cDNA Cloning and Sequencing, Gene Expression ...

DNA

RESEARCH

6, 57-62 (1999)

Short Communication

cDNA Cloning and Sequencing, Gene Expression, and Immunolocalization of Thrombomodulin in the Sprague-Dawley Rat Junru WANG, Aiwei YAO, Jing-Yi and Martin HAUER-JENSEN*

WANG,

Ching-Ching

SUNG,

Louis M.

FINK,

James W.

HARDIN,

Departments of Surgery and Pathology, University of Arkansas for Medical Sciences and John L. McClellan VAMC, 4301 W. Markham, Little Rock, AR 72205, USA (Received 18 September 1998; revised 14 October 1998)

Thrombomodulin (TM), in addition to its significance in the protein C anticoagulant pathway and cardiovascular diseases, has recently been shown to play important roles in normal embryonic development, several inflammatory conditions, as well as in tumor biology and in the pathogenesis of chronic radiation toxicity. We cloned and sequenced the cDNA encoding the complete TM protein from the Sprague-Dawley rat. The cDNA sequence consisted of a 78-bp 5' non-coding region and a 1731-bp open reading frame encoding 577 amino acids. Comparison of the deduced amino acid sequences showed Sprague-Dawley rat TM to be 87% homologous with mouse and 70.3% with human TM. In addition to the previously described highly conserved region in the lectin-like domain, another region was found which possessed significant homology among the species and may be involved in regulating cell surface expression of TM. Primers and fluorogenic probe for 5' exonuclease-based real time RT-PCR detection (TaqMan™ PCR) were constructed based on the cDNA sequence information and used to determine steady-state TM mRNA levels in lung, intestine, kidney, brain, and liver. The highest TM mRNA levels were found in lung and the lowest in liver. Immunohistochemistry confirmed that TM was mainly localized on the endothelium of blood vessels and lymphatics. The alveolar capillaries of lung showed the strongest immunoreactivity, whereas the endothelium of hepatic sinusoids and cerebral cortex were virtually negative. Key words: Thrombomodulin; molecular cloning; cDNA sequence; TaqMan™ PCR; immunohistochemistry; rat

Thrombomodulin (TM), an endothelial cell surface tial for normal embryonic development, and its absence glycoprotein, is a key regulator of the protein C antico- causes embryonic lethality in mice before development of agulant pathway and plays a pivotal role in maintaining a functional cardiovascular system and expression of the coagulation-anticoagulation homeostasis in vivo.1 Recent thrombin gene.10 accumulating evidence suggests that TM has several imThe complete cDNAs encoding the mouse and huportant functions beyond anticoagulation. In addition man TM proteins have been previously cloned and to its recognized significance in cardiovascular disease, sequenced, n ~ 1 3 and a partial Norway TM cDNA sedata from our laboratory and others show that TM is a quence has been posted on the GenBank database. Bevaluable tumor marker,2'3 and that it may play a central cause of the common use of the rat in many experimental role in the mechanisms of chronicity in normal tissue ra- models, and because only 71% of the TM cDNA sequence diation injury,4'5 inflammatory bowel diseases,6 and cer- in this species was known, we cloned and sequenced the tain vascular and autoimmune disorders.7~9 TM is essen- entire coding area and partial 5' end flanking region of the Communicated by Mituru Takanami ™ c D N A i n t h e Sprague-Dawley rat. The sequence * To whom correspondence should be addressed. Arkansas Can- data were used to design a fluorogenic probe and primers cer Research Center 4301 West Markham, Slot 725 Little Rock, for quantitation of Steady-State TM mRNA in rat lung, 5/ exonucleaseAR 72205 USA. Tel. +1-501-686-7912, Fax. +1-501-686-7861, k M u brai a n d intestine usi h-mail: mhjensen«ahie.uams edu

t

The cDNA sequence data reported in this paper have been posted to the GenBank Data Libraries, accession number AF022743.

T-»/-IT-»

based real tlme P C R

/m

HI

T M T>/~IT->\

detection (TaqMan 1M PCR), followed by comparison with TM immunolocalization in the same organs.

Downloaded from http://dnaresearch.oxfordjournals.org/ by guest on June 2, 2013

Abstract

58

1.

Thrombomodulin Gene of Sprague-Dawley Rat cDNA Cloning and Sequencing of Coding Area of TM

[Vol. 6.

1 ccctctgccgggactgggtgcctgcaccatcgcagtgctagcgtttctcgtagcttgcac 60

of Sprague-Dawley rat TM. The nucleotide sequence is numbered 1-1813 with the deduced amino acid sequence shown below. The start and stop codons are shown in boldface.


Lung tissue was used as the source for RNA isola- 61 g g t g t t c t c c t g a a c a g c aMt g cLt t gGg g Vg t t tFt c cLt t cLt g gGg t Vg t gLc t gAg c tPc cAa g cGt g g c 120 14 tion because of its high thrombomodulin content.11 To- 121 ctggggatctctgcactagccaagctgcagcccaaaggcagtcaatgcgtggggaatgag 180 L G I S A L A K L Q P K G S Q C V G N E 34 tal RNA was extracted with Trizol® reagent (Gibco BRL, Grand Island, NY). The 5' end oligonucleotide 181 tgcttcgcgcttttccaggaccccgtgaccttcctcgatggcagccaggcctgccagcgc 240 C F A L F Q D P V T F L D A S Q A C Q R 54 primer was designed according to a homologous region 5'3 00 fianking the coding sequence of mouse and human TM. 241 Lc t gQc a gGg g aHc a tLt t gMa t gTa c aVg t gRc g cSt c cSt cVg g tAg g cAt g cDg g aVt g tIc aSt c t Lc c cLt t c t g 74 The 3' end primer was designed according to a homol3 01 gtgagcgacagtagtatggactcacggccctggatcggtttacagctccctcagggctgt 360 ogous 3'-flanking region of mouse, human and bovine V S D S S M D S R P W I G L Q L P Q G C 94 11 14 TM. " The sequence of the 5' end primer (forward) 361 ggtgacccggtgcatctcgggcccctgcgcggcttccagtgggttactggggataaccac 420 G D P V H L G P L R G F Q W V T G D N H 114 was 5' CCT GAA CAG CAT GCT TGG G 3' (bp 6987 in Fig. 1) and that of the 3' end primer (reverse) 421 accagttacagcaggtgggcgcggcccaacgaccagtcgcctccactttgcggtccgctg 480 T S Y S R W A R P N D Q S P P L C G P L 134 was 5' CTC AGA ACT TCT GCA GCG TCC G 3' (bp 4 81 tgcgtcacggtctcaacagcaacagaagctgcaccaggcgagccggcctgggaagagaag 54 0 1813-1772) (synthesized by Life Technologies, Grand IsC V T V S T A T E A A P G E P A W E E K 154 land, NY). Reverse transcription-polymerase chain reac- 541 c c g t g c g a g a a c g a g a c c a a g g g t t t t c t c t g c g a g t t t t a c t t c g c a g c t t t c t g c a g g 600 tion (RT-PCR) was performed using GeneAmp PCR SysP C E N E T K G F L C E F Y F A A F C R 174 tem 9600 (Perkin-Elmer Cetus, Foster City, CA). PCR 601 cctttacgggtgaatacccgagatcctgagggtgcccacatctctagcacctacaatacc 660 P L R V N T R D P E G A H I S S T Y N T 194 amplified cDNA fragments were a pure single band and 661 ccattgggggtcagcggcgcggattttcagacgctgccgataggcagttctgctaccgtg 720 corresponded to the predicted size of TM (1.8 kb) upon P L G V S G A D F Q T L P I G S S A T V 214 analysis by agarose gel electrophoresis. The identity of 7 80 this product was confirmed by Southern blot analysis us- 721 Agcgccctttggcttggagctggtgtgcagggccctgcccggaacttcagagggacactgg P F G L E L V C R A L P G T S E G H W 2 34 ing a radiolabeled mouse TM cDNA probe (gift of Dr. 781 actcgggaagtgacaggagcttggaactgcagcgtggagaatggtggctgcgagtacatg 84 0 T R E V T G A W N C S V E N G G C E Y M 254 Steve R. Lentz, University of Iowa, Iowa City, IA). 900 Two PCR amplification products from independent re- 841 tgcaacaggagcgctaacggacccagatgcgtctigccccagcggcggggacctgcaggct C N R S A N G P R C V C P S G G D L Q A 274 actions performed on lung tissue DNA samples from two 901 gatggccgttcgtgcgcaaaacctgtggctcaatitgtgcaacgaactctgccagcatttt 960 different animals were resolved on 1% agarose gel by D G R S C A K P V A Q L C N E L C Q H F 294 electrophoresis. The bands were excised, DNA was re- 961 tgcgtcaacaactctgatgtgccaggctcttatt.cctgtatgtgcgaaacaggctaccag 1020 C V N N S D V P G S Y £ ; C M C E T G Y Q 314 covered by Wizard® PCR Preps DNA Purification System (Promega Corp., Madison, WI), and cloned into 1021 ttggcggcagacggacatcggtgtgaggacgtgg;itgactgtaagcaggggcccaatcca 108 0 L A A D G H R C E D V D D C K Q G P N P 334 pGEM®-T easy vector (Promega). The cloned vec10 81 tgccctcagetctgttctaacaccgagggcggcttcgaatgccgctgctatgatggctat 114 0 tors were transformed into JM109 High Competent Cells, C P Q L C S N T E G G F E C R C Y D G Y 354 and the cells were plated on LB/ampicillin/IPTG/X1141 gagttggtggacggagagtgcgtggagcaactgg.itccgtgcttcagatctaaatgcgag 12 0 0 E L V D G E C V E Q L D P C F R S K C E 374 Gal plates. After incubation overnight at 37°C, white 12 01 tatcagtgccagccagCaaactccacgcactacaattgcatctgtgctgagggcttcgca 1260 colonies were picked and grown in Luria Bertani medium Y Q C Q P V N S T H Y N C I C A E G F A 3 94 (LB broth). Plasmid DNA was purified and subjected 12 61 cctaagctggatgatcccgacaggtgcgaaatgt-ctgcaatgaaacttcgtgcccagca 1320 P K L D H P D R C E H F C N E T S C P A 414 to restriction enzyme analysis. The inserts were identi1321 gactgtgaccccaactccccaagcttttgtcaatgccctgagggcttcatcctggacgag 1380 fied to be about 1.8 kb in 1% agarose gel. Both strands D C D P N S P S F C Q C P E G F I L D E 434 of each of the two inserts were sequenced by the dideoxy 13 81 ggttccatatgcacagacattgatgagtgcagtcaaggcgaatgcctcaccaatgaatgt 144 0 6 nucleotide chain termination method using ABI PRISM G S I C T D I D E C S Q G E C L T N S C 454 dye terminator cycle sequencing ready reaction kit and 1441 cgaaaccttcctggctcctatgagtgcatctgcggacctgacacagcccttgctggtcag 15 00 R N L P G S Y E C I C G P D T A L A G Q 474 model 377 Automated DNA Sequencing System (PE Ap1-5 01 attagcaaggactgtgaccccatccctgttctggaggactcagaggatggtggctctggg 1560 plied Biosystems, Perkin-Elmer, Foster City, CA). ComI S K D C D P I P V L E D S E D G G S G 494 puter analysis of sequence data was performed using 15 61 gagcacccatcaagcaatccgacggtagtctcttcgacagttcccccttctgcaagacca 1620 E H P S S N P T V V S S T V P P S A R P 514 the GCG Sequence Analysis Software Package (Genet16 21 atgcactctggtgtgctcattgggatctccattgccagcctgtccctggtggtggcgctt 1680 ics Computer Group, Inc., Madison, Wisconsin). M H S G V L I G I S I f i S L S L V V A L 534 DNA sequence analysis showed that Sprague-Dawley 1681 ttggcgcttctttgtcacctgcgcaagaagcagggcactgctcgcgcagagctggagtac 1740 L A L L C H L R K K Q G T A R A E L E Y 554 rat TM cDNA contains a 5' end untranslated region of 1741 aagtgtacctcttcagccaaggaggtagtactgcagcacgtgaggactgatcggacgctg 1BO0 78 bases, followed by 1731 bases encoding 577 amino K C T S S A K E V V L C ' H V R T D R T L 574 acids. The complete open reading frame (ORF) starts 1801 cagaagttctgag 1813 Q K F * 577 from ATG at nucleotides 79-81 and ends at TGA of nuFigure 1. Nucleotide sequence and predicted amino acid sequence cleotides 1810-1812 (Fig. 1).

No. 1]

J. Wang et al.

1 50 MLGVFLLGVL APAGfcGlSAL AKLQPKGSQC' VGNEEFilLFQ. DPVTFEDASQ MLGIFFLGVL APASLGLSAL AKLQPTGSQC'VEHECFALFQ GPATFLDASQ MLGVLVLQAJJ.. ALAGLGFPAP AEPQPGGSQC VEHDCFALYP GPAXFLNASQ

Srtm Mtm Ktm

51 100 AQQRIiQGH^.'WRSfevSAW 'igfcBVSDSS. .MDSRP»iGI». QtPQGCGDPV ACQRLQGHLM TVRSSVAADV ISLLLSQSS. . MDLGPWIGE.' QLPQGCDDPV ICDGLRGHLM TVRSSVAADV ISUJLNGDGG VGRRRLWIGL QLPPGCGDPK

Srtm Mtm Htm

101 150 HLGPLRGFOW'VTCEMHTSJEP RWARPNDQSP fSSjSBKS'Ttf' •STATEAAPGE HLGPLRGFQW VTGDNHTSYS RWARPNDQTA ELCGPLCVTV STATEAAPGE RtGPIiRGF(JW_.yTGpMNTSYS RWARLDLNGA PLCGPLGVAV SAAEATVPSE

Srtm Mtm Htm

151 200 PAWE*EKPCEN ETKBPEHSSFY F A A F C V M R ^faTRDPEGAH ISSTYNTPLG PAWEEKPCET ETQGFLCEFY FTASC.RPLT VNTRDPEAAH ISSXYNTPFG PIWEEQQCEV KADGEJaSSEH EPAT&JlEliA \(EP . GAAAAA VSirjGTEFA

Srtm Mtm Htm

201 250 VSGADFQTLP IGSSATVAPP GLELVCRALP:GTSEGHWTRE VTGAWNCSVE VSGADFQTLP VGSSAAVEPL GLELVCRAPP. GTSEGHWAWE ATGAWNGSVE ARGADEQALP VGSSAAVAPL GLQLMCTAPp|-GAVQGgWARE APGAVJDCSVE

Srtm Mtm Htm

251 300 NGGCEYMCNR SANGPRCVCP SGGELQABGR SCAKPVAQLC NELCQHFCVN NGGCEYLCNR STNEPRCLCP RDMELQADGR.:;S.CARPWQSC NELCEHFCVS NGGCEHACNA IPGAPRCQCP AGAAB^J5gRjr;S13TASATS[SC~JIDtfE8FGVP

Srtm Mtm Htm

301 350 NSDVPGSYSC MCETGYQLAA .DGHFCEDVDD'CKQGPNPCPQ LCSNTEGGFE NAEVPGSYSC MCETGYQLAA DGHICEDVDD CKQGPNPCPQ LCVNTKGGFE NPDQPGSYSC MCETGYRl4AII3Qig;,C!Et8JDD.;CILEPSPCPQ RCVNTQGGEE

Srtm Mtm Htm

351 400 CRCYDGYELV DGECVEQLDP CFREKOEYQG QPVNSTHYNC ICAEGFAPKL CFCYDGYELV DGECVELLQP. CFGENGEFQC ©PVSPTDYRC ICAPGFAPKP ^ ^ i VCAEGFAPIP

Srtm Mtm Htm

401 450 DDgDRCEMF.C NETSCPADpD PNSS SFCQCP EGFILDEGSI CTDIDECSQG DEPHKGEfJFC NETSCPADCD PNEITVCECP EGFIBDEGSV CTDIBECSQG HEPHRGQJ1E& NQTACPADCD PNTQASCECP EgYSJjgDSFI C/SBIBECENG

Srtm Mtm Htm

451 500 ECLTNECRNL PGSYECICGP DTAIAGQISK DODPIPVLED SEDGGSGEHP ECFTSEGRNF P^SYEClGGP DTJSIJAGQISK DGpPlPVRED TKEEEGSGEP GFCSGVgHNL ^gTFSeiSGP DSAlARHIGT BGpSGKV..p GGDSGSGE.P

Srtm Mtm Htm

501 550 SSNPTWSST VP.ESARPMHS GVL:GISIAS; LSLVVAtLAL LCHLRKKQGT PVSPTPGSPT GP.PSARPVHS GVL::GISIAS LSliWALLAL LCHLRKKQGA PPSPTPGSTL TPPAVGLVHS GLL: GISIAS LCliWALLAL LCHLRKKQGA

Srtm Mtm Htm

551 581 AKiJELEYKCT SSAKEVVLQH VRIDRTLQKF ARAELEYKGA SSAKEVVLQH VRTDRTLQKF ARAKMEYKCA APSKEWLQH. VRTJIRTPQRL

Figure 2. Comparison of the predicted amino acid sequence of Sprague-Dawley rat (Srtm), mouse (Mtm) and human (Htm). Identical amino acids are highlighted.

2.

Comparison with Deduced Mouse and Human Amino Acid Sequences

The predicted Sprague-Dawley rat TM amino acid sequence was compared with all entries in the GenBank database that contained a complete coding sequence, human (575 amino acids) and mouse (577 amino acids) (Fig. 2). The Sprague-Dawley rat TM was 70.3% homologous with human and 87.0% homologous with mouse TM. The predicted Sprague-Dawley rat TM protein, similar to mouse and human TM,11'12 contains a hydrophobic leader sequence (fimino acids 1-18) which is thought to be a signal peptide,12 a lectin-like domain, a region of epidermal growth factor (EGF)-like repeats,

a serine/threonine-rich region that is the most heterogeneous region among species, a transmembrane domain, and a cytoplasmic tail. Dittman et al.11 previously compared the predicted amino acids sequence of human TM with a partial sequence of mouse TM and found that the lectin-like domain contains a highly conserved region (amino acids 102-125), in which 22 of 23 amino acids are identical. When comparing the entire coding region among human, mouse, and Sprague-Dawley rat TM, we found an additional highly conserved region (amino acids 57-74) within the lectin-like domain, in which 18 amino acids were completely identical among the three species. These highly conserved regions might be important for TM localization or activity, although their functional significance is still not known. Recent evidence suggests that the lectin-like domain of human TM is involved in the regulation of cell surface expression of TM and in the control of intracellular and extracellular accumulation of thrombin by mediating its constitutive endocytic routing from the cell surface membrane.15 The transmembrane domain is also highly conserved among species, in that 20 of 23 amino acids are identical and the remaining 3 are conservative substitutions. Comparison with a partial Norway rat cDNA sequence posted on the GenBank database (accession number U90121, 461 amino acid overlap) revealed 99.5% homology with our complete sequence. There were nine different amino acids in the overlap region between SpragueDawley rat (577 amino acids) and Norway rat TM (461 amino acids): the 119th-123rd and 572nd amino acid of the Sprague-Dawley rat TM, although identical to mouse and human TM, were different from Norway rat TM. The Norway rat amino acid sequence included an additional amino acid (176th), which was not found in the Sprague-Dawley rat, mouse, or human cDNA. One additional amino acid of the Sprague-Dawley rat TM, 584th, differed from the Norway rat TM, but was identical to mouse and bovine TM. Thus, it is unlikely that these differences are due to errors in sequencing of the Sprague-Dawley rat cDNA or to errors arising from our PCR amplification. A single amino acid (287th) was different in all four species. 3.

Assessment of TM Gene Expression in Rat Tissues Using TaqMan™ PCR

The TM cDNA sequence data were used to design a fluorogenic probe and oligonucleotide primers for 5' exonuclease-based real time PCR (TaqMan™ PCR) using the ABI Prism 7700 Sequence Detection System (PE Applied Biosystems) and reagents, and kits from PerkinElmer (Foster City, CA). A 22-base oligonucleotide probe, 6FAM-CCT GCG CAA GAA GCA GGG CAC T-TAMRA, (bp 1698-1719) was designed according to the rat thrombomodulin sequence cloned and sequenced in the present study, and


Srtm Mtm Htm

59

Thrombomodulin Gene of Sprague-Dawley Rat

[Vol. 6,


synthesized and labeled by Perkin-Elmer. The probe con107 3 tained FAM (6-carboxy-fluorescein) as thefluorescentre< porter dye covalently linked to the 5' end. The quencher dye TAMRA (6-carboxytetramethylrhodamine) was covalently linked to the 3' end. The forward and reverse primer sequences were 5' GCT TTT GGC GCT TCT 'a. TTG TC 3' (bp 1677-1696) and 5' CTC CTT GGC TGA 8 AGA GGT ACA CTT 3' (bp 1764-1741), respectively 10 5 = (synthesized by Life Technologies). a: TM cDNA plasmid was linearized with Spe I and incuE bated with T7 RNA polymerase. The Riboprobe Transcription System (Promega) was used for in vitro RNA 10" synthesis. The 1877-base cRNA was used to construct the standard curve. Eight 40-day-old male Sprague-Dawley rats (Harlan, Figure 3. Steady-state TM mB.NA levels in Sprague-Dawley rat lung, liver, kidney, brain, and intestine. Individual plots indiIndianapolis, IN) were euthanized. Intestine, liver, lung, cate median, interquartile rarge, and upper and lower adjacent kidney and brain were procured and total RNA was exvalues. tracted with TRI-Reagent solution (Molecular Research Center, Cincinnati, OH). A total volume of 50 /xl con5.5 x106 -i tained 1 x TaqMan buffer A, 5 mM MgCl2, 300 (M. of each ATP, GTP, CTP and UTP, 400 nM of each forward and reverse primer, 100 nM probe, 20 unit RNAse in4.9 x106 to hibitor, 12.5 unit MuLV, 12.5 unit AmpliTaq Gold, 50 ng 0) of total RNA. Reverse transcription was carried out at §" 4.3 x106 42°C for 30 min, followed by 10 min at 95°C to activate the TaqMan™ DNA polymerase. Thirty-five cycles of amplification were carried out by denaturing at 95°C for E 3.6 x106 15 sec, and annealing at 60°C for 1 min. All samples were run in duplicate in a single 96-well plate, including 3.0 x106 three controls without the RNA template. -0.8 0.0 0.8 -1.5 1.5 Expected Normals Lung contained the highest copy number of TM mRN A (4.2 x 106 copies per 50 ng mRNA), followed by kidney 4. Normal probability plot of steady-state TM RNA levels (1.7 x 105), brain (8.9 x 104), intestine (6.9 x 104), and Figure in lung samples from 8 different Sprague-Dawley rats. The data 4 liver (4.8 x 10 ) (Fig. 3). The TM mRNA levels in each of are consistent with a normal distribution. the five organs were distributed normally, thus validating the TaqMan™ PCR assay with this primer-probe combination (Fig. 4). The coefficients of variation were 0.13 plex (Vector Laboratories, Burlingame, CA) for 30 min. for lung, 0.17 for brain, 0.25 for liver, 0.27 for kidney, The slides were subsequently developed in a solution of 3,3-diaminobenzidine tetrahydrochloride solution (DAB) and 0.35 for intestine. and counterstained in GILL's No. 2 hematoxylin (Sigma, St. Louis, MO). Specificity for TM was controlled by 4. Localization of TM in Rat Tissues Using Imthe omission of primary antibody and by substitution of munohistochemical Technique primary immune antibody with non-immune rabbit IgG Samples of lung, kidney, liver, intestine, and brain from (DAKO, Carpintera, CA). Comparison of our mRNA data and immunohistothe same 8 rats that were used for TaqMan™ PCR, were chemical observations demonstrated similar patterns of fixed in Methanol Carnoy's solution and processed for imexpression, in that lung expressed the highest amount of munohistochemistry. Paraffin-embedded specimens were TM and liver the lowest. Pulmonary TM immunoreactivcut at 4-5 ^m, deparaffinized, and treated with 1% to endothelial cells in alveolar capillaries ity was localized (v/v) hydrogen peroxide. Nonspecific protein binding and venules, with small amounts present in larger arteries was blocked by incubation in 10% normal goat serum. In the kidney, most of the immunoreactivity and veins. The sections were incubated for 2 hr with rabbit antiin the glomeruli In the liver, endothelium was found TM antibody at 1:200 dilution (gift of Dr. Philip W. and portal veins in the portal triades of hepatic arteries Majerus, Washington University School of Medicine, St. stained positive, whereas, hepatic sinusoids and central Louis, MO). The secondary biotinylated goat anti-rabbit or no immunoreactivity. The enveins exhibited little antibody was applied for 30 min at 1:400 dilution, and dothelium of vessels in the cerebral cortex did not show then incubated with streptavidin-biotin-peroxidase com-

No. 1]

J. Wang et al.

61


markers of activated coagulation in patients with systemic necrotizing vasculitis, Thromb. Haemost., 75, 892898. 8. Ohdama, S., Matsubara, O., and Aoki, N. 1994, Plasma thrombomodulin in Wegener's granulomatosis as an indicator of vascular injuries, Chest, 106, 666-671. 9. Kumada, T., Dittman, W. A., and Majerus, P. W. 1988, A role for thrombomodulin in the pathogenesis of thrombin-induced thromboembolism in mice, Blood, 71, 728-733. 10. Healy, A. M., Rayburn, H. B., Rosenberg, R. D., and Weiler, H. 1995, Absence of the blood-clotting regulator thrombomodulin causes embryonic lethality in mice before development of a functional cardiovascular system, Proc. Natl. Acad. Sci. USA, 92, 850-854. 11. Dittman, W. A., Kumada, T., Sadler, J. E., and Majerus, P. W. 1988, The structure and function of mouse thrombomodulin. Phorbol myristate acetate stimulates degradation and synthesis of thrombomodulin without affecting mRNA levels in hemangioma cells, J. Biol. Chem., 263, 15815-15822. 12. Wen, D. Z., Dittman, W. A., Ye, R. D., Deaven, L. L., Majerus, P. W., and Sadler, J. E. 1987, Human thrombomodulin: complete cDNA sequence and chromosome localization of the gene, Biochemistry, 26, 4350-4357. 13. Dittman, W. A. and Majerus, P. W. 1989, Sequence of a cDNA for mouse thrombomodulin and comparison of the predicted mouse and human amino acid sequences, Nucleic Acids Res., 17, 802. 14. Jackman, R. W., Beeler, D. L., VanDeWater, L., and Rosenberg, R. D. 1986, Characterization of a thrombomodulin cDNA reveals structural similarity to the low density lipoprotein receptor, Proc. Natl. Acad. Sci. USA, 83, 8834-8838. 15. Conway, E. M., Pollefeyt, S., Collen, D., and SteinerReferences Mosonyi, M. 1997, The amino terminal lectin-like domain of thrombomodulin is required for constitutive endocyto1. Dittman, W. A. and Nelson, S. C. 1995, In: High, K. A. sis, Blood, 89, 652-661. and Roberts, H. R. (eds) Molecular basis of thrombosis 16. Bassler, H. A., Flood, S. J., Livak, K. J., Marmaro, J., and hemostasis, Marcel Dekker, Inc., New York, pp. 425445. Knorr, R., and Batt, C. A. 1995, Use of a fluorogenic probe in a PCR-based assay for the detection of Liste2. Appleton, M. A., Attanoos, R. L., and Jasani, B. 1996, ria monocytogenes., Appl. Environ. Microbioi, 61, 3724Thrombomodulin as a marker of vascular and lymphatic 3728. tumours, Histopathology, 29, 153-157. 3. Ordonez, N. G. 1998, Thrombomodulin expression in 17. Holland, P. M., Abramson, R. D., Watson, R., and transitional cell carcinoma, Am. J. Clin. Pathol., 110, Gelfand, D. H. 1991, Detection of specific polymerase 385-390. chain reaction product by utilizing the 5'—3' exonuclease activity of Thermus aquaticus DNA polymerase, Proc. 4. Richter, K. K., Fink, L., Hughes, B. M., Sung, C. C , and Natl. Acad. Sci. USA, 88, 7276-7280. Hauer-Jensen, M. 1997, Is the loss of endothelial thrombomodulin involved in the mechanism of chronicity in 18. Ishii, H., Salem, H. H., Bell, C. E., Laposata, E. A., and late radiation enteropathy, Radiother. Oncol., 44, 65-71. Majerus, P. W. 1986, Thrombomodulin, an endothelial anticoagulant protein, is absent from the human brain, 5. Wang, J., Richter, K. K., Sung, C. C , and Hauer-Jensen, Blood, 67, 362-365. M. 1997, Association of chronic endothelial dysfunction with sustained transforming growth factor-beta (TGF19. Tran, N. D., Wang, L., Schreiber, S. S., Zlokovic, B., beta) overexpression and progression of experimental raand Fisher, M. 1998, Measurement of thrombomodulin diation enteropathy, Proceedings. Radiation Research SomRNA expression in brain capillaries by polymerase ciety, 45, 194. chain reaction, Thromb. Res., 91, 191-197. 6. Sanger, F., Nicklen, S., and Coulson, A. R. 1977, DNA 20. Wang, L., Tran, N. D., Kittaka, M., Fisher, M. J., sequencing with chain-terminating inhibitors, Proc. Natl. Schreiber, S. S., and Zlokovic, B. V. 1997, ThrombomodAcad. Sci. USA, 74, 5463-5467. ulin expression in bovine brain capillaries. Anticoagulant function of the blood-brain barrier, regional differences, 7. Hergesell, O., Andrassy, K., and Nawroth, P. 1996, Eleand regulatory mechanisms, Arterioscler. Thromb. Vase. vated levels of markers of endothelial cell damage and TM immunoreactivity, whereas, endothelial cells of some meningeal and sub-meningeal blood vessels were positive. These data are in agreement with Ishii et al.18 who found TM to be absent from human brain by radioimmunoassay. In contrast, Tran et al.19'20 found significant amounts of TM protein and mRNA in bovine brain cortex by competitive PCR and RT-PCR. Considering our immunohistochemical results, the TM mRNA detected in rat cortical tissue by TaqMan™ PCR is most likely from the pia mater and the vessels underlying the pia. The differences in TM expression among organs do not appear to be due only to differences in the relative number of endothelial cells per organ, but may also reflect differences among various types of endothelium. For example, Ford et al. suggested that organs in which capillaries have continuous endothelium express higher levels of TM than organs with fenestrated capillaries.21 On the other hand, the absence of TM from cerebral vessels is not in agreement with this theory. It has been suggested that the lack of TM in cerebral endothelium is an organ-specific characteristic of brain vasculature, along with tight junctions, lack of vesicles, and high concentration of certain enzymes.18 Acknowledgments: We are grateful to Dr. Steve R. Lentz for generously providing the mouse cDNA plasmid for Southern blot analysis, to Dr. Philip W. Majerus for providing the anti rat TM antibody, and to Dr. Yingxiang Wang for expert assistance with computer sequence analysis. This work was supported by Grant CA71382 from National Cancer Institute, N1H, DHHS.

62

Thrombomodulin Gene of Sprague-Dawley Rat

Biol., 17, 3139-3146. 21. Ford, V. A., Stringer, C , and Kennel, S. J. 1992, Throm-

[Vol. 6,

bomodulin is preferentially expressed in Balb/c lung microvessels., J. Biol. Chew,., 267, 5446-5450.
