대 한 주 산 회 지 제27권 제1호, 2016 Korean J Perinatol Vol.27, No.1, Mar., 2016 http://dx.doi.org/10.14734/kjp.2016.27.1.15
� Original article �
Brain-Derived Neurotrophic Factor (BDNF) Exerts a Protective Effect via an Anti-Apoptotic Mechanism on Hypoxic-Ischemic Injury in the Rat Brain Bong Jae Kim, M.D., Hyun Seuk Lee, M.D., Yoon Ho Han, M.D., Ji Eun Jeong, M.D., Eun Joo Lee, M.D., Eun Jin Choi, M.D. and Woo Taek Kim, M.D. Department of Pediatrics, School of Medicine, Catholic University of Daegu, Daegu, Korea
Purpose: Perinatal hypoxic-ischemic (HI) brain injury remains a common cause of chronic handicapping con ditions of cerebral palsy, mental retardation, learning disability, and epilepsy. HI brain injury induces cell death via either necrosis or apoptosis. Brain-derived neurotrophic factor (BDNF) is a member of the neurotrophin family. It plays key roles in survival, differentiation, and maintenance of neurons. This study was to investigate the neuroprotective effects of BDNF via the mechanisms of anti-apoptosis in HI brain injury by using cortical astrocyte and neuronal cell culture. Methods: Cortical astrocytes culture of 1-day-old Sprague-Dawley (SD) rat pups and embryonic cortical neuronal cell culture of SD rats at 14-day gestation were done. The Normoxia group was prepared in 5% CO2 incubators and the Hypoxia group and Hypoxia+BDNF group (after treatment with BDNF for 24 hours) were placed in 1% O2 incubators (94% N2, 5% CO2) for 6 or 18 hours. The expression of Bcl-2 and Bax were assess ed by real-time PCR and western blot. The caspase-3 activation was evaluated by caspase activity assay kit. Results: In astrocyte and neuronal cell, the expressions of Bcl-2 in the hypoxia groups were reduced compared to the normoxia groups, whereas, those in the Hypoxia+BDNF groups were increased compared to the hypoxia groups. However, the expressions of Bax and caspase-3 and the ratio of Bax/Bcl-2 were revealed reversely. In astrocyte, Hypoxia group for 6 hours was not significantly altered in Bcl-2, Bax expressions. Conclusion: BDNF neuroprotective effects on HI brain injury in neonatal rats may occur via anti-apoptotic mechanism. Key Words: Anti-apoptosis, Brain-derived neurotrophic factor, Hypoxia-ischemia, Neuroprotection Perinatal hypoxic-ischemic encephalopathy (HIE)
retardation, learning disability, and epilepsy.1, 2 It is
following asphyxia during antepartum, intrapartum
important to identify and develop therapeutic pro
and postpartum remains a common cause of chronic
cedures to reduce brain injury in neonates with HIE.
handicapping conditions of cerebral palsy, mental Received: 9 December 2015, Revised: 17 February 2016 Accepted: 22 February 2016 Correspondence to: Kim Woo Taek, M.D. Division of Neonatology, Department of Pediatrics, School of Medicine, Catholic University of Daegu, 33, Duryugongwon-ro 17gil, Namgu, Daegu 42472, Korea Tel: +82-53-650-4250, Fax: +82-53-622-4240 E-mail:
[email protected]
The immature brain has generally been considered to be resistant to the damaging effects of hypoxia and hypoxic-ischemic (HI). However, it is now appreciat ed that there are specific periods of increased sus ceptibility, which relate to the maturational stage at the time of the insult.3 The central nervous system (CNS) consists of
Copyrightⓒ 2016 by The Korean Society of Perinatology This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/license/ by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided that the original work is properly cited. The Korean Journal of Perinatology · pISSN 1229-2605 eISSN 2289-0432 · e-kjp.org
the brain and the spinal cord. The brain is made up of extensive and complex networks of neurons and
- 15 -
Bong Jae Kim, et al. : - BDNF Effects on HI Brain Injury -
their supporting cells termed as glial cells. Neurons
injury.16
are an electrically excitable cell that processes and
In this study, we determined the neuroprotective
transmits information through electrical and chemical
effects of BDNF via the mechanisms of anti-apoptosis
signals. Astrocytes, the most abundant glial cell
in HI brain injury by using cortical astrocyte and
types, are well known protectors of neurons. These
neuronal cell culture of rats. A potential role of BDNF
cells secrete a great variety of neurotrophic factors
was assessed by real-time PCR and western blot of
and protect neurons against excitatory amino acids
the proapoptotic protein Bax and the anti-apoptotic
4
(EAA), oxidative injury.
protein Bcl-2. The effect was also evaluated via cas
In neonatal brains, HI brain injury induces cell
pase-3 activation.
death via either necrosis or apoptosis. Apoptosis is
Materials and Methods
an essential mechanism of maintaining homeostasis during development. Whereas apoptotic cell death usually happens in the developing brain where it is
1. Materials (Chemicals and Reagents)
responsible for the physiological removal of over
BDNF, Caspase-3/CPP32 Colorimetric Assay
neurons.5 Apoptosis is an active cell death modulated
kit were obtained from BioVision Inc. (Milpitas, CA,
by pro-apoptotic (Bax, Bak, Bok etc.) and anti-
USA). Poly-D -lysine was from Sigma (St. Louis,
apoptotic (Bcl-2, Bcl-xL, Bcl-w etc.) genes. The
MO, USA). Rabbit polyclonal microtubule-associated
over-expression of the anti-apoptotic Bcl-2 inhibits
protein 2 (MAP2), Glial fibrillary acidic protein
apoptosis, but Bax over-expression forms Bax ho
(GFAP), mouse monoclonal Bcl-2 and secondary
modimers that advance apoptosis.6-8 Caspase-3 has
goat anti-mouse, or rabbit IgG-HRP, Fluorescein
been related to neuronal apoptosis during brain de
isothiocyanate (FITC) antibodies, β-actin were
velopment and to delayed neuronal cell death after
purchased from Santa Cruz Biotechnology (Santa
brain insult.9 Activated caspase-3 is directly res
Cruz, CA, USA). Rabbit polyclonal Bax was purchased
ponsible for proteolytic cleavages of a variety of basic
from Cell Sign aling Technology Inc. (Danvers,
proteins involving cytoskeletal proteins, kinases, and
MA, USA). 3- (4,5-dimethylthiazol-2-yl)-2,5-
10
DNA-repair enzymes. In addition to morphological
diphenyl-tetrazolium bromide (MTT) was purchased
evidence of apoptosis, Cheng et al. (1998) found
from Duchefa (Haarlem, The Netherlands). Hanks'
evidence of delayed caspase-3 activity following HI.
balanced salt solution (HBSS), Neurobasal media,
11
Neurotrophins (NTs) are a family of proteins that
B27 supplement, glutamax I, 4-(2-hydroxyethyl)-
regulate neuronal survival, development, and func
1-piperazineethanesulfonic acid (HEPES) were
tion. Brain-derived neurotrophic factor (BDNF), a
purchased from GibcoBRL (Invitrogen, Grand Island,
member of the NT family, protects neurons against
NY, USA). Dulbecco's Mod ified Eagle's Medium
12
different types of brain injury and also plays key
DMEM (high glucose, low glucose), Ham's F12,
roles in survival, differentiation, and maintenance
fetal bovine serum (FBS), penicillin-streptomycin,
13
of peripheral and central neurons. BDNF counter-
and trypsin-EDTA were obtained from Hyclone
regulate Bcl-2 and Bax expression after cerebral
Laboratories (Logan, UT, USA). Complete protease
14
15
ischemia and protect against neonatal HI brain
inhibitor cocktail tablets were purchased from Roche
- 16 -
김봉재 외 : - 저산소성 허혈성 뇌손상에서 BDNF의 효과-
Applied Science (Mannheim, Germany). Enhanced
pyruvate and 10 mM HEPES (pH 7.4). The dissected
Chemiluminoscence (ECL) plus western blotting
brain cortical tissues were then placed in 2 mL trypsin
detection system was purchased from Amersham
and incubated at 37℃ for 1 min. After washing five
Biosciences Corp. (Piscataway, NJ, USA). SUPEX was
times with 10 mL HBSS, the cells were moved in 1
purchased from Neuronex (Pohang, Korea).
mL HBSS, and dispersed by pipetting 6-7 times with a small-bore Pasteur pipette. The cell suspension
2. Cortical astrocyte and neuronal cell cultures
was centrifuged at 1,000 rpm at 25℃ for 5 min and
This study was performed in accordance with
pellets were washed with HBSS (without phenol red).
the approved animal use guidelines of the Catholic
The pellet was resuspended in Neurobasal media
University of Daegu. Cortical astrocytes used for the
supplemented with 2% B27 and 0.5 mM glutamax
primary cultures were also isolated from neonatal
Ⅰ. Cells were plated in each dish precoated with 50
Sprague Dawley (SD) rats (both sexes) at day 1
µg/mL poly-D-lysine. Cultures were maintained in
17
postnatally. Briefly, the brains removed and trans
Neurobasal media at 37°C in a humidified atmosphere
ferred into prechilled HEPES under sterile condition.
containing 5% CO2. Half of the medium was changed
And meninges were carefully removed. Then the
every 3 days.
cortex was chopped into pieces and resuspended in
The cultured cells were divided into five groups: N,
3 mL 0.25% trypsin solution. After 5 min incubation
normoxia; 6H, hypoxia for 6 hr; 6HB; hypoxia for 6 hr
at 37℃, FBS was added to stop the action of trypsin.
after treatment with BDNF for 24 hr; 18H, hypoxia for
The cells were dispersed gently and centrifuged at
18 hr; 18HB; hypoxia for 18 hr after treatment with
1,000 rpm for 5 min. Cells were isolated by filtering
BDNF for 24 hr. The N group was prepared in 5% CO2
the suspension through 80 mesh screens. After
incubators while the other groups were cultured in
washing the suspension in PBS centrifuged at 200 g
1% O2 incubators (94% N2, 5% CO2). To determine the
for 5 min. The final pellet was resuspended in DMEM
time of hypoxia, we referred to the studies of Callahan
(high glucose) supplemented with 10% FBS, 25 mm
et al.19 and Hong et al.20
HEPES, 2 mm l-glutamine, 100 U/mL penicillin, and 100 lg/mL streptomycin. Cells were seeded
3. Immunofluorescence
onto 100 mm dishes. The cultures were incubated
At the indicated time points, cells cultured on poly-
in a humidified incubator at 37℃ under 5% CO2. To
D -lysine coated plastic coverslips were fixed with
hypoxia, the cultures were washed with serum-free
4% formaldehyde for 30 min at room temperature.
medium, and fresh medium containing low glucose
Subsequently, cells were rinsed with PBS and per
was added to culture dish.
meabilized with 0.25% Triton X-100 for 5 min. After
Culture of cortical neuronal cells from rat embryos 18
two washes with PBS, cells were incubated with
was performed using the Brewer method. Disso
blocking solution (1% bovine serum albumin in PBS)
ciated cultures from SD rat embryonic (E14, both
for 1 hr, followed by primary polyclonal antibody
sexes) cerebral cortical neurons were prepared as
against MAP2 (1:50), GFAP (1:100) overnight at 4℃.
follows: the isolated cortices free of meninges were
Cells were then washed in PBS three times (5 min
dissected at 37℃ HBSS containing 1 mM sodium
each) and subsequently incubated in FITC goat anti-
- 17 -
Bong Jae Kim, et al. : - BDNF Effects on HI Brain Injury -
rabbit (1:200) secondary antibody at 37°C for 30
in 100% ethanol, air-dried, and re-diluted in diethy
min. Cells were washed three times with PBS. DAPI
plyrocarbonate (DEPC)-treated distilled water. The
(1 µg/mL) was included in the final wash to stain the
amount and purity of extracted RNA was quantitated
nuclei. Coverslips were attached on slides, mounting
by spectrophotometry (GeneQuantTM pro RNA/
medium (Dako, Glostrup, Denmark) was added, and
DNA calculator, GE Healthcare, USA), and the RNA
the preparation was covered with a glass coverslip.
was stored at -70℃ pending further processing. For
Coverslips detected by fluorescence microscopy (TE
reverse transcription, total RNA (2 µg) was reverse
2000-U, Nikon instruments Inc., NY, USA).
transcribed for 1 hr at 37℃ in a reaction mixture containing 20 U RNase inhibitor (Promega, Madison,
4. 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay
WI, USA), 1 mM dNTP (Promega), 0.5 ng oligo-(dT) 15 primer (Promega), 1 x RT buffer and 200 U M-
The MTT assay was used for estimation of cell vi
MLV reverse transcriptase (Promega). The reaction
ability and growth. MTT was dissolved at a concen
mixture was then incubated at 95℃ for 5 min to stop
tration of 5 mg/mL. 10 µL of the 5 mg/mL MTT stock
the reaction. The cDNA was stored at -20℃ until
solution was added to each well. After 4 hr of incu
further processing.
bation at 37℃, media was removed and added 100 µL
Real-time PCR was performed in 48-well PCR
of the lysing buffer (Dimethyl sulfoxide (DMSO): 95%
plates (Mini OpticonTM Real-Time PCR System, Bio-
ethanol=1:1). Absorbance of the samples was read at
rad, USA) using the iQTM SYBR Green Supermix
540 nm using a microtiter plate enzyme-linked im
(Bio-rad Laboratories, CA, USA). Amplification
munosorbent assay (ELISA) reader. The amount of
conditions are shown in Table 1. It was the same for all
formazan produced is proportional to the number of
apoptotic mRNA assayed: 95℃ for 5 min, followed by
live and metabolically active cells.
40 cycles of 95℃ for 40 sec, annealing temperature for 45 sec, and 72℃ for 45 sec. Real-time PCR data
5. RNA extraction and real-time PCR
were analysed with LightCycler software (BIORad
Total RNA was extracted from tissue with TRIzol
Lab, Hercules, CA, USA). All experiments were per
reagent (Invitrogen Corporation, Calsbad, CA, USA).
formed at least in six times.
Briefly, cells were homogenized in 1 mL of TRIzol reagent. Total RNA was separated from DNA and
6. Rat astrocyte, neuronal cell protein extraction
proteins by adding chloroform and was precipitated
Samples of astrocyte, neuronal cell were homoge
using isopropanol. The precipitate was washed twice
nized and total protein was extracted using a protein
Table 1. Primer Pairs and Annealing Temperatures for Real-Time PCR Name
Primer Sequence (5'-3')
Bcl-2
F: TTGACGCTCTCCACACACATG
Annealing
Amplicon size (bp)
57℃
89
55℃
110
53℃
146
R: GGTGGAGGAACTCTTCAGGGA Bax
F: TGCTGATGGCAACTTCAACT R: ATGATGGTTCTGATCAGCTCG
Β-Actin
F: TTGCTGATCCACATCTGCTG R: GACAGGATGCAGAAGGAGAT
- 18 -
김봉재 외 : - 저산소성 허혈성 뇌손상에서 BDNF의 효과-
lysis buffer containing complete protease inhibitor
8. Caspase-3 activation
cocktail tablets, 1 M Tris-HCl (pH 8.0), 5 M NaCl, 10%
The activity of caspase-3 was measured using a
Nonidet P-40 and 1 M 1,4-dithio-DL-threitol (DTT).
colorimetric assay kit according to the manufacturer's
After incubation for 10 min on ice, the samples were
instructions. Briefly, at the indicated time points,
centrifuged at 12,000 rpm at 4℃ for 30 min and the
cultured cells were collected into a test tube, followed
supernatant was transferred to a new tube. Proteins
by centrifugation. The pellet was resuspended in
were quantified using the Pierce BCA Protein Assay
a lysis buffer provided by the kit. Cell lysates were
Kit (Thermo Scientific, Rockford, USA) and taking
incubated at 37° C for 2 hr with 200 µM DEVD-p-
spectrophotometric readings at 540 nm.
nitroanilide (pNA). Spectrophotometric detection of the chromophore pNA after cleavage from the labeled
7. Sodium dodecyl sulfate-polyacrylamide gel
caspase substrates was then performed. Samples
electrophoresis (SDS-PAGE) and western blot
were read at 405 nm in a microtiter plate reader. All
analysis
experiments were performed at least in four times.
Equal amounts of proteins (30 µg) were subjected to 12% SDS-PAGE after denaturing in 5 x SDS gel-
9. Statistical analysis
loading buffer (60 mM Tris-HCl pH 6.8, 25% glycerol,
Data were analyzed using the SPSS version 12.0
2% SDS, 14.4 mM 2-mercaptoehanol and 0.1% bro
statistical analysis package. Examined data were
mophenol blue) in boiling water for 10 min. After elec
assessed using the t-test and ANOVA. In each test,
trophoresis, proteins were electrotransferred to a
the data were expressed as the mean±SD, and P
