009; Sawa et al., 2009) was used to improve the quality of enriched bread. It has been reported to be effective to improve the dough rheology and quality of bread crumb (Guarda et al., 2004; Renzetti & Arendt, 2009). The functionalities of emulsifiers are varied widely such as increasing in water retention capacity and loaf volume of product, improving dough strength during proofing, and decreasing in firmness of baked products according to their anti-staling properties (Collar et al., 1999; Sawa et al, 2009). DATEM and SSL are widely used emulsifiers in breadmaking. Response surface methodology (RSM) is a very useful technique to obtain optimal concentrations of ingredients or optimal the process conditions focused by several researchers. Generally, RSM relates product quality by using regression equations that describe interrelations between input parameters and the properties of finished products (Singh et al., 2004). However, the study of effects of different emulsifiers on the quality of bread incorporated with pineapple pomace fiber has been limited. Therefore, the objective of this study was to evaluate the effect of selected emulsifiers on their physical and sensory qualities of bread made with composite flour from wheat flour and pineapple pomace fiber. Materials and Methods Materials Wheat flour (11.4% moisture and 17.8% protein) and ingredients for bread making were purchased from a local market in Thailand. Pineapple pomace fiber (3.9% moisture, 70.2% total dietary fiber and 5.9% protein) was donated by Tipco Biotech Co., Ltd., Thailand. Diacetyl tartaric acid ester of monoglycerides (DATEM) and sodium stearoyl-2-lactylate (SSL) were provided by Berli Jucker Public Co.Ltd., Thailand. Bread making procedure Bread formulations modified from AACC 2000 (method 10-10B) were prepared with wheat flour (Control) or with composite flour from pineapple pomace fiber-wheat flour and the following ingredients (based on 100 g flour basis), active dry yeast (1.5%), salt (1%), sugar (6%), shortening (3%) and water (72%, based on farinogram absorption). Breads were prepared using an automatic home bakery machine (SEV-3983, Severin Elektrogeräte GmbH, Sundern, Germany). All ingredients were mixed for 30 min and the dough was divided into 300 g, manually rounded, and

77


rested for 15 min. Dough was punched, rolled, put into well greased aluminum pan (19 x 10 x 7.4 cm3), and proofed at 35 oC and 80% RH for 60 min. After that, the dough was baked at 180oC for 30 min. Then, bread had been cooled, packed in a polyethylene bag, and stored at 26 + 2oC for 24 h before further analyses. Bread quality evaluation Selected Physical properties measurements Loaf volume of bread was measured in duplicate using the rapeseed displacement method. The specific volume and expansion ratio was calculated from volume/weight (cm3/g) and from the mean value of specific volume of each sample⁄specific volume of the control, respectively. Texture profile analysis (TPA) was carried out using a texture analyser (LF500, Lloyd instruments Ltd., Fareham, UK) to determined the crumb texture of each bread formulation. The sliced bread (25 x 40 x 40 mm3) was compressed to 40% deformation at the speed of 50 mm/min (AACC 2000, method 74-09) using a compression probe (diameter of 48 mm). Results are the mean of six measurements of two different batches of bread. Sensory evaluation Sensory evaluation was conducted using panelists (n = 40) recruited from Srinakharinwirot University, Bangkok, Thailand. They were provided with water to clean their mouth before testing and between samples. Each consumer was presented with 3 coded pieces of bread (12.5 mm of thickness). Then, they were asked to rating for appearance (color and porosity of crumb surface), starch flavor, softness, and overall liking using the 9-point hedonic scale (1 = dislike extremely; 5 = neither like nor dislike; 9 = like extremely) and rested for 10 min between a set of 3 products. Wheat bread served as the control. Experimental design and statistical analyses Bread from different batches was evaluated for all measurements. Response surface methodology (RSM) was used to study the simultaneous effect of two variables according to full factorial 3x3 in CRD. All results obtained in this study were subjected to analysis of variance (ANOVA). The Duncan‘s Multiple Range Test (DMRT) was performed for post-hoc multiple comparison at P 0. The stochastic frontier profit function and the inefficiency model are simultaneously estimated using FRONTIER 4.1c (Coelli 1996). A two-stage estimation method is used in obtaining the final maximum likelihood estimation. 2.2 Data The farm-level data are collected from a face-to-face interview with 328 rice farmers in the Central Vietnam for winter-spring season of 2012/2103. A three-stage stratified random sampling method is adopted. In the first stage, the study site is stratified into two stratums comprising major and minor zones based on the rate of hybrid rice adoption in Vietnam (at 10% threshold, because difference in the rate of hybrid rice adoption may affect on profit efficiency). In the second stage, major and minor zones are stratified based on the existence of hybrid-rice seed production centers. In the final stage, from selected provinces in the second stage, four districts namely Tinh Gia district of Thanh Hoa Province, Quynh Luu district and Dien Chau district of Nghe An province, and A Luoi district of Thua Thien Hue province are randomly drawn.

4

LR = -2(LLF0 – LLF1), where LLF1 is value of Log Likelihood achieved by estimating unrestricted model and LLF 0 is value of Log Likelihood achieved by estimating restricted model. Reject H 0 (γ=0) if LR > R2 table value, where R = number of restrictions.

141


2.3 Empirical model This study uses Model 2 of Battese and Coelli (1995) (Coelli 1996), the estimation of profit efficiency is achieved by applying a translog functional form (flexible functional form). Based on Equation (1), after normalizing by the output price, the stochastic translog normalized profit frontier function of n hybrid rice farmers is specified as: 4

lnπi = β0 + j=1

1 βj lnPji + α1 lnZi + 2

4

4

j=1 k=1

1 βjk lnPji lnPki + α11 lnZi 2

2

4

+

γj1 lnPji lnZi + vi − ui

i = 1,2 … n

(4)

j=1

where 𝑃ji is the vector of j-th input used by i-th farmer including (1) the normalized prices of seed (PSeed, USD/kg), (2) fertilizer5 (PFertilizer, USD/kg), (3) labor (PLabor, USD/man-day), and (4) pesticide6 (PPesticide, USD/packet); 𝑍i is rice farming area (FSize, hectare), the quasi-fixed input; and the profit inefficiency (ui) is expressed as a following linear function: 17

ui = δ0 +

i=1, 2, 3…n

δh Xhi

(5)

h=1

𝑋hi is the vector of h-th explanatory variable of i-th farmer including (1) Age of household head (year), (2) Household size (person), (3) Educational level of household head (year of schooling), (4) Farming experience of household head (year), (5) Farm size (hectare), (6) Irrigation (%), (7) Share of rice income in household‘s total income (%), (8) Share of rice for sale (%), (9) Share of hybrid rice area (%), (10) Trained about hybrid rice production (times/year), (11) Hybrid rice production experience (year), (12) Family labor for rice production (person), (13) D1_Region of farm (dummy variable, =1 if lowland; =0 otherwise), (14) D2_Credit access (dummy variable, =1 if Yes; =0 otherwise), (15) D3_Type of seed (dummy variable, =1 if 3 lines; =0 if 2 lines), (16)

5

Because farmer simultaneously uses different types of fertilizers; therefore, price of fertilizer = (price of f-th fertilizer * quantity of f-th fertilizer)/(total quantity of fertilizer used by farmer i-th) 6 Price of pesticide = (price of y-th pesticide * quantity of y-th pesticide)/(total quantity of pesticide used by farmer i-th)

142


D4_Source of seed (dummy variable, =1 if domestic; =0 otherwise), and (17) D5_Poor7 household (dummy variable, =1 Non-poor; =0 otherwise). 3. Results and Discussions 3.1 Profit efficiency The coefficient estimates of stochastic translog normalized profit frontier function and the results of hypothesis testing of the existence of inefficiency are presented in Table 1. The estimation value of  is equal 0.99 (close to 1), and is significantly different from zero (statistically significant at 1%). Therefore, H0 ( = 0) is rejected and accept H1 ( > 0); this can be concluded that there is existence of inefficiency in hybrid rice production among farmers in the Central Vietnam. The estimated result also shows that the average profit efficiency of hybrid rice production in the Central Vietnam is 63.12%, it implies that farmers can increase their profit of hybrid rice by 36.88%

by

the

improvement

of

technical,

7

allocative

and

scale

efficiencies.

Poor households in rural area are those having average income per capita under 400,000 VND/person/month (corresponding to 19.05 USD/person/month with 1USD = 21,000 VND) according to decision No. 09/2011/QD-TTg on 30 January 2011 ( Vietnam‘s poor standard for households in rural area).

143


Table 1 Parameter estimates of translog stochastic profit frontier function Variable

Parameter β0 β1 β2 β3 β4 α1 β11 β22 β33 β44 α11 β12 β13 β14 β23 β24 β25 γ11 γ21 γ31 γ41

Constant ln PSeed ln PFertilizer ln PLabor ln PPesticide ln FSize 1/2(ln PSeed)2 1/2(ln PFertilizer)2 1/2(ln PLabor)2 1/2(ln PPesticide)2 1/2(ln FSize)2 ln PSeed x ln PFertilizer ln PSeed x ln PLabor ln PSeed x ln PPesticide ln PFertilizer x ln PLabor ln PFertilizer x ln PPesticide ln PLabor x ln PPesticide ln FSize x ln PSeed ln FSize x ln PFertilizer ln FSize x ln PLabor ln FSize x ln PPesticide Variance Parameters σ2 = σ2v + σ2u  = σ2u /(σ2v + σ2u ) Log-likelihood N

Coefficient estimates - 11.0837 - 0.1202 - 6.3694 9.9638 - 3.2721*** 2.8376*** 0.2627 0.0886 - 2.7340 0.1131 0.0062 0.2905 - 0.2758 - 0.1171 1.4806 - 0.1701 1.0863*** 0.2085* 0.3686 - 1.0991*** 0.1084 2.3088*** 0.9876*** - 205.36 328

t-ratio - 0.94 - 0.08 - 1.21 1.18 - 3.13 2.89 0.98 0.07 - 0.89 0.69 0.06 0.53 - 0.48 - 0.79 0.80 - 0.49 2.90 1.80 1.10 - 3.13 1.23 9.73 277.42

Note: ***, ** and * are statistically significant at 1%, 5% and 10%, respectively. Source: survey data (2013).

This result is consistent with the result of Kolawole (2006) in Nigeria with the average profit efficiency is 60%. However, it is quite low compared to the results from Ghana, Bangladeshi, and Brunei Darussalam. For examples, Abdulai and Huffman (1998) reported the average profit efficiency of rice farmers in Northern Ghana is 73%, Rahman (2003) reported the average profit efficiency of high yielding varieties of farmers in Bangladeshi is 77%, Galawat and Yabe (2012) reported the average profit efficiency of farmers‘ rice production in Brunei Darussalam is 81%.

144


3.2 Determinants of profit inefficiency The parameter estimates of the explanatory variables for the profit inefficiency and their ttests are shown in the Table 2. Table 2 Parameter estimates of profit inefficiency model

Constant

δ0

Coefficient estimates 1.8619***

Age of household head

δ1

0.0741***

Household size

δ2

- 0.1672

- 1.46

Educational level of household head

δ3

- 0.1901***

- 3.09

Farming experience of household head

δ4

- 0.0100

- 0.32

Farm size

δ5

0.2519***

3.55

Irrigation

δ6

- 0.0597***

- 3.62

Share of rice income in household‘s total income

δ7

- 0.0790***

- 7.11

Share of rice for sale

δ8

0.0195**

2.08

Share of hybrid rice area

δ9

- 0.0534***

- 3.79

Trained about hybrid rice production

δ10

- 0.5671***

- 4.40

Hybrid rice production experience

δ11

- 0.6318***

- 8.66

Family labor for rice production

δ12

- 0.3820*

- 1.68

D1_Region of farm (1=lowland, 0=otherwise)

δ13

- 2.7151***

- 5.47

D2_Credit access (1=yes, 0=otherwise)

δ14

1.0656*

1.73

D3_Type of seed (1=3 lines, 0=2 lines)

δ15

- 0.3545

- 0.68

D4_Source of seed (1=domestic; 0=otherwise)

δ16

- 0.4556

- 0.67

Variable

Parameter

D5_Poor household (1=non-poor, 0=otherwise) δ17 - 1.4901*** Note: ***, ** and * are statistically significant at 1%, 5% and 10%, respectively. Source: survey data (2013)

t-ratio 7.62 3.02

- 3.01

The explanatory variables are hypothesized having a negative effect on the profit inefficiency of farmers‘ hybrid rice production except for age of household head. The estimation results illustrate that almost all of explanatory variables have the expected sign except for farm size, share of rice for sale, and access to credits. As can be seen that age, education, farm size, irrigation, share of rice income, share of hybrid rice area, attendance of hybrid rice production training, experience of hybrid rice production, region of farm, and being a member of farmer groups are the

145


key factors affecting farmers‘ profit inefficiency in hybrid rice production (statistically significant at 1%). Particularly, the older the farmer is, the more inefficiency he performs. By contrast, the profit inefficiency can be reduced if the education level of farmer increases. Similarly, improvement in irrigation, the increases in share of rice income, share of hybrid rice area, frequency of training attendance about hybrid rice production, and experience of hybrid rice production, respectively are ways to reduce the profit inefficiency. It is also found that rice farmers in the lowland operate more efficiently by 2.72% than in the upland, and non-poor farmers produce hybrid rice more efficient by 1.49% than poor farmers do. Conclusions and implications This paper reveals that hybrid rice production in Central Vietnam is not efficient on average, about 63.12% with a wide variation among farmers, and the average actual profit farmers earned is around 621.02 USD/ha. This implies that 36.88% of profit is lost (corresponding to about 325.46 USD/ha) due to the combination of technical, allocative, and scale inefficiencies. The findings from investigating the determinants of profit inefficiency imply that in order to improve the profit efficiency of hybrid rice farming, rice farmers should actively attend the training and learn experience about hybrid rice production from well-performed farmers as well as promote hybrid rice intensive production, especially for three-line hybrid rice. Besides, government should have policies to improve socio-economic conditions of this area such as enhancing education, improving irrigation system, increasing access to credit, especially in the upland and among poor farmers. In addition, government should also have policies to promote the adoption of high-quality hybrid rice varieties such as the three-line hybrid rice seed. Last but not least, the support policies to increase training about hybrid rice production and organizing the programs of visiting and learning experience from well-performed farmers are suggested to increase the profit efficiency of hybrid rice production.

146


References Abdulai A, Huffman WE. 1998. An Examination of Profit Inefficiency of Rice Farmers in Northern Ghana. Staff paper in Department of Economics, Iowa State University, Ames. Battese GE, Corra GS. 1977. Estimation of a Production Frontier Model: With Application to the Pastoral Zone of Eastern Australia. Australian Journal of Agricultural and Resource Economics 21(3): 169-179. Battese GE, Coelli TJ. 1993. A Stochastic Frontier Production Function Incorporating a Model for Technical Ineffciency Effects. Working paper in Econometrics and Applied Statistics, No.69, Department of Econometrics, University of New England, Armidale pp.22. Coelli TJ. 1996. A Guide to Frontier Version 4.1: A Computer Program for Stochastic Frontier and Cost Function Estimation. CEPA Working Paper, University of New England, Armidale, NSW, 2351, Australia. Galawat F, Yabe M. 2012. Profit Efficiency in Rice Production in Brunei Darussalam: A Stochastic Frontier Approach. J ISSAAS 18(No. 1): 100-112. [GSO] Vietnam General Statistic Office. 2010, 2011, 2012. Available from: www.gso.gov.vn/default_en.aspx?tabid=469&idmid=3. Accessed Sep 20, 2013. Hoai NM. 2012. The Basic Theory and Reality of Building New Rural Area in Vietnam. Kolawole O. 2006. Determinants of Profit Efficiency among Small Scale Rice Farmers in Nigeria: A Profit Function Approach. Research Journal of Applied Sciences 1(1): 116-122. Kumbhakar SC, Lovell CAK. 2003. Stochastic Frontier Analysis. Cambridge University Press, London. Rahman S. 2003. Profit Efficiency among Bangladeshi Rice Farmers. J Food Policy 28(5–6): 487503. Vien TD, Nga NTD. 2009. Economic Impact of Hybrid Rice in Vietnam: An Initial Assessment. J. Sci. Dev, Ha Noi University of Agriculture 7(Eng.Iss. 2): 258-272. Xie F. 2011. Proceeding of a Conference on the Hybrid Rice R&D Program at IRRI. 2011 Dec 1213, Sanya, China. Yuan L. 2004. Proceeding of a Conference on Hybrid Rice for Food Security in the World. 2004 Feb 12-13, Rome, Italy.

147


A Goal Programming for Production Planning: A Case of Herbal Drink Producers at Yogyakarta, Indonesia Novita Erma Kristanti *, Henry Yuliando, Arif Indarto 1), 1)

Department of Agroindustrial Tehnology, Universitas Gadjah Mada, Indonesia *Corresponding author: [email protected]

Abstract This study concerned a production planning problem faced by a company of herbal products at Yogyakarta, Indonesia. It is observed that such products has a volatile demand and low switching cost. Producers always compete for making a new formula for their captive market. Most of the products are marketed as food supplement and some medical products. In this regard, the production decisions rely on the resources procurement and allocation. Due to a large variety products, it requires a company to optimize production planning in correspond to productivity as a base of profit making. Here, a goal programming model was employed to synchronize market requirements and resources availability in terms of its utilization (productivity). Constrained by the process capacity and material availability, goals priority was determined to several scenarios in order to achieve productivity target. Based on the case, the result shows that the production planning could be focused in prioritizing the usage of material such as turmuric, curcuma, and ginger that gave the highest productivity in profit making. A change of demand level as constrained by process capacity should be maintained at most 17% deviation. The model also reveals that at the current condition, there is an excessive inventory for some herbs material, and a shortage of sugar. This propose a policy for the company to take a different platform in their supply and storage for each product in correspond to market trend and optimal production planning. Keyword: Herbal products, Goal programming, Productivity, Process capacity Introduction As a tropical country, Indonesia is abundant with crops such as medicinal plants. The people are accustomed to consume herbal drink. According to the Agency for Agricultural Research and Development (2007), it was estimated that herbal industry booked for 2050 new trading, increasing 15% per year, higher than modern - conventional medicine industry for only 3% per year. Many small-medium enterprises (SME) in herbal drink industry have been growing due to their potential material and market. SME that survive in this industry are those who capable to produce effectively. This means that they have to respond to the demand accurately in correspond to production level, quality and delivery time.

148


In this study, a goal programming for production planning of herbal drink is analyzed. An SME of Indonesian Herbs An Nuur, Yogyakarta, Indonesia, is taken as a case. This SME produces herbal drink for more than 20 product variants. It is found that the company often could not optimize the profit. It has always encountered problems such as delay in production, product shortages, and additional workload in inventory management which causes lost sales. The objective of production planning is to achieve a general statement about the characteristics of the operating framework of the planned production during the period. This framework should be designed to meet the objectives of the company, to meet the needs of customers and to meet welfare of employees, and reduce the total cost. (Heizer and Render, 2011) Traditionally, the objective of production planning is either to maximize profit or minimize cost and is formulated to a single-objective function in linear programming. In practice, production planning can be based on some decision parameters such as productivity. This means that from every planning scenarios, a priority can be approached by productivity level in terms of resources utilization. To achieve this, a goal programming approach is taken because the company‘s management has indicated several targets with various priorities assigned. Various studies shows that goal programming is appropriate to solve problem in production planning. Leung and Chang (2008) employed goal programming to solve the problem of aggregate production planning constrained by production capacity, workforce level, factory locations, machine utilization, storage space and other resource limitations. While Choudary and Shankar (2014) solved joint decision making of inventory lot-sizing, supplier selection and carrier selection problem using goal programming with three variants. Production process can be said to be good if the value of high productivity as simply defined as the ratio of output value (goods or services ) divided by the input (resources such as capital and labor) (Heizer & Render, 2011). Basically productivity improvements will have a relationship profitability (Tangen, 2002). One of famous productivity measurement method is Multifactor Productivity Measurement Model (MFPMM) as developed by the American Productivity Center (APC) (Sink, 1985). The basic concept of this model is to create a constant value for the price and costs as well as eliminate the effect of changes in prices and costs from the base period to the observed period. MFPMM gives several advantageous since it can indicate which the operating unit (product variants) that capable to deliver a profit and vice versa. It also can

149


indicate resource utilization performance, whether is efficient or less so that corrective action can be taken. In this study, an efficient production planning is proposed using a goal programming model in correspond to priorities based on productivity target. Here, the performance in terms of productivity or usage of material, labor and machine working hours is treated as decision parameters to construct the goal programming (GP) model. The priorities is based on economic contribution of each ingredient used to profit. Data of SME - Indonesian Herbs - An Nuur is used to demonstrate the applicability of proposed model. Materials and Methods The GP model used in this paper is called as pre-emptive GP, in which unwanted deviations are minimized hierarchically, according to the priority levels of individual goals, so that goals of primary importance can receive first-priority attention, those of second importance can receive second-priority attention, and so forth. In other words, in the pre-emptive GP, goals of first-priority are minimized in the first phase. Using the obtained feasible solution result in the first phase, goals of second-priority are minimized, and so on. The pre-emptive GP model accepts implicitly infinite trade-offs among goals having different priority levels Romero (1991). The company has indicated that the productivity of material, labor and machine hours are important. Here, the analysis is started by measuring contribution of each production factor to profit using MFPMM model. A base period was chosen among 17 periods data. The result

shows which

factors are efficient in contributing to profit and vice versa. To find the influence level of each production factor to profit a multiple regression model was used. The complete result is presented at Table 1 and Table 2.

150


Table 1 Profit contribution and influence level of each production factor Production factor White turmeric Curcuma Turmeric Spice Sugar Labor hour Mixer Oven Total

Contribution to profit (in rupiahs = Rp) 7685.03 2116.26 22371.83 36097.88 88230.32 -925924.41 19185.19 7081.52 -675693.16

Influence level

Priority (P)

-0.843 -0.804 -0.690 0.905 0.984 -0.94 0.822 0.986

P5 P7 P8 P4 P2 P3 P6 P1

Slope Negative Negative Negative Positive Positive Negative Positive Positive

Deviational variables (d)

Goal (G)

d+ d+ d+ ddd+ dd-

G5 G7 G8 G4 G2 G3 G6 G1

Table 2 Goals, formulas and description for the objective function of goal programming

Goal (G) G1 G2 G3

Min P1d8Min P2d5Min P3(d6+d7+d8+d9+d10)

G4 G5 G6 G7 G8

Min P4d4Min P5d1+ Min P6(d11- + d12-) Min P7d2+ Min P8d3+

Formula

Description Maximize oven use by optimize availability time Maximize sugar usage, avoid excess stock Minimize addition of labor hours, assumed that the labor hours is quite available Maximize seasoning usage, avoid excess stock Over stock of white turmeric, maximize it usage Avoid idle time of mixer Avoid more supply of curcuma, stock is sufficient Avoid more supply of turmeric, sock is sufficient

For the constraints, it is based on material usage, working hours (labor and machine) and demand level of each product. For material usage, it is approached by the ingredient amount of each product that presented in following table.

151


Table 3 Ingredient and available source for each product in each production period

White turmeric instant White turmeric capsule Curcuma instant Curcuma capsule Turmeric instant ―Staminur‖ instant ―Staminur‖ capsule Available source

White turmeric 75 gram 24 gram 20000 gram

Curcuma 75 gram 24 gram 4000 gram

Turmeric 75 gram 22.5 gram 2.4 gram 1000 gram

Seasoning 74.5 gram 21.6 gram 2000 gram

Sugar 150 gram 150 gram 150 gram 150 gram 20000 gram

For each ingredient there is certain volume that always be available stocked in every production e.g. white turmeric, curcuma, turmeric, seasoning and sugar are 20000, 4000, 1000, 2000, and 20000 gram respectively. For working hoursm it is measured by applying time study method. The result is presented in Table 4. Table 4 Processing time of each product variants

White turmeric instant (minute) Peeling Instant mixing Pressing Boiling Capsule mixing Drying Capsule packing Instant packing

9 1.437 1.722 4.54 8.93

White turmeric capsule (minute) 2.88 0.59 5.76 5.48 -

Curcuma instant (minute)

Curcuma capsule (minute)

9 1.437 1.722 4.54 8.93

2.88 0.59 5.76 5.48 -

Turmeric instant (minute)

Staminur instant (minute)

Staminur capsule (minute)

Available time (minute)

9 1.437 1.722 4.54 8.93

2.7 0.431 0.517 8.93

0.288 1.36 0.059 5.76 5.48 -

21840 10920 10920 21840 10920 21840 10920 21840

Finally for the demand level, by employing a simple regression, the forecasting for each product is as follows.

152


Table 5 Forecasting of each product Product

Demand level

White turmeric instant White turmeric capsule Curcuma instant Curcuma capsule Turmeric instant ―Staminur‖ instant ―Staminur‖ capsule

184 unit 594 unit 88 unit 40 unit 11 unit 21 unit 12 unit

Combining goal and constraints above, a formula of the GP model here can be written as follows. Goal Min P5d1+ + P7d2+ + P8d3+ + P4d4- + P2d5- + P3(d6+ + d7+ + d8+ + d9+ P6(d11- + d12-) + P1d8Constraint: 75 X1 + 24 X2 + d1- - d1+ = 20000 75 X3 + 24 X4 + d2- - d2+ = 4000 75 X5 + 22.5 X6 + 2.4 X7 + d3- - d3+ = 1000 74.5 X6 + 21.6 X7 + d4- - d4+ = 2000 150 X1 + 150 X3 + 150 X5 + 150 X6 + d5- - d5+= 20000 9 X1 + 2.88 X2 + 9 X3 + 2.88 X4 + 9 X5 + 2.7 X6 + 0.288 X7 + d6- - d6+ = 21840 1.437 X1 + 1.437 X3 + 1.437 X5 + 0.431 X6 + d11- - d11+ = 10920 1.722 X1 + 1.722 X3 + 1.722 X5 + 0.517 X6 + d7- - d7+ = 10920 4.54 X1 + 4.54 X3 + 4.54 X5 + 1.36 X6 + d8- - d8+ = 21840 0.59 X2 + 0.59 X4 + 0.059 X7 + d12- - d12+ = 10920 5.76 X2 + 5.76 X4 + 5.76 X7 + d13- - d13+ = 21840 5.48 X2 + 5.48 X4 + 5.48 X7 + d9- - d9+ = 10920 8.93 (X1 + X3 + X5 + X6) + d10- - d10+ = 21840 7

 Xn  Sn

+ d10+) + (1) (2) (3) (4) (5) (6) (7) (8) (9) (10) (11) (12) (13) (14)

for n = 1,…,7 where Xn = product variants, and Sn = demand level

n 1

For all Xi ≥ 0 The constraint (2) to (6) expressing the necessary of ingredients used for each product, while for constraint (7) to (13) represent the processing activities needed for each product. And constraint (14) prompt a policy that the company want to avoid over production by as many as forecasted demand level. Result and Discussion The optimal solution for the GP proposed here is obtained by the Simplex method. For the slack or inventory excess of the production planning is as follows.

153


Table 5. The resources excess Goal (G)

Objective function

G1

Min P1d8-

G2 G3 G4 G5 G6

Min P2d5Min P3(d6+d7+d8+d9+d10) Min P4d4Min P5d1+ Min P6(d11- + d12-)

G7 G8

Min P7d2+ Min P8d3+

Slack Labor hours unused as amount of 21139.52 menit Nil or need addition of 5350 grams sugar Nil Excess of 176.3 grams spice Nil Un-allocated hours as amount of 10698.27 minutes and 10538.86 minutes of mixer and oven usage Need addition of 3560 grams curcuma Need addition of 326.30 grams turmeric

Status Not achieved Achieved Achieved Not achieved Achieved Not achieved

Not achieved Not achieved

It can be discussed that the company unable to fill the demand level but optimal to make to stock. The result also shows that the performance and target that could be achieved in order to get maximum profit. The production planning should consider to supply more of 5350 grams sugar, 3560 grams curcuma, and 326.3 grams turmeric respectively. The GP model here also indicate amount of products that have to be produced and amount of materials needed in order to make an efficient stock facing the demand level. The most important find in this study is how to allocate resources to meet the demand. Optimal production needs several conditions that visible to give a maximum profit for the company. At the same time give an insight for management regarding its inventory policy for materials and stock. It is preferred to have a good due to perishability character of the material. In further, due to the excess inventory of some resources, the company can consider to produce more products with a consequence to make more extensive sales effort of related products as well as effective capacity planning.

Conclusion Based on the results, the company of An Nuur Herbal Indonesia is facing a problem in production planning due to imbalance of production factors and productivity target regarding to a need to respond the market. The GP model that is used to solve the problem indicates a several slack (inventory excess) of some materials and also for working hours. In this regard, an addition of sugar, curcuma and turmeric in fact needed more while other have an excess. An improvement in sales can increase an opportunity to raise the profit. This should be synergized to capacity planning.

154


References Agency for Agricultural Research and Development. 2007. Prospect and purpose development agribusiness medicine crop. 2. Agricultural Department of Indonesia . Choudary, D, and Shankar, R. 2014. A goal programming model for joint decision making of inventory lot-size, supplier selection and carrier selection. Computers & Industrial Engineering 71 (2014) 1–9. Heizer, J., and Render, B. 2011. Operations Management. Eleventh edition. Prentice Hall. New York. Leung, S.C., & Chan, S.W. 2008. A goal programming model for aggregate production planning with resource utilization constraint. Computers & Industrial Engineering 56 (2009) 1053– 1064. Ozdamar, L., Bozyel, M. A., and Birbil, S. L. 1998. A hierarchical decision support system for production planning (with case study). European Journal of Operational Research, 104, 403–422. Romero, C. 1991. Handbook of critical issues in goal programming. Oxford: Pergamon Press. Sink, D.S. 1985. Productivity Management: Planning, evaluation measurement, control, and improvement. John Wiley and Sons: New York Tangen, S. 2002. A theoretical foundation for productivity measurement and improvement of automatic assembly systems. Licentiate thesis, The Royal Institute of Technology, Stockholm,3, 19-30.

155


Risk Management Approach for Equipment Maintenance at Sugar Cane Factory (Study at PG Madukismo, Yogyakarta) Adi Djoko Guritno*) 1) and Henry Yuliando 1) 1)

Department of Agroindustrial Technology, University of Gadjah Mada, Indonesia *)


Abstract

Sugarcane consumption in Indonesia is growing with the expanding population. The sugar supply mainly relies on national production that mostly are state companies with many of them are equipped by old aging facilities and facing land degradation of sugar cane. This condition causes a low yield, and therefore need a serious maintenance program to improve the yield. In this study, an analysis of maintenance management applied in a sugar company PG Madukismo, Yogyakarta, Indonesia is proposed. It is found that a risk identification that able to approach more appropriate equipment maintenance activities has not been properly implemented. The analysis of risk identification is based on ISO 31000:2009 to derive risk categories that inherent to each equipment in the sugar processing. It is started by classifying risk owners who in charge to certain equipment operations and followed by a description of the risk register, risk mapping, risk mitigation and risk treatment. The result shows that the risk register in the milling process consists of 20 types of equipment and led to require 10 types of maintenance activities. The risk mapping reveals 3 types as risk appetite, 14 types as avoid risk, and 3 types as transfer/sharing risk. The risk mitigation is then necessary to eliminate or minimize the loss during process due to improper maintenance that potential to cause some breakdown.. Here, predictive maintenance is an effective way to increase yield and it can be planned more accurate by proper risk management.

Keywords: Sugar factory, Risk identification, Risk mitigation, Maintenance management

Introduction Sugar consumption in Indonesia is growing with the expanding population. It reached 2,97 million tons for refined sugar per year, or 250 thousand tons per month in 2012. The supply mainly

156


relies on national production. The industry mainly are state companies consist of 51 plants in 2013 and mostly are equipped by old aging facilities.

Recently, sugar plants in Java Island have been experiencing a declining in sugar cane plantation area, and having a low yield as around 6-7%. (Soemitro in Baristand, 2013). As well as occurred at PG Madukismo, a state sugar plant located in Bantul Regency, Yogyakarta Province, Indonesia, beside experienced a low yield this plant is also equipped by old aging facilities that more than 20 years of usage. Plantation Directorate General (2010) reported that PG. Madukismo was facing a problem of land degradation caused by shifting cultivation to other crops. In sugar processing, the overall recovery of the plant is low, indicated by high production cost, low automation, low sugar quality, and weak innovation to diversify sugarcane products. PG Madukismo has been attempting to increase the yield by intensively apply maintenance activities. This company is used to implement three types of maintenance including preventive, breakdown and corrective maintenance. Each maintenance type differ in term of their schedule to be carried over. Preventive maintenance is done during off- milling season, while breakdown maintenance is during the milling session. Corrective maintenance is applied due to the breakdown frequency where the higher frequency should receive more priority for maintenance. However, the risk management that require to the risk owner or those who in charge in manage the equipment along with the maintenance activities has not been applied appropriately. The only reason of what risk management being applied in this company is the existence of corrective maintenance activities. It is realized that any breakdown during milling season causes material loss that in further influence the yield. Preventive maintenance becomes critical for achieving the high yield. However, Yuliando 2013, exposed that material loss in PG Madukismo mainly due to a lack to determine mean time between failure. Most of the by maintenance activities rely on the schedule planned according to the equipment which were breakdown in the last milling season. It is far from the goodness to combine maintenance and risk management. In this study, a risk management approach to obtain more appropriate maintenance activities in PG Madukismo is proposed. In this regard, to improve more effective maintenance management for each equipment is approached by the risk identification, risk registers, risk mapping and risk

157


mitigation. It is expected that by recognizing the risk and know-how to mitigate it, maintenance priority can be effectively constructed. Here, the risk measurement is based on perception of those (operators) who in charge to manage certain equipment related to the risk to failure. Guritno 1 et al., 2013 expressed that this method is valid for such assessment. Material and Method The management of risk places the main focus on how on avoiding the repletion of errors made in the past. As found in PG Maduksimo, the company often experienced breakdown in the milling process although already placed an intensive preventive maintenance. It can be realized that most of the maintenance plan is based on the which equipment that fail in the past milling season. In this study, the risk assessment is focused at milling plant department where the operators become respondents or perceived as the risk owners. The perceptual based research is conducted where respondent perceptions directing the discussion and conclusion of the result found. The sampling method used here is purposive sampling with a requirement that respondents understand the milling process equipment and have knowledge of maintenance management. Focus group discussion was conducted, discussing maintenance management related to the function, process, and capacity of equipment especially for milling process, which it can be categorized as a critical point in the whole sugar process production. The respondents were asked to give their opinion in the context of risk management for the equipment where the respondent acts as the risk owner. This is done in accordance to ISO 31000:2009 in risk identification manner. The assessment is based on impact/severity of failure occurred over the product including other damage that can appear according to the perception of the risk owner. The data gathered by this method is analyzed using risk management standard including risk identification, risk mapping, risk assessment, risk mitigation, risk treatment dan risk monitoring (Guritno, 2012). Factors to rate each process equipment is based on Equipment Criticality Rating (ECR) that influence the performance measurement of related equipment in the maintenance management.

Result and Discussion The milling process mostly equipped with old aging facilities, where operated by 5 operator consisted of chemist, supervisor head and 3 supervisors. These operators became respondents which act as the risk owner too. Type of risk are identified and assessed as follows.

158


1. Risk Analysis and Maintenance Management

1. Risk Analysis and Maintenance Management

Respondents were asked givetheir their opinion likelihood (the occurence frequency of Respondents were asked to to give opinionoverover likelihood (the occurence assessed) and severity (impact (impact intensity intensity caused by caused risk assessed) forassessed) each equipment in the frequency risk of risk assessed) and severity by risk for each equipmentmilling in the milling process. An assumption thatfunction all equipment function by process. An assumption that all equipment can accordingly can is understood accordingly is understood by respondents is pre-requirement before the respondents fill the 2 respondents is pre-requirement before the respondents fill the value of risk identification (Guritno value of risk identification (Guritno2 et al., 2013). Figure 1 below depicts overall risk al., 2013).equipment. Figure 1 below depicts overall risk mapping of utilized equipment. mapping ofetutilized

S E V E R I T Y

5

4

1;5;7; 8 ; 9 ; 10 ; 11 ; 15 ; 17

4

3 ; 13 ;

2 ; 12 ; 20

16

3

6 ; 14 ; 19

3

4

18

2

1 1

2

5

L I K E L I H O O D : APPETITE RISK

: TRANSFER/SHARING RISK

: AVOID RISK

: MANAGE RISK

!

Notes 1 : Cane crane 2 : Cane table 3 : Cane adjuster 4 : Cane carrier 5 : Unigrator 6 : Elevator 7 : Milling 1 8 : Milling 2 9 : Milling 3 10 : Milling 4 11 : Milling 5 12 : Intermediate crane 13 : DSM screen 14 : Door clone 15 : Imbibition pump 16 : Raw juice pump 17 : Oil pump 18 : Hydraulic pump 19 : Juice bin 20 : Turbine

1. Risk mapping of milling process equipments. Figure 1.Figure Risk mapping of milling process equipments

The above figure shows that most of the equipment include to the category of avoid The above figure shows that most of the equipment include to the category of avoid risk and risk and transfer/sharing risk led to a conclusion that most of equipments must perform transfer/sharing led to a conclusion most overal of equipments mustwhen performitaccordingly due to a accordingly due to a risk significant impact that to the process breaks down (experiencesignificant failure).impact In practice, this category clarifies thatdown operators must failure). concernInand pay athis to the overal process when it breaks (experience practice, full attention that related equipments mustconcern function or intolerant failure. In category clarifies that operators must andappropriately pay a full attention that related to equipments must this case the appropriate maintenance activity is preventive management emphasizing to the function appropriately or intolerant to failure. In this case the appropriate maintenance activity is use of plan and schedule in doing maintenance. This is done to anticipate problems that can preventive emphasizing the use of plan and schedule in doing maintenance. This is cause damage to themanagement equipment or keep the toequipment to function normally. Thedone group of manage risk indicate risk that appear in high frequent but have to to anticipate problems that cantypes cause of damage to the equipment or keep the equipment no significant impact. function normally.For this group the proper maintenance activity is predictive maintenance. In this case, the evaluation of periodic maintenance (preventive maintenance) group of manage risk indicate types of risk that appear in high frequent but have no stem from severalThe indicators, which installed to equipment (vibration, temperature, pressure, etc.). The group transfer/sharing risk equipment159such as cane carrier, DSM and cane adjuster can cause a significant disturbance in the process when these occur. The plant needs to divide and cooperate with others to minimize the impact. In this group, a neceesary maintenance activity is corrective maintenance that must be planned prior to setup time


significant impact. For this group the proper maintenance activity is predictive maintenance. In this case, the evaluation of periodic maintenance (preventive maintenance) stem from several indicators, which installed to equipment (vibration, temperature, pressure, etc.). The group transfer/sharing risk equipment such as cane carrier, DSM screen and cane adjuster can cause a significant disturbance in the process when these occur. The plant needs to divide and cooperate with others to minimize the impact. In this group, a neceesary maintenance activity is corrective maintenance that must be planned prior to setup time based on a feasible operating lifetime of particular equipment. The operating time usually is determined according to efficient capacity. And the maintenance is focused to a failure caused by upper limit control. This is to anticipate deviation prior to failure. Finally, for equipment classified as appetite risk, considering the low impact over the risk, the proper maintenance activity is breakdown maintenance. This maintenance usually will give a significant result the whole process. The following Table 1 covers the whole maintenance activities that are necessary to anticipate risk types of milling plant equipment.

160


Table 1 Risk assessment and appropriate maintenance category

No 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

Equipment

Likelihood

Risk Implication Risk type based Severity on Risk Mapping 5 Avoid risk 4 Avoid risk 4 Transfer risk 5 Transfer risk 5 Avoid risk 3 Appetite risk 5 Avoid risk 5 Avoid risk 5 Avoid risk 5 Avoid risk 5 Avoid risk

Cane crane 3 Cane table 3 Cane adjuster 2 Cane carrier 2 Unigrator 3 Elevator 2 Milling 1 3 Milling 2 3 Milling 3 3 Milling 4 3 Milling 5 3 Intermediate 3 4 Avoid risk carrier Dsm screen 2 4 Transfer risk Door clone 2 3 Appetite risk Imbibition pump 3 5 Avoid risk Cane juice pump 4 4 Avoid risk Oil pump 3 5 Avoid risk Hydraulic pump 4 5 Avoid risk Raw juice bin 2 3 Appetite risk Turbine 3 4 Avoid risk Note: Severity and likelihood are data modus of 5 respondents

Maintenance Category Preventive Preventive Corrective Corrective Preventive Breakdown Preventive Preventive Preventive Preventive Preventive Preventive Corrective Breakdown Preventive Preventive Preventive Preventive Breakdown Preventive

2. Risk Mitigation The next analysis is an assessment over likelihood and severity of risks that inherent to certain equipment in milling process. The score of 1 to 5 is used in scaling likelihood and severity of risks assessed. The validity of data is based on respondent numbers and judgement sampling. The result is then plotted to depict the risk position as an approach of risk mitigation. This measurement is classified as Equipment Criticality Rating (ECR) which is aimed to rate equipment in priority order of importance to the continued operation of a facility. Equipment that stops production, or that causes major production costs when failed, is considered most critical. Once criticality is known, maintenance is matched to the priority and importance of the equipment continued operation. The correlation of ECR and maintenance management as shown in following tables.

161


Table 2 Relationship matrix between equipment score and ECR factor. Equipment Criticality Rating (ECR) Factor Capacit

y Idle

time Mean Applica

downof bility

time monitori Spare ng part techniqu lead Vendor e time availabil

ity Realibili

ty Commer

cial Life

support

Equipment

Safety

No

S L S L S L S L S L S L S L S L S L S L 1 Cane crane

3 2 4 2 5 2 3 2 1 2 3 2 4 2 4 2 3 2 3 2

2 Cane table

4 2 3 2 3 2 3 2 4 2 4 2 4 2 2 2 4 2 5 2

3 Cane adjuster

1 2 1 2 1 2 2 2 1 2 4 2 2 2 4 2 2 2 1 2

4 Cane carrier

5 2 5 2 5 2 4 2 4 2 3 2 4 2 4 2 5 2 5 2

5 Unigrator

5 2 5 2 5 2 4 2 4 2 4 2 5 2 4 2 5 2 5 2

6 Elevator

1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 1 1

7 Milling 1

5 2 5 2 5 2 4 2 5 2 4 2 4 2 4 2 4 2 4 2

8 Milling 2

5 2 5 2 5 2 4 2 5 2 4 2 4 2 4 2 4 2 4 2

9 Milling 3

5 2 5 2 5 2 4 2 5 2 4 2 4 2 4 2 4 2 4 2

10 Milling 4

5 2 5 2 5 2 4 2 5 2 4 2 4 2 4 2 4 2 4 2

11 Milling 5

5 2 5 2 5 2 4 2 5 2 4 2 4 2 4 2 4 2 4 2

12

Intermediate carrier

5 2 5 2 5 2 4 2 3 2 4 2 4 2 4 2 5 2 5 2

13 DSM screen

3 2 3 2 4 2 3 2 1 2 2 2 3 2 3 2 3 2 5 2

14 Door clone

2 2 2 2 1 2 3 2 1 2 2 1 3 1 2 1 3 1 3 1

15 Imbibition pump

5 2 4 2 4 2 3 2 1 2 2 2 3 2 4 2 3 2 4 2

16 Cane juice pump 5 2 4 2 4 2 3 2 3 2 2 2 3 2 3 2 3 2 3 2 17 Oil pump

5 2 5 2 5 2 4 2 4 2 4 2 3 2 3 2 2 2 2 2

18 Hydraulic pump

5 2 5 2 5 2 4 2 4 2 2 2 5 2 3 2 5 2 5 2

19 Raw juice bin

4 1 3 1 3 1 3 1 2 1 2 1 2 1 4 1 3 1 3 1

20 Turbine

4 2 5 2 5 2 4 2 5 2 4 2 4 2 4 2 5 2 4 2

Notes: S= Severity, L= Likelihood

162


Table 2 shows that ECR factor give a different risk level for each equipment. The risk intensity that predicted by risk owners realtively high for milling equipment, but overal all equipment having low likehood that proper to be categorized as transfer/sharing risk. This means that management can divide maintenance activities based on priority, spare parts inventory, procurement schedule, and cost. Table 3 Activities of Maintenance Management. No

Activity Checking cane impurity prior entering milling process 1* (trash) 2* Routine checking for each lot of cane (pol) 3* Chain checking of cane table 4 Position adjustment of cane from cane table into unigrator 5* Adjust hammer tape handlebar at unigrator 6* Adjust hammer tape position at unigrator 7 Checking cane flake at unigrator 8* Routine checking of first juice polar (POL) 9* Adjust water usage and temperature 10 * Routine checking of remain cake over first milling process 11 * Adjust hydraulic pressure at all milling machines 12 * Checking screen under milling 13 Adjust mash screen of all milling 14 * Checking roll roughness at all milling 15 * Adjust milling RPM 16 * Adjust flake shape at all milling 17 * Adjust cake flow at milling 1 to 5 18 * Checking open gear oil at all milling 19 Cleaning scheduling for all milling (crusher wash) 20 Seal checking of hydraulic 21 Pipe checking 22 Adjust all pump motor position 23 * Adjust screw strain at all machine parts 24 * Adjust machine oil 25 * Checking water coolant of turbine Notes: Severity and likelihood are modus of 5 selected respondents

S

L

4

4

4 4 2 5 4 3 4 5 5 5 5 5 5 5 5 4 4 5 5 3 3 5 5 5

4 5 5 4 4 3 5 5 5 5 4 2 4 5 4 5 5 3 2 2 4 4 5 5

*= classified as avoid risk Table 3 reflects that workers in milling plant perceipt that maintenance management is crucial and therefore they pursue preventive maintenance in order to avoid a significant impact (Fujianti et al., 2012). Combined to risk analysis in ISO 31000, this preventive activities aims to risk mitigation and risk treatment. The mitigation is considered as preventive activity, and risk treatment is a guideline to mitigate the risk when it occures.

163


Table 4 below explores type of risk mitigation and risk treatment at PG. Madukismo as found to the related case. Table 4 Risk mitigation and risk treatment for milling process at PG. Madukismo Activity

Risk Mitigation

1

Inspection at harvesting

2 3

Inspection at intake station Spare of cane table Surveillance of employee during process Adjustment of blunt hammer handlebar Schedule of hammer handlebar for each 1000 tons cane Inspection of flake stem from unigrator

4 5 6 7 8

Laboratory test each hour for yield

9

Water usage at 70 – 75oC

10

Laboratory test each hour for yield

11 12 13 14 15 16 17 18 19 20 21 22 23 24

Conditioning pressure set up prior milling Periodic inspection over screw tautness Optimizing preventive management Crusher checking every 1000 tons cane milled Checking juice yield Routine checking of triangle crusher by supervisor Employee surveilance Oil checking Crusher washing every after 1000 tons cane milled Periodic unigrator seal replacement Stock of pipes Initial adjustment after set up Active surveillance by supervisor in each shift Checking is undertaken by supervisor in each shift

164

Risk Treatment Worker addition at harvesting as quality controller Acceptance sampling Routine maintenance Cane crane on the table must be in parallel shape Adjustment schedule of hammer handlebar at unigrator to maintain sharpness and efficient energy consumption Laboratory test each hour as early warning to process Standard water steamer temperature Information taking each hour for yield of juice at each milling

Routine schedule for crusher replacement every 1000 tons cane milled

Adjust crusher RPM Replace triangle crusher every shift Routine inspection every shift change Planned schedule for reducing idle time Planned schedule for replacement For juice watering

Routine inspection and maintenance


25

Daily checking for turbine

Routine water coolant changing

To determine type of risk mitigation that work for preventive activities is based on risk owner decision. In this case, mitigation means compulsary steps to be carried over prior to the activity execution in order to minimize particularly avoid risk category. However, in practice, several activities complete yet the mitigation as caused by absence, idle time, shortage, and so on, therefore in this case, risk treatment is necessary to overcome the problem when such risks appear. The benefit of this risk analysis is to guarantee that the process can achieve target and performance as determined by company.

Conclusion Concerning to the case of PG. Madukismo, the risk in sugar milling process are categorized as avoid risk and transfer/sharing risk that need mitigation procedures. Particularly, transfer/sharing risk is indicated by ECR factor. While, the relationship between maintenance and risk management can be describe into preventive maintenance is for avoid risk, corrective maintenance is for transfer/sharing risk, and breakdown maintenance concern to appetite risk. The risk mitigation is necessary to be done prior process running and in practice, when the mitigation is yet accomplished, risk treatment is necessary to complete the procedure.

Acknowledgement Authors convey a big appreciation to Ms. Mariani Agustin, alumnus of Agro-industrial Technology Gadjah Mada University, for kind of help in data gathering.

References Baristand (Balai Riset dan Standarisasi Industri) Padang, Indonesia, 2013. Revitalitation of Cane Sugar Industry in Indonesia. http://baristandpadang.kemenperin.go.id/news43-kunci-menujurevitalisasi-industri-gula-nasional.html. (in Indonesia language) Directorate General of Plantation Department of Agriculture. 2010. Blueprint of Self-sustaining National Cane Sugar 2012-2014. Department of Agriculture, Republic of Indonesia. Jakarta. Fujianti R, Guritno AD, Suwondo E. 2012. Valuation of supply chain performance in fresh vegetables using the analytical hierarchy process (AHP) and supply chain operations

165


references (SCOR). Proceedings of a Conference on the Development of National Competitiveness; 2011 Nov 16-18; Yogyakarta. 434 p. Guritno, A.D. 2013. Development of supply chain risk management of fresh vegetables. Proceeding of Food Innovation Asia Conference 2013: Empowering SMEs through science and technology. Bangkok, Thailand. Guritno1, A.D., Suwondo, E., and H. Yuliando, H. 2013. The inventory management approaches using inventory balance and decision of inventory acroos suply chain of fresh vegetables. Proceeding of the Internatinal Conference on Operation Research OR 2013, Rotterdam, Netherlands. Guritno2, A.D., Suwondo, E. Yuliando, H., Ushada, M., and H. Murase. 2013. Development of drum-buffer-rope algorithm to control capacity constrained machine in a bioproduction system. Proceeding of the 2013 IFAC Bio-Robotics Conference, International Federation of Automatic Control. Osaka, Japan. Guritno, AD, 2012. Software Development of Risk Management. PT Timah (Persero) Tbk, Jakarta. Kusumaputri DA, Guritno AD, Suwondo E. 2012, Evaluation of inventory decision and inventory balance of fresh vegetables in several stages of supply chains. Proceedings of a Conference on the Development of National Competitiveness; 2011 Nov 16-18; Yogyakarta. 434 p. Yuliando, H, 2013. The implication of mean time between failure to the reliability management at PG Madukismo. Proceeding of 4th annual Seminar of Indonesia Association of AgroTechnologist Profession. p323-343.

166


Supply Chain Risk Management and Logistics Cost Structure Analysis of Corn (Zea mays L.) to Reduce the Negative Effects of Mycotoxins Growth Megita Ryanjani Tanuputri1 *, Adi Djoko Guritno2, Novita Erma Kristanti2 1

Student at Department of Agroindustrial Technology, Faculty of Agricultural Technology, Gadjah Mada University, Yogyakarta 55281, Indonesia.

2

Faculty member at Department of Agroindustrial Technology, Faculty of Agricultural Technology, Gadjah Mada University, Yogyakarta 55281, Indonesia *Corresponding author: [email protected] ; [email protected]

Abstract Corn (Zea mays L.) is a susceptible agricultural commodity by mycotoxins contamination and it possibly causes negative effects on food safety. Environmental conditions throughout the supply chain as a key trigger of mycotoxins growth can be identified visually. The objectives of this study are (1) to identify the factors triggering the growth of mycotoxins, (2) analyze the cost structure of logistics, and (3) mitigate the potential risks associated with logistics costs to reduce the mycotoxins. The research was conducted by convenience sampling method and in-depth interview to the respondents throughout the supply chain. Locations of this study were done in central of corn production in Central Java and Yogyakarta province, Indonesia. Risk analysis method using the ISO 31000:2009 standard and logistics cost structure analysis using Activity-Based Costing. The results show that the emergences of mycotoxins were identified at each stage of the supply chain (farmers, collectors, traders, and users). In the avoid risk category of farmers level, there were 4 activities and in the level of the collectors and traders respectively consisted of 3 activities. Risk mitigation at the farmers level is proposed through the involvement of technology in the improvement of pre-harvest handling, while at the collectors and traders level can be done through the lead time reduction and controlling of water content below 17% wet basis in inventory. Analysis of logistics cost structure shows that the dominant logistics cost is identified in the material handling, transportation and inventory activities that contribute to 66.66%, 16.08% and 8.97% of the total logistics cost. Combination of avoid risk category and logistics costs along supply chain proposed recommendation to improve material handling and inventory activities. This research concludes that there is a linkage between the structure of logistics costs and preventive activities to prevent mycotoxins growth happens along the supply chain. Keywords: Corn, Supply chain, Mycotoxins, Risk management, Logistics costs Introduction Besides serving a significant role for human‘s daily need, corn is one of commodities having great potential as people demand it either for food or animal feed. Unfortunately, corn is one of

167


seasonal crops. Moreover, it is easily getting rotten and contaminated by many kinds of microorganisms, bacteria, and fungi. Even worse, the condition of Indonesia with a tropical climate having high temperature, high humidity, heavy rainfall, and poor sanitation condition fastens the decay and contamination of corn which will lead to declining quality of corn and negatively affect food safety. The declining food safety will have adverse impact on the attempt of achieving food security. One of the most serious threats for the quality of corn is the contaminating fungi producing mycotoxin, in which Bahri and others (2004) states that corn stored with high water content in a poor sanitation will easily get infected by A. flavus and A. parasiticus. From the background above, it is necessary to apply risk management on corn supply chain to reduce the short-term and longterm risk of mycotoxin contamination. Moreover, the risk scale is determined by risk owner, so that the mitigation given will be suitably prevent the risk scale. The risk mitigation could be illustrated as an action that should be done before the risk happen, so it could be more effective for losses reduction. Within a supply chain, we need an integrated attempt for every stage which can be performed through coordination, collaboration, and sharing information, so that we can minimize the production cost and maximize the service. Information sharing in terms of logistics cost serves as an indicator in monitoring and evaluating logistics activities in order to minimize the total system-wide cost (Pishvaee and others 2009, Ongkunaruk and others 2011). The cost structure analysis in this research is conducted to find out the proportion of logistics cost and determine the manageable activities. This analysis can be used as supporting information of risk analysis and basis data of the evaluation of logistics cost allocation. This research aims to identify the factors triggering the growth of mycotoxin and analyze the logistics cost structure. Afterwards, in related to the logistics cost, we can perform risk mitigation to prevent the potential growth of mycotoxin. The combination of both is aimed at reducing mycotoxin risk for the activities with dominant logistics cost. Materials and Methods The research is conducted in Central Java and DIY province by putting main concern on risk scale aspect and logistics cost aspect along the corn supply chain. The researcher uses convenience sampling and in depth interview towards to collect data from agents along the supply chain. In depth interview is chosen to obtained information that illustratively describe the real condition

168


thoroughly. For the risk analysis method, the researcher uses ISO 31000:2009 standard and focuses on risk identifying, risk analysis, and risk mitigation. Through the in depth interview, the researcher can identify the potential risks for each tier whose probability and impact will be assessed and mapped in the risk mapping. This is conducted to know the categorization of each risk and then recommend the preventive action based on the prioritized risk level. The following step is performing analysis of logistics cost structure using activity-based costing. According to Ongkunaruk and others (2011), the first step of logistics cost structure analysis is determining logistics activity. The second step is calculating the logistics cost per quintal corn for each activity and analyzing it. The result of this analysis will then be correlated to the obtained risk scale in order to determine the preventive action able to reduce the potential growth of mycotoxin. Results and Discussions On the basis of the field survey conducted in the two regions, the researcher can draw the corn supply chain illustration as illustrated in Figure 1 below. TIER 1

TIER 2

TIER 3

TIER 4

Traders Animal Feed Manufacture Farmers

Collectors

Supplier

Traders in traditional market

Local Breeder

Figure 1. Corn supply chain The farmers perform pre-harvest activities and post-harvest activities such as corn threshing, drying, and packaging. Some of dry grain of corn will mostly be sold to collectors in their area, while some others will be directly sold to traders in the market. Most of corn collectors collect corn from the surrounding farmers to fulfill the demanded quantity. Their activity will usually range from redrying, packaging, and distributing it to the next tier. Most of corn collectors deliver their corn to traders (whole saler), but some of them may also sell it to the market traders, suppliers, or directly to users who mostly are local livestock breeder with smaller quantity. The stakeholder in the third stage consists of traders, suppliers, and market traders. Traders and suppliers collect corn from

169


many areas in large quantity as they are bound to a signed contract with animal feed manufacturer besides distributing it to the local great scale breeders. The stakeholders in the third tier perform the activities to preserve the raw material such as redrying, packaging, and direct distribution to users.

Supply Chain Risk Management of Corn The data, both supply chain risk and logistics cost, is obtained from 38 respondents which are consist of 12 farmers, 8 collectors, 12 traders and 6 users from both province. From the initial observation, identified risk consists of pre-harvest risk and post-harvest risk include dryness, threshing technique and storage condition. The research shows that the potential growth of mycotoxin has been identified since the farmers stage and that the proof of its existence occurs in each stage of corn supply chain. However, the different management in dealing with this problem in each tier will lead to different opinion in viewing the potential risk and the risk scale. This difference is related to corn handling in each stage, so it will result different evaluation. The probability value and impact of each identified risk is then mapped in risk mapping as shown in Figure 2. Probability value was determined based on percentage of identified risk occurrence in the given period. Risk of corn husk condition was occurred in almost every period of planting, so it can be classified into high probability. Impact, meanwhile, was determined based on the amount of losses occurred. The risk matrix is divided into 4 categories. Appetite risk which is symbolized with white color is a risk with low probability and impact which is why it can still be tolerated. Manage risk, the green quadrant, is a risk with high probability but relatively comes with small impact which is why it is necessary to decrease its probability to a lower level. Transfer risk which is symbolized in yellow is a risk demanding others involvement to divide or transfer its impact. Meanwhile, avoid risk symbolized in red is a risk with high probability and impact so that it needs preventive action in order to manage the loss. Based on those four risk levels, we can assume that avoid risk is the most prioritized risk needing the preventive action. It is due to its high probability and impact. Based on Figure 2, we can identify that there are four risks in the category of avoid risk at the farmer‘s stage, namely pre-harvest risk, drying risk, and threshing out technique risk. Pre-harvest risk include ‗klobot‘ (dried corn husk) condition risk and infection occurrence. The risk mitigation given is technology involvement both in the pre-harvest activity and post-harvest activity, such as

170


the using of seed variety that perfectly covering stem, regular pesticide spraying, the usage of thresher and dryer machine to anticipate the decayed corn

Figure 2. Risk mapping of corn supply chain

due to wrong threshing technique and damp corn due to incessant rainfall. The avoid risk category in the collector‘s stage and trader‘s are water content level risk of the material and storage risk. Thus, the preventive action which should be taken is reducing lead time selling through purchase appointment with either supplier or traders, shortening corn supply chain, concerning about the water content of the corn during purchasing process and maintaining the storage to keep the water content below 17% wet basis by using a pallet and managing air

171


circulation of the storage. At the user‘s stage, the avoid risk category lies in the storage risk so that the users needs immediate consumption as the preventive action. This can be done through small purchase quantity with a more frequent intensity.

Logistics Cost Analysis Table 1 Average and proportion of logistics cost and its details on activities of corn

The logistics activity along the corn supply chain is divided into six activities as described in Table 1. The logistics cost is counted per quintal corn for each tier and then calculated to find its average and percentage of the total logistics cost. From the calculation result, we can find the proportion of each activity as described above. Table 1 shows that the total logistics cost is dominated by material handling cost with 66.66%. The second biggest cost is transportation which reaches 16.08%, followed by inventory with 8.97%, maintenance with 5.09%, procurement 2.42% and information with 0.78% from the total logistics cost. Meanwhile, table 2 shows that material handling cost is dominated by post-harvest cost and on-farm cost with 44.19% and 39.75%. Post-harvest cost consists of labor cost to conduct postharvest activity starting from drying, threshing out, packaging, until goods transporting. On-farm cost is only conducted by farmers since the collectors and sellers do not perform any on-farm activities. Table 2 Proportion of the logistics cost categorized by activities Procurement (2.42%)

Purchasing transportatiom cost (67.59%), Communication cost (100%)

172

The 16th FOOD INNOVATION ASIA CONFERENCE 2014 12 -13 June 2014, BITEC Bangna, Bangkok, Thailand Material Handling (66.66%) Maintenance (5.09%) Inventory (8.97%) Transportation (16.08%) Information (0.78%)

On-farm cost (39.75%), post-harvest cost (44.19%), inspection cost (2.64%), depreciation of equipment (3.78%), losses during material handling (9.64%) Maintenance of equipment (61.17%), maintenance of vehicle (38.83%) Holding and opportunity cost (100%) Delivery cost (69.61%), depreciation of vehicle (9.31%), losses during delivery (21.08%) Communication cost (100%)

Based on table 1, it can be seen that besides on-farm cost and post-harvest cost, delivery cost has a quite high percentage with 11.07%, while the inventory cost reaches 8.97% from the total logistics cost. Farmers have biggest delivery cost due to high price of fuel and high driver wage with limited delivery capacity which is why it is less effective. The biggest proportion of inventory cost lies in the opportunity cost of inventory of supplies.

Figure 3 Proportion of logistics cost in each stage of corn suply chain

Figure 3 indicates that at all stage, the activity with the biggest average logistics cost is material handling, transportation, and inventory. Meanwhile, in the risk analysis, the activity which is listed as avoid risk category is the material handling activity (drying and threshing out) and storage. Maximizing the role and function of farmer group association by monitoring and evaluating the onfarm and post-harvest activities, procuring thresher and dryer machine with improvement technology, and facilitating massive delivery can be performed in order to fasten the selling, so that the risk of mycotoxin growth can be reduced and the logistics cost can be optimized as well. When the drying risk activity at the farmer‘s stage can be reduced, the risk of water content level of the corn in the collector‘s stage and traders can be minimized as well. Thus, the cost for the redrying activity can be allocated for sortation and grading activity during the purchase. In addition, the pallet usage and air circulation management as controlling of water content below 17% wet

173


basis in the storage will minimize the potential growth of mycotoxin in the well sorted and highly qualified grain of corn. Conclusions The corn supply chain is divided into 4 tiers which are consisting of farmers, collectors, traders and users. Based on category of avoid risk, we have concluded that material handling and inventory are the most prioritized risk in each tier. Risk mitigation in farmer‘s stage focused on corn thresher and dryer machine usage with technology improvement. Moreover, risk mitigation in collectors and traders are reducing lead time selling, controlling the water content and maintaining the storage by using a pallet and managing air circulation. In addition, we have studied logistics cost to present the major logistics activity and related it to risk analysis. In fact, 66.66% of logistics cost is material handling cost, then followed by transportation and inventory cost. Therefore, preventing mycotoxin growth can be done by maximizing the role of farmers group in material handling to transportation activity and controlling of water content in storage. References Bahri S, Romsyah M, Raphaella W. 2004. Review The Effects of Mycotoxin of Poultry Performance. Journal of Indonesian Medical Mycology Vol. 4 No 1-2/Vol. 5 No 1-2, p 53-64. Ongkunaruk P, Chonlachart P. 2011. Logistics Cost Structurefor Mangosteen Farmers in Thailand. System Engineering Procedia 2: 40 – 48. Pishvaae MS, Hadi B, Mohsen SS. 2009. Supply Chain and Logistics in National, International and Governmental Environment. Berlin: Springer-Verlag. p 57-66.

174


Production of Fructosyltransferase Recombinant Enzyme from Kaentawan (Helianthus tuberosus L.) by Pichia pastoris X-33 Kriengsak Boonchoo1, and Budsaraporn Ngampanya1* 1

Department of Biotechnology, Faculty of Engineering and Industrials Technology, Silpakorn University, Muang, Nakhonpathom 73000 * Corresponding author: [email protected]

Abstract Fructo-oligosaccharides (FOS) are increasingly used in many health food products as a prebiotic. Kaentawan (Helianthus tuberosus L.) tuber is considered as a good source for the industrial production of FOS due to its high contents of accumulated FOS. In order to produce high amount of FOS by means of enzyme synthesis under in vitro conditions, sufficient amounts of enzyme in group of fructosyltransferases which involved in FOS synthesis should be considered. The aim of this research was to produce 1-fructan: fructan fructosyltransferase (1-FFT, EC: 2.4.1.100) in recombinant form by using Pichia pastoris X-33 as heterologous expression host. The 1-fft genes encoding for 1-fructan: fructan fructosyltransferase (1-FFT, EC: 2.4.1.100) was cloned from Kaentawan tuber and analyzed. The cloned 1-fft containing appropriated sites of restriction enzymes were then amplified and ligated to pPICZ B vector and transformed into P. pastoris X-33 by lithium chloride transformation method. The yeast transformants were selected on YPD medium containing 100 μg/ml zeocin™ and analyzed by PCR method. The yeast transformants harboring 1-fft genes were grown for production of recombinant enzyme. The obtained recombinant enzyme was analyzed for FOS synthesis by using 1- kestose as substrate. The yeast transformants with capable of 1-FFT recombinant enzyme production were obtained. The yeast transformants name PF1 gave highest 1-FFT activity at 3.33 and 3.57 unit/L in cell and medium portion in respectively. The 1-FFT recombinant enzyme was successfully produced in P. pastoris X-33. It may benefit for fructooligosaccharide synthesis by means of enzyme synthesis. Keywords: 1-FFT, Pichia pastoris X-33, Fructo- oligosaccharide, Kaentawan, FOS Introduction Kaentawan or Jerusalem artichoke (Helianthus tuberosus L.) is a tuberous annual crop which stored fructans in the form of inulin and fructo-oligosaccharides (FOS) as reserve carbohydrates (Khajarern et al., 2006). FOS is fructose polymers with a degree of polymerization (DP) in range of 2-10. The short chain FOS (DP2-4) was not digested in the

175


human small intestine, but fermented in colon where the growth of probiotics such as Lactobacillus and Bifidobacteria were stimulated (Roberfroid et al., 1993). FOS was synthesized by the action of different fructosyltransferases (FTases) in vacuole of plant cells. Edelman and Jefford (1968) proposed model of fructan synthesis by concerted action of two FTases, 1- sucrose: sucrose fructosyltransferase (1- SST, EC:2.4.1.99) initiated reaction by catalyzing transfer of a fructosyl residue from sucrose to another sucrose molecule, resulting in the formation of 1-kestose (GF2) and 1- fructan: fructan fructosyltransferase (1- FFT,EC: 2.4.1.100) functioned to elongate the fructose chains in afterward (Edelman and Jefford, 1968). In order to synthesize FOS under in vitro conditions, sufficient amounts of 1- FFT is required. According to less amount of enzyme directly extracted from plants was obtained, an alternative means for producing enzyme was interesting. Expression of gene encoded 1- FFT derived from plants in heterologous microorganisms such as yeast and bacterial system have been paid more attentions due to high amount of recombinant enzymes would be obtained. Therefore, the cloning of 1-fft (Accession no. AJ009756.1) from Jerusalem artichoke were conducted in this study. The cloned gene was then sub cloned to pPICZ B vector for further expressing in yeast expression system. Materials and Methods Gene materials The 1-fft gene. inserted in pGEM®-T easy vector was obtained from previous experiment in our laboratory. The 1-fft gene was cloned from RNA of 105 days old tuber of Kaentawan by RT- PCR technique Subcloning of 1- fft gene into expression vector To construct expression vector with gene of interest named pPIC_1-fft, a PstI and SacII restriction sites were introduced to the 5‘ and 3‘ end of the mature protein by PCR. The primers pair; 1-fft_F_Pst I (5‘CAGCTGCAGTCAGTCACCATGCAAACCCC) and 1fft_R_Sac II (5‘CAGCCGCGGTGGTGCAGAAGCCATTTGCC3‘) were used to amplify gene following these conditions: an initial 5-min denaturation step (95°C) followed by 30 cycles of 94°C for 30 s, 52°C for 30 s and 72°C for 2 min and then a final step at 72°C for 7 min.

176


The amplified products were purified and then ligated to the pPICZα B (Invitrogen, USA) in frame with the α-factor from Saccharomyces cerevisiae. The resulting pPIC_1fft was transformed to E. coli strain JM109. The genes cassette of positive transformants was screened by restriction analysis. The expression vector harboring gene of interest was isolated and transformed to yeast cells. Pichia pastoris transformation and small-scale expression P. pastoris strains X-33 was transformed with linearized pPIC_1-fft plasmid following the lithium chloride transformation protocol. The screening of yeast transformants harboring pPIC_1-fft plasmid was performed on YPD medium supplemented zeocin as selective agent. To setup control of experiment, the empty vector (pPICZα B) was also transformed to yeast cell. Single colony of transformants growing on YPD containing zeocin was reinoculated on fresh YPD/Zeocin plates. Genomic DNA was extracted from yeast colonies grew on YPD with 100 µg/ml of Zeocin. To verify yeast transformants containing 1- fft, PCR of genomic DNA primed with AOX1 forward (5‘GAC TGG TTCCAATTGACAAGC3‘) and AOX1 reverse primer (5‘GCAAATGGCATTCTGACATCC3‘) was performed following these conditions: an initial 5-min denaturation step (95°C) followed by 30 cycles of 94°C for 1 min 55°C for 1 min and 72°C for 2 min and then a final step at 72°C for 7 min. The amplified PCR product was analyzed by gel electrophoresis. Yeast transformants containing 1- fft were inoculated in 20 ml of pre-culture medium (buffered glycerol- complex, BMGY) for a small-scale expression. After 18h of incubation at 30OC and 250 rpm, the cells (OD600nm= 1) were transferred to 50 ml of induction medium (buffered methanol-complex BMMY) and incubated under the same conditions. To keep a final concentration of methanol at 2%, it was replaced every 24h for 5 days. Yeast cells were centrifuged after fermentation was finished. The supernatant was concentrated by ultrafiltration (30,000 NMWC VivaSpin concentrators; VivaScience Ltd, Lincoln, UK). The activity of recombinant enzyme in cells and medium portions were determined by mixing 15µl of crude enzyme with 50 mM of 1-kestose in 100 mM of potassium phosphate buffer, pH 5.4 at 34OC for 6 and 12h. The produced carbohydrates were analyzed by HPLC. Determination of carbohydrates

177


The samples were filtered before injecting into HPLC. The separation and detection was performed by carbohydrate column coupled with refractive index detector (RID). The deionized water was used as mobile phase with flow rate of 0.4 mL min-1. The temperature of column was controlled at 45oC. Glucose, fructose, sucrose, 1-kestose, nystose, and inulin form chicory were used as the standards. Chromatographic peaks were identified by comparing sample retention times with those of known standards. Results and Discussions Construction of gene expression vectors for recombinant enzymes production in yeast system To produce recombinant 1- FFT from Kaentawan by yeast system, subcloning open reading frame (ORF) of 1- fft to expression vector was conducted. Firstly, the appropriated restriction sites (PstI and SacII) were introduced to ORF of genes by PCR and amplified products with expected size (about 1,800 bp) as shown in Fig. 1 was cut and eluted from agarose gel. The purified gene about 1,800 bp in size was cut by PstI and SacII and ligated to PstI and SacII- cut expression plasmid (pPICZ B vector). The ligated products were then transformed to E. coli JM109.

Figure 1 Analysis of the PCR product from pGEM®-T easy vector containing cDNA of 1- fft primed with 1-fft_F_Pst and fft_R_Sac II, on 1% (w/v) agarose gel. lane 1 : DNA marker (VC 100 bp plus), lane 2-3 : PCR products (about 1,800 bp in size)

178


The positive transformants were screen on medium containing zeocin as selective agent. The pPICZ B vectors containing ORF of 1- fft with appropriated restrict enzymes were isolated from colonies grown on YPD/zeocin. The restriction analysis was done to correct the orientation of gene. These expression vectors containing ORF of 1- fft was further transformed to yeast cells for enzymes production. Selection of yeast transformant Yeast Pichia pastoris X-33 was transformed by lithium chloride transformation method. The 4 yeast transformants grew on YPD medium containing 100 μg/ml zeocin™ were further analyzed by PCR method. The PCR amplified product of yeast genomic DNA primed with AOX1 forward and reverse primer was shown in Fig. 2. As the control transformant (empty vector, lane 2) gave 2 bands with ~2,200 bp and ~500 bp in size, it indicated that PF2, PF3 and PF4 (lane 4-6) were yeast cells harboring expression vector with 1-fft. It is normally that the 2 amplified products in size of ~2,200 and 2,300 (500 bp (part of AOX gene on yeast genomic DNA) + 1,800 bp of 1-fft) should be obtained. According to the poor resolution of amplified products with similar size on 1%agarose, only one band was seen.

179


Figure 2 Analysis of the PCR product from Genomic DNA of expected transformants containing 1-fft primed with AOX1forward and reverse primer on 1% (w/v) agarose gel . lane 1 : DNA marker ( 1kb, Fermentas), lane 2 : Control transformant (empty vector) lane 3 : Transformant PF1 lane 4 : Transformant PF2 lane 5 : Transformant PF3 lane 6 : Transformant PF4

Small-scale expression The three transformants harboring 1-fft gene were grown in BMGY medium and recombinant enzyme production was induced in BMMY medium for 5 days. The yeast transformants name PF1 gave highest 1-FFT activity at 3.33 and 3.57 unit/L in cell and medium portion in respectively. Conclusions The 1-FFT recombinant enzyme was successfully produced in P. pastoris X-33. It may benefit for fructooligosaccharide synthesis by means of enzyme synthesis.

180


Acknowledgement Financial support from Department of Biotechnology, Faculty of Engineering and Industrial Technology are gratefully acknowledged. References Abe, M., Ueno, K., Ishiguro, Y., Omori, T., Onodera, S. and Shiomi, N.. 2009. Purification, Clning and Functional Characterization of Fructan : Fructan 1-Fructosyltransferase from Edible Burdock (Arctium lappa L.). J. Appl. Glycosci. 56; 239-246 Edelman J, Jefford TG. The mechanisim of fructosan metabolism in higher plants as exemplified in Helianthus tuberosus. New Phytol. 1968; 67: 517-531 Khajarern J, Siriloaphaisan S, Thisong P. Kaentawan (Jerusalem artichoke) in animal feeds. Khon Kaen Agric. 2006; 34(2): 91-103. Roberfroid MB, Gibson GR, Delzenne N. The biochemistry of oligofructose, a nondigestible fiber: an approach to caloric value. Nutr Rev.1993; 51: 137-146.

181


A Comparison between the In Vitro Carbohydrate Digestibility and the Glycemic Response of Chinese Starchy Foods Aoitip Samanros*, Thitipong Phothisoot, Chiawei Chang, Jenshinn Lin Department of Food Science National Pingtung University of Science and Technology Pingtung, Taiwan 91201, ROC (Taiwan) * Corresponding author: ([email protected])

Abstract The rate of starch digestion and absorption seem to be important factors for the consumer‘s health, especially in diabetes patients. Therefore, the objective of this study was to evaluate the relationship between the results of in vitro determination of carbohydrate digestibility and the glycemic index in some kind of Chinese starchy foods. The samples were prepared as eaten and then rubbed through a stainless steel sieve, before digesting. The measurement of rapidly digested starch (RDS) and slowly digested starch (SDS) was based on the measurement of glucose released from a test food during incubation period with digestive enzymes. Data obtained from the experiment by using in vitro technique was compared to estimated GI values based on published paper for the same foods. It shows that the white bread had highest GI value of 100, followed by the brown rice (82), taro (69), Chinese sweet potato (52) and mung bean noodles yield the lowest GI of 28, respectively. The results showed that brown rice elicited the highest RDS, followed by taro, Chinese sweet potato and mung bean noodles, respectively. It was also found that RDS values and GI values in each samples had a significant positive correlation (r = 0.86 at p < 0.01), whilst SDS showed no significant correlation with GI. It may be concluded that the in vitro carbohydrate digestibility measurement could serve as a tool for measuring the starch fractions of differing digestibility that influent the glycemic impact of starchy foods. Keywords: In vitro carbohydrate digestibility, Glycemic response, Rapidly digested starch, Slowly digested starch Introduction Dietary carbohydrates are digested and absorbed at different rates to different extents in the human small intestine, depending on their botanical source and the physical form of the food. After digestion, carbohydrate (CHO) is changed to glucose. However, the rate of starch digestion and absorption seem to be important factors for consumer‘s health benefit, especially, non-insulin-dependent diabetes type II and hyperlipidimea. The GI is a classification of the blood glucose raising potential of carbohydrate rich food. It has particular relevance to those chronic diseases associated with central obesity and insulin resistance (Jenkin and others 2002). The GI value of food is normally determined by measuring the

182


blood glucose at defined interval of time for 2-3 h after feeding the test meals containing known levels of carbohydrates to human subjects. Either glucose or white bread has been suggested as a standard food. A GI value of  70 is considered high, a GI value 56-69 inclusive is medium and a GI value ≤ 55 is low, where glucose = 100. A food with low glycemic response is considered beneficial as nutritious food, especially for individual person who is suffering from impaired glucose tolerance. Low GI carbohydrates are classified as those that are digested and absorb at a slow pace with lead to a low glycemic response, while GI carbohydrates are rapidly digested in the gastro intestinal tract (GIT), and absorbed quickly from the small intestine showing a high glycemic response (Foster-Powell and others 2002, Jenkin and others 2002). Many factors may influence in vivo absorption, including the food form (physical form, particle size), type of preparation (cooking method and processing), type of starch (amylose and amylopectin), and amount of fiber, fat, and protein (Brouns and others 2005). However, the methodology for evaluating GI of human study is very expensive and time-consume, moreover, a few samples can be done at the same time. An alternative to this method is the in vitro method for analyzing the digestibility of carbohydrate containing foods, which constitutes the oral, gastric and intestinal phases of digestion. The advantages of in vitro digestion assays are that they are fast and cost-efficient and help to determine the effect of specific food components on starch digestion (Woolnough and others 2008). In Taiwan, there have been only a few studies of in vitro digestion method in starchy foods. Therefore, the purpose of this study was to evaluate the relationship between the results of in vitro determination of carbohydrate digestibility and the glycemic index in some kind of Chinese starchy foods. Materials and Methods Samples The test foods included brown rice (oryza sativa L. japonica), mung bean noodles, Chinese sweet potato (Ipomoea batata L. Lam), taro (Colocasia esculenta L. Schott) and white bread (reference material).

183


Sample preparation In food preparation, brown rice was washed twice and prepared by soaking (a ratio of rice to water was 1:1.5) overnight, cooked by a rice cooker for 40 minutes and smoldered for 10 minutes before test. Mung bean noodles were boiled with water (a ratio of noodles to water was1:1) for 15 minutes. Taro and Chinese sweet potato were skin peeled and cut into 5 cm cube and steamed by rice cooker for 50 minutes. The reference food was white bread. The samples were rubbed through a 2 mm stainless steel sieve. In vitro digestion Digestibility of starch food was determined by using in vitro CHO digestible method modified from Mishra and others (2008). This method was based on measurement of the amount of glucose release at 20 min (RDS) and during 20-120 min (SDS) from a test meal by incubation with digestive enzymes. The amount of glucose when released at different time was used as an indicator of CHO digestibility. The RDS and SDS values of each sample were done in three replicates. Briefly, the samples (2 g of carbohydrate) were digested in 60 ml polypropylene centrifuge tube. The digestion consisted of a simulated gastric digestion followed by small intestinal digestion, with timed sampling during the small intestinal phase. Twenty milliliters of water and 0.8 ml 1 M HCl were added to the sample in all the tubes to attain pH 2.5 (±0.2) followed by 1 ml of 10% pepsin dissolved in 0.05 M HCl. The mixture was shaked for 30 min at 37 C to accomplish gastric digestion. The ileal phase was initiated by neutralising the gastric HCl with 2 ml of 1 M NaHCO3 and 5 ml of 0.2 M maleate buffer (pH – 6.0/0.2% sodium azide/1 mM CaCl2) followed by 1 ml of 2% pancreatin solution in 0.1 M maleate buffer (pH – 6.0/0.2% sodium azide/1 mM CaCl2) and 0.1 ml amyloglucosidase. Digestion was timed from the addition of pancreatin and 0.5 ml aliquots were removed from all the tubes at 20, 60 and 120 min to 2 ml ethanol in tubes and mixed thoroughly. The tubes were centrifuged (1000 g for 2 min) to clarify them, and an aliquot of the supernatant was removed for analysis of reducing sugars. Sugars released during digestion were measured as monosaccharides by a modified DNS colourimetric method after an amyloglucosidase secondary digestion to complete depolymerisation of starch fragments to monosaccharides. A 0.05 ml aliquot of glucose standard (10 mg/ml glucose) or the ethanolic sample from the in vitro digestion was added to

184


0.25 ml of 1% amyloglucosidase in acetate buffer (pH 5.2) and incubated at 30 C for 10 min. Reducing sugars were measured by adding 0.75 ml DNS mixture (containing a 1:1:5 mixture of 0.5 mg/ml glucose: 4 M sodium hydroxide: DNS reagent) and heating for 15 min at 95– 100 C in a water bath. The tubes were cooled. 4 ml water was added and mixed. The absorbance was measured at 530 nm. Results and Discussions Figure1 shows the release of reducing sugars during in vitro digestion of test foods in small intestinal phase. All samples showed rapid starch digestion during the first 20 min, after that, the rate of digestion slowed down. White bread gave the highest amount of glucose released, followed by brown rice, taro, Chinese sweet potatoes and mung bean noodles, respectively.

Figure 1 Release of glucose during in vitro digestion of test foods. Values are means ± SD of 3 replicates.

Table 1 shows the amount of RDS and SDS in the test samples. The results showed that brown rice provided the highest RDS, followed by taro, Chinese sweet potato, and mung

185


bean noodles, respectively. On the other hand, Chinese sweet potato, taro, and brown rice showed high SDS while the white bread provided the lowest SDS. RDS measurement shows how food type and food processing can influence the physiologic properties of dietary CHO. White bread is highly processed food. The starch in bread is fully gelatinized and thus likely to be rapidly digested and absorbed, so this food has high RDS values. In this study, the brown rice had the high RDS value. It is an unexpected result because a characteristic of brown rice is often composed of the higher fiber content than white rice. Therefore, lower RDS is expected in this sample. The higher RDS from this study can be explained that the present soaking allows starch expansion, performs better gelatinization, and improves digestion. Mung bean noodles; however had low RDS value due to a dense food matrix which hinders enzymatic hydrolysis of starch. The result of mung bean showed lower RDS than other four starchy foods. Generally, mung bean noodles are made from high amylose of mung bean or pea starch which had been reported for lower GI effect (Kabir and others 1998). Because of its tightly packed structure, amylose is more resistant to digestion than other starch molecules. This important form of resistant starch has been found to be an effective prebiotic.

Table 1 Rapidly digestible starch (RDS) and slowly digestible starch (SDS) in Chinese starchy foods.

Sample

RDS (mg/g sample)

SDS (mg/g sample)

Mung bean noodles

23.93 ± 4.9

61.76 ± 11.9

Chinese sweet potatoes

44.31 ± 3.3

92.94 ± 17.0

Taro

86.14 ± 12.4

90.34 ± 30.7

Brown rice

109.25 ± 13.7

88.46 ± 18.8

White bread

302.26 ± 23.4

54.76 ± 8.1

Values are mean ± SD of 3 replicates.; RDS – Sugars released after 20 min digestion.; SDS – Sugars released between 20 and 120 min digestion.

186


The results obtained from this study. When compared with estimates of GI from previous published paper for the same foods (Lin and others 2010). They showed the same arrangement, which the white bread had the highest GI value of 100, followed by the brown rice (82), taro (69), Chinese sweet potato (52) and mung bean noodles yield the lowest GI of 28, respectively. Figure 2 shows the Pearson‘s correlation coefficient between RDS and GI; SDS and GI which were obtained from regression analysis. The data of present study reveals that RDS had a significantly positive correlation coefficient with GI values (r = 0.86, p0.05). Strong correlation has also been reported between the glycemic indices of meals determined in vivo and the ratio of rapid carbohydrate digestion rate and slow carbohydrate digestion rate from in vitro digestion assays (Araya and others 2002)

(a)

(b)

Figure 2 Correlation between RDS and GI of Chinese starchy foods; r = 0.86 (p < 0.01) (a), SDS and GI of Chinese starchy foods ; (p>0.05) (b). Conclusions The RDS values calculated for mung bean noodles, Chinese sweet potato, taro, brown rice, and white bread predict that these foods fall in the same GI values as in vivo

187


methodologies, which indicates that RDS correlates well with the GI of these foods. The simple in vitro carbohydrate digestibility measurement could serve as a tool for measuring the starch fractions of differing digestibility that influent the glycemic impact of starchy foods. Acknowledgement This work financially and officially supported by National Pingtung University of Science and Technology, Taiwan. References Araya H, Contreras P, Alvina M, Vera G, Pak N. 2002. A comparison between an in vitro method to determine carbohydrate digestion rate and the glycemic response in young men. Eur J Clin Nutr 56: 735-9. Brouns F, Bjork I, Frayn KN, Gibbs AL, Lang V, Slama G, Wolever TMS. 2005. Glycemic index methodology. Nutr Res Rev 18: 145-71. Foster-Powell K, Holt HS, Brand-Miller C J. 2002. International table of glycaemic index and glycaemic load values: 2002. Am J Clin Nutri 76: 5-56. Jenkins DJA, Kendall CWC, Augustin LSA, Franceschi S, Hamidi M, Marchie A, Jenkins AL, Axelsen M. 2002. Glycemic index: overview of implications in health and disease. Am J Clin Nutri 76: 266S-73S. Kabir M, Rizkalla SW, Champ M, Luo J, Boillot J, Bruzzo F, Slama G. 1998. Dietary amylose-amylopectin starch content affects glucose and lipid metabolism in adipocytes of normal and diabetic rats. J Nutr 128: 35–43. Lin MHA, Wu MC, Lu S, Lin J. 2010. Glycemic index, glycemic load and insulinemic index of Chinese starchy foods. World J Gastroenterol 16: 4973-9. Mishra S, Monro JA, Hedderley D. 2008. Effect of processing on slowly digestible starch and resistant in potato. Starke 60: 500-7. Thondre PS, Monro JA, Mishra S, Henry CJK. 2010. High molecular weight barley -glucan decreases particle breakdown in chapattis (Indian flat breads) during in vitro digestion. Food Res Int 43: 1476-81.

188


Woolnough JW, Monro JA, Brennan CS, Bird AR. 2008. Simulation human carbohydrate digestion in vitro : a review of methods and the need for standardization. J Food Technol 43: 2245-56.

189


Effect of Reduced Particle Size of Edible Bird Nest on the Physicochemical Properties and Lipid Oxidation of Chicken Patty Ravisangkar Ramachandran1, Abdul Salam Babji*,Masitah Muslim1& Norhasidah Sairi1. 1

School of Chemical Sciences and Food Technology,

Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor, Malaysia *


Abstract This study was carried out to determine the effect of micro-particulates of edible bird nest (EBN) on the physicochemical properties, lipid oxidation and sensory quality of chicken patty. Four treatments of chicken patty were prepared for this study and all samples were stored at 4⁰C + 1 for 12 days. The EBN of various sizes were evaluated for their antioxidant activities through 2, 2-diphenyl-1-picrylhydrazyl (DPPH), superoxide radical scavenging activity and metal chelating methods. Physicochemical analysis and thiobarbituric acid reactive substance (TBARS) were conducted on the samples to study the oxidative activity in chicken patty. TBARS analysis showed that samples added with EBN 300 µm and 38 µm sizes had lower TBARS values at the end of storage period (P74

56

Medium

Rojolele

22.47

4

70–74

67

Soft

Mentikwangi

19.32

5

70–74

88

Soft

Pandanwangi

24.21

5

70–74

68

Soft

Hipa 8

19.36

5

70–74

81

Soft

Situ Patenggang

20.63

7

>74

63

Soft

Hipa 5 Ceva

22.87

1

>74

65

Soft

Ciherang

Ref.

Amylose content, gel consistency, and gelatinization temperature of samples were shown on Table 4. Ciherang (22.65%), Inpari 1 (22.65%), Situ Patenggang (20.63%), Hipa 5 Ceva (22.87%) were classified to varieties that had medium amylose, high gelatinization temperature, and soft gel consistency. Meanwhile Local black rice, Rojolele, Mentikwangi, Pandanwangi, and Hipa 8 were grouped to varieties that had medium amylose, medium gelatinization temperature, and soft gel consistency. Additionally, Inpari 6 was included to varieties that had low amylose, low gelatinization temperature, and soft gel consistency.

265


Inpara 3 was included to varieties that had high amylose, low gelatinization temperature, and hard gel consistency. Inpara 4 was included to varieties that had high amylose, high gelatinization temperature, and medium gel consistency. Conclusion Out of 12 varieties, Local black rice, Mentikwangi (local varieties), Inpari 1, and Inpari 6 (new superior varieties) had the best quality based on head rice percentage and milled rice yield. The head rice percentage for Local black rice and Mentikwangi had fulfilled for class II, while Inpari 1 and Inpari 6 had fulfilled for class I Indonesian National Standard (INS) No. 6128:2008.

Local black rice and Mentikwangi

were grouped to

varieties that had medium amylose, medium gelatinization temperature, and soft gel consistency. Inpari 1 was classified to varieties that had medium amylose, high gelatinization temperature, and soft gel consistency.

Inpari 6 was included to varieties that had low

amylose, low gelatinization temperature, and soft gel consistency. Indonesia has many diversity of rice varieties which consist of local and new superior varieties. Up to now more than two hundred new superior rice varieties have been released by Indonesian Agency for Agricultural Research and Development (IAARD). It seems essential to understand a lot more about the grain characteristics, so that those information will be useful for breeders, farmers, consumers, and food producers. References Cagampang C.D., C.M. Perez, and B.O. Juliano. 1973. A gel consistency test for eating quality of rice (Oryza sativa). Sci. Food Agric. No. 24. p. 1589–1594. Cruz N. J. and G.S. Khush. 2000. Rice grain quality evaluation procedures. In R.K. Singh, U.S. Singh, G.S. Khush (eds.). Aromatic Rice. Oxford and IBH Publishing Co. Pvt. Ltd. Calcutta. 289p. Damardjati D. S. 1995. Characterization and Properties of Rice Quality Standards as a Development Platform for the Rice Agri-Business and Agri-Industries

in

Indonesia. Inauguration speeches Expert Researcher. Research Institute for Food Crop Biotechnology. Department of Agriculture. Bogor. (in Indonesian).

266


Indonesian Center for Food Crops Researh and Development, 2007. Repository: Toward Improved Rice Production in 2020. http://pangan.litbang.deptan.go.id/index.php [2 Mei 2012]. (in Indonesian). IRRI. 1996. Standard Evaluation System for Rice. INGER Genetic Resources Centre, International Rice Research Institute, Manila, Philippines. p46-52. Jane J. 2009. Structural features of starch granules II. In J. Be Miller and R. Whistler (Eds.). Starch Chemistry and Technology. 3rd ed. Academic Press. New York. 879 p. Little R.R., G.B. Hilder and E.H. Dawson. 1958. Differential effect of dilute alkali on 25 varieties of milled white rice. Cereal Chem. 35:111–126. Mutters R. G., J. F. Thompson. 2009. Rice Quality Handbook. University of California Agriculture and Natural Resources Publication. 141p. National Standardization Agency of Indonesia. 1993. Indonesian National Standard (INS) of Paddy. SNI 0224-1987/SPI-TAN/01/01/1993. Jakarta. 4 p. (in Indonesian) National Standardization Agency of Indonesia. 2008. Indonesian National Standard (INS) of Milled Rice. SNI No. 6128:2008. Jakarta. 9 p. (in Indonesian) Perez C. M. 1979. Gel consistency and viscosity of rice. In Proceedings of The Workshop on Chemical Aspects of Rice Grain Quality. IRRI. 390p. Suismono, A. Setyono, S.D. Indrasari, P. Wibowo, dan I. Las. 2003. Evaluation of rice quality on various rice varieties in Indonesia. Sukamandi Research Institute for Food Crops (SURIF). Subang. 41p. (in Indonesian)

267


Effects of Size Reduction on Antioxidant Property and Effective Concentration of Edible Bird Nest Drink Abdul Salam Babji*, Nurfatin Mohd Halimi, Nurul Nadia Muhammad, Farahniza Zainul and Norhasidah Sairi School of Chemical Sciences and Food Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor, Malaysia *


Abstract Edible bird nest (EBN) refers to the nest that swiftlet usually builds during the breeding season by the interwoven strands of solidified salivary of male. In the present study, EBN solubility and antioxidant capacity of EBN with various size reductions were evaluated for their potential antioxidant functional properties. This is important to relate in EBN because it brings up the true value why EBN is popular among Asian consumers. From this study, the degree of total solubility of EBN increased with boiling time. Five hours of boiling time solubilized EBN in water by 74.64%. Effective concentration (EC50) of optimum amount of EBN to be used in food product development is compared with BHA and BHT by using DPPH method. For micro-particle EBN, 300 µm EBN gave highest value of EC50 compared to 710 µm and 38 µm. When EBN micro-particulate sizes were added to red-dates drink, oxidative inhibition percentage increase compared to control. EBN-red dates drink with particle size 300 µm had the highest percentage inhibition of DPPH (88.32%) compared to control. It showed that different particle size influenced the antioxidant activities in food products. This preliminary study showed the potential of EBN as natural antioxidant, and it‘s potential in improving functional properties such as solubility and antioxidant properties with reduction in particle size. Keywords: Edible bird nest, Solubility, Antioxidant activity, EC50 & micro-particles. Introduction There are more than 24 species of swiflets distributed around the world, but only a few produce nests that are deemed ‗edible‘ that is made from its saliva. Preliminary analysis found that more than half of EBN‘s weight is consisted of unique protein which is glycoprotein, making EBN a good source of protein according to Marcone (2005). The therapeutic effects of EBN, including replenishing deficiency and expelling phlegm, were recorded in a Chinese ancient literature first publish in 1695 (Zhang, 1959). For these therapeutic and beauty-rejuvenating applications, the EBN is much in demand in the international market.

268


Edible bird nest is not only a medicine to make people healthy but also become a pleasant food. Traditionally, it is double boiled with rock sugar to make a delicacy known as "bird's nest soup" (Chan, 2006). In spite of the long history of using edible bird nest as cooking material for food and medicinal purposes, there are a limited number of scientific researches relating to its detailed bioactive components and their functional properties. Nowadays, consumers prefer to eat healthier foods incorporated with food rich in bioactive compounds such as edible bird‘s nest (EBN) in order to non-communicable diseases (Hathorn et al., 2008). For this reason industry and researchers are involved in optimizing EBN into food products to improve the variety, quality, taste and availability. In modern and ancient China, edible bird‘s nests are considered nutritious and therapeutic (Lim & Cranbrook, 2002). Actually severe boiling and cooking destroy the ―goodness‖ of EBN. Thus there is a need to look at processing methods to improve and expand the market of EBN utilization through processing technologies and product development. Antioxidants play a vital role in both food systems as well as in the human body to reduce oxidative processes. In food systems, antioxidants are useful in retarding lipid peroxidation and secondary lipid peroxidation product formation, and thus help to maintain flavor, texture and in some cases, the color of the food product during storage (Elias et al., 2008). In this study, EBN solubility and antioxidant capacity of EBN with various size reductions were evaluated for their potential antioxidant functional properties. Materials and Sample preparation Sample collection & Materials Raw cleaned Edible Bird Nest (EBN) from Pahang and Terengganu were purchased from Nest Excel Resources Sdn. Bhd.in Kuala Lumpur. Edible bird‘s nests were transferred into air tight containers and kept at ambient temperature (25ᵒC to 30ᵒC) until further analysis. Preparation of micro-particulate EBN EBN was soaked in distilled water for overnight so that the nest become soft and resolved the laminate strips. The nest was cleaned to remove impurities such as dirt and fur. Next, it was dried in an oven at 50°C for 24 hours. To get three different sizes of 710μm,

269


300μm and 38μm, the dried EBN was ground using Buchi Mixer Homogenizer (B-400, Switzerland). Total solubility Total solubility of EBN plays an important role in the final absorption of functional peptides and amino acids. Determination of EBN solubility was carried out following the method of Daniela and Maria (2008) with modification. Preparation of EBN drink EBN red dates drink was prepared by following the formulation by Universiti Kebangsaan Malaysia (UKM) researcher. 2,2-diphenylpicrylhydrazyl (DPPH) assay The scavenging effects of EBN in different sizes (38 µm, 300 µm and 710 µm) on DPPH free radical were measured according to the procedure described in Shahidi et al. (2006) with some modifications. The sample solution (1 mL) with various aliquot concentrations was added to 1 mL of 0.2 mM DPPH in 95% ethanol (1 mL of 95% ethanol in place of the DPPH solution as sample blank). The mixture was shaken and left for 30 min at room temperature, and the absorbance of the resulting solution was measured at 517 nm. At each concentration of the EBN aliquot sample, triplicate determinations were carried out. Different sample concentrations were used in order to obtain antiradical curves for calculating the EC50 values. Antiradical curves were plotted referring to concentration on the x axis and their relative scavenging capacity on the y axis. The same procedure was used on BHA, BHT and BHA + BHT sample. Results and Discussions Total solubility Table 1 showed EBN solubility as affected by boiling time at 100ᵒC (double boiled). Solubility increased after 5 hours boiling time ranged from 47.8% to 76.63% of total solubility. The total solubility of EBN increase significantly (P0.05).

0.09d

Table 2 Properties, total phenols, antioxidant activity and anthocyanin content of third generation products at different ratios of cassava starch:sweet potato flour (after frying) Cassava starch:Sweet potato flour extrudate

L*

a*

b*

Hardness (kgf)

Energy to break (kgf-mm)

Expansion ratio

Density (g/cm3)

Total phenols (mg GAE/100 g dry matter)

Antioxidant activity (%)

Anthocyanin (mg/100 g)

20: 80

28.50b

12.08b

7.02b

415.90a

1769.00b

2.55b

0.03b

146.70a

34.26a

11.32a

50: 50

31.81b

11.83b

6.49b

457.83a

1830.33b

2.63b

0.02b

139.67a

32.45a

7.46b

80: 20

37.39a

13.27a

4.85b

413.17a

1710.00b

3.05a

0.02b

129.30b

30.84a

4.96c

100: 0 38.41a 8.55c 69.98a 425.73a 2665.33a 2.60b 2.85a 24.45c 18.37b Values are means of triplicate determinations. In a same column, means followed by same letters are not significantly different among samples (p>0.05).

0.73d

320


Table 3 Properties, total phenols, antioxidant activity and anthocyanin content of direct expanded products from rice flour:sweet potato flour ratio of 20:80 at different percentage of soy flour Soy flour (% wt)

L*

a*

b*

Hardness (kgf)


Expansion ratio

Density (g/cm3)




0

45.52a

13.03b

8.32c

12.92b

74.66a

2.40b

0.31b

136.43a

23.26d

10.05ab

10

43.37a

15.16a

33.94b

12.92b

74.66a

2.96a

0.31b

20.91d

51.53a

8.42b

20

43.10a

14.83a

35.23b

11.68c

52.31b

2.51b

0.49a

26.70c

48.93b

8.63b

30

44.13a

14.44a

38.91a

15.49a

59.32ab

2.44b

0.52a

49.51b

44.27c

12.60a

Values are means of triplicate determinations. In a same column, means followed by same letters are not significantly different among samples (p>0.05).

Table 4 Properties, total phenols, antioxidant activity and anthocyanin content of third generation products from cassava starch:sweet potato flour ratio of 20:80 at different percentage of soy flour (after frying) Soy flour (% wt )

L*

a*

b*

Hardness (kgf)


Expansion ratio

Density (g/cm3)




0

28.50a,b

12.08c

7.02a

415.90a

1769.00b

2.55a

0.03c

146.70c

34.26b

11.32a

10

27.66b,c

20.11b

44.48b

456.03a

1959.33a

2.70a

1.43b

134.26d

36.31b

6.25c

20

26.56c

19.60b

44.81b

443.77a

1476.33c

2.60a

1.77b

153.89b

40.93a

7.93b,c

30

29.81a

21.17a

48.50a

335.10b

924.00d

2.00b

2.93a

170.31a

44.36a

8.64b

Values are means of triplicate determinations. In a same column, means followed by same letters are not significantly different among samples (p>0.05).

321


Conclusions Purple-fleshed sweet potato flour was successfully incorporated in the formulation of both direct expanded and third generation snack products with desirable properties. Anthocyanin content, antioxidant activity and total phenolic content increased with an increase in sweet potato flour content. By modifying screw configuration and extrusion conditions such as in-barrel temperature, die temperature screw speed, moisture content, die geometry, the products with different shape and texture can be developed. Acknowledgement This research was financially supported by the National Research Council of Thailand. References De O Fonseca MJ, Soares AG, Freire Junior M, de Almeida DL, Ascheri JLR. 2008. Effect of extrusion-cooking in total carotenoids content in cream and orange flesh sweet potato cultivars. Hortic bras 26: 112-5. Huang Y-C, Chang Y-H and Shao Y-Y.2006. Effects of genotype and treatment on the antioxidant activity of sweet potato in Taiwan. Food Chem 98: 529-538. Lee J, Durst RW, Wrolstad RE. 2006. Determination of total monomeric anthocyanin pigment content of fruit juices, beverages, natural colorants, and wines by the pH differential method: collaborative study. J AOAC Int 88: 1269-78. Suda I, Oki T, Masuda M, Furuta S, Nishiba Y, Matshgano K, Koichi S, Norihiko, T. 2002. Direct absorption of acylated anthocyanin on purple-fleshed sweet potato into rats, J Agr Food Chem 50:1672-6. Terahara N, Konczak I, Ono H, Yoshimoto M, Yamakawa O. 2004. Characterization of acylated anthocyanins in callus induced from storage root of purple-fleshed sweet potato, Ipomoea batatas L. J Biomed Biotechnol 5:279-86. Turkmen N, Sari F, Poyrazoglu ES, Velioglu YS. 2005. Effects of prolonged heating on antioxidant activity and colour of honey. Food Chem 95: 653–7

322


Van Hal M. 2000. Quality of sweet potato flour during processing and storage. Food Res Int 16: 1-37. Yang J, Gadi RL.2008. Effects of steaming and dehydration on anthocyanins, antioxidant activity, total phenols and color characteristics of purple-fleshed sweet potatoes (Ipomoea batatas). Am J Food Technol 3: 224-34.

323


Effect of Pretreatments by Blanching and Chemical Soaking on Quality of Dried Winter Mushroom Parawee Chookleeb and Wannasawat Ratphitagsanti* Department of Product Development, Faculty of Agro-Industry, Kasetsart University, Bangkok, Thailand. * Corresponding author: [email protected]

Abstract Winter mushroom is often consumed in Asian countries due to its delicacy and highly nutritious content. However, quality of fresh mushroom is quickly degraded. Therefore, the aim of this study was to investigate the influence of pretreatment methods on quality of dehydrated winter mushroom. Different approaches of pretreatment were carried out, which were (1) blanching by hot water or steam, (2) chemical soaking using sodium metabisulphite or citric acid solutions and (3) blanching followed by soaking in a combined solution. Mushroom was then dried at 65ºC for 4 h. Results showed that winter mushroom treated with hot water and steam blanching appeared mucilage due to the damage of cellular structure. Decrease in lightness (L* 46.35±1.10) and increase in redness (a* 10.25±1.04) was observed for dried mushroom pretreated with steam blanching. Dried winter mushroom pretreated with sodium metabisulphite (Na2S2O5) solution had color comparable to fresh mushroom as observed by minimal color difference (E* 17.84±4.49). Rehydration ratios ranged from 3.08±0.17 to 4.02±0.39. It was remarkable that dried mushroom pretreated with citric acid had the least rehydration ratio and high E* (23.01±2.03). Soaking in Na2S2O5 solution appeared to be the proper pretreatment method since it tended to retain qualities of dried winter mushroom. Results from this study could be beneficial to mushroom industry for extending shelf life of dried mushroom. Keywords: Flammulina velutipes, Mushroom, Blanching, Drying, Rehydration Introduction Edible mushrooms are rich in nutrients that are beneficial to consumers, such as proteins, carbohydrates, and fiber with low fat content (Ko and others 2007). The consumption of mushroom is prevalent in Asian. Thailand‘s export information on agricultural products reports that several varieties of dehydrated mushroom are exported in large quantity every year. In 2012, approximately 963.0 tons of dried mushroom were exported, providing an income for about 50 million baht (Office of Agricultural Economics, 2013). Oyster mushroom, shiitake, wood ear mushroom and straw mushroom are some examples of economical mushrooms generally found in Thailand. Winter mushroom (Flammulina velutipes) in the world production has been in a large amount of 65,000 tons per

324


year and its production is ranked 5th for edible mushroom cultivation. Since winter mushroom is fragile, the process for extending shelf life while providing consumer acceptability should be carefully selected. This might facilitate mushroom industry and increase export revenue to Thailand. Gothandapani and others (1997) studied effect of pretreatment method as blanching and soaking in potassium metabisulphite (KMS) on dried oyster mushroom. Although pretreatment affected loss of nutrition, it could minimize browning reaction as observed by the decrease of browning index of dried oyster mushroom. Mushroom treated with KMS had high rehydration ratio of 5.9 at 30ºC for 60 min (Gothandapani and others 1997). Krokida and others (2000) investigated effect of pretreatment on apple, banana, potato and carrot with sodium bisulfite and blanching by hot water and steam on color of dried products and found that raw materials treated with sulfite slightly increased redness (a*). The objective of this study was to evaluate the effects of pretreatments on selected quality of dried winter mushroom, i.e., rehydration ratio, color parameter and moisture content to determine quality changes and optimal pretreatment for winter mushroom. Materials and Methods 1. Preparation of raw material Winter mushroom (Flammulina velutipes) was kindly provided by Pro Mushroom Co., Ltd, Thailand. For each experiment, stripe end of mushroom was removed by 4 cm before washing (Ko and others 2007). Cleaned mushroom was drained for about 5 min. Since edible mushroom is rich in protein and low in fat contents (Ko and others 2007), protein content was determined using Kjeldahl‘s method (AOAC 2006) by multiplying total nitrogen content with conversion factor of 4.38. Moisture content, fat content, color parameters and whiteness index of fresh mushroom were also evaluated. Whiteness index = 100 – [(100-L*)2+ a*2+ b*2]1/2 2. Pretreatment methods The pretreatments given to mushrooms before drying were: (1) blanching by hot water at 70ºC for 5 min; (2) blanching by steam (100ºC) for 3 min; (3) soaking in 0.5% (w/v) sodium metabisulphite (Na2S2O5) solution for 5 min; (4) soaking in 0.5% (w/v) citric acid solution for 5 min; (5) soaking in a combination of 0.5% (w/v) Na2S2O5 and 0.5% (w/v) citric

325


acid solution for 5 min; (6) blanching by hot water at 70ºC for 5 min followed by soaking in combination solution of 0.5% (w/v) Na2S2O5 and 0.5% (w/v) citric acid for 5 min; and (7) blanching by steam for 3 min followed by soaking in a combined solution of 0.5% (w/v) Na2S2O5 and 0.5% (w/v) citric acid solution for 5 min. Untreated mushroom was used as a control. Untreated and treated mushrooms were then dried at 65ºC for 4 h (modified from Martínez-Soto and others 2001). 3. Evaluation of quality of dried mushroom Moisture content of dried mushroom from different pretreatments was determined by the method of AOAC (2006). Rehydration ratio was determined by soaking 2±0.5 g dried mushroom (w1) in a temperature-controlled water bath at 80ºC for 30 min. Then, rehydrated mushrooms were removed from the water bath and excess water was gently absorbed by paper towel. The rehydration samples were weighed (w2) and rehydration ratio was calculated from the below equation. Rehydration ratio = w2/wd where wd = dry basis of w1 Color of dried mushroom was evaluated using Spectrophotometer (Minolta, CM3500d) and the color parameters were displayed as L* (lightness), a* (redness (+) or greenness (-)) and b* (yellowness (+) or blueness (-)) scales. Color difference (E*) was calculated by using the following equation. E* = ((L*)2+(a*)2+(b*)2)1/2 4. Drying conditions After the proper pretreatment method was identified, effect of drying temperatures was also investigated using a hot air oven. Pretreated mushroom was subjected to three different drying temperatures at 45ºC, 50ºC and 55ºC. Moisture content of mushroom during drying was determined at several time intervals. Drying process was done when final moisture content was less than 10%. Drying rates of each drying temperature were calculated by the below equation. Drying rate = (Xi-Xi-1)/t where Xi is moisture content (wet basis), Xi-1 is moisture content at the time interval, and t is period of drying at the time interval.

326


Results and Discussion Table 1 presents quality of fresh winter mushroom in term of selected physical and chemical properties. High moisture content was obtained as 90.19±0.10%. Winter mushroom was also high in protein content, approximately 21.66±0.39%. Ko and others (2007) reported high protein content present in fresh winter mushroom as of 27.50±0.90%. Lightness (L*) of fresh winter mushroom was 74.10±1.89 with yellowness (b*) of 18.18±0.36. Table 1 Protein content, fat content and color of fresh winter mushroom Quality parameter Protein content Fat content L* a* b*

Value 21.66±0.39% 1.72±0.30% 74.10±1.89 -0.49±0.43 18.18±0.36

Protein content and fat content based on wet basis.

Quality of dried winter mushroom from various pretreatments is presented in Table 2. Winter mushrooms treated with hot water blanching (HWB) and steam blanching (STB) appeared mucilage on the surface of mushroom. Ko and others (2007) found that winter mushroom released mucilage after treated with hot water at 70ºC and the degree of mucilage increased when heating at 80ºC due to the extensive damage of cellular structure of winter mushroom. Soluble polysaccharides that are the composition of the outer layer hyphae wall of mushroom were released. For color parameters, the dried sample treated with steam blanching (STB) had the least L* (46.35±1.10) and the highest a* (10.25±1.04). The largest color difference (E* 31.10±1.87) was also observed. Dried winter mushroom pretreated with citric acid solution (CA) had lower L* than that pretreated with Na2S2O5 solution (SMS). Zivanovic and others (2003) found that acidity (pH 3.0-4.5) had no effect on lightness of pasteurized mushroom at 85ºC for 25 min, but extensive darkness was observed with sterilized mushroom (121ºC for 25 min at pH 3.3). Possible cause for mushroom browning has been reported as non-enzymatic oxidative reactions. Low pH and high temperature increased hydrolysis of polysaccharide and protein, hence; the substrates of carbonyl-amine reactions were increased and discoloration of sample was observed although at low pH (Bailey and others 2000). In case of Na2S2O5 solution (SMS) pretreatment, color of dried

327


winter mushroom was comparable to the fresh mushroom as observed from minimal E* of 17.84±4.49. However, redness of dried mushroom with either SMS or STB+CB pretreatment was lower than control. Whiteness index of dried mushroom from various pretreatments decreased as compared to whiteness index of fresh winter mushroom (68.33±1.39). The highest whiteness index was observed with HWB+CB (hot water blanching followed by soaking in the combined solution) and SMS (soaking in Na2S2O5 solution). As the largest E*, whiteness index (39.01±1.97) was the lowest in steam blanching pretreated sample. Rehydration ratio of dried winter mushroom ranged from 3.08±0.17 to 4.02±0.39 regardless of blanching or soaking techniques. The highest rehydration ratio was obtained from soaking with Na2S2O5 solution (SMS) or steam blanching followed by soaking in combination (STB+CB), which was not different from rehydration ratio of control (dried mushroom without pretreatment). Dried winter mushroom pretreatment with blanching followed by soaking in the combined solution had higher rehydration ratio than using only blanching irrespective to blanching methods (Table 2). Mushroom tissue structure after blanching could probably absorb the chemical solution during soaking. Tedjo and others (2002) found that fresh mango had smaller pore compared with pretreated mango. Soaking in Na2S2O5 solution could retain structure; hence rehydration ratio was the highest. Zivanovic and others (2003) found that when pH decreased, tissue structure of sterilized mushroom changed as observed from larger intercellular and thin hyphae. Result from this study was opposite to the study of Martínez-Soto and others (2001) that dried oyster mushroom previously soaked in 0.5% Na2S2O5 solution for 10 min as a pretreatment had rehydration ratio less than that of 0.5% citric acid solution for 10 min. When oyster mushroom was pretreated in the combined solution, rehydration ratio of untreated mushroom was greater than treated mushroom (Pal and Chakraverty 1997). Due to thin structure of winter mushroom, extreme pretreated temperature and exposure to chemical solution could cause detrimental changes to winter mushroom. Careful consideration of mild heat treatment following proper exposure to chemical soaking (type, concentration and time) could preserve minimal changes to the fragile winter mushroom. Final moisture content of dried winter mushroom ranged from 4.23±0.10 to 10.32±1.01. Mushroom pretreated with blanching had lower final moisture content than soaking in chemical solutions and untreated dried mushroom. Blanching

328


destroyed structure of winter mushroom to some degree, leading to the ease of moisture transfer during drying. Leeratanarak and others (2006) found that blanching increased drying rate of potato chips when dried at 90ºC. Tedjo and others (2002) said that different pretreatments such as blanching, high intensity electric field pulse, high pressure, and supercritical carbon dioxide had an effect on osmotic dehydration of mango due to different mechanisms of cell permeabilization. Table 2 Effect of pretreatments on color parameters, rehydration ratio and moisture content of dried winter mushroom Pretreatment method Control (without pretreatm ent) HWB HWB+C B STB STB+CB SMS CA CB

L*

a*

b*

∆E*

Whiteness index

Rehydration ratio

Moisture content (%)

59.86±0.58c

8.09±0.79b

26.43±2.63e

18.70±1.20def

51.21±1.24ab

3.87±0.14a

10.03±1.23ab

55.16±1.67d 62.85±2.53b

8.07±2.44b 5.47±0.17d

27.13±2.44de 22.71±3.25bc 28.67±0.57cde 16.61±1.46f

46.93±3.00c 52.72±1.70a

3.29±0.07c 3.51±0.12b

7.08±1.00c 4.23±0.10e

27.12±1.91de 30.01±0.89bc 31.88±2.91b 28.95±1.25cd 34.77±0.76a

39.01±1.97d 49.17±1.96bc 52.25±4.29a 46.64±1.97c 48.67±0.29bc

3.45±0.07bc 3.88±0.08a 4.02±0.39a 3.08±0.17d 3.24±0.07cd

7.70±0.82c 6.06±0.34d 10.32±0.84a 9.07±0.78b 10.32±1.01a

46.35±1.10e 10.25±1.04a 59.41±1.80c 5.92±0.38d 65.07±2.82a 6.46±2.13cd 56.07±1.59d 8.87±0.85ab 63.04±1.07ab 7.65±0.19bc

31.10±1.87a 19.93±1.93cde 17.84±4.49ef 23.01±2.03b 21.57±0.10bcd

HWB is hot water blanching, HWB+CB is hot water blanching+soaking in combination, STB is steam blanching, STB+CB is steam blanching+soaking in combination, SMS is soaking in Na2S2O5, CA is soaking in citric acid and CB is soaking in the combined solution.

Pretreatment method by soaking in 0.5% (w/v) Na2S2O5 solution (SMS) was chosen and the study on drying temperatures was carried out. Drying times to reach final moisture content less than 10% were 8, 5.5 and 4 h for drying temperature at 45ºC, 50ºC and 55ºC, respectively. Figure 1 shows drying curves of pretreated winter mushroom. Critical moisture contents were 11.64±0.46%, 17.11±2.36% and 9.16±0.13% at 6th-hour drying time for drying temperature at 45˚C and 4th-hour drying time for drying temperature at 50˚C and 55˚C

329


(b)

(a)

(c) Figure 1 Drying rate under hot air drying at 45ºC (a), 50ºC (b) and 55ºC (c) Conclusions Dried winter mushroom pretreated with steam blanching was very dark and appeared mucilage. Structure of mushroom changed when blanching was used as a pretreatment regardless hot water or steam. Pretreatment by soaking in Na2S2O5 solution retained color similar to fresh winter mushroom and had the highest rehydration ratio of 4.02±0.39. Information obtained from this study could be beneficial to mushroom industry for extending shelf life of mushroom. However, studies on other qualities should be further investigated such as microstructure and texture. Acknowledgement The authors would like to gratefully acknowledge the financial support from The Graduate School, Kasetsart University. References AOAC. 2006. Official Methods of Analysis of AOAC International. 18th ed., Maryland, USA.

330


Bailey RG, Ames JM, Mann J. 2000. Identification of new heterocyclic nitrogen compounds from glucose-lysine and xylose-lysine Millard model system. J Agric Food Chem. 48: 6240–6246. Gothandapani L, Parvathi K and Kennedy ZJ. 1997. Evaluation of different methods of drying on the quality of oyster mushroom (Pleurotus sp.). Dry Technol. 15: 1995– 2004. Krokida MK, Kiranoudis CT, Maroulis. ZB, Marinos-Kouris D. 2000. Effect of pretreatment on color of dehydrated products. Dry Technol. 18: 1239–1250. Leeratanarak N, Devahastin S, Chiewchan N. 2006. Drying kinetics and quality of potato chips undergoing different drying techniques. J Food Eng. 77: 635–643. Martínez-Soto G, Ocanña-Camacho R, Paredes-López O. 2001. Effect of pretreatment and drying on the quality of oyster mushrooms (Pleurotus ostreatus). Dry Technol. 19: 661–672. Office of Agricultural Economics. 2012. Homepage. Website. Bangkok, Thailand. Available: www.oae.go.th. Accessed March 10th, 2014. Pal US, Chakraverty A. 1997. Thin layer convection-drying of mushrooms. Energ Convers Manage. 38: 107–113. Tedjo W, Taiwo KA, Eshtiaghi MN, Knorr D. 2002. Comparison of pretreatment methods on water and solid diffusion kinetics of osmotically dehydrated mangos. J Food Eng. 53: 133–142. Ko W, Liu W, Tsang Y, Hsieh C. 2007. Kinetics of winter mushrooms (Flammulina velutipes), microstructure and quality changes during thermal processing. J Food Eng. 81: 587–598. Zivanovic S, Buescher R and Kim SK. 2003. Mushroom texture, cell wall, composition, color, and ultrastructure as affected by pH and temperature. J Food Sci. 68: 1860– 1865.

331


Influence of Cooking Conditions and Drying Temperatures on Physical and Functionality of Adzuki Bean and Flour Akatta Lumprom, Wannasawat Ratphitagsanti*, Penkwan Chompreeda and Vichai Haruthaitanasan Department of Product Development, Faculty of Agro-Industry, Kasetsart University, Bangkok 10900, Thailand * Corresponding author: [email protected]

Abstract Adzuki bean is widely grown throughout East Asia, especially in China, Japan and South Korea. It has low fat, high protein and fiber. Flour as a readily used form of legume has often been incorporated into various products for protein fortification. However, the production of legume flour involves several steps from soaking to milling and sieving. Soaking time, cooking time and drying condition of adzuki bean were investigated in this study to determine optimum conditions for adzuki bean flour production. Beans were soaked at room temperature up to 15 h before employing two cooking methods (autoclaving and steaming). Water absorption of adzuki beans increased with soaking time until reaching 78.82±2.94% after 13 h. As cooking time increased from 55 to 80 min, hardness of steam cooked beans decreased from 11.19±1.93 N to 6.31±0.84 N, respectively. Linear relationship (r = 0.996) between hardness and cooking time was found when steam cooker was used. Different drying temperatures (60, 70 and 80ºC) were carried out until final moisture content was less than 13%. Autoclaving accelerated the drying process leading to 5, 2 and 1.5 h for optimum drying times at 60, 70 and 80ºC, respectively. On the other hand, steam cooked beans were dried for 5, 3 and 2 h at 60, 70 and 80ºC, respectively. Physical and functional properties of adzuki bean flour produced by autoclaving and steaming were not markedly different. Once the optimum soaking time, cooking condition and drying condition were determined, slight modification could be made when preparing other types of legume flour. Keywords: Adzuki bean, Legume flour, Cooking, Drying, Hardness Introduction Adzuki bean is common in many Asian countries with varieties on seed coat color such as red, brown and speckled purple. Grain legumes have been generally known as an important source of protein for human nutrition. Cultivation of adzuki bean in Thailand has been promoted by Royal Project. However, the beans could only be grown in Northern parts of Thailand due to climate similarity to Japan. Until now, the utilization of adzuki bean in food products is still limited. Even though dry bean flour has often been incorporated into various products for protein fortification, the preparation of flour involves several steps from

332


soaking to milling and sieving. Instrumental texture analysis had been used to evaluate the hardness of beans with its cooking quality (Nasar-Abbas and others 2008, Saha and others 2009, Yousif and others 2002). The purpose of this study were to investigate water absorption characteristics of adzuki bean for varying lengths of soaking time, to evaluate texture (hardness) of bean when cooked at different cooking conditions, and to find suitable drying conditions for flour production. Materials and Methods 1. Raw material Adzuki beans (Vigna angularis) were obtained from Phufa Development Center (Nan, Thailand). Beans were hand sorted to remove any broken or immature seeds. 2. Soaking Beans were washed and soaked at ratio of 1:5 (w/v) at room temperature up to 15 h. Weight increase in the soaked beans was determined every hour and expressed as percentage of initial unsoaked beans. 3. Cooking After the beans were soaked for the optimum soaking time, two cooking methods were employed. Each batch of 500 g of the soaked beans was cooked in a steam cooker at 100C for different times from 55, 60, 65, 70, 75 to 80 min. For cooking by an autoclave, the soaked beans (500 g) were placed in a cotton bag and cooked under the conditions of 121ºC and 15 psi. Cooking times in the autoclave were varied at 10, 15, 20, 25, 30 and 35 min. Hardness of cooked beans from each cooking time was determined using a TA-XT plus texture analyzer (Stable Micro Systems Ltd, Surrey, UK). Single bean was placed in a center on a flat plate and measuring force under compression with a 4 mm cylindrical probe compressed by 50% at a speed of 1.0 mm/sec. Twenty randomly chosen beans were tested and mean results were recorded. 4. Drying condition Cooked beans from two cooking methods (steaming and autoclaving) were then dried in a hot air dryer. Different drying temperatures were applied at 60, 70 and 80ºC. During drying, the sampling of beans was taken for determination of moisture content and water

333


activity. Drying process was complete when final moisture content reached approximately 13%. Optimum drying time at each drying temperature was determined. 5. Flour preparation Dried beans were ground by Rotor beater mill SR 300 (RETSCH Ltd, UK) and sieved into flour with a particle size of 100 mesh. All flour samples were stored in aluminum pouches and kept at 4ºC until used. Native bean flour was prepared by milling unsoaked beans and sieved to obtain 100 mesh particle size. 6. Determination of flour properties Color of each flour sample was determined using Spectrophotometer (Minolta, CM3500d, Japan). Bulk density (Kuar and others 2005), water absorption (Du and other 2014) and selected chemical compositions (AOAC 2000) were analyzed. Results and Discussions 1. Determination of optimum soaking time Water absorption of adzuki bean was monitored every hour as shown in Figure 1. During initial soaking times (1-5 h), the beans gradually absorbed water. Small air bubbles could be sparsely observed in the soaking water due to the release of pressurized gases trapped in the interior of the beans (Phlak and others 1989). Then, water absorption increased almost linearly until reaching maximum adsorption after 13 h soaking time. When soaking the beans for a long time, reduced rate of water uptake was observed which could be attributed to the filling of free capillary and intermicellar spaces with water and the swelling of hydrocolloids (Phlak and others 1989). Figure 1 shows that pattern of water absorption of adzuki bean followed Sigmoid curve, which was similar to results from Baik and others (1998). In their study, two adzuki bean cultivars (Erimo and WSU 262) were compared and found that Erimo could absorb water faster than WSU 262 due to its smaller bean size. Since the water absorption remained almost constant during 13 to 15 h soaking time (P > 0.05), the optimum soaking time was determined as 13 h with 78.82±2.94% water absorption. Taiwo and others (1997) found that water absorption of cowpea continued to slowly increase during prolonged soaking times at room temperature, whereas elevated temperatures did not enhance water absorption at long hours of soaking time.

334

The 16th FOOD INNOVATION ASIA CONFERENCE 2014

Water absorption (%)

12 -13 June 2014, BITEC Bangna, Bangkok, Thailand 100 80 60 40 20 0 1

2

3

4

5

6

7

8

9 10 11 12 13 14 15

Soaking time (h) Fig 1 Water absorption of adzuki bean during soaking

2. Determination of cooking condition Two cooking methods (steaming and autoclaving) were applied to adzuki beans. Optimum cooking time was investigated for each method by determination of bean hardness. Increasing cooking times decreased bean hardness. Figure 2 and Figure 3 represent the relationship between hardness and cooking time when steam cooker and autoclave were used, respectively. From 55 min to 80 min, the relationship between hardness and cooking time was linear with r = 0.996 (Figure 2). Hardness of steam cooked beans decreased from 11.19±1.93 N to 6.31±0.84 N, respectively. Hardness of beans cooked in the autoclave for 10, 15 and 20 min was significantly different (P < 0.05). Severe treatment from thermal and pressure rendered the beans to become soft quickly. Hardness of autoclaved beans after 20 min cooking time was approximately 1.93±0.21 N, which was substantially lower than bean hardness after cooking for 80 min in the steamer. Baik and others (1998) reported that the seed coat of adzuki beans erupted and the cotyledon began to disintegrate after 50 min cooking. When carioca beans were autoclaved at 115ºC for 20 min, bean hardness was determined as 0.77 N, compared to 2.99 N for beans cooked at 105ºC for 10 min (Siqueira and others 2013). Due to the differences in process severity, 75 min was selected as an appropriate cooking time when the steamer was used. In autoclaving, only 20 min was adequate to soften the beans.

335

The 16th FOOD INNOVATION ASIA CONFERENCE 2014

Hardness of cooked bean (N)

12 -13 June 2014, BITEC Bangna, Bangkok, Thailand 14 12 10 8 6 4 2 0

y = -0.197x + 22.14 R² = 0.996

50

55

60

65

70

75

80

Cooking time (min)

Hardness of cooked bean (N)

Fig 2 Hardness of adzuki bean cooked in steam cooker during cooking time of 55 to 80 min 6 5 4 3 2 1 0

0

5

10

15

20

25

30

35

40

Cooking time (min)

Fig. 3 Hardness of adzuki bean cooked in autoclave during cooking time of 10 to 35 min 3. Determination of drying condition Drying is an important step for flour preparation since majority of water is removed. Figure 4 and Figure 5 show that increasing drying temperatures increased drying rates, thus reducing drying times. Beans cooked with autoclave had significantly high drying rates, especially at 70 and 80ºC (Figure 5). Drying rates at critical moisture contents of autoclaved beans were 1.16, 3.78 and 3.88 g water.g dry solid-1.min-1 when drying at 60, 70 and 80ºC, respectively. With steaming, the fracture on bean seed coats was minimal. Therefore, steamed beans required longer drying times than autoclaved beans at all drying temperatures. Optimum drying times were determined when moisture content of adzuki bean was lower than 13% (w/w). Therefore, drying times were 5, 3 and 2 h for steamed beans dried at 60, 70 and 80ºC. Autoclaved beans used 5, 2 and 1.5 h when drying at 60, 70 and 80ºC, respectively.

336

The 16th FOOD INNOVATION ASIA CONFERENCE 2014 12 -13 June 2014, BITEC Bangna, Bangkok, Thailand 2.0 1.5 1.0

60 ๐c

70 ๐c

0.5

80 ๐c

0.0 0

20

40

60

80

100

120

Drying rate(g water.gdry solid-1.min-1)

Drying rate(g water.gdry solid-1.min-1)

\\\

4.0 3.5 3.0 2.5 2.0 1.5 1.0 0.5 0.0

60 ๐c

70 ๐c 80 ๐c

0

Moisture content (g water.g dry solid-1)

20

40

60

80

100

120

Moisture content (g water.g dry solid-1)

Fig 4 Drying curve of steamed bean

Fig 5 Drying curve of autoclaved bean

at 60, 70 and 80ºC

at 60, 70 and 80ºC

4. Properties of adzuki bean flour Selected physical, chemical and functional properties of cooked bean flours produced by steaming and autoclaving were investigated. Table 1 shows that increasing drying temperatures reduced lightness (L*) of flour color, while redness (a*) and yellowness (b*) increased. Intensity of cooking process resulted in dark color of flour. Table 1 Color, bulk density and water absorption of native and cooked adzuki bean flour Adzuki bean Drying L* a* b* Bulk density Water flour temperature (g.cm-3) absorption (g (ºC) of water.g of sample-1) a g f c 0.80±0.00 2.40±0.03e Native 78.00±0.03 2.79±0.04 9.29±0.02 0.76±0.04d 2.79±0.01d Steamed 60 67.51±0.03c 5.76±0.01e 9.44±0.06e d c d c 0.84±0.01 2.91±0.06d 70 64.93±0.06 6.42±0.05 10.08±0.12 0.97±0.01a 3.91±0.08a 80 61.45±0.03f 6.64±0.07b 11.83±0.09a b f e c 0.82±0.03 3.19±0.17c Autoclaved 60 75.17±0.03 4.07±0.00 9.43±0.07 e d c b 0.92±0.00 3.59±0.03b 70 62.21±0.07 6.25±0.00 11.01±0.02 0.99±0.00a 3.98±0.02a 80 60.60±0.07g 7.93±0.04a 11.70±0.09b a–g

means with different letters within column are significantly different (P0.05). Finding in this study clearly indicated that broken rice, including those that had sizes of less than half grain rice, had a potential to be further processed by a vacuum impregnation to increase its commercial value. During this process, the rice could be supplemented with nutritional compounds, functional ingredients, antimicrobial agents and/or enzymes. Keywords: Vacuum impregnation, Jasmine rice, Cooking methods, Rice grain sizes Introduction Rice is a staple food in Thailand and the country produced more than 31.6 million tonnes of rice in 2011-2012 (Rumruaytum and others 2014). One of the most popular variety of the rice was Jasmine rice or Khao Dawk Mali 105 (Leelayuthsoontorn and Thipayarat 2006). The popularity was contributed to the rice‘s pleasant aroma, white color and soft

348


texture (Leelayuthsoontorn and Thipayarat 2006, Jaisut and others 2008). Although rice could be consumed in many ways, including whole grain consumption (Leelayuthsoontorn and Thipayarat 2006), some workers had attempted to create a value added rice by iron fortification (Prom-u-thai and others 2009), vitamin enrichment (Kyritsi and others 2011) or coating with natural flavor extract (Laohakunjit and Kerdchoechuen 2007). These were done by a combination of soaking and steaming (Prom-u-thai and others 2008) or a spouted bed method (Laohakunjit and Kerdchoechuen 2007). Up to now, there was not any literature that investigated the possibility of vacuum impregnation to enrich the rice grain. The method of vacuum impregnation was based on the application of a partial vacuum pressure that allowed removal of native liquids and gases entrapped in the capillaries and impregnated them with a desired external solution after a restoration of atmospheric pressure (Derossi and others 2012). During the process, three phenomena that occurred were gas outflow, deformation-relaxation of the solid matrix and liquid influx. These phenomena were affected by tissue structure, relaxation time of the solid matrix, transport rate of hydrodynamic mechanisms and size and shape of the sample (Zhao and Xie 2004). Most of the application of vacuum impregnation was carried out for fruits and vegetables (Fito and others 2001b). A small number of published papers also examined the relevance of vacuum impregnation on cheese (Hofmeister and others 2005) and smoked fish (Bugueño and others 2003). In the present study, the work was investigated the effect of vacuum impregnation on cooked rice by varying the rice grain sizes and cooking methods prior to the vacuum impregnation process. Materials and Methods Rice sample Jasmine rice variety Thung Kula 105 from Phichit province, Thailand was used in this research. During the study period, the rice sample was packed in a bag and stored at 5ºC. Cooking and vacuum impregnation treatments Rice grains were divided into 3 groups, including full grain, half to full grain and smaller than half grain sizes. Each rice group was washed one time with water and cooked

349


either by a normal boiling method in a household cooking pot using a ratio of rice to distilled water of 1:3 (w/v) for 20 min or an electric rice cooker (National, Japan) with a ratio of rice to distilled water of 1:2 (w/v) (Byun and others 2010) for 15 min (the temperature inside the cooker reached a temperature of 99+1ºC). The cooked rice was then subjected to a vacuum impregnation process, which was done in 0.75% (w/v) salt solution (Thip salt, Thailand). This salt solution had a similar aw to the cooked rice (Zhao and Xie 2004). The utilization of salt was considered to be suitable in adjusting the aw of impregnation solution and had been reported by Mestres and others (2011). The vacuum impregnation process was performed at 500 mbar for 10 min (Mújica-Paz and others 2003b), followed by 10 min restoration time (Hofmeister and others 2005) at atmospheric pressure. At the end of the process, the vacuum impregnated rice was separately from the solution using a strainer and analyzed for its physicochemical properties. Each treatment was done in triplicate. Physicochemical analyses The vacuum impregnated rice samples were analyzed for their moisture content using an AOAC method no 942.15 (AOAC 2000), water activity by AquaLab water activity meter (AquaLab CX3TE, USA) and total soluble solid using a hand refractometer (Atago, Japan). The size of the vacuum impregnated rice was measured by a digital caliper (Moore & Wright, Netherlands). Some vacuum impregnation parameters, including water loss and solid gain, were carried out following methods of Mújica-Paz and others (2003a). For apparent and real densities of the rice samples, they were determined by volume displacement at room temperature with a pycnometer (Martínez-Monzó and others 2000, Cháfer and others 2003). The real density of rice samples was measured as the density of sample puree after air in the samples was removed in a vacuum chamber at a pressure of 260 mbar for 2 h (MartínezMonzó and others 2000, Cháfer and others 2003, Paes and others 2008). The measurements of external solution impregnated into the rice samples (X value), volumetric deformation of rice (γ value), real (εr) and effective (εe) porosities were determined based on Eq. 1, 2, 3 and 4, respectively (Rongkom and others 2013).

350


(1) γ=

(2)

𝜀r =

(3)

X- γ = εe

(4)

In the Eq. 1 and 2, X was the amount of impregnation solution incorporated into rice samples, Mf was the final mass of the fruit (kg), Mi was the initial mass of the fruit (kg), νo was the initial volume of the fruit (m3), ρs was the density of the sucrose solution (kg/m3), γ was the volumetric deformation of rice samples and νt was the final volume of samples (m3). For Eq. 3 and 4, εr was real porosity, ρa was the apparent density of the fruit (kg/m3), ρr was the real density of the fruit puree (kg/m3), εe was the effective porosity and r value was a compression ratio (atmospheric pressure/vacuum pressure). Statistical analysis All data were subjected to Analysis of Variance using SPSS for Windows version 17.0 and presented as mean values with standard deviations. Differences between mean values were established using Duncan‘s multiple range tests at a confidence level of 95% (p0.05, Table 1). The value of εe that was between 0.03 and 0.05% was lower than those of the εr values, which were in the range of 0.03 to 0.13%. This indicated that there was still free volume in the rice samples for impregnation. Mújica-Paz and others (2003b) suggested that a possibility of capillary effects or structural modifications of the samples during vacuum impregnation caused the free volume of the samples was not completely filled. Conclusions Results from this study clearly displayed that the cooking methods prior to vacuum impregnation significantly affected the moisture content and total soluble solids of the vacuum impregnated rice. However, both the rice grain sizes and cooking methods did not significantly affect vacuum impregnation parameters, including water loss, solid gain, X value, γ value, εe and εr values, of the rice. A further processing with vacuum impregnation for the rice grain that had sizes smaller than half grain together with the boiling process would be an opportunity to increase the rice commercial value. Acknowledgement The authors would like to acknowledge some financial supports from the Graduate School of the Chiang Mai University.

356


References Andrés A, Salvatori D, Albors A, Chiralt A, Fito P. 2001. Vacuum impregnation viability of some fruits and vegetables. In: Fito P, Chiralt A, Barat JM, Spiess WEL, Behsnililan D, eds. Osmotic dehydration and vacuum impregnation: Applications in food industries. Pennsylvania: Technomic Publishing Company. p. 53-60. Association of Official Analytical Chemists. 2000. Official methods of analysis of AOAC International. 17th ed. Gaithersbury, USA: AOAC International. Bugueño G, Escriche I, Martínez-Navarrete N, Camacho MdM, Chiralt A. 2003. Influence of storage conditions on some physical and chemical properties of smoked salmon (Salmo salar) processed by vacuum impregnation techniques. Food Chem 81: 85-90. Byun Y, Hong SI, Mangalassary S, Bae HJ, Cooksey K, Park HJ, Whiteside S. 2010. The performance of organic and inorganic coated retort pouch materials on the shelf life of ready-to-eat rice products. LWT - Food Sci and Technol 43: 862-866. Cháfer M, González-Martínez C, Chiralt A, Fito P. 2003. Microstructure and vacuum impregnation response of citrus peels. Food Res Int 36: 35-41. Chiralt A, Fito P, Andres A, Barat JM, Martinez-Monzó J, Martinez-Navarrete N. 1999. Vacuum impregnation: A tool in minimally processing of foods. In: Oliveira FAR, Oliveira JC, eds. Processing of foods: Quality optimization and process assessment. Boca Raton: CRC Press. p. 314-356. Das T, Subramanian R, Chakkaravarthi A, Singh V, Ali SZ, Bordoloi PK. 2006. Energy conservation in domestic rice cooking. J Food Eng 75: 156-166. Derossi A, De Pilli T, Severini C. 2012. The application of vacuum impregnation techniques in food industry. In: Valdez B, editor. Food industry, scientific, health and social aspects of the food industry. Croatia: InTech Europe. p. 25-56. Fito P, Chiralt A, Barat JM, Andrés A, Martínez-Monzó J, Martínez-Navarrete N. 2001a. Vacuum impregnation for development of new dehydrated products. J Food Eng 49: 297302. Fito P, Chiralt A, Betoret N, Gras M, Cháfer M, Martínez-Monzó J, Andrés A, Vidal D. 2001b. Vacuum impregnation and osmotic dehydration in matrix engineering – Application in functional fresh food development. J Food Eng 49: 175-183.

357


Hofmeister LC, Souza JAR, Laurindo, JB. 2005. Use of dyed solutions to visualize different aspects of vacuum impregnation of Minas cheese. LWT 38: 379-386. Horigane AK, Suzuki K, Yoshida M. 2013. Moisture distribution of soaked rice grains observed by magnetic resonance imaging and physicochemical properties of cooked rice grains. J Cereal Sci 57: 47-55. Jaisut D, Prachayawarakorn S, Varanyanond W, Tungtrakul P, Soponronnarit S. 2008. Effects of drying temperature and tempering time on starch digestibility of brown fragrant rice. J Food Eng 86: 251-258. Kyritsi A, Tzia C, Karathanos VT. 2011. Vitamin fortified rice grain using spraying and soaking methods. LWT – Food Sci Technol 44: 312-320. Laohakunjit N, Kerdchoechuen O. 2007. Aroma enrichment and the change during storage of non-aromatic milled rice coated with extracted natural flavor. Food Chem 101: 339-344. Leelayuthsoontorn P, Thipayarat A. 2006. Textural and morphological changes of Jasmine rice under various elevated cooking conditions. Food Chem 96: 606–613. Maneepan P, Yuenyongputtakal W. 2011. Osmotic dehydration of coconut pieces: Influence of vacuum pressure pretreatment on mass transfer and physical characteristics. Kasetsart J (Nat Sci) 45: 891-899. Martínez-Monzó J, Barat JM, González-Martínez C, Chiralt A, Fito P. 2000. Changes in thermal properties of apple due to vacuum impregnation. J Food Eng 43: 213-218. Mestres C, Ribeyre F, Pons B, Fallet V, Matencio F. 2011. Sensory texture of cooked rice is rather linked to chemical than to physical characteristics of raw grain. J Cereal Sci 53: 81-89. Mújica-Paz H, Valdez-Fragoso A, López-Malo A, Palou E, Welti-Chanes J. 2003a. Impregnation and osmotic dehydration of some fruits: Effect of the vacuum pressure and syrup concentration. J Food Eng 57: 305-314. Mújica-Paz H, Valdez-Fragoso A, López-Malo A, Palou E, Welti-Chanes J. 2003b. Impregnation properties of some fruits at vacuum pressure. J Food Eng 56: 307-314. Paes SS, Stringari GB, Laurindo JB. 2008. Effect of vacuum impregnation temperature on the mechanical properties and osmotic dehydration parameters of apples. Braz Arch Biol Techn 51(4): 799-806.

358


Prom-u-thai C, Fukai S, Godwin ID, Rerkasem B, Huang L. 2008. Iron-fortified parboiled rice – A novel solution to high iron density in rice-based diets. Food Chem 110: 390-398. Prom-u-thai C, Glahn RP, Cheng Z, Fukai S, Rerkasem B, Huang L. 2009. The bioavailability of iron fortified in whole grain parboiled rice. Food Chem 112: 982-986. Rongkom H, Phianmongkhol A, Wirjantoro TI. 2013. Physical properties of impregnated cantaloupe and apple affected by different pressure levels. Asian J Agr Food Sci 1(4): 163-171. Rumruaytum P, Borompichaichartkul C, Kongpensook V. 2014. Effect of drying involving fluidization in superheated steam on physicochemical and antioxidant properties of Thai native rice cultivars. J Food Eng 123: 143-147. Tamura M, Nagai T, Hidaka Y, Noda T, Yokoe M, Ogawa Y. 2013. Changes in histological tissue structure and textural characteristics of rice grain during cooking process. Food Struct http://dx.doi.org/10.1016/j.foostr.2013.10.003. Tamura M, Ogawa Y. 2012. Visualization of the coated layer at the surface of rice grain cooked with varying amounts of cooking water. J Cereal Sci 56: 404-409. Yadav BK, Jindal VK. 2007. Water uptake and solid loss during cooking of milled rice (Oryza sativa L.) in relation to its physicochemical properties. J Food Eng 80: 46-54. Zhao Y, Xie J. 2004. Practical applications of vacuum impregnation in fruit and vegetable processing. Trends Food Sci Tech 15: 434-451.

359


Effect of Milling Processes on Physicochemical Properties of Rice Flour (Oryza sativa L.) cv. Sang Yod Wipawan Wongsudaluk1*, Nanthiya Paothong1, Wanwipa Nooma1, Damrongkiat Sritep1, Thitimaporn Nooniam1 and Pornchai Puttarak1 1

Faculty of Science and Technology, Songkhla Rajabhat University, Songkhla *


Abstract Rice is an economic plant of Thailand. Sang Yod is native pigmented rice in Phatthalung province of southern Thailand. It was used in many OTOP food products such as bakery products in form of rice flour. To preparing rice flour, the process of milling affects the physicochemical characteristics of starch and qualities of rice product. The purpose of this research was to determine the physicochemical properties of Sang Yod rice flour from different process of milling such as dry, semi-dry, wet milling methods and flour from pregelatinized rice. The results of the degree of swelling of various rice flours were significantly difference (P0.05). The moisture, anthocyanin contents and fatty acids including oleic acid, linoleic acid and palmitic acid of Phatthalung Sungyod broken rice were significantly decreased during storage (p40 years). Consumers were asked to evaluate sensory acceptability of each attribute of each sample in the following order: color, size, pandan flavor, softness and overall liking using a 9-point hedonic scale (1 = dislike extremely, 5 = neither dislike nor like, 9 = like extremely). Samples (10 g) were served with sweetened coconut milk syrup (15 ml) and ice (15 g) in white plastic cups coded with random three digit numbers. Distilled water was provided for mouth-rinsing between samples. Consumers evaluated two sets of four samples with 10 min mandatory break in between. Statistical data analysis Analysis of variance (ANOVA) and Duncan multiple-range test were performed by the procedure of SPSS® for Windows version 12 software (SPSS Inc., Chicago, IL, USA). The significance was determined at p ≤ 0.05. Principal component analysis (PCA) was done using a correlation matrix with the means of physical, chemical properties and consumer

781


acceptability data. Preference mapping and biplots were also generated. Additionally, partial least squares (PLS) regression analysis using data on physical, chemical and sensory properties of the eight samples. Statistical analysis for Preference mapping was completed using XLStat 2010 (Addinsoft, New York, NY, USA). Results and Discussions Physical and chemical properties The physical and chemical properties of the eight pandan noodle samples are shown in Table 1. The mean length and the diameter were ranged from 24.62 to 144.96 mm and 4.10 to 14.14 mm, respectively. There were 2 shapes of pandan noodle, the shorter oval shape (A, E and F) and the slimmer rod shape ( B, C, D, G and H). L* value (lightness), -a* value (greenness), b* value (yellowness), C* value (color saturation) and h value (hue angle) were ranged from 35.29 to 58.02, -12.53 to -15.89, 18.89 to 36.82, 22.67 to 39.13 and 109.8 to 123.58, respectively. This result indicated that the color of these samples was green obtained from the pandan juice color. The firmness of samples varied from 4.65 to 18.05 N because of the different flour types and pH of the mixture. The shorter oval shape samples had higher firmness than the slimmer rod shape samples. The pH value was ranged from 8.04 to 10.47 depending on the amount of lime solution (Ca(OH)2). Consumer acceptable The mean hedonic scores for sensory attributes of commercial pandan noodle samples were significantly different (P < 0.05) among eight samples, as shown in Table 2. Samples B and D had high liking score for all attributes and sample F had the lowest liking score for all attributes, except for color attribute. Samples G and H received low liking score for color attribute because they had high L* value (table 1) resulting in light color. The overall liking of samples A, B, C and D was not significantly different. Sample D had the highest overall liking score (7.0) whereas sample F had the lowest overall liking score (5.6). In addition, the means of all attributes and overall liking scores of all samples evaluated by the younger consumer group tended to be higher than the older consumer group but they were not significantly different (data not shown).

782


Table 1 Physical and chemical properties of pandan noodle samples Sample Properties

A

B

C

D

E

F

G

H

31.66d

104.98b

144.96a

57.07c

24.62d

57.24c

51.1c

48.06c

14.14a

4.36e

4.10e

9.55c

10.72b

11.68b

5.63d

5.52d

Color L*

40.48c

38.82d

38.23d

48.35b

35.56e

35.29e

58.02a

57.51a

a*

-15.80f

-14.60e

-15.89f

-13.26b

-14.46de

-12.53a

-13.77bc

-13.92cd

b*

31.61bc

28.56d

31.97b

36.82a

27.83d

18.89e

31.01bc

30.51c

C*

35.34b

32.07d

35.70b

39.13a

31.36d

22.67e

33.93c

33.54c

h

116.55bc

117.07bc

116.42c

109.80e

117.47b

123.58a

113.95d

114.53d

Firmness (N)

11.01c

4.65g

7.63e

5.77f

9.32d

18.05a

8.01e

11.80b

pH

10.02d

10.09c

8.04h

10.47a

9.76e

10.33b

8.88g

9.26f

Length (mm) Diameter (mm)

a-h

Means with different superscript letters in the same row are significantly different (P≤0.05).

Table 2 Mean consumer hedonic scores for sensory attribute of commercial pandan noodle samples Attribute

Sample A

B b

C a

D a

6.0

F b

6.8

G a

4.7

H c

4.7c

Color (greenness)

6.4

6.8

6.9

Size

5.8cd

6.4ab

6.1bc

6.8a

5.9cd

5.6d

5.6d

5.7cd

Pandan flavor

6.8a

6.6a

6.9a

6.6a

5.9b

5.5c

6.0b

5.7bc

Softness

6.7a

6.9a

6.8a

6.7a

6.2b

5.1c

5.9b

5.4c

Overall liking

6.8a

6.9a

6.8a

7.0a

6.1b

5.6c

5.9bc

5.7c

a-d

7.1

E a

Means with different superscript letters in the same row are significantly different (P≤0.05).

Internal preference mapping PCA was applied to analyze the physical and chemical properties of pandan noodle samples. Three PCs could explain 95.04% of the total variance. PC1 (48.08%) was closely related to diameter, h value and firmness (negative loading) as well as b* value and C* value (positive loading). PC2 (23.68%) was dominated by length (positive loading) and pH value (negative loading). The first 2 components were explained by 71.76 % of the total variance

783


(Fig. 1). The result of PCA showed that samples were different characteristics due to different positions (Cruz and others 2013). As shown in Fig. 1, Sample F was associated with firmness and h value. Samples B and C were positively related to length and sample D was positively correlated with b* value, C* value and L* value. The results were consistent with the data of physical and chemical properties. Sample F was the highest firmness (18.05 N) and h value (123.58). Samples B (104.98 mm) and C (144.96 mm) were longer than many other samples and sample D had a high b* value (36.82), C* value (39.70) and L* value (38.23).

Figure 1 Internal preference map of physical and chemical properties of pandan noodle. Capital letters represent the sample codes used to identify each sample. Fig. 2 shows the internal preference mapping of consumer liking of pandan noodle. In Fig. 2(a), the majority of consumers seemed to dislike the samples which high L* value (57.51 to 58.02) because the color of samples G and H were light-green with high L* value (Table 1). On the other hand, consumers like the samples which had Low L* value (35.29 to 48.35). For pandan flavor attribute, consumers were classified into two groups; one group prefered samples A, B, C and D having pandan flavor and the other group liked sample E having pandan flavor and scented candle flavor ‗Tian-Op‘ [Fig. 2 (b)]. Tian-Op is used for adding a unique aroma and flavor to Thai desserts (Jangchud and others 2013).

784

The 16th FOOD INNOVATION ASIA CONFERENCE 2014 12 -13 June 2014, BITEC Bangna, Bangkok, Thailand (b)

(a)

Figure 2 Internal preference map of consumer liking: (a) liking of greenness and (b) liking of pandan flavor. Capital letters represent the sample codes used to identify each sample. 1 = the younger consumer (≤40 years) and 2 = the older consumer (>40 years).

External preference mapping Partial least squares regression (PLS) was used to explain the relationship between the sample characteristics and overall liking (Fig. 3). The result indicated that the overall liking score was highly positive affected by C* value and b* value. In addition, the firmness and a* value were negatively related to overall liking score indicating that consumers preferred pandan noodles with appropriately soft texture and green color. These characteristics could be considered as driver of liking. The firmness of the pandan noodles should range from 4.65 to 7.63 N. For the color, a* and C* value should range from -14.60 to -15.89 and 35.34 to 39.13, respectively. The biplot showed that samples A, B, C and D received high overall liking score ranged from 6.8 to 7.0. The shape of sample A, short oval shape, was different from samples B, C and D. However, sample A had a high overall liking score. This indicated that a shape was not the important attribute affecting driver of liking.

785


Figure 3 External preference map of combined consumer liking and descriptive sensory attributes. Capital letters represent the sample codes used to identify each sample.

Conclusions Pandan noodles for Thai Lod-chongs have different characteristics and there is no standard manufacturing method. In this study, the preference mapping of pandan noodle revealed that the overall liking was influenced by firmness, greenness and pandan flavor. The findings of this study were useful for the development of Thai Lod-Chong to satisfy consumer satisfaction. Acknowledgement The authors express appreciation to Kasetsart University, Bangkok, Thailand for financial support. References Ares G, Giménez A, Barreiro C, Gámbaro A. 2010. Use of an open-ended question to identify drivers of liking of milk desserts: Comparison with preference mapping techniques. J Food Qual and Preference 21: 286-294.

786


Bao J, Bergman CJ. 2004. Starch in food: structure, function and applications. In: Eliasson A, editors. Starch in food : structure, function and applications. Boca Raton: CRC Press. p 271-283. Cruz AG, Cadena RS, Castro WF, Esmerino EA, Rodrigues JB, Gaze L, Faria JAF, Freitas MQ, Deliza R, Bolini HMA. 2013. Consumer perception of probiotic yogurt: Performance of check all that apply (CATA), projective mapping, sorting and intensity scale. Food Research Int 54: 601–610. Fernández-Muñoz JL, Acosta-Osorio AA, Zelaya-Angel O, Rodríguez-Garcia ME. 2011. Effect of calcium content in the corn flour on RVA profiles. J Food Eng 102: 100-103. Jangchud K, Jangchud A, Prinyawiwatku W. 2013. Soft starchy candy as a food model to study the relationship between sensory and selected physicochemical properties. Int J Food Sci and Tech 48: 2078-2085. Kuamornpattana N. The ways of Thai desserts. 1st ed. Bangkok: Sangdad publishing co. ltd. 172p. Volpini-Rapina LF, Sokei FR, Conti-Silva AC. 2012. Sensory profile and preference mapping of orange cakes with addition of prebiotics inulin and oligofructose. LWT Food Sci and Tech 48: 37-42. Worch T. 2013. PrefMFA, a solution taking the best of both internal and external preference mapping techniques. J Food Qual and Preference 30: 180-191. Yackinous C, Wee1 C, Guinard J. 1999. Internal preference mapping of hedonic ratings for Ranch salad dressings varying in fat and garlic flavor. J Food Qual and Preference 10: 401-409.

787


Effect of Packaging Films on the Quality and Shelf Life of “Khao Tan” Pattra Maneesin*, Gansuda Wangchanachai, Chawee Seebuppha and Sakkhee Sansupa Thai Packaging Centre, Thailand Institute of Scientific and Technological Research (TISTR) 196 Phahonyothin Road, Chatuchak, Bangkok 10900, Thailand *


Abstract Shelf life study is costly and time consuming. In addition, several factors e.g. product characteristics, packaging materials and storage conditions, etc. have effects on the shelf life of foods, making its prediction difficult. Khao Tan is Thai typical snack widely consumed in a large amount each year. This study aimed to conduct an actual storage test of Khao Tan packed using different packaging materials. Approximately 25 g freshly prepared Khao Tan samples were packed under N2 flushing using three flexible pouches which had different barrier properties i.e. OPP/CPP, OPP/PE/MPET/CPP and PET/Al/LLDPE prior to storage at room temperature. Water vapor permeabilities of PP, OPP/CPP, OPP/PE/MPET/CPP and PET/Al/LLDPE films were 240, 159, 13.4 and 5.4 g-m/m2-day, respectively. In addition, the samples packed in PP pouches under atmospheric condition were used as a control sample. The samples were periodically sampling in order to determine their physical and chemical attributes, e.g. moisture content, water activity (aw), crispness and TBA values as well as sensory characteristics. The results showed that packaging materials had an effect on the quality and shelf life of Khao Tan. Off-odor from rancidity might be the critical evidence found when the samples packed using high barrier films; however, loss of crispness due to moisture gain might occur prior to rancidity if they were packed using low barrier film. Changes of all physical and chemical attributes of the samples packed in the PP and OPP/CPP pouches occurred more rapidly than the values obtained from the samples packed in the OPP/PE/MPET/CPP and PET/Al/LLDPE pouches. For example, the moisture contents of the samples packed in the PP and OPP/CPP pouches increased to >6% and >4% after three weeks storage, respectively. Alternatively, the moisture content of the samples packed using OPP/PE/MPET/CPP and PET/Al/LLDPE pouches slightly increased after storage until the end of the study. Accordingly, the samples had 4% after three weeks storage, respectively. Since the pouches allowed high amounts of water to get in as indicated by their water vapor permeation rates (Table 1). Alternatively, the moisture contents of the samples packed in the OPP/PE/MPET/CPP and PET/Al/LLDPE pouches were slightly increased because the OPP/PE/MPET/CPP and PET/Al/LLDPE pouches provided better protection against moisture than the PP and OPP/CPP pouches as shown in Table 1. The results are in agreement with several researchers who reported that packaging materials affect water absorption rate of the dry product inside the packages (Hernandez and others 2000; Robertson 2006). Figure1c presents crispness scores of samples after storage. Although there were significant sample variations, the crispness scores tended to decrease after storage especially for the samples packed using the PP and OPP/CPP pouches since PP and OPP/CPP had high water vapor permeation rates. Some physical properties such as crispness and aw were

792


affected by the water vapor transmission rate of the packages (Taoukis and others 1988). Thus, high moisture barrier packages could effectively help maintain product crispness. Figure 1d presents the TBA values of the samples after storage. Although there were significant sample variations, the samples packed in the PP pouches tended to have higher TBA values than those packed in OPP/PE/MPET/CPP and PET/Al/LLDPE pouches because the OPP/PE/MPET/CPP and PET/Al/LLDPE pouches provided better protection against O2 and light. The results are in agreement with those of Nagi and others (2012) who reported that the formation of free fatty acids was higher in case of cookies stored in LDPE when compared to those stored in aluminum laminated package which could protect the cookies against light that acted as the catalyst for oxidation. Table 2 presents comparison between the qualities of all samples packed in different packaging materials which were conducted after 21 days because the storage period for the samples packed using PP and OPP/CPP pouches was 21 days. The results showed that a w values of the samples packed using PP and OPP/CPP increased more rapidly than the samples packed using OPP/PE/MPET/CPP and PET/Al/LLDPE pouches. For example, the water activity of the samples packed using PP and OPP/CPP increased from 0.122 to 0.389 and 0.266, respectively. In addition, the samples packed using PP pouches had significantly (p