Cellular and Biochemical Features of Skeletal ... - Wiley Online Library

Animal Physiology

Cellular and Biochemical Features of Skeletal Muscle in Obese Yucatan Minipigs Christelle Guillerm-Regost,* Isabelle Louveau,* Sylvain P. Se´bert,† Marie Damon,* Martine M. Champ,† and Florence Gondret*

Abstract GUILLERM-REGOST, CHRISTELLE, ISABELLE ´ LOUVEAU, SYLVAIN P. SEBERT, MARIE DAMON, MARTINE M. CHAMP, AND FLORENCE GONDRET. Cellular and biochemical features of skeletal muscle in obese Yucatan minipigs. Obesity. 2006;14:1700 –1707. Objective: To examine cellular and biochemical features of skeletal muscle in response to dietary-induced obesity in a novel Yucatan minipig model of childhood obesity. Research Methods and Procedures: From 4 to 16 months of age, minipigs were fed either a recommended humantype diet (NF; n ⫽ 4) or were overfed a western-type diet with saturated fat and high-glycemic index carbohydrates (OF, n ⫽ 4). Muscle samples (biceps femoris) were histochemically stained for the identification of intramuscular adipocytes, intramyocellular lipid aggregates (oil red O), and myofiber types (myosin ATPase, succinate dehydrogenase). Gene expressions and/or activities of factors involved in lipogenesis, lipolysis, or energetic metabolism were quantified in muscle. Results: Cross-sectional areas of myofibers paralleled pig body weight (r ⫽ 0.86, p ⬍ 0.01). The size of intramuscular adipocytes, the relative proportion of oil red O-stained fibers, and total muscle lipid content tended (p ⱕ 0.10) to increase in response to OF diet. Hormone-sensitive lipase, carnitine palmityl transferase-I, and uncoupling protein 2 mRNA levels were lower (p ⬍ 0.05) in OF pigs than in NF pigs. Activities of ␤-hydroxyacyl-coenzyme A dehydroge-

Received for review July 25, 2005. Accepted in final form July 13, 2006. The costs of publication of this article were defrayed, in part, by the payment of page charges. This article must, therefore, be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. *Institut National de la Recherche Agronomique/AgroCampus Rennes, Unite´ Mixte de Recherche, Livestock Production Systems, Animal and Human Nutrition, Saint Gilles, France; and †Institut National de la Recherche Agronomique, Human Nutrition and Gut Function Unit, Nantes, France. Address correspondence to Florence Gondret, Institut National de la Recherche Agronomique, Unite´ Mixte de Recherche Syste`mes d’Elevage, Nutrition Animale et Humaine, 35590 Saint-Gilles, France. E-mail: [email protected] Copyright © 2006 NAASO

1700

OBESITY Vol. 14 No. 10 October 2006

nase and citrate synthase assessing post-carnitine palmityl transferase I events and the proportion of oxidative myofibers were not altered by OF diet. Activity and gene expression of fatty acid synthase were lower (p ⬍ 0.02) in OF pigs than in NF pigs. Discussion: Overfeeding in Yucatan minipigs reduced the expression levels of three catabolic steps in skeletal muscle that are involved also in the etiology of human obesity. Key words: extramyocellular lipid, fat metabolism, intramyocellular lipid, myofibers, oxidation

Introduction Increased food intake and decreased energy expenditure resulting from sedentary lifestyles have contributed to the development of obesity in both children and adults. Obesity is associated with a wide range of metabolic disorders including insulin resistance. Skeletal muscle is the primary site of insulin-stimulated glucose disposal and whole-body lipid oxidation. Abnormalities in glucose storage (1,2) and in triglyceride features (3) in muscle are clearly observed in human obesity and insulin resistance. Triglyceride stores in muscle are localized (4) both in droplets within fiber cytoplasm [intramyocellular lipids (IMCLs)]1 (1) and in adipocytes interlaced between muscle fibers [extramyocellular lipids (EMCLs)]. A correlation between IMCL content and the severity of insulin resistance has been described in both humans and rodent models (3–5), whereas variation in EMCLs has been poorly depicted. An increase in EMCL storage has been shown in high-fat-fed rats using 1H magnetic resonance spectroscopy (6), but it is likely that EMCL depots were not distinguished from intermuscular adipose fat located between muscles. Muscle accretion of triglycer-

1 Nonstandard abbreviations: IMCL, intramyocellular lipid; EMCL, extramyocellular lipid; CPT, carnitine palmityl transferase; BW, body weight; NF, normally fed a recommended human-type diet; OF, overfed a western type diet; s.c., subcutaneous; SDH, succinate dehydrogenase; CSA, cross-sectional area; LDH, lactate dehydrogenase; CoA, coenzyme A; HAD, ␤-hydroxyacyl-coenzyme A (CoA)-dehydrogenase; CS, citrate synthase; FAS, fatty acid synthase; SREBP, sterol regulatory element binding proteins; PPAR, peroxisome proliferator-activated receptor; HSL, hormone-sensitive lipase; UCP, uncoupling protein.

Skeletal Muscle of Obese Minipigs, Guillerm-Regost et al.

ides seems to arise mainly from an imbalance between lipid deposition and rates of use. Indeed, reduced capacity for lipid oxidation has been demonstrated in muscle of obese and insulin-resistant patients (7). This was apparently due to lower activities of carnitine palmityl transferase (CPT)-I, regarded as the rate-limiting enzyme for longchain fatty acid oxidation, and various mitochondrial enzymes, used as a measure of the capacity for metabolic fuel use (8,9). Increased rates of fatty acid transport and esterification also have been sometimes described in obese individuals (10). Considering problems in collecting tissue samples and multifactorial etiology of obesity in human patients, suitable animal models are essential for a better understanding of the metabolic onset of obesity and related muscle lipid disorders. Minipigs with their physiological similarities to humans (11,12) are of special interest for the study of dietaryinduced obesity. Unlike rodents, they are omnivorous and have an adult weight that is close to that of an adult man. High-fat feeding is known to accelerate weight gain, increase fat mass, and induce low insulin sensitivity in minipigs (13–15). However, the effects of hyperenergetic diets on muscle metabolism are still unknown. The present study was undertaken to determine whether histological and metabolic characteristics of muscle were altered in a novel Yucatan minipig model of childhood obesity in a manner similar to that described in humans. Lipid content, histological characteristics of IMCL and EMCL stores, and expression of genes involved in lipid metabolism or energy production were determined in muscle of minipigs overfed or not overfed a hyperenergetic diet during the growth period.

Research Methods and Procedures Animals and Tissue Preparation The experimental design was conducted in accordance with the French guidelines for humane care and use of animals in research. Animals were a subset of the minipigs used recently (15). From 4 to 16 months of age, male Yucatan minipigs [initial body weight (BW), 11.3 ⫾ 1.5 kg] were either normally fed a recommended human-type diet (NF; n ⫽ 4) or overfed a western type diet (OF, n ⫽ 4) mainly composed of saturated fat and high glycemic index carbohydrate sources (Table 1). All pigs were individually fed twice a day. The amount of food distributed to OF pigs was calculated on the basis of NF pig mean BW on a weekly basis to provide 290 kcal/BW0.75 per day to NF pigs and 435 kcal/BW0.75 per day to OF pigs, respectively (15). Pigs were weighed at 16 months of age. Porcine obesity index was calculated according to a formula considering pig body as a truncated cone (15). Pigs were then killed with an intraperitoneal injection of sodium pentobarbital. Samples

Table 1. Composition and energy content of the experimental diets Ingredient Composition (g/100 g dry matter) Sucrose Glucose Dry mashed potatoes Ground wheat Butter Coconut oil Sunflower margarine Olive oil Soybean oil Casein Vitamin mix* Mineral mix† Butyl-hydroxy-toluene Energy distribution meal (percentage of total energy) Carbohydrates Protein Fat Energy consumption (kcal/BW0.75 per day) Carbohydrates Protein Fat

NF

OF

3.6 5.4 71.2 70.8 3.0 11.5 1.2 6.6 2.15 1.08 0.1

12.9 0.3 4.2

3.5 0.80 1.60 0.1

50 15 35

53 10 37

145.0 43.5 101.5

230.6 43.5 160.9

NF, normally fed a recommended human-type diet; OF, overfed a western type diet. * The amounts of trace elements (per gram of vitamin mix) were: vitamin A (2400 IU), vitamin D3 (300 IU), vitamin E (10 mg), vitamin K (0.5 mg), biotin (0.004 mg), thiamin (0.6 mg), riboflavin (0.860 mg), pantothenic acid (2.45 mg), pyridoxine (0.51 mg), and nicotinic acid (0.0001 mg). † Composed of (per gram of mineral mix): calcium hydrogen phosphate dihydrate (573.9 mg), calcium carbonate (407 mg), zinc sulfate monohydrate (12.0 mg), manganese sulfate monohydrate pentahydrate (5.3 mg), copper sulfate (1.8 mg), and cobalt sulfate hydrate (0.013 mg).

of dorsal subcutaneous (s.c.) adipose tissue (i.e., a pool of the upper and lower layers) and of muscle (biceps femoris) were immediately collected. Visible intermuscular fat was carefully removed from the muscle. Portions of s.c. adipose tissue and muscle samples prepared after myofiber axis were restrained on flat sticks and frozen in liquid nitrogen. All samples were stored at ⫺75°C until subsequent analyses. OBESITY Vol. 14 No. 10 October 2006

1701


Table 2. Primer sequences used for real-time polymerase chain reaction Gene

Code

Forward primer

Reverse primer

FAS SREBP-1 SREBP-2 PPAR␥ HSL CPT-I HAD CS UCP2 UCP3

AY183428 AF102873 AF278694 AF103946 S80110 AY181062 AF027652 M21197 AF03675 AF12883

AGCCTAACTCCTCGCTGCAAT CGGACGGCTCACAATGC TGGGAACAGAGGCCAAGATG ATTCCCGAGAGCTGATCCAA CAACTTGGTGCCCACAGAAGA CACTGTCTGGGCAAACCAAA ACAAATGAGGCGCAGCTTCT GAAACATCGGTTCTTGATCCTGAT AGGGTCCCCGAGCCTTCT CGACTCCGTCAAGCAGCTCTA

TCCTTGGAACCGTCTGTGTTC GCAAGACGGCGGATTTATTC TTTATGATTGACCTGCTGCAAATAC TGGAACCCCGAGGCTTTAT GTCATGCAGTGTCAGGTACTTGAGA GCCACCTGGTAGGAACTCTCAAT ATCAAAATGCACACTGAACAGATCA GGTTCTTCCCCACCCTTAGC CAGCTGCTCATAGGTGACAAACA CCAAAATCCGGGTGGTGAT

Adipocyte Histology Serial cross sections (12 ␮m thick, five sections per sample, 50-␮m intervals) from s.c. adipose tissue or muscle were cut with a cryostat (2800 Frigocut; Reichert-Jung, Paris, France), and fixed for 10 minutes in 0.1 M phosphate buffer containing 2.5% (vol/vol) glutaraldehyde (25% aqueous solution; Sigma, St. Louis, MO). They were stained for 4 minutes in isopropanol containing 0.5% oil red O (wt/vol), and membranes of adipocytes and myofibers were then counterstained in an aqueous solution of cristal-violet (16). Visible adipocytes (i.e., EMCLs) clustered along myofiber fasciculi were then carefully reproduced on transparent plastic sheets using a projection microscope (Visopan, Reichert, Vienna), digitized with a charge-coupled device camera, and individual areas were then measured using an image analysis system (Optimas 6.5; Media Cybernetics, Silver Spring, MD) as described previously (16). Mean diameter was then calculated from ⬃200 visible adipocytes per section. Myofiber Characteristics Four serial cross sections of muscle (12 ␮m thick) were obtained with the cryostat. One section was processed for actomyosin ATPase activity after acidic preincubation at pH 4.3 (17) to identify slow-twitch type I fibers and fasttwitch type IIA or IIB/IIX fibers. A second section was stained for succinate dehydrogenase (SDH) activity to assess the aerobic oxidative capacity of the same fibers (18). A third section was incubated in oil red O staining solution to assess IMCL droplets within myofibers (19), and fibers were then classified as positive or negative oil red O stained, based on relative luminescence. Myofiber type proportions were determined from ⬃1000 fibers into four fields randomly selected in muscle section after image capture with a color camera. Mean cross-sectional areas (CSAs) of metabolic fiber types were determined using a programmable planimeter (Hitachi Siko, Tokyo, Japan). 1702


Metabolite Contents Total lipid content of s.c. adipose tissue or muscle was determined after extraction with chloroform/methanol (20). Glycogen content of muscle was quantified as previously described (21), using a commercially available enzymatic kit for glucose determination (glucose HK; ABX Diagnostics, Montpellier, France). Enzyme Activities Activities of catabolic enzymes were determined in a portion of muscle that was homogenized in a 1:20 dilution (wt/vol) of 0.1 M phosphate buffer solution before being assayed at 30°C spectrophotometrically. Activities of lactate dehydrogenase (LDH) and ␤-hydroxyacyl-coenzyme A (CoA)-dehydrogenase (HAD) were monitored at 340 nm (22,23), whereas determination of citrate synthase (CS) activity was performed at 405 nm (24). Activity of fatty acid synthase (FAS), the key enzyme involved in palmitate synthesis, was measured on cytosolic supernatant at 340 nm at 37°C (25). Soluble protein content of the different fractions was determined using a commercially available kit (BCA Protein Assay Kit; Pierce, Rockford, IL). Real-Time Polymerase Chain Reaction Total RNA was extracted from muscle (26), and RNA integrity was electrophoretically checked by ethidium bromide staining. First strand cDNA was generated from 1.5 ␮g of DNase-treated RNA using random hexamers and reverse transcriptase (Amersham Biosciences, Buckinghamshire, United Kingdom). Primers (Table 2) for selected genes involved in lipogenesis [FAS, sterol regulatory element binding proteins (SREBPs)-1 and -2, and peroxisome proliferator-activated receptor (PPAR) ␥], lipolysis [hormone-sensitive lipase (HSL)], long-chain fatty acid catabolism (CPT-1, HAD, CS), or energy expenditure [uncoupling proteins (UCPs) 2 and 3)] were designed using Primer Express software (version 2.0; Applied Biosystems, Foster


Figure 1: Lipid distribution in biceps femoris muscle of NF pigs (䡺) or OF pigs (f). (A) Typical muscle cross section stained for EMCLs as adipocytes clustered along myofiber fasciculi and mean diameter of adipocytes (␮m). (B) Typical muscle cross section stained for IMCLs as lipid droplets within myofiber cytoplasm and relative proportion of oil red O positively stained fibers. Data are plotted as mean ⫾ standard error († p ⱕ 0.10 vs. NF), n ⫽ 4 per group.

City, CA). Real-time polymerase chain reaction was performed using ABI PRISM 7000 sequence detection system (Applied Biosystems) with Sybr Green dye. Forty cycles of PCR were performed at 59°C in 25 ␮L of buffer containing forward and reverse primers (500 nM, except for SREBP-1, 200 nM) and cDNA (50 ng) as described previously (27). Endogenous 18S ribosomal RNA amplifications (Human 18S rRNA, predeveloped TaqMan assay reagents; Applied Biosystems) were used to normalize the expression of target genes. mRNA levels of target genes relative to 18S were calculated using the cycle threshold value as mean of triplicate measurements (28). Statistical Analysis All data are presented as means ⫾ standard error. Student’s t test was used to assess differences between NF and OF groups using SAS software (SAS, Cary, NC). Pearson correlation coefficients between different variables were also calculated.

Results Body Mass and s.c. Fat At the end of the study, the body mass was higher in the OF group than in the NF group (105.9 ⫾ 8.4 vs. 47.8 ⫾ 3.3

kg, p ⬍ 0.001). This increase was associated with a higher obesity index (0.97 ⫾ 0.05 vs. 0.47 ⫾ 0.02, p ⬍ 0.001) and with enlarged diameter of s.c. adipocytes (131 ⫾ 4 vs. 96 ⫾ 6 ␮m, respectively, p ⬍ 0.01) in OF pigs. In contrast, there was no difference in total lipid content per gram of s.c. adipose tissue (819 ⫾ 8.1 mg/g, on average, p ⫽ 0.92) between the two groups. EMCL and IMCL Morphology Figure 1 shows typical staining for EMCL (adipocytes) and ICML (lipid droplets within myofiber cytoplasm) pools in muscle cross-sections. Both the mean diameter of intramuscular adipocytes (EMCL, p ⫽ 0.07) and the relative proportion of oil red O stained fibers (IMCL, p ⫽ 0.10) tended to be higher (⫹22% and ⫹26%, respectively) in OF than in NF pigs. Biochemical Composition Muscle lipid content tended to be 41% higher in OF than in NF pigs (p ⫽ 0.07; Table 3), whereas muscle glycogen content did not differ (p ⫽ 0.25) between the two groups. Activities and mRNA Expression of Lipid-Related Metabolic Factors in Muscle Table 4 shows the effects of diet on gene expressions and enzyme activities. Both expression and specific activity of OBESITY Vol. 14 No. 10 October 2006

1703


Table 3. Biochemical composition in muscle of pigs fed NF or OF* Metabolite

NF

OF

p

Lipids Glycogen

34.4 ⫾ 1.5 8.6 ⫾ 1.1

49.4 ⫾ 7.8 7.0 ⫾ 0.6

0.09 0.25

NF, normally fed a recommended human-type diet; OF, overfed a western type diet. * Values (mean ⫾ standard error) are expressed in milligrams per gram wet weight, n ⫽ 4 per group. Figure 2: Relative proportions of fiber types in biceps femoris muscle of NF pigs (䡺) or OF pigs (f), n ⫽ 4 per group.

Table 4. Gene expression and enzyme activities in muscle of pigs fed NF or OF* Targets

NF

OF

p

Lipogenesis FAS activity 1.77 ⫾ 0.51 0.22 ⫾ 0.03 0.02 FAS mRNA 66 ⫾ 12 17 ⫾ 10 0.02 SREBP-1 mRNA 56 ⫾ 12 45 ⫾ 3 0.36 SREBP-2 mRNA 75 ⫾ 15 50 ⫾ 5 0.16 PPAR␥ mRNA 62 ⫾ 18 7⫾3 0.02 Lipolysis HSL mRNA 32 ⫾ 3 14 ⫾ 5 0.04 Nutrient catabolism CPT-I mRNA 69 ⫾ 12 22 ⫾ 4 0.01 HAD activity 46 ⫾ 9 61 ⫾ 12 0.35 HAD mRNA 85 ⫾ 20 44 ⫾ 3 0.09 CS activity 172 ⫾ 24 172 ⫾ 13 0.97 CS mRNA 86 ⫾ 14 72 ⫾ 13 0.48 LDH activity 17,670 ⫾ 1182 14,808 ⫾ 1473 0.18 LDH/CS 103 ⫾ 23 87 ⫾ 9 0.35 UCP2 mRNA 64 ⫾ 4 15 ⫾ 4 ⬍0.001 UCP3 mRNA 44 ⫾ 7 33 ⫾ 6 0.29 NF, normally fed a recommended human-type diet; OF, overfed a western type diet; FAS, fatty acid synthase; SREBP, sterol regulatory element binding proteins; PPAR, peroxisome proliferatoractivated receptor; HSL, hormone-sensitive lipase; CPT, carnitine palmityl transferase; HAD, ␤-hydroxyacyl-coenzyme A (CoA)dehydrogenase; CS, citrate synthase; LDH, lactate dehydrogenase; UCP, uncoupling protein. * Values for mRNA levels (arbitrary units) represented the ratio of selected gene to 18S mRNA levels. Values for enzyme activities are expressed in nanomoles per minute and per milligram of proteins. Values are means ⫾ standard error, n ⫽ 4 per group.

1704


FAS were lower (p ⬍ 0.05) in OF than in NF group. The mRNA expressions of the transcriptional regulators SREBPs did not differ between the two groups, whereas mRNA level of PPAR␥ was lower (p ⬍ 0.05) in OF than in NF pigs. Compared with NF pigs, HSL and CPT-1 mRNA expressions were lower (p ⬍ 0.05) in OF pigs. For HAD, mRNA level tended to be lower in OF than in NF pigs, but specific enzyme activity did not differ between the two groups. Expression of mRNA and activity of CS and the ratio of LDH to CS activities did not differ between the two groups. Finally, UCP2 mRNA expression was lower in OF than in NF pigs (p ⬍ 0.05), whereas UCP3 gene expression was unaffected by dietary treatment. Muscle Fiber Types The relative proportions of contractile and metabolic fiber types did not differ between the two groups (Figure 2). In contrast, mean CSAs of both oxidative fibers and nonoxidative fibers were increased in response to OF diet (p ⬍ 0.01, Figure 3). Mean myofiber CSAs correlated positively with final BW (r ⫽ 0.86, p ⬍ 0.01, data not shown).

Discussion As expected (14), overconsumption of a high-fat hyperenergetic diet during growth increased weight gain and BMI in Yucatan minipigs. As reported in human studies (29), mean CSA of porcine myofibers correlated positively with BW. Insulin-resistant status was previously (15) established in OF pigs (i.e., 5.7 ⫾ 1.3 vs. 13.6 ⫾ 4.3 mg/kg per minute for glucose infusion rates in OF compared with NF pigs), and these pigs were then described as a good model of systemic-related disorders associated with childhood obesity. The present study further documents the alterations induced by obesity and insulin resistance on lipid features in skeletal muscle. The slight increases observed in muscle lipid content, adipocyte diameter (EMCL stores), and the


Figure 3: Mean CSAs of oxidative (SDH⫹) and non-oxidative (SDH⫺) fiber types in biceps femoris muscle of NF pigs (䡺) or OF pigs (f). Data are plotted as mean ⫾ standard error (** p ⬍ 0.01 vs. NF), n ⫽ 4 per group.

proportion of oil red O-stained myofibers (IMCL pool) in OF compared with NF pigs are consistent with recent data describing lipid accumulation in muscles of obese compared with lean adolescents using magnetic resonance imaging (30). The small magnitude of increase in muscle lipid stores observed for OF pigs relative to human patients (3) may be related to the degree of obesity because significant increase in IMCL stores has been sometimes restricted to extremely obese men (31). In addition, it may also refer to difference in the period of dietary induction that started in young growing pigs (i.e., in a period of marked myofiber hypertrophy) and not in adult individuals. Such an observation of increased muscle lipid stores in obesity might arise from an imbalance between importation of plasma fatty acids and lipid use. We provide new evidence that obesity in muscle of OF pigs was associated with a lower expression of HSL, the rate-limiting enzyme for the breakdown of stored triglycerides. This decrease might be associated with a decrease in HSL activity as reported in obese and insulin-resistant rat muscles (32), although HSL activity was not measured in the present study. Moreover, impaired ␤-adrenergically mediated lipolysis in muscle of obese human subjects has been suggested as an early event in the process of triglyceride accumulation (33). Therefore, it is possible that the modest increase observed in lipid content in OF compared with NF pigs involved a slight decrease in lipolysis in OF muscle. Further measurements, however, are needed to check the lipolytic rates in OF and NF pig muscles. Because we cannot distinguish between adipocyte and myofiber HSL (34), it remains also to determine which lipid pool (EMCL, IMCL, or both) was primarily affected. An inability to effectively oxidize circulating lipids has also been proposed to play an important role in human obesity (8,35). Long-chain fatty acid oxidation is partially

dependent on transport across the mitochondrial membranes by CPT-I. In the current study, we showed a lower expression of CPT-I mRNA in OF than in NF muscles. Inhibition of CPT-I activity has been also evidenced in muscle of obese compared with lean human patients (8,35). Because muscle content in malonyl-CoA (a potent allosteric inhibitor of CPT-I activity in pig) (36) is also increased in rodent models of obesity/insulin resistance (37,38), it is likely that long-chain fatty acyl-CoA content in mitochondria is impaired in OF compared with NF pigs. However, in contrast to findings in human studies (35,39), we did not find any cumulative decrements in post-CPT-1 events assessed as maximal potential activity of HAD, the key enzyme in ␤-oxidation, and CS, a reliable marker of mitochondrial content, and glycolytic-to-oxidative enzyme activities ratio. In addition, we did not show any differences in metabolic and contractile fiber-type proportions between groups. Several studies have indicated that type I fiber proportion is either unchanged in human obesity (40) or inversely related to increased fatness and insulin resistance (41– 43). A modest reduction in the proportion of type IIA fibers has been also evidenced in skeletal muscle from obese compared with lean subjects (40). It is well known that type I fibers have the highest content in IMCL, followed in order by types IIA and IIB in pigs (44) as in humans (40). Then, our data suggest that the modest effect of dietary obesity on IMCL stores in pig was independent of muscle fiber type in accordance with data obtained in obese human subjects (40). Interestingly, we also found a lower expression of UCP2 mRNA in OF muscle, without any effect of the diet on UCP3 gene expression. Although still under discussion, UCPs are thought to modulate fatty acid oxidation and development of obesity by controlling the energy expenditure (45). Similar to our results, increased adiposity and type 2 diabetes have been related to a lower expression of UCP2 mRNA without any effect on UCP3 in human adipose tissue (46,47). Conversely, increased expression of UCP3 has been demonstrated in muscles of high-fat-fed rodents (48). Therefore, the precise role of UCP in the etiology of porcine obesity remains to be investigated. Because both fat and glucose dietary supplies were increased in OF compared with NF pigs, alterations of carbohydrate metabolism in OF muscle are also possible. The lack of difference in glycogen content between NF and OF muscle agrees with many studies indicating that muscle glycogen is not or only slightly decreased in obesity (2). We also reported similar levels in muscle LDH activity (anaerobic glycolysis) between the two groups. In contrast, a clear reduction in the expression of FAS, the key enzyme involved in palmitate synthesis, was detected in OF pigs. Interestingly, changes in FAS expression did not involve variation of SREBP-1 and -2 mRNA levels, two transcription factors that activate a cascade of enzymes required for OBESITY Vol. 14 No. 10 October 2006

1705


triglyceride synthesis (49). These observations support our recent findings indicating that the regulation of FAS by insulin may not necessarily involve changes in SREBP-1 expression in porcine isolated adipocytes (27). Also, mRNA level of SREBP-1 in rat muscle is decreased by diabetes (50) but not by obesity (51). Finally, activation of PPAR␥ in adipocytes is known to up-regulate the expression of several genes involved in fatty acid storage, thereby improving whole-body insulin sensitivity (52), whereas the physiological relevance of PPAR␥ modulation in muscle is less understood. The reduction of PPAR␥ expression currently observed in muscle of OF compared with NF pigs associated with recent findings in rodents (53) suggests that PPAR␥ system may play a significant role in insulin sensitivity in muscle. Further studies, however, are required to get a better understanding of the action of PPAR␥ in muscle compared with adipose tissue. In conclusion, overfeeding in Yucatan minipigs reduced HSL expression, impaired the first step of fat oxidation (CPT-1), and decreased UCP2 expression in muscle, three steps identified also in the etiology of human obesity. These early metabolic modifications might then precede the enlargement of EMCL and IMCL stores. Minipigs, then, may be an interesting model for research on the upset of obesity acquired during childhood.

Acknowledgments This work was supported by the Ministe`re de la Recherche, France (postdoctoral grant to C.G.-R.). We thank Fabienne Pontrucher and Ge´rard Lecannu for expert technical assistance. References 1. Bogardus C, Lillioja S, Mott D, et al. Relationship between obesity and maximal insulin-stimulated glucose uptake in vivo and in vitro in Pima Indians. J Clin Invest. 1984;73:800 –5. 2. He J, Kelley DE. Muscle glycogen content in type 2 diabetes mellitus. Am J Physiol. 2004;287:E1002–7. 3. Kelley DE, Goodpaster BH. Skeletal muscle triglyceride: an aspect of regional adiposity and insulin resistance. Diabetes Care. 2001;24:933– 41. 4. Machann J, Ha¨ring H, Schick F, Stumvoll M. Intramyocellular lipids and insulin resistance. Diabetes Obes Metab. 2004; 6:239 – 48. 5. Hegarty BD, Furler SM, Ye J, Cooney GJ, Kraegen EW. The role of intra-muscular lipid in insulin resistance. Acta Physiol Scand. 2003;178:373– 83. 6. Dobbins RL, Szczepaniak LS, Bentley B, et al. Prolonged inhibition of muscle carnitine palmitoyltransferase-1 promotes intramyocellular lipid accumulation and insulin resistance in rats. Diabetes. 2001;50:123–30. 7. Kelley DE, Reilly JP, Veneman T, Mandarino LJ. Effects of insulin on skeletal muscle glucose storage, oxidation, and glycolysis in humans. Am J Physiol. 1990;258:E923–9. 1706


8. Kelley DE, Goodpaster B, Wing RR, Simoneau JA. Skeletal muscle fatty acid metabolism in association with insulin resistance, obesity and weight loss. Am J Physiol. 1999;277: E1130 – 41. 9. Simoneau JA, Veerkamp JH, Turcotte LP, Kelley DE. Markers of capacity to utilize fatty acids in human skeletal muscle: relation to insulin resistance and obesity and effects of weight loss. FASEB J. 1999;13:2051– 60. 10. Bonen A, Parolin ML, Steinberg GR, et al. Triacylglycerol accumulation in human obesity and type 2 diabetes is associated with increased rates of skeletal muscle fatty acid transport and increased sarcolemmal FAT/CD36. FASEB J. 2004;18: 1144 – 6. 11. Douglas WR. Of pigs and men and research: a review of applications and analogies of the pig, sus scrofa, in human medical research. Space Life Sci. 1972;3:226 –34. 12. Gerrity RG, Natarajan R, Nadler JL, Kimsey T. Diabetesinduced accelerated atherosclerosis in swine. Diabetes. 2001; 50:1654 – 65. 13. Johansen T, Hansen HS, Richelsen B, Malmho¨f K. The obese Go¨ttingen minipig as a model of the metabolic syndrome: dietary effects on obesity, insulin sensitivity, and growth hormone profile. Comp Med. 2001;51:150 –5. 14. Xi S, Yin W, Wang Z, et al. A minipig model of high-fat/ high-sucrose diet-induced diabetes and atherosclerosis. Int J Exp Path. 2004;85:223–31. 15. Se´bert SP, Lecannu G, Kozlowski F, et al. Childhood obesity and insulin resistance in a Yucatan mini-piglet model: putative roles of IGF-1 and muscle PPARs in adipose tissue activity and development. Int J Obes. 2005;29:324 –33. 16. Gondret F, Lebret B. Feeding intensity and dietary protein level affect adipocyte cellularity and lipogenic capacity of muscle homogenates in growing pigs, without modification of the expression of sterol regulatory element binding protein. J Anim Sci. 2002;80:3184 –93. 17. Brooke MH, Kaiser KK. Muscle fiber types: how many and what kind? Arch Neurol. 1970;23:369 –79. 18. Nachlas MM, Tsou KC, De Souza E, Cheng CS, Seligman AM. Cytochemical demonstration of succinic dehydrogenase by the use of new p-nitrophenyl substituted ditetrazole. J Histochem Cytochem. 1957;5:420 –36. 19. Koopman R, Schaart G, Hesselink MKC. Optimization of oil red O staining permits combination with immunofluorescence and automated quantification of lipids. Histochem Cell Biol. 2001;116:63– 8. 20. Folch J, Lees M, Sloane-Stanley GH. A simple method for the isolation and purification of total lipids from animal tissues. J Biol Chem. 1957;226:497–509. 21. Good CA, Kramer H, Somogyi M. The determination of glycogen. J Biol Chem. 1933;100:485–91. 22. Vassault A. Lactate dehydrogenase: UV-method with pyruvate and NADPH. In: Bergemyer HU, ed. Methods of Enzymatic Analysis. 3rd ed, Vol 3. Weinheim, Germany: Verlag Chemie; 1983, pp. 118 –26. 23. Bass A, Brdiczka D, Eyer P, Hofer S, Pette D. Metabolic differentiation of distinct muscle types at the level of enzymatic organization. Eur J Biochem. 1969;10:198 –206. 24. Srere PA. Citrate synthase. Methods Enzymol. 1969;13:3–11.


25. Bazin R, Ferre´ P. Assays of lipogenic enzymes. Methods Mol Biol. 2001;155:121–7. 26. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156 –9. 27. Louveau I, Gondret F. GH and insulin affect fatty acid synthase activity in isolated porcine adipocytes in culture without any modifications of sterol regulatory element binding protein-1 expression. J Endocrinol. 2004;181:271– 80. 28. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29: 2002–7. 29. Lithell H, Lindgarde F, Hellsing K, et al. Body weight, skeletal muscle morphology, and enzyme activities in relation to fasting serum insulin concentration and glucose tolerance in 48-year-old men. Diabetes. 1981;30:19 –25. 30. Sinha R, Dufour S, Petersen KF, et al. Assessment of skeletal muscle triglyceride content by 1H nuclear magnetic resonance spectroscopy in lean and obese adolescents: relationships to insulin sensitivity, total body fat, and central adiposity. Diabetes. 2002;51:1022–7. 31. Hulver MW, Berggren JR, Cortright RN, et al. Skeletal muscle lipid metabolism with obesity. Am J Physiol. 2003; 284:E741–7. 32. Kim CH, Kim MS, Youn JK, et al. Lipolysis in skeletal muscle is decreased in high-fat-fed rats. Metabolism. 2003;52: 1586 –92. 33. Blaak EE. Basic disturbances in skeletal muscle fatty acid metabolism in obesity and type 2 diabetes mellitus. Proc Nutr Soc. 2004;63:323–30. 34. Donsmark M, Langfort J, Holm C, Ploug T, Galbo H. Regulation and role of hormone-sensitive lipase in rat skeletal muscle. Proc Nutr Soc. 2004;63:309 –14. 35. Kim JY, Hickner RC, Cortright RL, Dohm GL, Houmard JA. Lipid oxidation is reduces in obese human skeletal muscle. Am J Physiol. 2000;279:E1039 – 44. 36. Schmidt I, Herpin P. Carnitine palmitoyltransferase I (CPT I) activity and its regulation by malonyl-CoA are modulated by age and cold exposure in skeletal muscle mitochondria from newborn pigs. J Nutr. 1998;128:886 –93. 37. Ruderman NB, Saha AK, Vavvas D, Heydrick SJ, Kurowski TG. Lipid abnormalities in muscle of insulin-resistant rodents: the malonyl CoA hypothesis. Ann N Y Acad Sci. 1997;827:221–30. 38. Saha AK, Vavvas D, Kurowski TG, et al. Malonyl-CoA regulation in skeletal muscle: its link to cell citrate and the glucose-fatty acid cycle. Am J Physiol. 1997;272:E641– 8. 39. Simoneau JA, Colberg SR, Thaete FL, Kelley DE. Skeletal muscle glycolytic and oxidative enzyme capacities are determinants of insulin sensitivity and muscle composition in obese women. FASEB J. 1995;9:273– 8.

40. Malenfant P, Joanisse DR, The´riault R, Goodpaster BH, Kelley DE, Simoneau JA. Fat content in individual muscle fibers of lean and obese subjects. Int J Obes. 2001;25:1316 – 21. 41. Lillioja S, Young AA, Culter CL, et al. Skeletal muscle capillary density and fiber type are possible determinants of in vivo insulin resistance in man. J Clin Invest. 1987;80:415–24. 42. Kriketos AD, Pan DA, Lillioja S, et al. Interrelationships between muscle morphology, insulin action, and adiposity. Am J Physiol. 1996;270:R1332–9. 43. Wade AJ, Marbut MM, Round JM. Muscle fibre type and aetiology of obesity. Lancet. 1990;335:805– 8. 44. Essen-Gustavsson B, Karlsson A, Lundstro¨m K, Enfa¨lt A. Intramuscular fat and muscle fibre lipid contents in halothanegene-free pigs fed high or low protein diets and its relation to meat quality. Meat Sci. 1994;38:269 –77. 45. Dulloo AG, Seydoux J, Jacquet J. Adaptative thermogenesis and uncoupling proteins: a reappraisal of their roles in fat metabolism and energy balance. Physiol Behav. 2004;83:587– 602. 46. Pedersen SB, Nyholm B, Kristensen K, Nielsen MF, Schmitz O, Richelsen B. Increased adiposity and reduced adipose tissue mRNA expression of uncoupling protein-2 in first degree relatives of type 2 diabetic patients: evidence for insulin stimulation of UCP-2 and UCP-3 gene expression in adipose tissue. Diabetes Obes Metab. 2005;7:98 –105. 47. You Y, Yang Y, Zhang S, et al. Study of uncoupling protein-2 gene expression in intraperitoneal adipose tissue of obese humans and normal humans. Wei Sheng Yan Jiu. 2003; 32:201–3. 48. Thompson MP, Kim D. Links between fatty acids and expression of UCP2 and UCP3 mRNAs. FEBS Lett. 2004;568: 4 –9. 49. Eberle´ D, Hegarty B, Bossard P, Ferre´ P, Foufelle F. SREBP transcription factors: master regulators of lipid homeostasis. Biochimie. 2004;86:839 – 48. 50. Guillet-Deniau I, Mieulet V, Le Lay S, et al. Sterol regulatory element binding protein-1c expression and action in rat muscles: insulin-like effects on the control of glycolytic and lipogenic enzymes and UCP3 gene expression. Diabetes. 2001;51:1722– 8. 51. Ducluzeau PH, Perretti N, Laville M, et al. Regulation by insulin of gene expression in human skeletal muscle and adipose tissue. Diabetes. 2001;50:1134 – 42. 52. Ferre´ P. The biology of peroxisome proliferator-activated receptors: relationship with lipid metabolism and insulin sensitivity. Diabetes. 2004;53:S43–50. 53. Kintscher U, Law RE. PPAR␥-mediated insulin sensitization: the importance of fat versus muscle. Am J Physiol. 2005;288:E287–91.


1707