Cavia porcellus endogenous virus CpEB1409 ...

11 downloads 0 Views 100KB Size Report
16 Feb 2015 - AUTHORS Razlan, N.F.A. and Kambol, R. TITLE Characterisation Of A Group Of Endogenous Betaretrovirus In The. Guinea Pig Genome.
2/16/2015

Cavia porcellus endogenous virus CpEB1409 protease and reverse transcr ­ Nucleotide ­ NCBI

Nucleotide Display Settings:

GenBank

Cavia porcellus endogenous virus CpEB1409 protease and reverse transcriptase genes, partial cds GenBank: KP203851.1 FASTA

 Graphics

Go to: LOCUS       KP203851                 954 bp    DNA     linear   ROD 19‐JAN‐2015 DEFINITION  Cavia porcellus endogenous virus CpEB1409 protease and reverse             transcriptase genes, partial cds. ACCESSION   KP203851 VERSION     KP203851.1  GI:747038937 KEYWORDS    . SOURCE      Cavia porcellus (domestic guinea pig)   ORGANISM  Cavia porcellus             Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;             Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia;             Hystricognathi; Caviidae; Cavia. REFERENCE   1  (bases 1 to 954)   AUTHORS   Razlan,N.F.A. and Kambol,R.   TITLE     Characterisation Of A Group Of Endogenous Betaretrovirus In The             Guinea Pig Genome   JOURNAL   Unpublished REFERENCE   2  (bases 1 to 954)   AUTHORS   Razlan,N.F.A. and Kambol,R.   TITLE     Direct Submission   JOURNAL   Submitted (26‐NOV‐2014) School of Biology, Faculty of Applied             Sciences, Universiti Teknologi MARA, Shah Alam, Selangor 40450,             Malaysia COMMENT     ##Assembly‐Data‐START##             Assembly Method       :: DNASTAR Lasergene v. 11.2.1             Sequencing Technology :: Sanger dideoxy sequencing             ##Assembly‐Data‐END## FEATURES             Location/Qualifiers      source          1..954                      /organism="Cavia porcellus"                      /mol_type="genomic DNA"                      /db_xref="taxon:10141"                      /country="Malaysia"                      /collection_date="20‐Nov‐2014"                      /PCR_primers="fwd_name: Cavpor‐For, fwd_seq:                      atgctctcgctcagggttaatgg, rev_name: Cavpor‐Rev, rev_seq:                      cctatttatgtccttcgcact"                      /note="breed: Abyssinian; endogenous_virus: CpEB1409"      CDS