Chapter 1

Complimentary Contributor Copy


AGRICULTURAL RESEARCH UPDATES

AGRICULTURAL RESEARCH UPDATES VOLUME 22

No part of this digital document may be reproduced, stored in a retrieval system or transmitted in any form or by any means. The publisher has taken reasonable care in the preparation of this digital document, but makes no expressed or implied warranty of any kind and assumes no responsibility for any errors or omissions. No liability is assumed for incidental or consequential damages in connection with or arising out of information contained herein. This digital document is sold with the clear understanding that the publisher is not engaged in rendering legal, medical or any other professional services.


AGRICULTURAL RESEARCH UPDATES Additional books in this series can be found on Nova’s website under the Series tab.

Additional e-books in this series can be found on Nova’s website under the eBooks tab.


AGRICULTURAL RESEARCH UPDATES

AGRICULTURAL RESEARCH UPDATES VOLUME 22

PRATHAMESH GORAWALA AND

SRUSHTI MANDHATRI EDITORS


Copyright © 2018 by Nova Science Publishers, Inc. All rights reserved. No part of this book may be reproduced, stored in a retrieval system or transmitted in any form or by any means: electronic, electrostatic, magnetic, tape, mechanical photocopying, recording or otherwise without the written permission of the Publisher. We have partnered with Copyright Clearance Center to make it easy for you to obtain permissions to reuse content from this publication. Simply navigate to this publication’s page on Nova’s website and locate the “Get Permission” button below the title description. This button is linked directly to the title’s permission page on copyright.com. Alternatively, you can visit copyright.com and search by title, ISBN, or ISSN. For further questions about using the service on copyright.com, please contact: Copyright Clearance Center Phone: +1-(978) 750-8400 Fax: +1-(978) 750-4470 E-mail: [email protected].

NOTICE TO THE READER The Publisher has taken reasonable care in the preparation of this book, but makes no expressed or implied warranty of any kind and assumes no responsibility for any errors or omissions. No liability is assumed for incidental or consequential damages in connection with or arising out of information contained in this book. The Publisher shall not be liable for any special, consequential, or exemplary damages resulting, in whole or in part, from the readers’ use of, or reliance upon, this material. Any parts of this book based on government reports are so indicated and copyright is claimed for those parts to the extent applicable to compilations of such works. Independent verification should be sought for any data, advice or recommendations contained in this book. In addition, no responsibility is assumed by the publisher for any injury and/or damage to persons or property arising from any methods, products, instructions, ideas or otherwise contained in this publication. This publication is designed to provide accurate and authoritative information with regard to the subject matter covered herein. It is sold with the clear understanding that the Publisher is not engaged in rendering legal or any other professional services. If legal or any other expert assistance is required, the services of a competent person should be sought. FROM A DECLARATION OF PARTICIPANTS JOINTLY ADOPTED BY A COMMITTEE OF THE AMERICAN BAR ASSOCIATION AND A COMMITTEE OF PUBLISHERS. Additional color graphics may be available in the e-book version of this book.

Library of Congress Cataloging-in-Publication Data ISBN: H%RRN ISSN: 2160-1739

Published by Nova Science Publishers, Inc. † New York


CONTENTS Preface Chapter 1

Chapter 2

Chapter 3

Chapter 4

vii Ecological Adaptations of White-Rot Fungi: A Solution to Human Caused Problems? Tiberius Balaes, Cristiana Virginia Petre and Catalin Tanase Streptomyces Bio-Products against Apple and Pear Diseases in Organic Orchards T. Doolotkeldieva Organic Crop Production in Sub-Saharan Africa: Filling the Skills and Awareness Fissures N. T. Sithole, M. N. Mbatha, G. D. Arthur and K. K. Naidoo Citric Acid Production Using Alternative Substrates Luciana Porto de Souza Vandenberghe, Priscilla Zwiercheczewski de Oliveira, Cristine Rodrigues and Carlos Ricardo Soccol


1

41

85

119

vi Chapter 5

Chapter 6

Chapter 7

Chapter 8

Chapter 9

Chapter 10

Contents The Cultivation, Composition and Usage of Wild Ginger (Siphonochilus aethiopicus (Schweinf) B.L. Burtt) Ngozichukwuka P. Igoli Hydrosols and Fluidolates® Derived from Lavandula angustifolia Grown in Poland Krzysztof Śmigielski, Renata Prusinowska and Alina Kunicka-Styczyńska Ecological Characteristics of Tara (Caesalpinia spinosa), a Multipurpose Legume Tree of High Ecological and Commercial Value Sheena Sangay-Tucto and Robin Duponnois Some Precipitation Patterns That Affect Agricultural Practices in the Plains of Buenos Aires (Argentina) Alfredo Luis Rolla and Marcela Hebe González Plant Production through Somatic Embryogenesis of Theobroma cacao L. Leaf Cultures Esther E. Uchendu, Omolola O. Oso and Victor O. Adetimirin Salt Stress Alleviation and Antioxidants Changes in Mycorrhizal Strawberry Plants Shiam Ibna Haque and Yoh-ichi Matsubara

Index

145

167

189

209

239

257 269


PREFACE In Agricultural Research Updates. Volume 22, the authors begin by presenting research on the ecological features and adaptation of white-rot fungi in relation to the possible applications of these fungi in bioremediation strategies. The selection of an appropriate species should consider the production of ligninases and their activity as well as the ecological factors that could stimulate and increase the process. Following this, Streptomyces sр strains were tested for apple scab control in vitro and field conditions. Two applications of Streptomyces strain C1-4 within 35 days completely stopped the scab disease in seedling leaves. The authors also address the necessity for farmers to adapt to these challenges such as restricted land boundaries, adversity of climate changes and environmental degradation to prevent low crop output and maintain livelihoods of people. This is especially true in developing countries. As land becomes less productive, ground-breaking organic crop production systems that cover different cultivating pattern must be implemented. The subsequent chapter provides important information about different possibilities for citric acid production, including the use of alternative agro-industrial substrates. Fermentation techniques, such as submerged fermentation and solid-state fermentation, and conditions that affect the acid synthesis are reported with the presentation of concrete examples of developed research. Wild ginger, or Siphonochilus aethiopicus, is discussed in the context of its usage as an


viii

Prathamesh Gorawala and Srushti Mandhatri

anti-inflammatory, anti-plasmodial, anti-thrush and an indication for allergies, asthma, candidiasis, headache, influenza, menstrual cramps, sinusitis and sore throat among other conditions. Next, the book focuses on the unique characteristics of lavender hydrosols obtained from Polish cultavations of Lavandula angustifolia and describes a new lavender derivative fluidolate® acquired in an innovative technology relying on raw material drying. The scientific knowledge acquired on Tara is reviewed in order to sustainably manage the Tara plantations and increase their productivity and stability. The botanical description of this tree species, as well as its ecology, is addressed. Later, a study is presented focusing on factors of different rainfall interannual variability using monthly precipitation in 22 stations for the period 1950-2012. El Niño, El Niño Modoki, the positive phase of the Indian Ocean Dipole, and the shift to the south of the South Atlantic High are shown to lead to an increase in spring precipitation in central Buenos Aires. In another study, an efficient protocol for somatic embryogenesis using leaf explants was developed with three elite cacao cultivars (CRIN TC1, CRIN TC2 and CRIN TC5). The zygotic embryos of these cultivars were aseptically excised and cultured on Murashige and Skoog (MS) basal medium without growth regulators. The compilation ends with an investigation of salt tolerance and the changes of antioxidative ability in mycorrhizal strawberry plants. Arbuscular mycorrhizal fungi Gigaspora margarita were inoculated in strawberry (Fragaria×ananssa. Duch) plants. Plants were treated with no salt, 200mM and 500mM NaCl solution. Chapter 1 - White-rot fungi form a group of organisms with characteristics of particular importance for human activities. Growing on wood or, sometimes, on litter, these fungi possess adaptations for using different wood components, such as cellulose, lignin and tannins, as nutrients in their own metabolism. These compounds are degraded by specific enzymes, the most important group being formed by ligninases versatile enzymes with remarkable properties, responsible for the degradation of lignin and other polyphenols in natural environments and of many types of human made compounds as well. Production and secretion of ligninases are directly associated with the taxonomic group of white-rot


Preface

ix

fungi, having distinctive characteristics and varied efficiencies, and these enzymes are using as substrates a wide spectrum of chemical compounds that present structural analogies with lignin - the specific natural target for these enzymes. The particular ecological features of different fungi are also influencing the activity and versatility of ligninases, being strongly connected with other metabolic phenomena and the overall development of fungal mycelium. The degradation of wood components is completed by other enzymes (non-ligninolytic), by the production of hydrogen peroxide and various secondary metabolites. The efficiency of the process depends on many factors affecting the reactions kinetics or on the fungal development and enzyme production, meaning that the specific adaptations of a certain species are of great importance. Ligninases from white-rot fungi have been extensively studied in the last two decades for possible use in several industrial/scientific activities, from pharmaceutical technologies to bioremediation. The latter line of research has been especially receiving attention, as these enzymes present an increased potential to be used for the biodegradation of organic pollutants, such as PAHs or synthetic dyes. Whether such technologies could be economically feasible or not, depends on the costs of cultivating these fungi and/or on the production of ligninases, aspects strongly influenced by the ecological adaptations of the chosen fungi. In situ application of white-rot fungi for bioremediation purposes is also subjected to a screening for assessing which species can be used in particular situations. White-rot fungi obviously represent a source of solutions for eliminating organic pollutants, and the selection of an appropriate species should not only consider the production of ligninases and their activity but also the ecological factors that would stimulate and increase the process. In this chapter, ecological features and adaptation of white-rot fungi are being presented and discussed in relation to the possible applications of these fungi in bioremediation strategies. Chapter 2 - Erwinia amylovora as a fire blight pathogen and Venturia inaequalis as a scab pathogen were isolated from the blossoms, exudates, infected fruits, leaves and bent branches of diseased apple, pear and hawthorn trees, selected in the Chy, Osh and Jalal Abad regions. Biochemical and pathogenicity tests, alongside PCR analyses were


x


conducted to identify the local isolates of Erwinia amylovora and Venturia inaequalis. The alternative antagonistic microorganisms which combat bacterium E. amylovora and fungus Venturia inaequalis were tested within in vitro and in vivo conditions. The results revealed the ability of Streptomyces antagonistic bacteria to decrease fire blight severity on pear and apple trees during the first stage of the fire blight disease in leaf tissues. Streptomyces strain C1-4 suppressed E. amylovora disease symptoms in the leaf tissues and excised apple and pear shoots. The incidence of fire blight on leaves was reduced by about 70% with two applications of bacterial antagonists. Streptomyces sр strains were tested for apple scab control in vitro and field conditions. Two applications of Streptomyces strain C1-4 within 35 days completely stopped the scab disease in seedling leaves. Within 40 days, the seedlings were recovered; the new leaves have blossomed on branches. Seedlings grew new shoots and leaves around 50 days after the second treatment. Orchard experiment results provide great hope that a biological product based on Streptomyces could work as an effective agent to suppress the development of the pathogen in the early spring, when leaves start to show scab disease symptoms. Further studies at different locations in Kyrgyzstan, using large scale application, would allow for stronger recommendations to be made, including studies and recommendations on their ability to prevent diseases and to use them as main components in an integrated pest management program. Chapter 3 - Crop production involves the cultivation of crops mainly as food and supplements for humans and animals. Prior to the implementation of modern technology, soil fertility was maintained using various farming systems such as strip cropping, shifting cultivation and crop rotation. However, global population increase has resulted in restricted land boundaries, adversity of climate changes and environmental degradation. Farmers will need to adapt to these challenges to prevent low crop output to maintain livelihoods of people, especially in developing countries. As land becomes less productive, ground-breaking organic crop production systems that cover different cultivating patterns must be implemented. High crop yields with acceptable nutrient levels will depend on production


Preface

xi

environments, production technologies, efficiency in the use of knowledge and skills that come through formal and informal training. New agricultural networks that enhance public participation, awareness and selfreliance are required to promote food security. Chapter 4 - Citric acid (CA) production is the most produced organic acid in the world due to its versatility, which is evidenced in many applications in food, beverages and pharmaceutical industrial areas. CA production is a well-established bioprocess that employs parental or mutant strains of the fungus Aspergillus niger. However, the high cost of raw materials and energy has transformed the once lucrative CA production sector into an unprofitable market. The search for alternative substrates is a powerful strategy to reduce production costs that is essential to try to solve the economic viability of the world CA production, which is commanded by the large Chinese market. This chapter brings significant information about different possibilities for CA production, which includes the use of alternative agro-industrial substrates (e.g., citric pulp, cocoa husks, cassava bagasse and others). Fermentation techniques, such as submerged fermentation and solid-state fermentation, conditions and factors that affect the acid synthesis are reported with the presentation of concrete examples of developed research. Chapter 5 - Wild ginger (Siphonochilus aethiopicus (Schweinf) B.L. Burtt) is a perennial herb of the family Zingiberaceae which is lesser known than its counterpart ginger (Zingiber officinale Roscoe). Nevertheless, it is also used as a spice and medicinally just like ginger. It improves the flavour of food and could act as a food preservative in view of its antimicrobial and antifungal properties. Additionally, it is highly prised medicinally and there is an accumulation of evidence for its usage as an anti-inflammatory, anti-plasmodial, anti-thrush and an indication for allergies, asthma, candidiasis, headache, influenza, menstrual cramps, sinusitis and sore throat among other conditions. There have been investigations to optimise its cultivation since it was going extinct in the wild in certain areas mainly due to over harvesting for medicinal usage. Research to identify the active constituents, verify the pharmacological actions and to ascertain the potent odourants and flavour properties is also


xii


ongoing. This article thus aims at reviewing the available data on these investigations and the basis for its usage in food flavouring as well as in several diseases and conditions. Chapter 6 - Lavandula angustifoila essential oil is recognized as the most commonly used worldwide, mainly utilized as a substantial component of flavorings in cosmetics and perfumery. Due to its antimicrobial properties, lavender essential oil of different origin serves as a valuable compound of preservative systems in cosmetic formulations. The main goal of the chapter are essential oil’s coproducts derived from Lavandula angustifolia. Obtained during lavender essential oil commercial production lavender hydrosol is rich in bioactive compounds. Hydrosol is condensate water produced during steam- or hydrodistillation of a plant material, which is often treated as wastes. Although the hydrosols contain much smaller amounts of volatile compounds in comparison with essential oils, the presence of soluble in water phytocompounds makes them useful for cosmetic industry. The chapter focuses on the unique characteristics of lavender hydrosols obtained from Polish cultavations of Lavandula angustifolia and describes a new lavender derivative fluidolate® acquired in an innovative technology relied on raw material drying. Fluidolate®, on the contrary to hydrosol, is the only water from plant material containing all volatile organic compounds lost in conventional drying processes. This product has the scent architecture of a “live” lavender. So far, the criterion of qualitative assessment of plant origin preparations was to preserve a raw material sensory characteristics at the maximum preparation volume per one mass unit of the raw material. In the studies, the authors demonstrate that such a philosophy of production is given to a product with a very low biological activity. In the chapter, the relationship of preparation volume acquired from the raw material mass unit for his performance, with particular regard to biological activity is discussed. Chapter 7 - Tara (Caesalpinia spinosa) has been cultivated for many years by managing natural forests, mainly for pod and seed extraction, and is highly appreciated for its multiple uses since ancient times. However it has been reported that limited regeneration process resulting from excessive seed collection or grazing was detected in most of Tara stands


Preface

xiii

examined in different localities in Peru. Little is known about the ecology and conservation status of Tara forests. The aims of this chapter are to review the scientific knowledge acquired on this species in order to sustainably manage the Tara plantations and increase their productivity and stability. The botanical description of this tree species as well as its ecology (geographical distribution, ecological preferences, susceptibility to pathogens and pests, etc.) will be addressed. Showing the economical values of its products and the description of the strong demands for Tara products will assess the economic importance of the Tara. Then the cultural practices used for the management of Tara plantations will be characterized. This chapter will be concluded by some recommendations to better manage the Tara plantations. Chapter 8 - The Buenos Aires plain in central-east Argentina generates economic resources based on agriculture, which is strongly influenced by precipitation. In this work factors of different rainfall interannual variability have been studied using monthly precipitation in 22 stations for the period 1950-2012. They showed that it depends heavily on the area and the season. El Niño, El Niño Modoki, the positive phase of the Indian Ocean Dipole and the shift to the south of the South Atlantic High are related to an increase of spring precipitation in central Buenos Aires. The weakening of westerlies associated with the negative phase of the Antarctic Oscillation and the weakening of the South Atlantic High favor the autumn precipitation in the east of the province. The positive phase of the Antarctic Oscillation and the intensification of the South Atlantic High is are associated with increased the increased winter precipitation in central and northwestern Buenos Aires. Chapter 9 - Theobroma cacao L. is a crop of global economic importance. It is traditionally propagated by rooted cuttings and grafting but these methods are inefficient due to low propagation rates. A high percentage of cacao plants is derived from seeds which produces considerable yield variation, a consequence of the crop’s heterozygosity. Clonal micropropagation protocols involving somatic embryos derived from floral parts were developed but resulted in many abnormal embryos. Many genotypes failed to produce somatic embryos and/or convert to


xiv


plants. In this study, an efficient protocol for somatic embryogenesis using leaf explants was developed with three elite cacao cultivars (CRIN TC1, CRIN TC2 and CRIN TC5). The zygotic embryos of these cultivars were aseptically excised and cultured on Murashige and Skoog (MS) basal medium without growth regulators. Young leaves were excised from 4week-old seedlings and segments (~5 mm in length) cultured abaxially on MS medium with 2, 4-D with or without sucrose for 4 weeks. Embryogenic callus was subcultured for 4 weeks. Somatic embryos were grown in growth regulator-free medium containing activated charcoal. Leaf segments of CRIN TC2 on 0.002 or 0.005 mM 2,4-D and 30 gL1 sucrose produced 100% embryogenic callus. The leaf segments of CRIN TC5 on 0.005 mM 2,4- D and 30 gL-1sucrose produced the highest number of somatic embryos (235.5). CRIN TC1 produced embryogenic callus and somatic embryos at low levels only on medium containing 0.009 mM 2,4D and 30 gL-1 sucrose. In general, leaf segments on 30 gL-1 sucrose produced significantly higher number of somatic embryos than the nonsucrose control. Somatic embryos formed within 18 to 28 days and converted to quality plants on medium with activated charcoal. Nearly 100% of these plants survived acclimatization in the green house. This is the first report on the production of plants from leaf-derived somatic embryos of T. cacao, indicating that leaves are important source for micropropagation of elite T. cacao cultivars. Chapter 10 - Salt tolerance and the changes of antioxidative ability in mycorrhizal strawberry plants were investigated. Arbuscular mycorrhizal fungi (AMF) Gigaspora margarita, were inoculated in strawberry (Fragaria × ananssa. Duch) plants. Plants were treated with no salt, 200mM and 500mM NaCl solution. Different morphological and physiological growth parameters were compared between mycorrhizal and nonmycorrhizal plants. The AMF symbiosis enhanced plant growth under salt stress condition. The Na+ accumulation was markedly lower in mycorrhizal plants than the control plants. The mycorrhizal plants showed an increased activity of enzymatic antioxidant superoxide dismutase and the antioxidative molecule 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical scavenging activity than the control plants under salt stress conditions.


Preface

xv

Stress severities were not varying from 200mM to 500mM NaCl application. So, AMF can alleviate the salinity-induced negative impact on strawberry plant growth by reducing the oxidative damages.



In: Agricultural Research Updates. Volume 22 ISBN: 978-1-53613-011-9 Editors: P. Gorawala et al. © 2018 Nova Science Publishers, Inc.

Chapter 1

ECOLOGICAL ADAPTATIONS OF WHITE-ROT FUNGI: A SOLUTION TO HUMAN CAUSED PROBLEMS? Tiberius Balaes1,, Cristiana Virginia Petre1 and Catalin Tanase2 1

Anastasie Fatu Botanical Garden, Alexandru Ioan Cuza University of Iasi, Dumbrava Rosie Street, Iasi, Romania 2 Faculty of Biology, Alexandru Ioan Cuza University of Iasi, Iasi, Romania

ABSTRACT White-rot fungi form a group of organisms with characteristics of particular importance for human activities. Growing on wood or, sometimes, on litter, these fungi possess adaptations for using different wood components, such as cellulose, lignin and tannins, as nutrients in their own metabolism. These compounds are degraded by specific 

Corresponding Author Email: [email protected].


2

Tiberius Balaes, Cristiana Virginia Petre and Catalin Tanase enzymes, the most important group being formed by ligninases - versatile enzymes with remarkable properties, responsible for the degradation of lignin and other polyphenols in natural environments and of many types of human made compounds as well. Production and secretion of ligninases are directly associated with the taxonomic group of white-rot fungi, having distinctive characteristics and varied efficiencies, and these enzymes are using as substrates a wide spectrum of chemical compounds that present structural analogies with lignin - the specific natural target for these enzymes. The particular ecological features of different fungi are also influencing the activity and versatility of ligninases, being strongly connected with other metabolic phenomena and the overall development of fungal mycelium. The degradation of wood components is completed by other enzymes (non-ligninolytic), by the production of hydrogen peroxide and various secondary metabolites. The efficiency of the process depends on many factors affecting the reactions kinetics or on the fungal development and enzyme production, meaning that the specific adaptations of a certain species are of great importance. Ligninases from white-rot fungi have been extensively studied in the last two decades for possible use in several industrial/scientific activities, from pharmaceutical technologies to bioremediation. The latter line of research has been especially receiving attention, as these enzymes present an increased potential to be used for the biodegradation of organic pollutants, such as PAHs or synthetic dyes. Whether such technologies could be economically feasible or not, depends on the costs of cultivating these fungi and/or on the production of ligninases, aspects strongly influenced by the ecological adaptations of the chosen fungi. In situ application of white-rot fungi for bioremediation purposes is also subjected to a screening for assessing which species can be used in particular situations. White-rot fungi obviously represent a source of solutions for eliminating organic pollutants, and the selection of an appropriate species should not only consider the production of ligninases and their activity but also the ecological factors that would stimulate and increase the process. In this chapter, ecological features and adaptation of white-rot fungi are being presented and discussed in relation to the possible applications of these fungi in bioremediation strategies.

INTRODUCTION Ligninolytic fungi form an important group of organisms, spread in all ecosystems and playing crucial roles in every environment. Their presence


Ecological Adaptations of White-Rot Fungi

3

can be detected through various way in almost all the ecological niches where lignocellulosic materials can be found, from marine environments to soils, leaf litter, wood, on the bark, and many other places. Researches of ligninolytic fungi are extensive and have been done during many decades. The most important findings in the field were achieved in the recent decades, the improvement in researching methods playing a vital role in this process. The lignin is the third abundant biopolymer on earth (Knežević et al., 2013) and is, generally, resistant to biodegradation. There are few groups of organisms that decompose lignin: few types of bacteria (Bugg et al., 2011) and different types of fungi (Anastasi et al., 2010; Shedbalkar and Jadhav, 2011; Yang et al., 2005), while the complete degradation of lignin is a matter of synergism among different species, some by-products being used by other species in a succession of chemical reactions with many types of enzymes involved (Jennings and Lysek, 1999; Nagy et al., 2015). Without them, this biological residue would accumulate in very large quantities, posing threats to environment healthiness. One of the main roles in the bio-geo-chemical cycles of some essential elements, such as carbon and nitrogen is played by the white-rot basidiomycetes, macromycetes that due to their specific morphology and physiology have the capacity of breaking down wood constituents, including the most resistant ones that are inaccessible to other organisms. Among the most important lignin decomposers are the basidiomycetes, the lignicolous ones being the most active. Depending on the bio-chemical modifications of wood determined by the fungal enzymes, the basidiomycetes are classified into species that produce white-rot and species that produce brown-rot. The white-rot fungi are able to degrade lignin, cellulose and hemicelluloses fact that determines the wood to become white and fibrous, while the brown-rot fungi degrade cellulose and hemicelluloses leaving the lignin almost intact, the wood becoming brown and brittle (Nakasone, 1993; Schmidt, 2006). The champions of lignin degradation are the white-rot fungi, species that have a complex enzyme system involved in the process (Ali, 2010),


4

Tiberius Balaes, Cristiana Virginia Petre and Catalin Tanase

some species being able to completely degrade the lignin by their self. Their ecological adaptation is directly related to the degradation of lignin, and for this reason, their metabolism is especially designed for this purposes. The ligninases secreted by these fungi have a remarkable versatility that make them useful in various economically important processes. The white-rot fungi represent a smaller group of organisms that are particularly adapted to degrade lignin through several mechanisms. Their presence is particularly detected in those environments where lignin is abundant, either on wood and woody debris or in leaf litter and soils, and even in sediments. Their strategies of survival involves different tactics for procuring nutrients, but as well, to compete with other organisms for space and food. These ecological strategies have important meanings for human activities, due to the production of metabolites that are very useful and the living mycelium itself that has importance in various applications. The enzymatic equipment possessed by the white-rot basidiomycetes along with their secondary metabolites make these organisms unique. The discovery during the 20th century of their biotechnological potential in biodegradation of products resulted from several industries or agriculture, in bioremediation of polluted habitats, determined the researchers to intensify their studies in this field (Tišma et al., 2010). Moreover, depending on the nature and composition of the substrate and the environmental factors, these fungi synthesize following their secondary metabolism several compounds with unique properties that can be successfully used in agriculture, medicine, pharmacy, chemical industry, cosmetics and perfumery, but also in ecological rehabilitation and reconstruction of polluted habitats.

THE ROLE OF WHITE-ROT BASIDIOMYCETES IN NATURAL ECOSYSTEMS White-rot basidiomycetes belong to a very diverse and specialized group of fungi, genetically and phenotypically different, but able to break



5

down lignin, one of the most resistant and abundant bio-polymers. This is due to their morphological and anatomical characteristics, the specific growth mode of the hyphae and substrate colonization strategies, but also to the enzymes and secondary metabolites that the mycelium secrets. In order to prevent other species from colonizing a substrate, the white-rot basidiomycetes use chemical mechanisms such as synthesizing and releasing of several compounds with antibacterial or antifungal properties. These compounds prevent the growth and development of other species and moreover, some metabolites also degrade the antagonist using it as a nitrogen source (Dix and Webster, 1995). The inhibitory potential of these secondary metabolites can be used with great results in the biocontrol of pathogenic species (Phillips-Laing et al., 2003). Species such as Bjerkandera adusta and Ganoderma sp. were successfully tested against Ceratocystis fimbriata, altering the growth and development processes of the pathogen (Grosclaude et al., 1990). The interactions between the white-rot basidiomycetes and other organisms (fungi, bacteria), the competitive strategies and their mutual effects also determine the succession between the colonization and degradation of a wooden substrate. Every species is capable to degrade and use certain compounds, which leads to the release of other nutrients that can be used by another organism (Jennings and Lysek, 1999). Wood represents the main substrate on which the white-rot basidiomycetes develop, but there are genera such as Pleutorus, Phanerochaete and Trametes, which were reported on soil, being responsible for the degradation of plant litter. Through this process, the white-rot basidiomycetes are also involved in changing the soil permeability, as a result of exchanging ions (Baldrian, 2008), fact that determines and controls the matter and energy flows between the biotic and abiotic component of the environment. The literature also mentions that white-rot basidiomycetes (Bjerkandera fumosa, Phlebia radiata, Trametes versicolor) can degrade mineral substrates (bio-weathering), by synthesizing certain organic anions


6


that lead to the formation of chelating agents involved in complex oxidation processes (Hoffland et al., 2004; Gadd, 2007). Within the natural ecosystems, parasitic white-rot basidiomycetes infect the plants living tissues, determining the decay of trees and shrubs: Fomes fomentarius, Merulius tremelosus, Polyporus squamosus. Moreover, Parmasto and Parmasto (1997) mention the role of white-rot basidiomycetes as bioindicators of environmental quality. Authors also describe the fruiting bodies belonging to white-rot basidiomycetes as shelters and reproduction places for several species of mosses, lichens or insects (Fäldt et al., 1999; Fritz and Heilmann-Clausen, 2010).

Enzyme System of White-Rot Fungi White-rot fungi develop and grow as a mycelium, a network of hyphae spread in the substrate, where using their enzymes degrade the substrate for using smaller compounds as nutrients. Depending on the used ecological strategy, they secrete various enzymes, with many different functions in decomposing large compounds in the substrate in order to us it as sources of nutrients. Some of the enzymes are very versatile, some are very specific, but generally, these organisms have particular adaptations to their ecological niches. Their primary substrate being lingo-cellulosic materials, the most important enzymes systems they develop are the cellulolytic and ligninolytic ones. The main source of nutrients for white-rot fungi are cellulose and hemicelluloses and these organisms are active decomposers of such substrata. Having a complex of enzyme for breaking down cellulose and hemicelluloses, the white-rot fungi degrade efficiently these macromolecules to small compounds that are absorbed through hyphal wall and membrane and used as sources of both carbon and energy, especially the latter case. The involved enzymes are different, but the most important ones are hydrolases that break down β-glicosidic connections. There are three major types: exo-1,4-β-glucanases that attack the cellulose



7

molecules at edges forming units of glucoses and cellobioses; endo-1,4-βglucanases which have similar activity but at the centre of the molecule; and β-glucosidases which breaks the oligo-saccharidic molecules forming units of glucoses (Dix and Webster, 1995). There is a synergism among the actions of several types of enzymes, and even more, the structure of cellulose is different in various species of plants, and for this reason, there are specific fungi that colonise some types of wood (Deacon, 2006). The white-rot fungi produce the degradation of celluloses and hemicelluloses not only through the activity of enzymes, but also through a mechanical action: the hyphae are penetrating the wood matrix, dislodging fibres (Dix and Webster, 1995). A characteristic feature of white-rot fungi is the ligninolytic enzyme system. Based on this biochemical adaptation, these fungi are able to efficiently colonise the wood, including both coniferous and hard-wood, even the most resistant types. Ligninases form a very complex system, and are responsible not only for degrading lignin, but also other types of polyphenols, such as tanins, although their main target is the lignin. Ligninases have a high versatility, property that is of main interest for different human activities, as it will be described further. This biochemical properties make white-rot fungi competitive in capturing a very common resource such as the wood, leaf litter etc. It is a resource widely distributed and found in large quantities. The particularity of the lignin is that it is a large molecule, resistant to biological degradation that is secreted by plants and deposited on the cell walls. One of its main role is the protection against pathogens, including some phyto-pathogenic fungi. Therefore, degradation of the lignin is a challenge for many organisms. White-rot fungi, using their complex system of ligninases and auxiliary enzymes do degrade with a very high efficiency the lignin. The ligninases-complex varies from a species to another, in many cases only one or two enzymes (sometimes isoforms of the same type of enzymes) are secreted by a species, while other species produce up to seven or more types of ligninases, all secreted extracellularly. The most common and important ligninases are the laccases (EC 1.10.3.2.), which


8


can be found in different isoforms (Moharčič et al., 2006) and have been described from many species of lignicolous fungi, lignin peroxidases (EC 1.11.1.14) which catalyses the breakdown of aromatic rings of lignin, using hydrogen peroxide in this process, and manganese-dependent peroxidase (EC 1.11.1.13), an enzymes that requires the presence of Mn2+ ions, oxidizing it to Mn3+ in the process. Presence or absence of particularly ligninases varies largely from a species to another, but also the amount and enzyme activity for each species, some white-rot possessing a very complex and active enzymes systems. Another ligninase, common, but only in some groups of fungi is Manganese Independent Peroxidase-MIP (EC 1.11.1.16) (Palmieri et al., 2005), while different other enzymes are less frequent, and produced only by the most active lignin decomposers: Aryl Alcohol Oxidase-AAO, Versatile Peroxidase-VP, Dye-degrading Peroxidase-DyP (Anastasi et al., 2010; Faraco et al., 2007; Karimi et al., 2009; Palmieri et al., 2005; Trupkin et al., 2003), citocrom P450 monooxigenase (Asgher et al., 2008). According to Nagy and collaborators (2015), degradation of lignin is achieved involving a much larger group of ligninases, although some enzymes act as auxiliary and have secondary roles. In some cases, the degradation of lignin starts with the production of hydrogen peroxide, after metabolising small amounts of celluloses (Kirk and Farrell, 1987). Degradation of lignin is achieved in aerobic conditions. Production of different types of ligninases and, eventually, different isoforms of the same type of ligninases is an advantage for a species, giving the possibility of colonising different types of wood, from different plants, sometime spread all over the continents (Balaes et al., 2017). The efficiency of wood degradation is also influenced, so is the frequency of distribution of the mentioned species of white-rot fungi (Balaes et al., 2017).

Ligninases Used in Bioremediation Ligninases have an important property: an increased versatility. Due to this versatility, these enzymes can attack a wide range of substrata,



9

according to the literature, more than 100 different substrata, making white-rot fungi a remarkable source of bio-products useful in various economic important processes. One the most studied field is the use of ligninases for bio-decontamination. Another field of applicability is in pharma industry, especially laccases having properties that make them useful in organic synthesis. Up to two decades ago, many investigations aimed at assessing the possible use of ligninases for decontamination of various organic pollutants. Among the most frequently studied, where the synthetic dyes a group of compounds with different chemical structures (there are at least 11 types of dyes, with a varied structure) (Demian and Bobeş, 2007). Due to some structural analogies between different types of dyes and natural lignin, ligninases have the ability of decolorizing (altering the chromophore of the molecules) or breaking down the the molecule. There is a matter of debate (Ali, 2010) of how such processes are feasible to be used in industry, however, efficient degradation of synthetic dyes through the activity of ligninases have been reported in various researches (Gomi et al., 2011; Hadibarata et al., 2011; Novotný et al., 2010). Two of the most important classes of synthetic dyes are the azoic and anthraquinonic dyes (Ramya et al., 2008). Studies conducted to assess how different ligninases might be used to bio-decontaminate such pollutant have been achieved by several authors (Blánquez et al., 2008; Gao et al., 2009; Novotný et al., 2010; Sanghi et al., 2009). It appears that laccases, lignin peroxidases and manganese dependent peroxidases affect the structure of the dyes, and eventually, induce the breakdown of aromatic ring. Among the species widely studied for this purpose are Bjerkandera adusta, Irpex lacteus, Phanerochaete chrysosporium, Pleurotus ostreatus, Trametes versicolor - all of these species secreting different types of ligninases. The efficiency of dye degradation might be correlated not only with the amount of enzymes and its specific activity, but also with the number of enzymes (Balaes et al., 2017). Degradation of other types of dyes have been also reported, such as aryl-methanic dyes (Balaes et al., 2013; Balaes and Tanase, 2013; Balaes et al., 2014; Hadibarata et al., 2011).


10


All the processes for removing dyes in simulated and real effluents are being strongly influenced by several factors. For improving dye degradation, some researchers used purified enzymes, such as laccase (Karimi et al., 2009; Neifar et al., 2010), lignin peroxidases or manganesedependant peroxidases (Moharčič et al., 2006). But most of the studies tried to use living fungal mycelium for removing dyes, taking into consideration that different types of enzymes might be involved, including non-ligninases, and even more, the mycelium itself has some important features that make it valuable. The synthetic dyes adsorb partially on the hyphal wall (Cing et al., 2003), and, in some cases, it has been reported that the mycelium resisted on the effluent itself, without requiring special supplements (Blánquez et al., 2008). Whether the mycelium can survive or not on a successional stages growing on real effluents is unclear, because fungal mycelium has a remarkable property: it is recycling nutrients from its own hyphae (Dix & Webster, 1995), which means that at the beginning of the process, the mycelium starts with some resources in itself, but after a longer period these resources might be exhausted. Some researchers even tried to use mycelium fixed on a support (Gao et al., 2009), in special batch bioreactors, for increasing the efficiency of dye removal. Different types of materials were tested for fixing mycelium, such as foam or alginate (Alaoui et al., 2008; Casieri et al., 2010; Novotný et al., 2004; Šušla et al., 2007) or woody materials (Novotný et al., 2004, 2010). This idea has been explored and improved in different ways by other researchers (Blánquez et al. 2006, 2008; Sanghi et al., 2009). Controlling the conditions of the processes or selecting strains that can tolerate extreme conditions in the environment is needed for establishing a strategy for bio-decontamination (or bio-remediation). The influences of different concentration of metal ions in the environment have been studied by many authors (Balaes et al., 2014; Baldrian, 2004; Li et al., 2009; Lorenzo et al., 2006; Neifar et al., 2010; Trupkin et al., 2003; Yu et al., 2006). It appears that some metals might stimulate degradation of particular dyes, depending on the enzymes involved (Baldrian, 2004; Lorenzo et al., 2006; Trupkin et al., 2003), however, the metal ions should be in non-toxic concentrations (Fonseca et al., 2010). Other ions inhibit the



11

enzyme activity even at low concentrations (Balaes et al., 2014). Temperature, types and quantity of nutrients or the pH are also very important factors that affect the efficiency of dye degradation. These conditions varies with the species involved, some species requiring low rather low temperatures (Bhatti et al., 2008; Yousefi and Kariminia, 2010), or rather high temperatures (Murugesan et al., 2007), but the enzyme life might be reduced. The nutrients are very important for the fungal mycelium development, but if the concentration is high, the degradation is reduced (Anastasi et al., 2010), especially when nitrogen sources are available in large quantities (Asgher et al. 2008; Moharčič et al., 2006). The pH also plays an important role in the process, lower values up to pH 3.0 stimulating the dye degradation (Michniewicz et al., 2008; Murugesan et al., 2007), but reduces the life of enzymes, while slow acidic conditions are favourable for mycelium growth (Pocedič et al., 2008; Radha et al., 2005). The presence of oxygen is another factor that affects the degradation, as ligninases are dependent on its presence in environment (Blánquez et al., 2006). Real effluents contain not only high concentration of salts, but frequently have an increased pH and high temperatures (Murugesan et al., 2007). Selecting strains that tolerate such conditions is vital for establishing protocols for effective removal of the dyes from effluents using white-rot fungi. White-rot fungi and their ligninases have not been studied only for removing pollutants such as synthetic dyes, but other types of organic pollutants as well. Degradation of polycyclic aromatic hydrocarbons by ligninases has been extensively investigated (Eibes et al., 2010; Pozdnyakova et al., 2010). Several authors (Wen et al., 2011; Zhang et al., 2015) tried to degrade pyrene using enzymes or mycelium of white-rot fungi. Bautista et al. (2015) have used a immobilized laccase on aminofunctionalized SBA-15 for degrading several PAHs, obtaining percentages from 55% up to 82% degradation. Studies have been conducted to use white-rot fungi to degrade other organic pollutants such as pesticides: Phanerochaete chrysosporium,


12


Pleurotus ostreatus, Trametes versicolor, Lentinula edodes, Stereum hirsutum, Hypholoma fasciculare (Pointing, 2000; De Soussa Fragoiero, 2005; Singh, 2006), polychlorinated biphenyls: Phanerochaete chrysosporium, Trametes versicolor, Bjerkandera adusta, Lentinula edodes, Pleutorus ostreatus (Singh, 2006), polycyclic aromatic hydrocarbons and chlorophenols: Trametes sp., Irpex sp., Pleurotus sp., Bjerkandera sp. (Gadd, 2007; Valentin et al., 2007), ibuprofen and carbamazepine: Trametes versicolor (Marco-Urrea et al., 2009). In some studies an attempt to enhance the degradation process has been made. Torres-Duarte et al. (2009) have investigated the degradation of tewelve pesticides using mediators for laccase obtained from Coriolopsis gallica, while Carabajal et al. (2016) used immobilized mycelium of Trametes versicolor on different substrata in order to degrade phenol. Even attempts to degrade oil with white-rot fungi have been enterprised (Young et al., 2015).

Other Uses of White-Rot Fungi The white-rot basidiomycetes are also able to absorb from the environment and accumulate in their mycelia and fruiting bodies heavy metals and radionuclides: lead, cadmium, copper, zinc, aluminum, mercury, uranium, cesium or strontium. From this perspective, species of white-rot basidiomycetes such as: Stereum hirsutum, Schizophyllum commune, Ganoderma applanatum, Phanerochaete chrysosporium, Trametes versicolor, Trametes hirsuta, Trametes gibbosa, Lentinus tigrinus, have great potential in the bioremediation and ecological reconstruction of polluted ecosystems (Gabriel et al., 1994; Sag et al., 2001; Singh, 2006). Species of white-rot basidiomycetes can be successfully used in the paper industry, in order to remove the residues from the cellulose fibers, but also for treating the effluents from paper factories (Carlile et al., 2001; Singh, 2006).



13

Moreover, Carlile co-workers (2001) mention that in some countries from South America, the cellulosic residues resulted from the degradation of wooden substrates by the white-rot fungi is used as nutritive supplements for livestock. According to Hobbs (1995), the fruiting bodies of several white-rot basidiomycetes have been used since ancient times in traditional medicine, to treat and cure several diseases such as digestive problems: Armillaria mellea, hepatic problems: Ganoderma lucidum, Flammulina velutipes, tuberculosis: Trametes suaveolens, hemorrhages: Fomes fomentarius, and even cancer: Lentinula edodes, Trametes versicolor, Pleurotus ostreatus, Ganoderma sp., Lenzites betulina, Schizophyllum commune, Bjerkandera fumosa. Researches done by Karaman et al., (2009) showed the potential of Flammulina velutipes, Ganoderma adspersum, Ganoderma lucidum and Meripilus giganteus extracts as natural antioxidants. Several secondary metabolites synthesized by white-rot basidiomycetes have antibacterial and antifungal properties against pathogenic microorganisms and can be therefore used in agriculture or medicine: Ganoderma sp., Stereum hirsutum, Meripilus giganteus, Daedaleopsis confragosa, Polyporus arcularius (Suay et al., 2000). All these facts classify the white-rot basidiomycetes and their synthesized compounds as viable alternatives in the bioremediation of polluted habitats and also as efficient and theoretically inexhaustible resource of bioactive molecules with unique properties that can be used in several industries.

Fungal Volatile Compounds Hanson mentions that in 2008 there were discovered approximately 100 volatile compounds synthesized by fungi, oct-1-en-3-ol being the most common of all, responsible for the “mushroom like” odor of the mycelia and fruiting bodies.


14


Regarding the volatile compounds, in nature there are two different synthesis paths: the mevalonate pathway and the 1-deoxy-D-xylulose-5phosphate pathway, isopentil diphosphate being the molecule that supplies the isoprene units. In fungi, the volatile compounds are synthesized via the mevalonate pathway, starting from acetyl-coA (Hanson, 2008). The quantity in which the fungal volatiles are synthesized and their diversity depends on several factors: the composition and pH of the substrate (Bruce et al., 2000; Wheatley, 2002; Ewen et al., 2004), temperature and water content (Tronsmo and Dennis, 1978; Jelen, 2002), but also on factors like genera, species and the presence of other organisms (Griffith et al., 1994; De Jong and Field, 1997; Hynes et al., 2007), stage of development and mycelium age (Nilsson et al., 1996; Jelen, 2002; Wu et al., 2005). Considering the last factor, Fäldt et al. (1999) observed that during sporulation, the fruiting bodies belonging to Fomes fomentarius and Fomitopsis pinicola synthesize higher amounts of volatile compounds such as: β-phellandrene, β-myrcene and 3-octanone and 3-octanone, 1-octen-3ol, octen-3-ol, β-barbatene respectively. Also during times of low humidity and high temperature, the amount of volatiles synthesized by these species drops. The volatiles are molecules produced by fungi not in a pure state, but as complex mixtures of low molecular weight compounds such as alcohols, aldehydes, ketones, terpenes, esters, amines, that possess characteristic smells. The volatiles produced by the fruiting bodies differ in terms of concentration by the ones synthesized by the mycelia. Rösecke and König (2000b) demonstrated that the mycelia from different parts of the fruiting bodily synthesize different amounts of volatiles. Thus, the mycelium from the crust (the sterile part of the fruiting body) of Fomitopsis pinicola dissolved almost completely when extracted with dichloromethane, fact that proves that it mostly produces triterpenes. This is due to the fact that volatiles synthesis starts at a young age of the fruiting body, the compounds gather at the surface (forming the crust), while within the fruiting body the concentration of volatiles is kept at a constant level.



15

In natural habitats, fungal volatiles play important roles especially in inter- and intra-specific communication, defense and signaling. Moreover, the volatile compounds are an efficient mechanism for carbon releasing, having inhibitory or stimulating properties on the growth and development of other organisms (Kai et al., 2009). Due to their volatile nature, these compounds have a wide range of action, sending the information at long distances through water, air or even soil (Wheatley, 2002). Hanson (2008) underlines the importance of sesquiterpenes in mediating the interaction between the white-rot fungi’s fruiting bodies and other organisms, including predators or parasites or possible vectors involved in spore spreading. These sesquiterpenes are one of the best information carriers, their high vaporization pressures determining the chemical message to be very precise and specific (Morath et al., 2012). Volatile compounds are also involved in signaling the presence of the fungus in a certain area, their characteristic odors acting like guidance signals for other organisms such as insects that use the fungal fruiting bodies as food resource of reproduction (Fäldt et al., 1999; Drilling and Dettner, 2009). The specific smell of volatile compounds can be pleasant or unpleasant for people, but that assessment is rather irrelevant for the importance of these molecules in the life of fungi. For example, the strong and unpleasant smell of species of Phallus sp., given by dimethyl oligosulphides (BorgKarlson et al., 1994) plays a key role in attracting insects (Diptera) that are spore dispersal vectors. Other volatiles attract insects (Coleoptera, Diptera, Lepidoptera) that use the fruiting bodies of white-rot basidiomycetes as places to lay their eggs (Jonsell and Nordlander, 1995), studies showing that these insects are able to perceive the terpenes synthesized by the fungi from long distances (De Bruyne and Baker, 2008). These molecules also attract predator organisms that feed on fruiting bodies pathogens (Fäldt et al., 1999) or have a repellent effect towards direct fungal predators, such as insects or gastropods (Wood et al., 2001). Hanson and co-workers (2008) mentioned that volatile compounds such as the ketoaldehyde panal synthesized by Panellus stipticus is the


16


precursor of luciferin, molecule involved in the bioluminescence phenomenon. The research of Larsen and Frisvald (1995) on the emissions of volatile compounds by microorganisms such as bacteria and fungi revealed that these are produced in some cases, in certain amounts and diversity by specific phylogenetic lines, fact that can be used in order to establish the taxonomical relations between organisms. Both in vivo and in vitro, through the volatile compounds produced by the mycelia, the species influence each other, determining several morphological and physiological changes on the antagonist (Wheatley et al., 1997; Heilman-Clausen and Boddy, 2005). These biomolecules diffuse in the environment/substrate and can act as inhibitors on certain organisms (affecting the growth and development and also the respiratory process) or as metabolic stimulants (Humphris et al., 2001). The specific properties of these compounds and their high bioactivity are nowadays used in various biotechnological processes, in the pharmaceutical industry (antibiotics, antivirals, antioxidants, immunostimulants or cytotoxic molecules), cosmetics and perfumery (volatiles with different aromas), agriculture (compounds with antibacterial and antifungal properties that can become ingredients for biopesticides). Compounds such as 2-methyl-3-methylbutyl ester and propanoic acid have can inhibit the growth and development of several human pathogens like Mycobacterium tuberculosis and Escherichia coli (Morath et al., 2012). Australic acid and methyl australate synthesized by Ganoderma australe affects the growth of Candica albicans, Microsporum canis, Trichophyton mentagrophytes (Smânia et al., 2007). Moreover, mucidin, produced by Mucidula mucida showed in vitro antifungal activity against Candica albicans, Microsporum sp., Trichophyton sp. and Epidermophyton sp. (Musilek et al., 1969). More than 130 volatile compounds extracted from the fruiting bodies of Ganoderma lucidum have cytotoxic effects against some tumor cellular lines, improving and treating the symptoms of several respiratory, digestive and nervous diseases (Zhong and Tang 2004).



17

The study of Luo et al. (2005) and Ye et al. (2005) proved the antioxidant, antimicrobial and anticancerous activities of grifolin and neogrifolin, compounds isolated from several representatives of Albatrellus sp. Fungal secondary metabolites are also used in agriculture, in the synthesis of antifungal products (azoxystrobin, krezoxim-methyl, trifloxystrobin). From this point of view, strobilurins and oudemansins synthesized by white-rot basidiomycetes belonging to Strobilurus sp., Oudemansiella sp., Crepidotus sp., Mycena sp. act as inhibitors of mitochondrial respiration, combining with the mitochondrial cytochrome b. The target of these compounds in non-specific and therefore they were proving to have cytotoxic and inhibitory action against some species of plants, insects and very weak activity against certain mammalian cell line the low cytotoxicity against mammals in not fully explained (Clough, 1993; Paláez, 2005). Following a survey on 317 isolates belonging to 204 species of basidiomycetes collected from Spain, Suay and co-workers (2000) showed the antimicrobial properties of extracts from 45% of the tested species. This study proved that representatives of Ganodermatales, Agaricales, Boletales, Porales and Stearales have significant antimicrobial activity. Many fungal volatile compounds such as alcohols, aldehydes, tiols, terpenes have specific odors (Fraatz and Zorn, 2010) that can be used in cosmetic and perfumery industries: 6-pentyl-α-pyrone with its coconut aroma, benzaldehyde with an almond fragrance, isobutiric acid and 2heptanone with a cheese-like odor or 1-butanol-3-methyl-acetate with a banana smell (Morath et al., 2012). All these volatile compounds are responsible for the taste and odor of white-rot basidiomycetes fruiting bodies, fact that makes these organisms an important food resource for human consumption. Also in the food and nutritional industry several fungal metabolites such as tannins, saponins, alkaloids or flavonoids can be used for their antioxidant properties (Karaman et al., 2009). Moreover, the volatiles produced by white-rot basidiomycetes such as Serpula sp. or Coniophora sp. can be used in order to identify the sick


18


building syndrome which can have negative effects on human health: respiratory infections, asthma, allergies, dermatological problems (Morath et al., 2012).

Antifungal Volatile Organic Compounds Synthesized by White-Rot Basidiomycetes Thacker and Train (2010) describe the antifungal volatile compounds used in biocontrol as molecules with a particular chemistry and specific action mechanism that directly affects the target organisms, being toxic or repellent for pests or attractants for useful species. Regarding the antifungal volatiles produced by white-rot basidiomycetes they can be directly used in the formulation of biofungicides or can be precursor molecules for the synthesis of inhibitory compounds. Some of the best well known precursors of antifungal products such as azoxystrobin, kresoxim-methyl, metominostrobin, trifloxystrobin, picoxystrobin, pyraclostrobin (Park et al., 2003) are strobilurins (Musilek et al., 1969; Anke et al., 1977). In vitro researches proved that strobilurins and oudemansins are synthesized by species such as Oudemansiella mucida: oudemansin A (Anke et al., 1990), Hymenopellis radicata: oudemansin A and X (Anke et al., 1990), Favolaschia pustulosa: oudemansin L (Wood et al., 1996), Xerula sp.: oudemansin B and strobilurin C (Anke et al., 1983; Florianowicz, 1999), Crepidotus fulvotomentosum: strobilurin E (Weber et al., 1990), Mycena sp.: strobilurin M (Deferner et al., 1998), Strobilurus tenacellus: strobilurin A and B (Anke et al., 1977). Data concerning the action mechanisms of volatile compounds against the growth and development of pathogens are relatively few. Several authors have hypothesis according to which these metabolites alter the enzyme activity cycle (Wheatley, 2002) or act as protein modifying agent (Humphris et al., 2001). Cowan (1999) mentions that the antimicrobial properties of phenols are determined by the presence of hydroxyl-phenolic groups which inhibit



19

the synthesis of extracellular enzymes or alter the oxidative phosphorylation mechanism. The alcohols act especially on the cell membrane, affecting the permeability of the phospholipid bilayer, allowing the ions and essential metabolites to cross it (Ingram and Buttke, 1984). Studies showed that the phenolic compounds synthesized by white-rot basidiomycetes have a significant antimicrobial activity (Barros et al., 2007; Alves et al., 2013). This category of metabolites is produced by several species, including Flammulina velutipes, Meripilus giganteus and several species belonging to Ganoderma sp. especially as flavonoids, coumarins and tannins that have antimicrobial properties (Karaman et al., 2010). Flavonoids are hydroxylated phenolic compounds commonly found in plants with antioxidant and antimicrobial activities, rarely identified in white-rot basidiomycetes (Kim et al., 2008). Their action mechanism involves several changes in the properties of the cell membrane (Cowan, 1999). Tannins are polyphenolic compounds, hydrolyzed or condensed that affect the phytopathogens metabolism by blocking the carrier proteins from the cell membrane and inhibiting the activity of their enzymes (Cowan, 1999). These compounds were identified in species such as: Flammulina velutipes, Meripilus giganteus, Ganoderma appanatum and Ganoderma lucidum (Karaman et al., 2009). Coumarins are described by Cowan (1999) as phenolic compounds such as lactones, that posse in their structures benzene nuclei and pyrones. Data concerning antimicrobial coumarins synthesized by white-rot basidiomycetes are few. Nakajima and co-workers (1976) show the antifungal activity of oospolactone produced by Gloeophyllum sepiarium that inhibits the growth and development of several pathogens (Alternaria sp., Aspergillus sp., Colletotrichum sp., Penicillium sp.). DeJong co-workers (1994) proves the weak antifungal activity of several volatile compounds isolated from Pleurotus pulmonarius and Bjerkandera adusta: anisaldehyde and (4-methoxyphenyl)-1,2propanediol.


20


Among the most bioactive volatiles produced by white-rot basidiomycetes are the terpenes formed via humulene-protoilludane metabolic pathway (Abraham, 2001). Terpenes, secondary metabolites, characteristic both to plants and animals, but also fungi, are lipophilic molecules that act on the cell membrane, increasing its permeability for a variety of cytotoxic compounds. They are hydrocarbons formed starting from an elementaru unit - isoprene, with open or closed chain, saturated or unsaturated (Jong amd Birmingham, 1993). One of the first triterpenes isolated from a fungus is favolon, synthesized by species belonging to Favolashia sp. (Inouye et al., 2004). Monoterpenes are volatile compounds rarely synthesized by fungi, unlike the sesquiterpenes which are oftenly produced, especially by basidiomycetes (Hanson, 2008). Among the terpenes, the sesquiterpenes proved to have a significant antimicrobial activity. For the basidiomycetes in general and for white-rot basidiomycetes in particular, numerous sesquiterpenes - protoilludane type (tricyclic compounds, highly reactive due to the presence of cyclobutane in their chemical structure), formed through specific cyclization reaction of farnesyl-pyrophosphate (Daniewski and Vidari, 1999). Bioactive sesquiterpenes are produced, among others, by Aleurodiscus mirabilis: aleurodiscal, antifungal compound (Lauer et al., 1989), Coriolus sp.: coriolin A, B, C (hirsutane sesquiterpenes) with antibiotic effects (Takahashi et al., 1971), Fomes sp.: fommanosin (Kepler et al., 1967), fomajorin D, fomajorin S acid (Donnelly et al., 1982a), all with antimicrobial properties, Flammulina velutipes: enokipodins A, B, C, D with antimicrobial activity (Ishikawa et al., 2001), enokipodins F, G I with weak antifungal activity against Aspergillus fumigatus (Wang et al., 2012), Lentinellus cochleatus: deoxylactarorufin A, blennin A and C which inhibit the growth and development of several phytopathogens belonging to Fusarium sp. and Mucor sp. (Wunder et al., 1996), Lentinus crinitus: desoxyhipnophilin and hipnophilin, with antifungal activity against Aspergillus sp. and Mucor sp. (Abate and Abraham, 1994). The latter compounds were also isolated from Lentinus strigosus, along with several



21

panepoxodole derivatives: neopanepoxidol and panepoxidone (Cota et al., 2008). Anke and Oberwinckler (1977) were among the first in successfully testing the antimicrobial activity of several metabolites synthesized by Cyathus striatus: strianins A, B and C, while Ayer and McCaskill (1981) isolated from other representatives of Cyathus genus cybrodol, isocybrodol, cybrodal, trisnorcybrodolid and cybrodic acid, compounds which showed weak bioactive properties. Daedalea quercina is other white-rot basidiomycetes from which several compounds, mostly triterpenes were isolated from the fruiting bodies extract, from them 16-o-acetylpolyporenic C acid, 16 α-acetoxy-24methylene-3-oxolanost-8-en-21-oic acid, 24-methylene-3, 23-dioxolanost8-en-26-oic acid, 3β, 12β-dihydroxy-24-methyl-23-oxolanost-8-en-26-oic acid and 12β, 23-epoxy-3α, 23-dihydroxy-24-methyllanost-8-en-26-oic acid, were proven to have antimicrobial activity (Rösecke and König, 2000a). Secondary metabolites such as merulinic acid A, B and C, isolated from Phlebia radiata and Merulius tremellosus showed when tested in vitro significant antimicrobial activity (Giannetti et al., 1978). Moreover Merulius tremellosus synthesizes merulidial, an antifungal sesquiterpene. Authors such as Donnelly et al. (1982b, 1985, 1986, 1990), Arnone et al. (1986, 1988) and Yang et al. (1984, 1990, 1991) dedicated numerous studies to the chemical profile of Armillaria mellea, discovering many volatile secondary metabolites with antibacterial and antifungal activity: orselinate, everninate and chlorinated derivatives (armillil, arnamiol, armillarin, armillaridin), melleolid B, C and D, melledonal A, B and C, and sesquiterpenes derivatives (armillasin, armillatin, armillaripin, armillarinin). High antibacterial and weak antifungal activities have several compounds isolated from Fomitopsis pinicola: polyporenic acid, 3αacetyloxylanosta-8, 24-dien-21-oic acid, pinicolic acid, trametenolic acid and fomitopsic acid (Keller et al., 1996).


22


Phenolic acids, p-hydroxybenzoic acid and cinnamic acid isolated from Ganoderma lucidum show antifungal activity against several species of Aspergillus, Penicillium and Trichoderma (Heleno et al., 2013). Koitabashi co-workers (2004) tested the antifungal activity of 5pentyl-2-furaldehyde synthesized by Irpex lacteus and noticed that it inhibits the growth and development of several phytopatogens: Botrytis cinerea, Colletotrichum fragariae and Fusarium oxysporum. Several studies shown that depending on the substrate chemical composition, the amount and types of volatile metabolites differs. Petre and Tănase (2013) observed that on different media, white-rot basidiomycetes cultures present different odors, underlining that the synthesis of volatiles is directly influenced by the culture media. Kahlos co-workers (1994) observed that Gloeophyllum odoratum produces different volatile compounds depending on the presence or absence from the culture media of some essential nutrients, while Wilkins and Larsen (1995) proved that adding fatty acids in the culture media enhances the synthesis of C8 alcohols and ketones. Following the same idea, Bjurman (1999) noticed that the presence of carbohydrates in the culture media increased the production of aromatic compounds, alcohols, while the synthesis of terpenes is higher on low nutritional media.

FINAL CONSIDERATIONS White-rot fungi have remarkable properties as adaptation to the ecological niches they occupy. These features make them useful tools in various human activities, from bio-decontamination to production of secondary metabolites with valuable properties. Economic importance of these organisms, although studied for decades, has been highlighted rather recently, as new techniques and new technologies have been developed. The feasibility of using white-rot fungi in bio-decontamination (bioremediation) is still a matter of debate. There have been made major



23

progresses in elaborating protocols for these purposes, and the results are promising, but the costs are still high. The production of secondary metabolites with various applications is very encouraging, as white-rot fungi have particular adaptations that make them very competitive for resources that attract many types of organisms the lignocellulosic materials. The competition drives the development of mechanisms for fighting competitors in different ways, the most common being the chemical war. The weapons developed by white-rot fungi have important meaning in biocontrol. Future studies and researches will bring new insight into this field, and many promising technologies might be developed.

REFERENCES Abate, D. and Abraham, W. R. (1994). Antimicrobial metabolites from Lentinus crinitus. The Journal of Antibiotics, 47: 1348-1350. Abraham, W. R. (2001). Bioactive sesquiterpenes produced by fungi: are they good for people as well? Current Medicinal Chemistry, 8: 583606. Alaoui, S. M., Merzouki, M., Penninckx, M. J. and Benlemlih, M. (2008). Relationship between cultivation mode of white rot fungi and their efficiency for olive oil mill wastewaters treatment. Electronic Journal of Biotechnology, 11(4): 1-8. Ali H. (2010). Biodegradation of Synthetic Dyes - A Review. Water Air Soil Pollut, 213: 251-273. Alves, M. J., Ferreira, I. C. F. R., Froufe, H. J. C., Abreu, R. M. V., Martins, A. and Pintado, M. (2013). Antimicrobial activity of phenolic compounds identified in wild mushrooms, SAR analysis and docking studies. Journal of Applied Microbiology, 115(2): 346-357. Anastasi, A., Prigione, V. and Varese, G. C. (2010). Industrial dye degradation and detoxification by basidiomycetes belonging to different eco-physiological groups. Journal of Hazardous Materials, 177: 260-267.


24


Anke, T. and Oberwinkler, F. (1977). The strianins-new antibiotics from the basidiomycete Cyathus striatus (Huds. Pers./Willd.). Journal of Antibiotics, 30: 221-225. Anke, T., Besl, H., Mocek, U. and Steglich, W. (1983). Antibiotics from basidiomycetes. XVIII. Strobilurins C and oudemansin B, two new antifungal metabolites from Xerula species (Agaricales). Journal of Antibiotics, 36: 661-666. Anke, T., Oberwinkler, F., Steglich, W. and Schramm, G. (1977). The strobilurins - new antifungal antibiotics from the basidiomycete Strobilurus tenacellus (Pers.Fr./Sing). Journal of Antibiotics, 30: 806810. Anke, T., Werle, A, Bross, M. and Steglich, W. (1990). Antibiotics from basidiomycetes. XXXIII. Oudemansin X, a new antifungal E-betametoxyacrylate from Oudemansiella radicata (Relhan. Fr./Sing.). Journal of Antibiotics, 43: 1010-1011. Asgher, M., Bhatti, H. N., Ashraf, M. and Legge, R. L. (2008). Recent developments in biodegradation of industrial pollutants by white-rot fungi and their enzyme sistem. Biodegradation, 19: 771-783. Ayer, W. A. and McCaskill, R. H. (1981). The cybrodins, a new class of sesquiterpenes. Canadian Journal of Chemistry, 59(14): 2150-2158. Balaeş, T. and Tănase, C. (2013). Optimization of nutritional conditions for the mycoremediation of synthetic dyes. Romanian Biotechnological Letters, 18(6): 8804-8811. Balaeş, T., Mangalagiu, I. I. and Tănase C. (2013). Lignicolous macromycetes: potential candidates for bioremediation of synthetic dyes. Revista de Chimie, 64(9): 790-795. Balaeş, T., Petre, C. V., Ungureanu, C., Mardari, C. and Tănase C. (2017). Ligninolytic enzyme system in ecological adaptation of lignicolous macrofungi. Applied Ecology and Environmental Research, 15(1): 207-224. Balaeş, T., Tănase, C. and Butnariu, C. D. (2014). The use of heavy metals in mycoremediation of synthetic dyes. Central European Journal of Biology, 9(7): 659-667.



25

Baldrian, P. (2004). Purification and characterization of laccase from the white-rot fungus Daedalea quercina and decolorization of synthetic dyes by the enzyme. Appl Microbiol Biotechnol, 63: 560-563. Baldrian, P. (2008). Wood-inhabiting ligninolytic basidiomycetes in soils: ecology and constrains for applicability in bioremediation. Fungal Ecology, 1: 4-12. Barros, L., Calhelha, R. C., Vaz, J. A., Ferreira, I. C. F. R., Baptista, P. and Estevinho, L. M. (2007). Antimicrobial and bioactive compounds of Portuguese wild edible mushrooms methanolic extracts. European Food Research and Technology, 225: 151-156. Bautista, L. F., Morales, G. and Sanz, R. (2015). Biodegradation of polycyclic aromatic hydrocarbons (PAHs) by laccase from Trametes versicolor covalently immobilized on minofunctionalized SBA-15. Chemosphere, 136: 273-280. Bhatti, H. N., Akram, N. and Asgher, M. (2008) Optimization of culture conditions for enhanced decolorization of Cibacrom Red FN-2BL by Schyzophyllum commune IBL-6. Applied Biochemistry and Biotechnology, 149: 255-264. Bjurman, J. (1999). Release of MVOCs from microorganisms, in Salthammer, T. (ed.). Organic indoor air pollutants: occurancemeasurement-evaluation, Wiley-VCH Verlag GmbH, Weinheim, pp: 259-273. Blánquez, P., Sarra, M. and Vicent, M. T. (2006). Study of the cellular retention time and the partial biomass renovation in a fungal decolourisation continuous process. Water Research, 40: 1650-1656. Blánquez, P., Sarrám and Vicent, M. T. (2008). Development of a continuous process to adapt the textile wastewater treatment by fungi to industrial conditions. Process Biochemistry, 43: 1-7. Borg-Karlson, A. K., Eglund, F. O. and Unelius, C. R. (1994). Dimethyl oligosulphides, major volatiles released from Sauromatum guttatum and Phallus impudicus. Phytochemistry, 35(2): 321-323. Bruce, A., Wheatley, R. E., Humphris, S. N., Hackett, C. A. and Florence, M. E. J. (2000). Production of volatile organic compounds by Trichoderma in media containing different amino acids and their effect on selected wood


26


decay fungi. Holzforschung, 54: 481-486. [Production of volatile organic compounds by Trichoderma in media containing different amino acids and their effect on selected wood decay fungi. Wood Research, 54: 481486]. Bugg, T. D. H, Ahmad, M., Hardiman, E. M. and Rahmanpour R. (2011.) Pathways for degradation of lignin in bacteria and fungi. Natural Products Reports, 28: 1883-1896. Carabajal, M., Perullini, M., Jobbagy, M., Ullrich, R., Hofrichter, M. and Levin, L. (2016). Removal of phenol by immobilization of Trametes versicolor in silica-alginate-fungus biocomposites and loofa sponge. Clean- Soil, Air, Water, 44(2): 180-188. Carlile, M. J., Watkinson, S. C., Goodway G. W. (2001). The fungi. Academic Press, London, UK, 603 p. Casieri, L., Anastasi, A., Prigione, V. and Varese, G. C. (2010) Survey of ectomycorrhizal, litter-degrading, and wood-degrading Basidiomycetes for dye decolorization and ligninolytic enzyme activity. Antonie van Leeuwenhoek, 98: 483-504. Cing, S., Asma, D., Apohan, E. and Yesillada, O. (2003) Decolorization of textile dyeing wastewater by Phanerochaete chrysosporium. Folia Microbiol., 47(5): 639-642. Clough, J. M. (1993). The strobilurins, oudemanisins and myxothiazols, fungicidal derivates of β-methoxyacrylic acid. Natural Product Reports, 10: 565-574. Cota, B. B., Rosa, L. H., Sousa-Fagundes, E. M., Martins-Filho, O. A., Correa-Oliveira, R., Romanha, A. J., Rosa, C. A. and Zani, C. Z. (2008). A potent trypanocidal component from the fungus Lentinus strigosus inhibits trypanothione reductase and modulates PBMC proliferation. Memorias de Insituto Oswaldo Cruz, 103(3): 263-270. [A potent trypanocidal component from the fungus Lentinus strigosus inhibits trypanothione reductase and modulates PBMC proliferation. Memoirs of Oswaldo Cruz Institute, 103(3): 263-270]. Cowan, M. M. (1999). Plant products as antimicrobial agent. Clinical Mycrobiological Reviwes, 12(4): 564-582.



27

Daniewski, W. M. and Vidari, G. (1999). Constituents of Lactarius (mushrooms), in Herz, W., Falk, H., Kirby, G. W., Moore, R. E. and Tamm, Ch. (eds.). Progress in the chemistry of organic natural products, Springer-Verlag Wien GmbH, 69-160. De Bruyne, M., Baker, T. C. (2008). Odor detection in insects: volatile codes. Journal of Chemical Ecology, 34: 882-897. De Jong, E. and Field, J. A. (1997). Sulfur tuft and turkey tail: biosynthesis and biodegradation of organohalogens by basidiomycetes. Annual Review of Microbiology, 51: 375-414. De Jong, E., Field, J., Spinnler, H. E., Wijnberg, J. B. P. A. and Debont, J. A. M. (1994). Significant biogenesis of chlorinated aromatics by fungi in natural environments. Applied and Environmental Microbiology, 60: 264-270. De Sousa Fragoiero, S. I. (2005). Use of fungi in bioremediation of pesticides- Ph.D. Thesis, Applied Mycology Group Institute of Bioscience and Technology, Cranfield University, UK, 217 p. Deacon, J. W. (2006) Fungal Biology, 4-th edition, Blackwell Publishing, Cornwell, 122-235 pp. Deferner, M., Anke, T., Hellwing, V., Steglich, W., Sterner, O. (1998). Strobilurin M, a tetracholoropyrocatechol and tetracholoropyro catechol methyl ether: new antibiotics from a Mycena species. Journal of Antibiotics, 51: 816-822. Demian, M. and Bobeş, T. (2007). Introduction in chemistry and technology of the dyes. Publishing House of Military and Technic Academy, Bucharest, 17-33 pp (in Romanian). Dix, N. J. and Webster, J. (1995). Fungal ecology, Chapman & Hall, London, 549 p. Donnelly, D. M. X., Coveney, D. J. and Fukuda, N. (1986). New sesquiterpene aryl esters from Armillaria mellea. Journal of Natural Products, 49: 111-116. Donnelly, D. M. X., Coveney, D. J. and Polonsky, J. (1985). Melledonal and melledonol, sesquiterpene esters from Armillaria mellea. Tetrahedron Letters, 26: 5343-5344.


28


Donnelly, D. M. X., Hutchinson, R. M., Coveney, D. J. and Yonemitsu, M. (1990). Sesquiterpene aryl esters from Armillaria mellea. Phytochemistry, 25: 2569-2572. Donnelly, D. M. X., O’Reilly, N. J., Polonsky, J. and Van Eijk, G. W. (1982a). Fomajorin S and D from Fomes annosus Fr. (Cooke). Tetrahedron Letters, 23: 5451-5452. Donnelly, D. M. X., Sanada, S., O’Reilly, J., Polonsky, J., Prange, T. and Pascard, C. (1982b). Isolation and structure (X-ray analysis) of the orsellinate of armillol, a new antibacterial metabolite from Armillaria mellea. Journal of the Chemical Society Chemical Communications, 2: 135-137. Drilling, K. and Dettner, K. (2009). Electrophysiological responses of four fungivorous coleoptera to volatiles of Trametes versicolor: application for host selection. Chemoecology, 19: 109-115. Eibes, G., McCann, C., Pedezert, A., Moreira, M. T., Feijoo, G. and Lema, J. M. (2010). Study of mass transfer and biocatalyst stability for the enzymatic degradation of anthracene in a two-phase partitioning bioreactor. Biochemical Engineering Journal, 51: 79-85. Ewen, R. J., Jones, P. R. H., Ratcliffe, N. M. and Spencer-Phillips, P. T. N. (2004). Identification by gas chromatography-mass spectrometry of the volatile organic compounds emitted from the woodrotting fungi Serpula lacrymans and Coniophora puteana, and from Pinus sylvestris timber. Mycological Research, 108: 806-814. Fäldt, J., Jonsell, M., Nordlander, G. and Borg-Karlson, A. K. (1999). Volatiles of bracket fungi Fomitopsis pinicola and Fomes fomentarius and their function as insect attractants. Journal of Chemical Ecology, 25: 567-590. Faraco, V., Piscitelli, A., Sannia, G. and Giardina, P. (2007). Identification of a new member of the dye-decolorizing peroxidase family from Pleurotus ostreatus. World Journal of Microbiology and Biotechnology, 23: 889-893. Florianowicz, T. (1999). Antifungal activity of some metabolites of higher fungi (Basidiomycetes)-an overview. Acta Societatis Botanicorum Poloniae, 68(4): 307-310. [Antifungal activity of some metabolites of



29

higher fungi (Basidiomycetes)-an overview. Journal of Polish Botanical Society, 68(4): 3017-310]. Fonseca, M. I., Shimizu, E., Zapata, P. D. and Villalba, L. L. (2010) Copper inducing effect on laccase production of white rot fungi native from Misiones Argentina. Enzyme and Microbial Technology, 46: 534539. Fraatz, M. A. and Zorn, H. (2010). Fungal flavours, in Hofrichter, M., (ed.). The Mycota X: Industrial Applications, Springer-Verlag, Berlin, Heidelberg, pp: 249-264. Fritz, Ö. and Heilmann-Clausen, J. (2010). Rot holes create key microhabitats for epiphytic lichens and bryophytes on beech (Fagus sylvatica). Biological Conservation, 143: 1008-1016. Gabriel, J., Mokrej, M., Bilý, J. and Rychlovsky, P. (1994). Accumulation of heavy metals by some white-rot fungi. Folia Microbiologica, 39(2): 115-118. Gadd, G. M. (2007). Geomycology: biogeochemical transformation of rocks, minerals, metals and radionuclides by fungi, bioweathering and bioremediation. Mycological Research, 3: 3-49. Gao, S., Chen, C., Tao, F., Huang, M., Ma, L., Wang, Z. and WU, L., (2009). Variation of peroxidase isoenzyme and biofilm of Phanerochaete chrysosporium in continuous membrane bioreactor for Reactive Brilliant Red X3-B treatment. Journal of Environmental Sciences, 21: 940-947. Giannetti, B. M., Steglich, W., Quack, W., Anke, T. and Oberwinkler, F. (1978). Antibiotika aus Basidiomyceten. VI. Merulinsäuren A, B und C, neue Antibiotika aus Merulius tremellosus Fr. und Phlebia radiata. Zeitschrift für Naturforschung, 33c: 807-816. [Antibiotics from Basidiomycetes. VI. Merulinic acids A, B and C, new antibiotics from Merulius tremellosus Fr. and Phlebia radiata. Journal for Nature Research, 33c: 807-816.] Gomi, N., Yoshida, S., Matsumoto, K., Okudomi, M., Konno, H., Hisabori, T. and Sugano, Y. (2011). Degradation of the synthetic dye amaranth by the fungus Bjerkandera adusta Dec 1: inference of the degradation


30


pathway from an analysis of decolorized products. Biodegradation, 22: 1239-1245. Griffith, G. S., Rayner, A. D. M. and Wildman, H. G. (1994). Interspecific interactions, mycelial morphogenesis and extracellular metabolite production in Phlebia radiata (Aphyllophorales). Nova Hedwigia, 59: 331-344. Grosclaude, C., Olivier, R., Romiti, C., Pizzuto, J. C. (1990). Action antagoniste, sur bois in vitro, de quelques basidiomycetes lignicoles vis a vis Ceratocystis fimbriata f platani present dans le tissu ligneus. Agronomie, 5(10): 403-405. [Antagonistic action on wood in vitro of some wood-rotting basidiomycetes against Ceratocystis fimbriata f platani present in the lignicolous tissues. Agronomy, 5(10): 403-405]. Hadibarata, T., Yusoff, A. R. M., Aris, A., Hidayat, T., and Kristanti, R. A. (2011). Decolorization of azo, triphenylmethane and anthraquinone dyes by laccase of a newly isolated Armillaria sp. F022. Water Air Soil Pollut, DOI 10.1007/s11270-011-0922-6. Hanson, J. R. (2008). The chemistry o fungi, RSC Publishing, Cambridge, UK, 221 p. Heilmann-Clausen, J. and Boddy, L. (2005). Inhibition and stimulation effects in communities of wood decay fungi: exudates from colonized wood influence growth by other species. Microbial Ecology, 49: 399406. Heleno, S. A., Ferreira, I. C. F. R., Estevez, A. P., Ciric, A., Glamoclija, J., Martins, A., Sokovic, M. and Queiroz, M. J. R. P. (2013). Antimicrobial and demelanizing activity of Ganoderma lucidum extract, p-hydroxybenzoic and cinnamic acids and their synthetic acetylated glucuronide methyl esters. Food and Chemical Toxicology, 58: 95-100. Hobbs, C. (1995). Medicinal mushrooms: an exploration of tradition, healing and culture. Botanica Press, Santa Cruz, California, 251 p. Hoffland, E., Kuyper, T. W., Wallander, H., Plassard, C., Gorbushina, A., Heselwandter, K., Holmström, S., Landerweert, R., Lundström, U., Rosling, A., Sen, R., Smits, M. M., Van Hees, P. A. W. and Van



31

Breemen, N. (2004). The role of fungi in bioweathering. Frontiers in Ecology and the Environment, 2(5): 258-264. Humphris, S. N., Wheatley, R. E. and Bruce, A. (2001). The effects of specific volatile organic compounds produced by Trichoderma spp. on the growth of wood decay basidiomycetes. Holzforschung, 55: 233237. [The effects of specific volatile organic compounds produced by Trichoderma spp. on the growth of wood decay basidiomycetes. Wood Research, 55: 233-237]. Hynes, J., Müller, C. T., Jones, T. H. and Boddy, L. (2007). Changes in volatile production during the course of fungal mycelial interactions between Hypholoma fasciculare and Resinicium bicolor. Journal of Chemical Ecology, 33: 43-57. Ingram, L. O. and Buttke, T. M. (1984). Effects of alcohol on microorganisms. Advances in Microbial Physiology, 25: 253-300. Inouye, S., Abe, S. H. and Yamagushi, H. (2004). Fungal terpenoid. Antibiotics and Enzyme Inhibitors, in Arora D. (ed.). Handbook of fungal Biotechnology, 2nd edition, New York: Marcel Dekker, 379-400. Ishikawa, N. K., Fukushi, Y., Yamaji, K., Tahara, S. and Takahashi, K. (2001). Antimirobial cuparene-type sesquiterpenes, enokipodins C and D, from a mycelian culture of Flammulina velutipes. Journal of Natural Products, 64(7): 932-934. Jelen, H. H. (2002). Volatile sesquiterpene hydrocarbons characteristic for Penicillium roqueforti strains producing PR toxin. Journal of Agricultural and Food Chemistry, 50: 6569-6574. Jennings, D. H. and Lysek, G. (1999). Fungal biology, 2nd edition. Bios, Oxford. 166 p. Jong, S. C. and Birmingham, J. M. (1993). Mushrooms as a source of natural flavor and aroma compounds, in Chang, S. T., Buswell, J. A., Chiu, S. W. (eds.). Mushrooms biology and mushroom products, Chinese University Press, Hong Kong, 345- 366. Jonsell, M. and Nordlander, G. (1995). Field attraction of Coleoptera to odours of the wood decaying polypores Fomitopsis pinicola and Fomes fomentarius. Annales Zooogici Fennici, 32:391-402.


32


Kahlos, K., Kiviranti, J. I. J. and Hiltunen, V. K. (1994). Volatile constituents of wild and in vitro cultivated Gloeophyllum odoratum. Phytochemistry, 36: 917-922. Kai, M., Haustein, M., Molina, F., Petri, A., Scholz, B. and Piechulla, B. (2009). Bacterial volatiles and their action potential. Applied Microbiology and Biotechnology, 81: 1001-1012. Karaman, M. A., Mimica-Dukic, N. M. and Matavuly, M. N. (2009). Lignicolous fungi from Northen Serbia as natural sources of antioxidants. Central European Journal of Biology, 4(3): 387-396. Karaman, M., Jovin, E., Malbaša R., Metavuly, M. and Popović, M. (2010). Medicinal and edible lignicolous fungi as natural sources of antioxidative and antibacterial agents. Phytotherapy Research, 24: 1473-1481. Karimi, S., Abdulkhani, A., Ghazali, A. H. B., Ahmadun, F. R. and Karimi, A. (2009). Color remediation of chemimecanical pulping effluent using combination of enzymatic treatment and Fenton reaction. Desalination, 249: 870-877. Keller, A. C., Maillard, M. P. and Hostettman, N. K. (1996). Antimicrobial steroids from the fungus Fomitopsis pinicola. Phytochemistry, 41: 1041-1046. Kepler, J. A., Wall, M. E., Mason, J. E., Basset, C., McPhail, A. T. and Sim, G. A. (1967). The structure of fommanosin, a novel sesquiterpene metabolite of the fungus Fomes annosus. Journal of the American Chemistry Society, 89(5): 1260-1261. Kim, M. Y., Seguin, P., Ahn, J. K., Kim, J. J., Chun, S. C., Kim, E. H., Seo, S. H., Kang, E. Y., Kim, S. L., Park, Y. J., Ro, H. M. and Chung, I. M. (2008). Phenolic compound concentration and antioxidant activities of edible and medicinal mushrooms from Korea. Journal of Agricultural and Food Chemistry, 56(16): 7265-7270. Kirk, T. K. and Farrell, R. L. (1987). Enzymatic combustion: the microbial degradation of lignin. Annu Rev Microbiol., 41: 465-505. Knežević, A., Milovanović, I., Stajić, M. and Vukojević, J. (2013). Trametes suaveolens as ligninolytic enzyme producer. Matica Srpska Journal of Natural Sciences, 124: 437-444.



33

Koitabashi, M., Kajitani, Y. and Hirashima, K. (2004). Antifungal substances produced by fungal strain Kyu-W63 from wheat leaf and its taxonomic position. Journal of General Plant Pathology, 70: 124-130. Larsen, T. O. and Frisvald, J. C. (1995). Characterization of volatile metabolites from 47 Penicillium species. Mycological Research, 99: 1153-1166. Lauer, U., Anke, T, Sheldrick, W. S., Scherer, A. and Steglich, W. (1989). Antibiotics from basidiomycetes. XXXI. Aleurodiscal: an antifungal sesterterpenoid from Aleurodiscus mirabilis (Berk. & Curt.) Höhn. Journal of Antibiotics, 42(6): 875-882. Li, X., Jia, R., Li, P. and Ang, S. (2009). Response surface analysis for enzymatic decolorization of Congo red by manganese peroxidase. Journal of Molecular Catalysis B: Enzymatic, 56: 1-6. Lorenzo, M., Moldes, D. and Sanromán, M. A. (2006). Effect of heavy metals on the production of several laccase isoenzymes by Trametes versicolor and on their ability to decolourise dyes. Chemosphere, 63: 912-917. Luo, D. Q., Shao, H. J., Zhu, H. J. and Liu, J. K. (2005). Activity in vitro and in vivo against plant pathogenic fungi of grifolin isolated from the basidiomycete Albatrellus dispansus. Zeitschrift für Naturforschung, 60c: 50-56. [Activity in vitro and in vivo against plant pathogenic fungi of grifolin isolated from the basidiomycete Albatrellus dispansus. Journal for Nature Research, 60c: 50-56]. Marco-Urrea, E., Pérez-Trujillo, M., Vicent, T. and Caminal, G. (2009). Ability of white-rot fungi to remove pharmaceuticals and identification of degaradation products of ibuprofen by Trametes versicolor. Chemosphere, 74: 765-772. Michniewicz, A., Ledakowicz, S., Ullrich, R. and Hofrichter, M. (2008). Kinetics of the enzymatic decolorization of textile dyes by laccase from Cerrena unicolor. Dyes and Pigments, 77: 295-302. Moharčič, M., Teodorovič, S., Golob, V., Friedrich, J. (2006). Fungal and enzymatic decolourisation of artificial textile dye bath. Chemosphere, 63: 1709-1717.


34


Morath, S. U., Hung, R. and Bennett, J. W. (2012). Fungal volatile compounds: A review with emphasis on their biotechnological potential. Fungal Biology Reviews, 26: 73-83. Murugesan, K., Nam, I. H., Kim, Y. M. and Chang, Y. S. (2007). Decolorization of reactive dyes by a termostable laccase produced by Ganoderma lucidum in solid state culture. Enzyme and Microbial Technology, 40: 1662-1672. Musilek, V., Cerna, J., Sasek, V., Semerdzieva, M. and Vondracek, M. (1969). Antifungal antibiotics from the basidiomycete Oudemanisiella mucida. Folia Microbiologica, 14: 377-387. Nagy, L. G., Riley, R., Tritt, A., Adam, C., Daum, C., Floudas, D., Sun, H., Yadav, J. S., Pangilinan, J., Larsson, H. K., Matsuura, K., Barry, K., LaButti, K., Kuo, R., Ohm, R. A., Bhattacharya, S. S., Shirouzu, T., Yoshinaga, Y., Martin, F. M., Grigoriev, I. V. and Hibbett, D. S. (2015). Comparative genomics of early-diverging mushroom-forming fungi provides insights into the origins of lignocellulose decay capabilities. Molecular Biology and Evolution, doi: 10.1093/molbev/msv337. Nakajima, S., Kawai, K, Yamada, S., Sawai Y. (1976). Isolation of oospolactone as antifungal principle of Gloeophyllum sepiarium. Agricultural and Biological Chemistry, 40(4): 811-812. Nakasone, K. K. (1993). Diversity of lignicolous basidiomycetes in coarse woody debris, in McMim, J. W. and Crossley, D. A. (ed.). Biodiversity and coarse windy debris in Southern forests. Proceedings of the Workshop on Coarse Woody Debris in Southern Forests: Effects on Biodiversity, pp: 35-42. Neifar, M., Jaouani, A., Ellouze-Ghorbel, R. and Ellouze-Chaabouni, S. (2010). Purification, characterization and decolourization ability of Fomes fomentarius laccase produced in solid medium. Journal of Molecular Catalysis B: Enzymatic, 64: 68-74. Nilsson, T., Larsen, T. O., Montanarella, L. and Madsen, J. O. (1996). Application of head-space solid-phase microextraction for the analysis of volatile metabolites emitted by Penicillium species. Journal of Microbiological Methods, 25: 245-255.



35

Novotný, Č., Svobodová, K., Benada, O., Kofroňová, O., Heissenberger, A. and Fuchs, W. (2010). Potential of combined fungal and bacterial treatment for color removal in textile wastewater. Bioresource Technology, 102(2): 879-888. Novotný, Č., Svobodová, K., Erbanová, P., Cajthaml, T., Kasinath, A., Lang, E. and Šašek, V. (2004). Ligninolytic fungi in bioremediation: extracellular enzyme production and degradation rate. Soil Biology and Biochemistry, 36: 1545-1551. Paláez, F. (2005). Biological activity of fungal metabolites, in Zhiqiang, A. (ed.), Handbook of Industrial Mycology, Mycology Series, New York, 22: 54-105. Palmieri, G., Cennamo, G. and Sannia, G. (2005). Remazol Brilliant Blue R decolourisation by the fungus Pleurotus ostreatus and its oxidative enzymatic system. Enzyme and Microbiol Technology, 36: 17-24. Park, J. H., Park, J. H., Choi, G. J., Lee, S. W., Jang, K. S., Choi, Y. H., Cho, K. Y. and Kim, J. C. (2003). Screening for antifungal endophytic fungi against six plant pathogenic fungi. Mycobiology, 31(3): 179-182. Parmasto, E. and Parmasto, I. (1997). Lignicolous Aphyllophorales of old and primeval forests in Estonia. The forests of northern Central Estonia, with a preliminary list of indicator species. Folia Cryptogamica Estonica. 31: 38-45. Petre, C. V. and Tănase, C. (2013). Culture characteristics of 20 lignicolous basidiomycetes species that synthesize volatile organic compounds. Scientific Annals of „Alexandru Ioan Cuza” University, Section 2, Vegetal Biology, 59: 37-51. Phillips-Laing, E. M., Staines, H. J. and Palfreyma, J. W. (2003). The isolation of specific bio-control agents for the dry rot fungus Serpula lacrymans. Holzforschung 57: 574-578. Pocedič, J., Hasal, P. and Novotný, Č. (2008). Decolorization of organic dyes by Irpex lacteus in a laboratory trickle-bed biofilter using various mycelium supports. Journal of Chemical Technology and Biotechnology, 84: 1031-1042. Pointing, S. B. (2000). Feasibility of bioremediation by white-rot fungi. Applied Microbiology and Biotechnology, 57: 20-33.


36


Pozdnyakova, N. N., Nikiforova, S. V., Makarov, O. E. and Turkovskaya, O. V. (2010). Effect of polycyclic aromatic hydrocarbons on laccase production by white rot fungus Pleurotus ostreatus D1. Applied Biochemistry and Microbiology, 47(5): 543-548. Radha, K. V., Regupathi, I., Arunagiri, A. and Murugesan, T. (2005). Decolorization studies of synthetic dyes using Phanerochaete chrysosporium and their kinetics. Process Biochemistry, 40: 33373345. Ramya, M., Anusha, B. and Kalavathy, S. (2008). Decolorization and biodegradation of Indigo carmine by a textile soil isolate Paenibacillus larvae. Biodegradation, 19: 283-291. Rösecke, J. and König, W. A. (2000a). Constituents of fungi Daedalea quercina and Daedaleopsis confragosa var. tricolor. Phytochemistry, 54(8): 757-762. Rösecke, J. and König, W. A. (2000b). Constituents of various white-rot basidiomycetes. Phytochemistry, 54: 603-610. Sag, Y. and Kutsal, T. (2001). Recent trands in the biosorption of heavy metals: A review. Biotechnology and Bioprocess Engineering, 6: 376385. Sanghi, R., Dixit, A., Verma, P. and Puri, S. (2009). Design of reaction conditions for the enhancement of microbial degradation of dyes in sequential cycles. Journal of Environmental Sciences, 21(21): 16461651. Schmidt, O. (2006). Wood and tree fungi: biology, damage, protection and use, Springer-Verlag Berlin Heidelberg, Germany, 334 p. Shedbalkar, U. and Jadhav J. P. (2011). Detoxification of Malachite green and textile industrial effluent by Penicillium ochrochloron. Biotechnology and Bioprocess Engineering, 16: 196-204. Singh, H. (2006). Mycoremediation: fungal boremediation, John Wiley & Sons, Hoboken, New Jersey, USA, 592 p. Smânia, E. F. A., Monache, F. D., Yunes, R. A., Paulert, R. and Junior, A. S. (2007). Antimicrobial activity of methyl australat from Ganoderma australe. Revista Brasileira de Farmacognosia, 17: 14-16.



37

[Antimicrobial activity of methyl australat from Ganoderma australe. Brazilian Journal of Pharmacognosy, 17: 14-16]. Suay, I., Arenal, F., Asensio, F. J., Basilio, A., Cabelo, M. A., Díez, T. M., García, J. B., Gonzáles Del Val, A., Gorrochategui, J., Hernández, P., Peláez, F. and Vicente, F. (2000). Screening of basidiomycetes for antimicrobial activities. Antoine van Leeuwenhoek, 78: 129-139. Šušla, M., Novotný, Č. and Svobodová, K. (2007). The implication of Dichomitus squalens laccase isoenzymes in dye decolorization by immobilised fungal culture. Bioresource Technology, 98: 2109-2115. Takahashi, S., Naganawa, H., Iinuma, H., Takita, T., Maeda, K. and Umezawa, H. (1971). Revised structure and stereochemistry of coriolin. Tetrahedron Letters, 12(22): 1955-1958. Thacker, J. R. M. and Train, M. R. (2010). Use of volatiles in pest control, in Herrmann, A. (ed.). Chemistry and biology of volatiles, John Wiley and Sons, Ltd, West Sussex, UK, pp: 151-172. Tišma, M., Zelić, B. and Vasić-Rački, Đ. (2010). White-rot fungi in phenols, dyes and other xenobiotics treatment-a brief review. Croatian Journal of Food Science and Technology, 2(2): 34-47. Torres-Duarte, C., Roman, R., Tinoco, R. and Vazquez-Duhalt, R. (2009). Halogenated pesticide transformation by a laccase-mediator system. Chemosphere 77: 687-692. Tronsmo, A. and Dennis, C. (1978). Effect of temperature on antagonistic properties of Trichoderma species. Transactions of the British Mycological Society, 71: 469-474. Trupkin, S., Levin, L., Forchiassin, F. and Viole, A. (2003). Optimization of a culture medium for ligninolytic enzyme production and synthetic dye decolorization using response surface methodology. Journal of Industrial Microbiology and Biotechnology, 30: 682-690. Valentin, L., Lu-Chau, T. A., López, C., Feijoo, G., Moreira, M. T. and Lema, J. M. (2007). Biodegradation of dibenzothiophene, fluoranthene, pyrene-andchrysene in a soil slurry reactor by the whiterot fungus Bjerkandera sp. BOS55. Process Biochemistry, 42: 641648.


38


Wang, Y., Bao, L., Yang, X., Li, L., Li, S., Gao, H., Yao, X. Z., Wen, H. and Liu, H. W. (2012). Bioactive sesquiterpenes from the solid culture of the edible mushroom Flammulina velutipes growing on cooked rice. Food Chemistry, 132: 1346-1353. Weber, W., Anke, T., Steffan, B. and Steglich, W. (1990). Antibiotics from basidiomycetes. XXXII. Strobilurin E: a new cytostatic and antifungal (E)-betamethoxyacrylate antibiotic from Crepidotus fulvotomentosus. Journal of Antibiotics, 43: 207-212. Wen, J., Gao, D., Zhang, B. and Liang, H. (2011) Co-metabolic degradation of pyrene by indigenous white-rot fungus Pseudotrametes gibbosa from the northeast China. International Biodeterioration & Biodegradation, 65: 600-604. Wheatley, R. E. (2002). The consequences of volatile organic compound mediated bacterial and fungal interactions. Antonie Van Leeuwenhoek, 81: 357-364. Wheatley, R. E., Hackett, C., Bruce, A. and Kundzewicz, A. (1997). Effect of substrate composition on production of volatile organic compounds from Trichoderma spp. inhibitory to wood decay fungi. International Biodeterioration & Biodegradation, 39(2-3): 199-205. Wilkins, K. and Larsen, K. (1995). Variation of volatile organic compound patterns of mold species from dump buildings. Chemosphere, 31: 3225-3236. Wood, W. F., Archer, C. L. and Largent, D. L. (2001). 1-octen-3-ol, a banana slug antifeedant from mushrooms. Biochemical Systematics and Ecology, 29: 531-533. Wu, S. M., Zorn, H., Krings, U. and Berger, R. G. (2005). Characteristic volatiles from young and aged fruiting bodies of wild Polyporus sulfureus (Bull.:Fr.) Fr.. Journal of Agricultural and Food Chemistry, 53: 4524-4528. Wunder, A., Anke, T., Klostermeyer, D., Steglich, W. (1996). Lactarane type sesquiterpenoids as inhibitors of leukotriene biosynthesis and other new metabolites from submerged cultures of Lentinellus cochleatus (Pers.:Fr./Karst). Zeitschrift für Naturforschung, 49c: 561570. [Lactarane type sesquiterpenoids as inhibitors of leukotriene



39

biosynthesis and other new metabolites from submerged cultures of Lentinellus cochleatus (Pers.:Fr./Karst). Journal for Nature Research, 49c: 561-570]. Yang, J. S., Chen, Y. W., Feng, X. Z., Yu, D. Q. and Liang, X. T. (1984). Chemical constituents of Armillaria mellea mycelium. I. Isolation and characterization of armillarin and armillaridin. Planta Medica, 50: 288-290. Yang, J. S., Su, Y. L., Wang, Y. L., Feng, X. Z., Yu, D. Q. and Liang, X. T. (1991). Two novel protoilludane norsesquiterpenoid esters, armillasin and armillatin, from Armillaria mellea. Planta Medica, 57(5): 478-480. Yang, J. S., Su, Y. L., Wang, Y. L., Feng, X. Z., Yu, D. Q. and Liang, X. L. (1990). Chemical constituents of Armillaria mellea mycelium. V. Isolation and characterization of armillarilin and armillarinin. Yaoxue Xuebao, 25: 24-28. [Chemical constituents of Armillaria mellea mycelium. V. Isolation and characterization of armillarilin and armillarinin. Chinese Journal of Pharmaceutics, 25: 24-28]. Yang, Q., Yediler, A., Yang, M. and Kettrup, A. (2005). Decolorization of an azo dye, Reactive Black 5 and MnP production by yeast isolate: Debaryomyces polymorphus. Biochemical Engineering Journal, 24: 249-253 Ye, M., Liu, J. K., Lu, Z. X., Zhao, Y., Liu, S. F., Li, L. L., Tan, M., Weng, X. X., Liu, W. and Cao, Y. (2005). Grifolin, a potential antitumor natural product from the mushroom Albatrellus confluens, inhibits tumor cell growth by inducing apoptosis in vitro. FEBS Letters, 579: 3437-3443. Young, D., Rice, J., Martin, R., Lindquist, E., Lipzen, A., Grigoriev, I. and Hibbett, D. (2015) Degradation of bunker C fuel oil by white-rot fungi in sawdust cultures suggests potential applications in bioremediation. PLOS ONE, DOI:10.1371/journal.pone.0130381. Yousefi, V. and Kariminia, H. R. (2010). Statistical analysis for enzymatic decolorization of acid orange 7 by Coprinus cinereus peroxidase. International Biodeterioration & Biodegradation, 64: 245-252.


40


Yu, G., Wen, X., Li, R. and Qian, Y. (2006). In vitro degradation of a reactive azo dye by crude ligninolytic enzymes from nonimmersed liquid culture of Phanerochaete chrysosporium. Process Biochemistry, 41: 1987-1993. Zhang, S., Ning, Y., Zhang, X., Zhao, Y., Yang, X., Wu, K., Yang, S., La, G., Sun, X. and Li, X. (2015). Contrasting characteristics of anthracene and pyrene degradation by wood rot fungus Pycnoporus sanguineus H1. International Biodeterioration & Biodegradation, 105: 228-232. Zhong, J. J. and Tang Y. J. (2004). Submerged cultivation of medicinal mushrooms for production of valuable bioactive metabolites. Advances in biochemical, engineering /biotechnology: Biomanufacturing, 87: 25-59.



Chapter 2

STREPTOMYCES BIO-PRODUCTS AGAINST APPLE AND PEAR DISEASES IN ORGANIC ORCHARDS T. Doolotkeldieva* Kyrgyz-Turkish Manas University, Department of Plant Protection, Bishkek, Kyrgyzstan

ABSTRACT Erwinia amylovora as a fire blight pathogen and Venturia inaequalis as a scab pathogen were isolated from the blossoms, exudates, infected fruits, leaves and bent branches of diseased apple, pear and hawthorn trees, selected in the Chy, Osh and Jalal Abad regions. Biochemical and pathogenicity tests, alongside PCR analyses were conducted to identify the local isolates of Erwinia amylovora and Venturia inaequalis. The alternative antagonistic microorganisms which combat bacterium E. amylovora and fungus Venturia inaequalis were tested within in vitro and in vivo conditions. The results revealed the ability of Streptomyces antagonistic bacteria to decrease fire blight severity on pear and apple trees during the first stage of the fire blight disease in leaf *



42

T. Doolotkeldieva tissues. Streptomyces strain C1-4 suppressed E. amylovora disease symptoms in the leaf tissues and excised apple and pear shoots. The incidence of fire blight on leaves was reduced by about 70% with two applications of bacterial antagonists. Streptomyces sр strains were tested for apple scab control in vitro and field conditions. Two applications of Streptomyces strain C1-4 within 35 days completely stopped the scab disease in seedling leaves. Within 40 days, the seedlings were recovered; the new leaves have blossomed on branches. Seedlings grew new shoots and leaves around 50 days after the second treatment. Orchard experiment results provide great hope that a biological product based on Streptomyces could work as an effective agent to suppress the development of the pathogen in the early spring, when leaves start to show scab disease symptoms. Further studies at different locations in Kyrgyzstan, using large scale application, would allow for stronger recommendations to be made, including studies and recommendations on their ability to prevent diseases and to use them as main components in an integrated pest management program.

1. INTRODUCTION The Kyrgyz Republic has significant potential for the cultivation of fruit crops. Since 2004 in Kyrgyzstan the agri-products produced in an ecological way and in excellent climatic conditions start increasing. For the successful implementation organic production, the farmers should be use the practices and techniques that are specific to organic farming. It is the creation of conditions for the functioning of the soil biota, especially microorganisms that destroy organic compounds and releasing elements of plant nutrition. For weed and pest control are applied biological methods: introducing natural enemies and specific pathogens. Fire blight and scab are the most harmful diseases of cultivated varieties of apple and pear in Kyrgyzstan, and they affect leaves, stems, flowers and fruits of trees and resulting in the loss of 30-40% of the crop. Fire blight, caused by the bacterium Erwinia amylovora, is an important disease affecting most types of Rosaceae plant and represents an enormous threat to fruit cultivation in many parts of the world. The host Rosaceous trees for Erwinia amylovora are pear, apple, quince, loquat, ornamental and wild plants (cotoneaster, pyracantha, stranvaesia,


Streptomyces Bio-Products against Apple and Pear Diseases …

43

hawthorn, sorbus). According to EPPO (2012), E. amylovora is currently present in more than 50 countries worldwide [1]. It is a complex disease which passes its entire cycle in close association with the host plant, where it is able to infect fruit, leaf, shoot and flower tissue. Infected plant parts will, in all cases, cause sticky, amber-like drops of ooze, composed of viable bacteria in a polysaccharide matrix, to be formed on the blighted plant parts [2]. Erwinia amylovora, the causative agent of fire blight, was identified independently from the common plasmid pEA29 by three different PCR assays with chromosomal DNA. PCR with two primers was performed with isolated DNA and with whole cells, which were directly added to the assay mixture. The oligonucleotide primers were derived from the ams region and the PCR product comprised the amsB gene, which is involved in exopolysaccharide synthesis. The amplified fragment of 1.6 kb was analysed and the sequence was found to be identical for two E. amylovora strains [3]. Pathogenicity and virulence of the pathogen E. amylovora depend on different factors. However, probably the most essential reasons for differences in virulence between different strains of E. amylovora are the variation in the synthesis of exopolysaccharides (EPS) and the mechanism of the type III secretion system (T3SS) and associated proteins. One of these EPS is amylovoran, which is the main constituent of bacterial ooze. Amylovoran is a polymer of a pentasaccharide repeating unit that generally consists of four galactose residues and one glucuronic acid residue [4, 5]. E. amylovora strains that do not have the capacity to produce amylovoran are non-pathogenic and are unable to spread in plant vessels [6]. Another EPS that is synthesized by E. amylovora is levan. Lack of levan synthesis can result in a slow development of symptoms in the host plant [7]. Koczan et al. [8, 9] discovered that the EPS of E. amylovora are also involved in biofilm formation, which enables the bacteria to attach to several surfaces and each other. They have suggested that biofilm formation plays an important role in the pathogenesis of E. amylovora, as


44

T. Doolotkeldieva

their study showed that amylovoran is necessary for biofilm formation and that levan contributes to this biofilm formation. Another important factor in pathogenicity is confined by the action of the T3SS (the type III secretion system). In E. amylovora, HRC and HRP genes are clustered in a pathogenicity island which contains four regions: a HRP/HRC region, an HRC effectors and elicitors region, an HRPassociated enzymes region and an island transfer region [10]. Fire blight is difficult to control, as it is able to rapidly spread in the plant and effective control methods are still lacking. Suppression of the blossom-blight phase of fire blight is a key point in the management of this destructive and increasingly significant disease in apple and pear trees [11]. Chemical control of fire blight is difficult, because there are few effective bactericides registered, while streptomycin (which is effective) and other antibiotics are not registered worldwide. According to some researchers, only copper fungicides can suppress this disease [12]. Scientists are attempting to find biological agents to use against this severely destructive disease, so in some parts of the world searches have been carried out for antagonist-microorganisms to use against fire blight. Biological control agents of fire blight have been found by applying, through spraying treatments, non-pathogenic bacteria, Bacillus subtilis or Pantoea agglomerans and plant extract, viz. Harmel (Peganum harmala L.), to open flowers in Egypt [13]. The talc-based formulation of P. agglomerans strain Eh-24 reduced the percentage of blighted blossoms on pear orchards by between 63% and 76%, approximately [14]. Under field conditions, Johnson et al. [15] found that early establishment of populations exceeding 105 CFU per blossom of P. fluorescens Pf A-506 and P. agglomerans Eh C9-1 on pear blossoms suppressed establishment and growth of E. amylovora, thereby decreasing disease incidence. The incidence of fire blight on blossoms was reduced by about 60% with two applications of bacterial antagonists in experimental plots in the Pacific Northwest [16] and California [17]. The efficacy of biological control approached or equalled levels obtained with chemical control in many of the field trials.



45

As became evident, many scientists prefer dealing with the blossom blight phase of fire blight for the management of this disease. Biological control agents (BCAs) are now commercially available [18]. However, the effectiveness of BCA products for fire blight control was generally low and highly variable [19]. Therefore, there is still a need for new species and strains of BCAs with novel mechanisms of action, which also fulfil the current strict authorization requirements in most countries for microbial bio-bactericides [20]. The first disease cases of fire blight in fruit trees were marked in several regions of Kyrgyzstan during the period of 2009-2013. The Phytosanitary Service of KR has examined 1235 ha in the Chui region, including 42.1 hectares of contaminated trees with fire blight. In the IssykKul region, the first signs of symptoms of fire blight in fruit have been identified since July, 2012. In 2013, the disease spread to the eastern districts of the region. The first signs of symptoms similar to bacterial blight on pome trees in the forests of Southern Kyrgyzstan were sighted in 2008-2009 by the employees of the Plant Protection station, located in the city of Jalal-Abad. Among the economically most important fruit crops in South and North Kyrgyzstan affected by scab disease are apples (Malus domestica). In 2015, 16189 hectares of gardens in Kyrgyzstan were surveyed, of which 4643 hectares were infected by scab disease. During the most intensive development period, this disease affected 5-55% of trees and from 1-56% of their fruits; 1267 hectares of garden were treated by chemical fungicides [21]. According to some data, up to 20 fungicide treatments are applied per season to control the disease [22, 23]. Venturia inaequalis (Cooke Wint) is the causal agent, affecting the leaves and fruit tissue of trees. V. inaequalis is a heterothallic fungus and contains seven haploid chromosomes [24]. It leads both a saprophytic (marsupial stage Venturia inaequalis (Cke)) and parasitic (imperfect stage Fusicladium dendriticum (Wallr) Fuck) lifestyle. The causal agent overwinters in infected fallen leaves. In the spring, it enters a marsupial stage in the form of small black tubercles – pseudothecium (typical fruiting bodies), within which ascospores mature [25, 26]. The asci of V. inaequalis


46

T. Doolotkeldieva

are bitunicate, cylindrical, double-walled and loculus. The ascospore consists of two unequal-sized cells, with a thin, brittle outer wall and a thick, elastic inner wall which assists the persistence of the pathogen during winter [27]. In the presence of moisture, the pathogen ascospores germinated on the leaves, breaking the thin surface epithelium of young leaves. Upon contact with a cuticle, the germ tube is differentiated into an appressorium and produces adhesive mucilaginous substances, assumed to be used to facilitate attachment to the host surface [28, 8]. Once an infection is established, curative preparations are required to stop further development of the mycelium. In organic apple-growing, scab disease control is focused on the protective use of sulphur, lime sulphur and copper. Additional sprays of lime sulphur during the germination period of the scab fungus are applied during severe infection periods. These specific applications are difficult to schedule, as the time period for the application is often short and in most cases these sprays have to be performed during rainfall and at night [29]. The control of scab infections on apple leaves and fruits is usually done by the conventional use of synthetic fungicides. Different compounds based on carbonates have been tested for apple scab control during previous years, resulting in variable efficacies [30, 31, 32, 33]. This can be explained by the influence of different formulations used, different weather conditions or by the timing of the application, which has a considerable impact on the efficacy. Alternative approaches to chemical use are highly appreciated due to the increasing importance of integrated management strategies relying on biocontrol, possibly combined with selective application of fungicides. The above strategies must meet two requirements: effectiveness and environmental safety [34]. Pseudomonas syringae (isolate 508) prevented spore germination and effectively suppressed scab disease to a level comparable to that provided by the fungicide, captan. This isolate provided greater suppression of apple scab disease than did other pathogenic isolates of P. syringae, isolated from various crops [35].



47

The filamentous actinobacteria of the genus Streptomyces are ubiquitous in soil. They are known as decomposers of organic material and an especially rich source of antimicrobial compounds [36]. Members of this genus have evolved to live in symbiosis with plants, fungi, and animals [37, 38]. Soil bacteria belonging to the Streptomycetes are regarded as promising biocontrol organisms due to their potential to produce a vast array of secondary substances such as vitamins, alkaloids, plant growth factors, enzymes, and enzyme inhibitors [39, 40, 41]. They are capable of exhibiting beneficial as well as detrimental effects on plants, including promotion of symbiosis, improved growth, abiotic stress resistance, and an enhanced resistance to fungi and bacterial diseases. The fact that many Streptomycetes are able to produce antifungal compounds indicates that they may be competitors of fungi. Direct inhibition of fungal parasites may lead to plant protection and is often based on antifungal secondary metabolites [42, 43]. In parallel to antibiotics, the Streptomycetes produce a repertoire of other small molecules, including for instance root growthinducing auxins [44] and iron acquisition-facilitating siderophores [45]. The aim of this study was to develop environmentally friendly local microbial products on the basis of Streptomycetes and control measures against these destructive and increasingly significant diseases in apple and pear trees.

2. METHODS AND MATERIALS 2.1. Plant Samples Collection Diseased pear and apple flowers, leaves, shoots and fruitlets showing necrotic/cankers characterizing symptoms of fire blight and scab were collected from trees and used for isolation of the causative pathogens (Table 1).


48

T. Doolotkeldieva

Table 1. Samples taken from diseased plants Time of sampling The end of April 2014, May 2015 May, 2015

Sampling place

Species of plants

Plant organs

Botanical Garden named after Gareev, Bishkek city Karakol city, Issyk-Kul province

June, 2015

Fruit farming of Nookat district, Osh province Fruit farming of Karasuu, Fruit farming Arslan bob walnut forests, Jalal Abad Fruit farming of Suzak district, Osh province

Different varieties of apple and pear trees Different varieties of apple and pear trees Different varieties of apples and pears Different varieties of apples and pears Hawthorn

The young buds; blooms e with exudate The young buds; blooms e with exudate The affected shoots and leaves The affected shoots and leaves The affected shoots and leaves The affected immature fruits and leaves

June, 2015

June, 2015

May, 2015

Different varieties of apples

2.2. Extraction of Pathogens from Primary Materials by Shaking in Buffer Samples were placed in a suitable container, such as a disposable 150 ml plastic cup with lid or a 200 ml Erlenmeyer flask. 30 ml phosphate buffer or phosphate-buffered saline was added. The container was placed on a rotary shaker and then incubated at 200 rev/min for 1.0 h. For samples with symptoms, an appropriate amount of macerate was selected for polymerase chain reaction (PCR) analysis. For asymptomatic samples extracted, suspension was concentrated by centrifugation. 50 ml of Macerate was carefully poured either directly into the centrifuge tube,



49

leaving the pulp in a container, or pre-filtered through filter paper and then centrifuged for 10 minutes, with an acceleration of 8000 g. The sample was also frozen at -18°C. The supernatant was discarded without damage; the pellet was resuspended in 1 ml of phosphate buffer and transferred to a sterile microtube. The extract was used immediately for the selection tests: biochemical and PCR analyses.

2.3. Isolation of Pure Culture of Erwinia amylovora To isolate E. amylovora isolates from primary materials (diseased parts of plants), as well as to identify and store them in vitro, cultures commonly used for bacteria nutrient mediums and selective mediums were used, like Levan, King’s B medium and nutrient agar with sucrose. A 30-50 μl dose of plant extract suspension from diseased parts was added to the Petri dish and sequentially distributed over the surface of the medium on three plates with a spatula. The stroke method was also used for plating the plant extract suspension. For this purpose, four decimal dilutions of plant extract were prepared in the extraction buffer and then 50-100 μl of undiluted extract, before each of the dilutions was plated on its medium with the stroke method. To control the quality of the medium, the reference strains of fire blight pathogen were plated.

2.4. Enrichment in the Unripe Fruits Immature fruits are an ideal medium for bacterial blight pathogen, while constraining the growth of accompanying microorganisms. Therefore, enrichment on the biological material can be more efficient than media. For each sample, three to five immature fruits (or 1/4-1/2 of the fruit) of susceptible apple and/or pear varieties were used. One hundred μl of sample suspension was distributed between fruits by making a few


50

T. Doolotkeldieva

nyxes through the fruit skin, to a depth of about 5 mm, using disposable syringes with thin needles. As a positive control, the same fruit varieties were inoculated with a pure culture suspension of blight pathogen at a concentration of 106 cells/ml. As a negative control, the same fruit varieties were inoculated with a buffer in which a macerate was prepared. They were incubated in a humid chamber at 25°C to 27°C for five to seven days. Necrosis and white exudate were observed being produced by the fruits. With the development of typical symptoms, isolation and identification of a pure culture was performed.

2.5. Molecular Identification of Erwinia amylovora 2.5.1. Sample Preparation of Samples for Tests Based on Polymerase Chain Reaction Levan-positive, non-fluorescent culture at a concentration of 106 cells/ml in sterile distilled water suspension was prepared and used immediately or stored at -18°C until PCR product was observed. 2.5.2. Classic Analysis Based on the Polymerase Chain Reaction DNA isolation, restriction and agarose gel electrophoresis were carried out according to standard protocols. Amplification of E. amylovora gene hrpN was performed with primers Eam1 (5'gaggaataccatatgagtct gaatacaagtg3') and Eam2 (5'agcgtcgaccagcttgccaagtgccat3').

2.6. Isolation of a pure Venturia inaequalis Culture The following culture media were used for the primary isolation of scab pathogens:



51

1) Potato agar (g/distill. water): potatoes – 200g; Agar – agar – 15g; water – 1 L; pH -6.2; 2) Apple agar: chopped apple fruit weight – 200g; Agar agar – 15.0; water – 1L; pH -6.5; 3) Czapek medium; 4) Wort agar: wort – 50ml; agar-agar – 20 g; water – 1.0 L; A special technique was used to determine the morphological features of Venturia inaequalis proposed by [33, 34] for other fungi. This technique is simple, cheap and does not require much time. It analyses the following morphological features: the size of spores, the diameter of the hyphae and culture function; the growth of the colonies and the colour of the pathogen colonies were studied accurately.

2.7. Sources of Antagonists Biocontrol antagonistic microorganisms (Streptomyces) from our laboratory collection were used in this study.

2.8. In Vitro Determination of Antibiotic Activity of Antagonistic Microorganisms against Fire Blight and Scab Pathogens The N.S. Egorov [46] perpendicular stroke Method was used. THE Antagonist culture was plated on the diameter of the Petri dishes; after four to five days, test cultures (Erwinia amylovora) and (Venturia inaequalis) were plated. The agar blocks method was also used. Biocontrol antagonistic microorganisms (Streptomyces sp.) were plated onto the surface of the agar medium in a Petri dish, having formed during the growth of a continuous lawn. Cultures were incubated at a suitable temperature for four to five days. Then a sterile cork drill (6-8 mm in diameter) was used to cut from the layer agar blocks and transferred to the surface of the agar medium, inoculating only the test organisms (Erwinia


52

T. Doolotkeldieva

amylovora) and (Venturia inaequalis). Agar blocks were placed increasing (lawn) up at an equal distance from each other and from the edge of the cup tightly to the agar plate.

2.8.1. Evaluation of Antagonistic Activity Biocontrol Agents in Liquid Media against Fire Blight Pathogen Antagonistic activity of biocontrol agents against the bacterial blight pathogen was studied by co-cultivation of the antagonist and the test culture in a liquid medium. The Erwinia amylovora culture was incubated in 5 ml tubes in a meat-peptone broth for 48 hours. Then 1 ml of an antagonist culture was added to each tube: Streptomyces bambargiensis SK-6,6; Streptomyces fumanus gn-2, Streptomyces C-4; Streptomyces Pr -3 and Streptomyces C1-4. After incubation at 28°C for 24 hours, tube contents were analysed and the activity of the biocontrol agents was evaluated.

2.9. Screening the Antibiotic Activity of Antagonistic Microorganisms against the Bacterial Blight and Scab Pathogens on Apple and Pear Seedlings The potential of candidate antagonists to suppress the cell production of Erwinia amylovora and conidia production of V. inaequalis on infected leaves was tested on susceptible local Aychurok apple seedlings and local Myskii pear seedlings. Seedlings were sprayed with suspensions of Erwinia amylovora (1x 106 ml-1) and with conidial suspensions of Venturia inaequalis (1x 105ml-1) until runoff and seedlings were incubated for five days at 85% RH, 15°C and with 16 hrs of light per day. Thereafter, E. amylovora -inoculated and V. inaequalis -inoculated seedlings were sprayed with antagonist suspensions (containing 1 x 106 spores or cells ml1) or water (containing 0.01% Tween 80) as controls. Two seedlings of both apples and pears were used for each replicate of each treatment. Contact between leaves of neighbouring plants was avoided. Seedlings were grown for nine to 12 days at 15°C, with 16 hrs of light per day at



53

138 µE s-1 m-2. From both seedlings of each replicate, the youngest five true leaves were carefully removed, put into Duran bottles (100 ml) containing 35 ml of tap water with 0.01% Tween 80. Four, 10, 15 and 20 days after treatment with antagonist cultures, five leaves of the apple seedling were removed for microscopy and planting on the relevant mediums. Pathogen colonies were counted on each single leaf and the average number of colonies forming units was calculated.

2.10. Orchard Experiments Two rows of three-year-old apple trees of the Aychurok variety were used to test the antagonists in the Plant Research field at the Agriculture Faculty, KTU Manas, Bishkek. For each experiment, two to four trees in two replicates were used. Within each replicate, two treatments were carried out.

2.11. Statistical Analysis Data were analysed following the GLIM program of the Royal Society of London [47]. Significant differences between the two mean values, due to different treatments or varieties and their interaction at a crop growth stage, were computed by comparing their significant levels at Psample-chapters. Gedil, M., Ferguson, M., Girma, G., Gisel, A., Stavolone, L., and Rabbi, I. (2016). Perspectives on the Application of Next-generation Sequencing to the Improvement of Africa’s Staple Food Crops. In J.K. Kulski, Next Generation Sequencing-Advances, Applications and Challenges. Intech Croatia. DOI: https://dx.doi.org/10.5772/61665. Accessed 05 July 2017. Gold, M.V. (2007). Alternative Farming Systems Information Center: Organic Production and Organic Food. Information Access Tools. https://www.nal.usda.gov/afsic/organic-productionorganic-foodinformation-access-tools. Accessed on 07 July 2017. Hansra., B.S., and Jain, P.K. (2012). Open and Distance Learning System in Extension Education. Indian Research Journal of Extension Education 1:20-24. Holland, J.M.. (2004). The environmental consequences of adopting conservation tillage in Europe: reviewing the evidence. Agriculture, Ecosystems & Environment, 103.1-25.


Organic Crop Production in Sub-Saharan Africa

111

Hosack, P., and Miller, L. (2017). Preventing and managing plant diseases. Master Gardner, University of Missouri Extension. 13:1-16. International Atomic Energy Agency (IAEA). (2008). Guidelines on Nitrogen Management in Agricultural Systems. International Atomic Energy Agency. 29:1-237. Intergovernmental Panel Climate Change. (2014). Mitigation of Climate Change Summary for Policymakers Technical Summary Part of the Working Group III Contribution to the Fifth Assessment Report of the Intergovernmental Panel on Climate Change O. Edenhofer., R. PichsMadruga and Y. Sokona., eds. Cambridge University Press. https:// www.ipcc.ch/pdf/assessment-report/ar5/wg3/ipcc_wg3_ar5_summaryfor-policymakers.pdf. Accessed 20 July 2017. ITC. (2007). Organic farming and climate change. International Trade Center.11:1-38. Issaka, Y. B., Antwi, M., and Tawia, G. (2016). A Comparative Analysis of Productivity among Organic and Non-organic farms in the West Mamprusi District of Ghana. Multidisciplinary Digital Publishing Institute Journals. DOI: 10.3390/agriculture6020013. Jagtap, S.S. and Chan, A.K. (2000). Agrometeorological aspects of agriculture in the sub-humid and humid zones of Africa and Asia. Agricultural and Forest Meteorology, 103:59-72. Jama, B., Kwesiga, F., and Niang, A. (2006). Agroforestry innovations for soil fertility management in sub-Saharan Africa: Prospects and challenges ahead. World Agroforestry Centre, Nairobi. 6:53-60. Jeeva, S.R.D.N., Laloo, R.C., and Mishra, B.P. (2006). Traditional agricultural practices in Meghalaya, North East India. Indian Journal of Traditional. Knowledge. 5:7-18. Jones, K., Richter, K., and Ludgate, N. (2015). Innovate Study: Agricultural Education and Training System in Tajikistan. Virginia Tech. http://www.oired.vt.edu/innovate/wp-content/uploads/2015/08/ innovATE-Tajikistan-AET-Assessment-for-MOES.pdf. Accessed 06 July 2017. Jouzi, Z., Azadi, H., Taheri, F., Zarafshani, K., Gebrehiwot, K., Van Passel, S., and Lebailly, P. (2017). Organic farming and small-scale


112

N. T. Sithole, M. N. Mbatha, G. D. Arthur et al.

farmers: Main opportunities and challenges. Ecological Economics. 132:144-154. Kareem, O.I. (2016a). The High-Value Commodity Export Effects of Standards in Africa. The International Trade Journal. 30:237-259. Kareem, O.I. (2016b). European Union’s Standards and Food Exports from Africa: Implications of the Comprehensive Africa Agricultural Development Programme for Coffee and Fish. Journal of African Development. 18:83-97. Kareem, O.I. (2016c). Cocoa export’s effects of the European Union’s sanitary and phytosanitary measures. International Journal of Sustainable Economy. 8:76-92. Kareem, O.I. (2016d). Food safety regulations and fish trade: Evidence from European Union-Africa trade relations. Journal of Commodity Markets. 2:18-25. Kareem, O.I. (2016e). The European Union’s and United States of America’s Non–Tariff Measures: Impacts on African Exports. African Growth and Development Policy Modelling. http://www.agrodep.org/. Accessed 12 July 2017. Kariuki, J.G. (2011). The future of agriculture in Africa. The Pardee Papers. 15:1-46. Kark, S., Tulloch, A., Gordon, A., Mazor, T., Bunnefeld, N., and Levin, N. (2015). Cross-boundary collaboration: key to the conservation puzzle. Current Opinion in Environmental Sustainability. 12:12-24. Karki, S.K., Fasse, A., and Grote, U. (2016). The role of standards in domestic food value chains in Sub-Saharan Africa: a review article. African Journal of Horticultural Science. 9:41-53. Kasirya. I. (2013). Constraints to agricultural technology adoption in Uganda: Evidence from the 2005/06-2009/10 Uganda National Panel Survey. Economic Policy Research Centre. 102:1-32. Kfir, R. (2003). Biological control of the diamond back moth Plutella xylostella in Africa. In: Neuenschwander P, Borgameister C, Langewald, J., eds. Biological control in IPM systems in Africa. CAB International, Wallingford. www.ecoagrijournal.com/downloads/ JournalEcoFriendly2017.pdf. Accessed 18 July 2017.



113

Khan, Z.R., Midega, C.A., Pittchar, J.O., Murage, A.W., Birkett, M.A., Bruce, T.J., and Pickett, J.A. (2014). Achieving food security for one million sub-Saharan African poor through push–pull innovation by 2020. Philosophical Transactions of the Royal Society of London B: Biological Sciences. DOI:10.1098/rstb.2012.0284. Accessed 16 July 2017. Kisaka-Lwayo, M. (2011). Risk Preference and Optimal Crop Combinations for Smallholder Farmers in Umbumbulu District, South Africa: An Application of Stochastic Linear Programming. In Innovations as Key to the Green Revolution in Africa. Springer, Dordrecht. www.springer.com/la/book/9789048125418. Accessed 05 July 2017. Kisaka-lwayo, M., and Obi, A. (2014). Analysis of Production and Consumption of Organic Products in South Africa. Intech Open Journals. DOI: 10.5772/58356. Kuntashula, E., Sileshi, G., Mafongoya, P.L., and Banda, J. (2006). Farmer participatory evaluation of the potential for organic vegetable production in the wetlands of Zambia. Outlook Agriculture. 35:299305. Krupinsky, J.M., Bailey, K.L., McMullen, M.P., Gossen, B.D., and Turkington, T.K. (2002). Managing plant disease risk in diversified cropping systems. Agronomy Journal, 94:198-209. Lacey, L.A., Grzywacz, D., Shapiro-Ilan, D.I., Frutos, R., Brownbridge, M., and Goettel, M.S. (2015). Insect pathogens as biological control agents: back to the future. Journal of Invertebrate Pathology. 132:141. Lesk, C., Rowhani, P., and Ramankutty, N. (2016). Influence of extreme weather disasters on global crop production. Nature. 529:84-87. Lai, E. R. (2011). Collaboration : A Literature Review. Research Reports. DOI: 10.2307/3069464. Accessed 03 July 2017. Lindgren, J.F., Salo, K., Brynolf, S., Andersson, K., Svensson, E., Zetterdahl, M., Granhag, L., and Magnusson, M. (2016). The Natural Environment and Human Impacts. In Shipping and the Environment. Springer Berlin Heidelberg. 1:29-74.


114


Lowry, P.B., Curtis, A. and Lowry, M.R. (2004). Building a taxonomy and nomenclature of collaborative writing to improve interdisciplinary research and practice. The Journal of Business Communication (1973), 41:66-99. Maliki, R., Sinsin, B., Floquet, A., Cornet, D., Malezieux, E. and Vernier, P. (2016). Dry matter production, nutrient cycled and removed, and soil fertility changes in yam-based cropping systems with herbaceous legumes in the Guinea-Sudan zone of Benin. Scientifica. DOI:10.1155/2016/5212563. Accessed 04 July 2017. Mollá, O., Biondi, A., Alonso-Valiente, M., and Urbaneja, A. (2014). A comparative life history study of two mirid bugs preying on Tuta absoluta and Ephestia kuehniella eggs on tomato crops: implications for biological control. Biological Control. 59:175-183. Muchara, B., Letty, B., McCosh, J., Arowolo, S., and Adeyemo, A.J. (2015). Investigation of smallholder food value chains: Evidence from Eastern Cape and KwaZulu-Natal Provinces. Sabinet. 14:12-13. Mugendi, E. (2013). Crop diversification : A potential strategy to mitigate food insecurity by smallholders in sub-Saharan Africa Institute of Life Sciences. Saint Anna School of Advanced Studies, and Kenyatta University. 3:63–69. Mukute, M. (2010). Exploring and expanding learning processes in sustainable agriculture workplace contexts. Annual Research ReportRhodes University. 20:413-419. Nel, A. A. (2005). Crop rotation in the summer rainfall area of South Africa. South African Journal of Plant and Soil, 22:274–278. Nel, A.A., and Lamprecht, S.C. (2011). Crop rotational effects on irrigated winter and summer grain crops at Vaalharts. South African Journal of Plant and Soil. 28:127–133. Newell, S., Robertson, M., Scarbrough, H., and Swan, J. (2009). Managing knowledge work and innovation. Palgrave Macmillan Education. https://he.palgrave.com/page/detail/Managing-Knowledge-Work-and Innovation/?K=9780230522015. Accessed 20 July 17. Nyakanyanga, S. (2015). Earthworms help smallholders increase crop yields. Scidev.net. http://www.scidev.net/sub-saharan-africa/farming/



115

news/earthworms-smallholders-increase-crop-yields.html. Accessed 12 July 2017. Obalum, S.E., Buri, M.M., Nwite, J.C., Watanabe, Y., Igwe, C.A., and Wakatsuki, T., 2012. Soil degradation-induced decline in productivity of Sub-Saharan African soils: The prospects of looking downwards the lowlands with the Sawah Ecotechnology. Research Gate.2012:1-10. Obopile, M., Munthali D.C., and Matilo, B. (2008). Farmers’ knowledge, perceptions and management of vegetable pests and diseases in Botswana. Crop Protection. 27:1220-1224. OECD-FAO. (2016). OECD-FAO Agricultural Outlook 2016-2025 subSaharan Africa. Organisation for Economic Co-operation and Development-Food and Agriculture Organization. www.fao.org/3/ai5778e.pdf. Accessed 12 July 2017. Organic Instead. (2013). Soil Degradation: Causes and Consequences. Organic Instead. www.organicinstead.com/soil-degradation.html. Accessed 04 July 2017. One Green Planet (2014). How the Growth of Monoculture Crops Is Destroying our Planet and Still Leaving us Hungry. One Green Planet. www.onegreenplanet.org/animalsandnature/monoculture-cropsenvironment/. Accessed 04 July 2017. O’Sullivan, P.S., Stoddard, H.A. and Kalishman, S. (2010). Collaborative research in medical education: a discussion of theory and practice. Medical education, 44:1175-1184. Papanastassiou, N. J. (2012). Development Strategies and Environmental Policy in East Africa Chapter 3: Crop-Environment Interactions in Sub-Saharan Africa. Environmental Policy Update.http://web.colby. edu/eastafricaupdate2012/files/2011/12/CH3_CropEnvironmentInteractions-in-sub-Saharan-Africa.pdf. Accessed 07 July 2017. Rosegrant, M.W., Cenacchi, J.K.N., Ringler, C., Robertson, R., Fisher, M., Cox, C., Garrett, K., Perez, N.D., and Sabbagh, P. (2014). Food Security in a World of Natural Resource Scarcity: The Role of Agricultural Technologies. International Food Policy Research Institute. DOI: http://dx.doi.org/10.2499/9780896298477. Accessed 20 July 2017.


116


Sachs, J.D. (2005). Can extreme poverty be eliminated? Scientific American. 293:56-65. Shiferaw, B., Tesfaye, K., Kassie, M., Abate, T., Prasanna, B.M., and Menkir, A. (2014). Managing vulnerability to drought and enhancing livelihood resilience in sub-Saharan Africa: Technological, institutional and policy options. Weather and Climate Extremes. 3: 67-79. Sibanda, T., Dobson, H.M., Cooper, J.F., Wanyangarirwa, W., and Chiimba, W. (2000). Pest management challenges for smallholder vegetable farmers in Zimbabwe. Crop Protection. 19:807-815. Silici, L. (2010). Conservation agriculture and sustainable crop intensification in Lesotho. Food and Agriculture Organization of the United Nations. 10:1-74. Simms, A. (1999). Selling suicide: farming, false promises and genetic engineering in developing countries. Food and Agriculture Organization. www.agris.foa.org/agris-search/search.do?recordID= GB2013202425. Accessed 01 July 2017. Sooryamoorthy, R. (2013). Scientific collaboration in South Africa. South African Journal of Science, 109:01-05. TerAvest, D., Carpenter-Boggs, L., Thierfelder, C., and Reganold, J.P. (2015). Crop production and soil water management in conservation agriculture, no-till, and conventional tillage systems in Malawi. Agriculture, Ecosystems & Environment. 212:285-296. The Lancet (2013) Integrity in research collaborations: The Montreal Statement. The Lancet. 382:1310. Thierfelder, C., Cheesman, S. and Rusinamhodzi, L. (2012). A comparative analysis of conservation agriculture systems: Benefits and challenges of rotations and intercropping in Zimbabwe. Field crops research, 137:237-250. Tiemann, L.K., Grandy, A.S., Atkinson, E.E., Marin‐Spiotta, E., and McDaniel, M.D. (2015). Crop rotational diversity enhances belowground communities and functions in an agroecosystem. Ecology Letters.18:761-771.



117

Tilman, D., Clark, M., Williams, D.R., Kimmel, K., Polasky, S., and Packer, C. (2017). Future threats to biodiversity and pathways to their prevention. Nature. 546:22900. Tiwari, M., and Tripathi, N.N. (2016). Decision pattern among women performing agricultural activities. Indian Research Journal of Extension Education. 14:31-34. Tlala, M. (2014). Agroecological Case Studies: The Machobane Farming System in Lesotho. Oakland Institute and the Alliance for Food Sovereignty in Africa. 1:1–4. Tully, K., Sullivan, C., Weil, R., and Sanchez, P. (2015). The state of soil degradation in sub-Saharan Africa: Baselines, trajectories, and solutions. Sustainability, 7:6523-6552. Van Bruggen, A.H.C., and Finckh, M.R. (2016). Plant diseases and management approaches in organic farming systems. Annual Review of Phytopathology. 54:25-54. van Rensburg, L. D. (2010). Advances in soil physics: Application in irrigation and dryland crop production. South African Journal of Plant and Soil. 27:9–18. Vanlauwe, B., and Giller, K. E. (2006). Popular myths around soil fertility management in sub-Saharan Africa. 116:34–46. Viljoen, W. (2014). Sanitary and phytosanitary measures: Citrus Black Spot and American Foulbrood Disease. https://www.tralac.org/ discussions/article/6611-sanitary-and-phytosanitary-measures-citrusblack-spot-and-american-foulbrood-disease. Accessed 28 August 2017. Webber, H., Gaiser, T., and Ewert, F. (2014). What role can crop models play in supporting climate change adaptation decisions to enhance food security in Sub-Saharan Africa ? Agricultural Systems. Elsevier Ltd. 127:161–177. Wittwer, R.A., Dorn, B., Jossi, W., and Van Der Heijden, M.G. (2017). Cover crops support ecological intensification of arable cropping systems. Scientific Reports. 7:1-12. World Food Programme (2010). Annual Report Democratic Republic of Congo. World food Programme.http://documents.wfp.org/stellent/


118


groups/public/documents/newsroom/wfp224363.pdf. Accessed 21 July 2017. Zingore, S., Mutegi, J., Agesa, B., Tamene, L., and Kihara, J. (2015). Soil degradation in sub-Saharan Africa and crop production options for soil rehabilitation. Better Crops Plant Food. 99:24-26.



Chapter 4

CITRIC ACID PRODUCTION USING ALTERNATIVE SUBSTRATES Luciana Porto de Souza Vandenberghe*, Priscilla Zwiercheczewski de Oliveira, Cristine Rodrigues and Carlos Ricardo Soccol Biotechnology and Bioprocess Engineering Department, Federal University of Parana, Curitiba, PR, Brazil

ABSTRACT Citric acid (CA) production is the most produced organic acid in the world due to its versatility, which is evidenced in many applications in food, beverages and pharmaceutical industrial areas. CA production is a well-established bioprocess that employs parental or mutant strains of the fungus Aspergillus niger. However, the high cost of raw materials and energy has transformed the once lucrative CA production sector into an unprofitable market. The search for alternative substrates is a powerful strategy to reduce production costs that is essential to try to solve the economic viability of the world CA production, which is commanded by the large Chinese market. This chapter brings significant information *



120

Luciana Porto de Souza Vandenberghe et al. about different possibilities for CA production, which includes the use of alternative agro-industrial substrates (e.g., citric pulp, cocoa husks, cassava bagasse and others). Fermentation techniques, such as submerged fermentation and solid-state fermentation, conditions and factors that affect the acid synthesis are reported with the presentation of concrete examples of developed research.

Keywords: citric acid, Aspergillus niger, submerged fermentation, solidstate fermentation, agro-industrial residues

INTRODUCTION Citric acid (CA) is a tricarboxylic acid, which is is a natural constituent and common metabolite of plants and animals. It is the most versatile and widely used organic acid in the field of food and beverages and pharmaceuticals [1]. About three-quarters of the world consumption of CA is in beverages and food, primarily as an acidulant. It is used to control the growth of microorganisms, adjust acidity (pH), provide sourness and tartness, and enhance flavors. The global market for CA stood at USD 2.6 Billion in 2014, at USD 3.6 Billion by 2020 and is projected to grow 5.5% from 2015 to 2020. [2]. World consumption of CA is expected to increase at an average annual rate of 3.7% during 2015–20. China, Africa, and other countries are expected to exhibit above-average rates of growth in demand; increases in population and living standards are expected to result in higher per capita consumption of beverages and prepared foods [3]. In household detergents and cleaners (approximately 13% of the global market), CA is used as a co-builder with zeolites, mainly in concentrated liquid detergents. Environmental regulations have led to the replacement of phosphate builders with CA/zeolite builders in many liquid detergent formulations. CA does not contribute to the eutrophication of water systems and thus is preferable to phosphates from an environmental perspective. The amount of CA production oscillates according to the market’s demand, price and manufactures. In this way, the high cost of raw


Citric Acid Production Using Alternative Substrates

121

materials led to the search for alternative substrates for process costs’ reduction [4, 5].

FACTORS THAT AFFECT CA ACCUMULATION CA (2-hydroxypropane-1,2,3-tricarboxylic acid) is an intermediate in Kreb’s cycle. CA synthesis is divided in three steps: a) Sugar degradation with glucose transformation into pyruvate; b) The central step consisting of the oxydatif decarboxylation of pyruvate and the carboxylation of pyruvate; c) The TCA cycle and CA accumulation. A. niger, under certain environmental conditions, synthesize CA as an over flow product of the tricarboxylic acid cycle (TCA). The merit of CA fermentation depends on the regulation of the synthesis of each one of the enzymes involved in the TCA cycle and their activity, which depends on some control mechanisms and the presence of some co-factors that are associated with these enzymes. Metal ions form a part of co-factors whose concentration can regulate the enzyme activity [6, 7, 8]. There are three main biochemical ways of sugar degradation for pyruvate formation: the glucolysis, the pentoses’ way and the EntnerDoudoroff way. Studies have shown that, during the first hours of fermentation, after A. niger’s spores germination, around 80% of glucose metabolism passes through the pentose way where there is the production of some essential components for cell’s life (amine acids, nucleotides, vitamins). After that, the glycolysis occurs, when the enzyme phosphogluconate deshydrogenase is inhibited by the intracellular CA. Finally, the phosphofructokinase activity progressively rises and favors the glycolysis [6, 7, 8]. CA, which is produced in the mitochondria, is excreted after passing through the cytoplasm. Phosphofructokinase must be inhibited by high concentrations of citrate, otherwise the glycolysis cycle will continue. In this way, the presence of high concentration of NH4+ ions is indispensable [8, 9, 10].


122

Luciana Porto de Souza Vandenberghe et al.

FACTORS AFFECTING CA PRODUCTION CA accumulation is strongly influenced by the type and concentration of carbon source. The presence of carbohydrates, which are rapidly consumed by the employed microorganism is essential for a CA production [9, 11]. Among the easily metabolized carbohydrates, sucrose is the most favorable carbon source followed by glucose, fructose and galactose [6, 9, 12]. Other sources of carbon such as cellulose, ethanol, sorbose, mannitol, lactic, malic and -acetoglutaric acid, do not favor CA accumulation. Better productions are reached with 14-22% of sugar [13]. The synthesis of CA is directly influenced by the concentration and nature of nitrogen and phosphate sources. It is important to point out that there is an interaction between them. High CA accumulation is directly linked with the limitation of growth. In this way, the presence of nitrogen and phosphate must be limited in the medium. Strains with large requirements of N and P seem to be disfavored, due to the restriction of accessibility to the nutrients in the medium [6, 14, 15]. Acid ammonium compounds are preferred because their consumption leads to pH decrease, what is essential for the CA fermentation. However, it is necessary to maintain pH values, in the first day of fermentation, prior to a certain biomass production [6, 9, 10]. The concentration of nitrogen source required for CA fermentation is from 0.1 to 0.4 g N/L [13]. Urea, ammonium nitrate and sulfate, peptone, malt extract are generally used. Urea has a tampon effect, which assures pH control [4, 6]. Ammonium nitrate concentrations over 25% lead to accumulation of oxalic acid, what is undesirable. Low levels of phosphate have positive effect in CA production. This effect acts at the level of enzyme activity and not at the level of gene expression. On the other hand, the presence of excess of phosphate leads to a decrease in the fixation of carbon dioxide that increases the formation of certain sugar acids and stimulates growth [13]. Phosphorous at concentration of 0.5 to 5.0 g/L is required by the fungus in a chemically defined medium for maximum production of CA [4, 9]. Potassium



123

dihydrogen phosphate has been reported as the most suitable phosphorous source. Trace metal ions have a significant impact on CA accumulation by A. niger [16] that requires certain trace metals for growth. However, a limitation in other trace elements is necessary for CA production, including Zn, Mn, Fe, Cu, heavy metals and alkaline metals [7]. Different reports showed the importance of the optimization of media composition and supplementation with trace elements whose interaction must be studied [4, 6, 9, 15, 17-22]. There are few differences in the response of A. niger to metal ions and minerals in solid-state and submerged fermentation systems. Solid-state culture systems are able to overcome the adverse effects of the high concentrations of these components in the medium [23, 24]. Methanol, ethanol, n-propanol, iso-propanol or methylacetate neutralize the negative effect of the metals in CA production generally in amounts about 1 to 5% [13], even so optimal concentrations of methanol and ethanol depends upon the strain and the composition of the medium [9]. Alcohols have also been shown to act on membrane permeability in microorganisms by affecting its phospholipid composition [4, 6, 7, 9]. Oils and fats can be used in CA fermentation to control foam formation. These lipids also act as carbon sources and can be consumed during fermentation. The pH of a culture may change in response to microbial metabolic activities. For example the secretion of organic acids, such as CA, makes the pH decrease. Changes in pH kinetics depend highly also on the microorganism. With Aspergillus sp., Penicillium sp. and Rhizopus sp., pH can drop very quickly until less than 3.0. For other groups of fungi such as Trichoderma, Sporotrichum, Pleurotus sp., pH is more stable between 4.0 and 5.0. Initial pHs, generally between 2-6, are of extreme importance for maximum production of CA and has the advantage of limiting contamination and inhibiting oxalic acid formation [4, 6, 7-9, 13]. Since CA fermentation is an aerobic process, oxygen supply has a determinant effect on its production. An interruption of aeration during batch fermentation will be quite harmful [4, 6, 7-9, 25]. Aeration should be


124


performed through the medium during the whole fermentation with the same intensity, even so due to economic reasons it’s usually preferred to start with low aeration rates. High aeration rates lead to high amounts of foam, especially during the growth phase, so the addition of antifoaming agents and the construction of mechanical “defoamers” are required to tackle this problem [4, 6, 7-9]. It has been reported that forced aeration using packed-bed reactors in solid-state fermentation, allows high metabolic rates and thus, not necessarily, high CA production, which occurs under growth limitation [4, 6, 17]. CA processes by solid-state fermentatiojn usually employ substrates with about 70% (v/m) initial moisture depending on their absorption capacity. Temperature of incubation is adapted to the biocatalyst varying from 28 to 30°C. [8, 15, 17-24, 26- 29].

CA PRODUCTION CA production started in the thirties with some units implanted in England, in Soviet Union and in Germany. Submerged fermentation dominates the commercial production of CA since the fifties, with the discovery of the glycolytic pathway and the tricarboxylic acid cycle (TCA), mainly due to economic advantage of biological production over chemical synthesis [30]. Different techniques were also tested, including surface fermentation and solid-state fermentation techniques with the use of alternative substrates. Strain improvement was explored by different researchers with good results. However, each strain, substrate and experience leads to different operating conditions. The basis of a successful, economically and ecofriendly CA process would be then to find an efficient strain, a sustainable renewable source of substrate and an efficient recovery process.



125

Fermentation Processes CA production is carried out by fermentation using microorganisms including bacteria, fungi and yeasts such as Arthrobacter paraffinens, Bacillus licheniformis and Corynebacterium ssp., Aspergillus niger, A. aculeatus, A. carbonarius, A. awamori, A. foetidus, A. fonsecaeus, A. phoenicis and Penicillium janthinellum; and yeasts such as Candida tropicalis, C. oleophila, C. guilliermondii, C. citroformans, Hansenula anamola and Yarrowia lipolytica [4, 6, 8, 9, 13, 31]. Although, only A. niger and certain yeasts such as Saccharomycopsis sp. are employed for commercial production. The fungus A. niger has remained the organism of choice due to certain advantages: (a) its ease of handling, (b) its ability to ferment a variety of cheap raw materials, and (c) high yields. Submerged fermentation (SmF) process is the most employed technique for CA production with some advantages such as higher yields, productivity and lower operational costs. Two types of fermenters, conventional stirred and bubble column bioreactors are generally employed [10]. Different media and microorganisms are commonly used for CA production in SmF: starch, sucrose based media or raw materials such as molasses, different starchy materials and hydrocarbons (Table 1). Molasses, from cane and beet molasses, are suitable for CA production due their low cost and high sugar content (40-55%). The composition of molasses depends on various factors, e.g., the original composition of beet and cane, methods of cultivation of crops, fertilizers and pesticides applied during cultivation, conditions of storage, handling and production procedures. Beet molasses are reported to have lower content of trace metals, which could be seen as an advantage. SmF is largely employed in industry, with the employment of raw materials for the production of bulk chemicals and value-added fine products such as ethanol, single-cell protein (SPC), mushrooms, enzymes, organic acids, amino acids, biologically active secondary metabolites, etc. Although, solid-state fermentation (SSF) technique is described as the fermentation technique that employs solid alternative substrate in a freewater environment [8, 23, 24].


126

Luciana Porto de Souza Vandenberghe et al. Table 1. CA production in SmF with alternative substrate

Strain Raw material CA A. niger ATTC 9142 Beet molasses 109 kg/m3 Yarrow lipolytica A101 54 kg/m3 A. niger GCM 7 Black strap molasses 86 kg/m3 A. niger ATTC 9142 Brewery wastes 19 kg/m3 A. niger T 55 Cane molasses A. niger GCMC-7 113.6 kg/m3 A. niger Carob pod extract 86 kg/m3 C. lipolytica N-5704 Coconut oil A. niger IM-155 Corn starch A. niger ATTC 9142 Date syrup C. lipolytica N-5704 Glycerol Y. lipolytica DS-1 Starch hydrolysate Y. lipolytica A-101 A. niger UE-1 74 kg/m3 C. lipolytica N-5704 n-Paraffin C. lipolytica N-5704 Olive oil C. lipolytica N-5704 Palm oil Y. lipolytica A-101 Rapeseed oil A. niger Y. lipolytica A-101 Soybean oil C. lipolytica N-5704 Soybean oil A. niger IMI- 41874 Wood Hemicellulose 27 kg/m3 S. lipolytica IFO 1658 9 kg/m3 o A. niger YANG n 2 Xylan hydrolisate 72 kg/m3 A. niger YW-112 Yam bean starch Source: Adapted from Soccol et al. [4] and Vandenberghe et al. [6]. a based on sugar consumed; b based on oils and fatty acids.

Yield, % 68.7a 78.5 65 100% 99.6b 62 50 58.8b 75 49 161b 119b 155b 57 115b 63 115b 45a 41 74a

CA production by SSF (the Koji process) was first developed in Japan and is the simplest method for its production. SSF can be carried out using several raw materials (Table 2). Agro-industrial residues are very well adapted to solid-state cultures due to their cellulosic and/or starchy nature. These solid residues provide rich nutrients to the microorganisms and are very good substrates for their growth and activity, especially for fungus whose habitat is well reproduced in these conditions [4, 23, 24, 26, 32].



127

Residues/sub-products such as apple pomace, cassava bagasse, citric pulp, coffee husk, wheat straw, pineapple waste, sugar beet cosset, kiwi fruit peel, etc. have been investigated with SSF techniques as substrates for CA production [4, 6, 26, 32, 33], what makes the fermentation process more economical. Some critical factors should be considered for the choice of the substrate such as cost and need of pre-treatment. The presence of trace elements in raw materials is the main problem of CA fermentation because they can act as inhibitors and/or stimulants. So, one of the important advantages of SSF process is that the presence of trace elements may not affect CA production as it does in SmF. Different types of bioreactors such as conical flasks, glass columns, horizontal drums and trays and other models have been employed for CA production in SSF [23, 24, 26, 28-30].

ADVANCES AN FUTURE PERSPECTIVES IN CA PRODUCTION CA production is a well stablished process. However, due to market oscillations and exigencies the industry claims for some alternatives, which must pass through new investments in research. In this way, some advances in CA process pass through the optimization of process conditions including strain mutation, media optimization, use of alternative substrates. Improvement of the microbial producer strain offers the greatest opportunity for cost reduction without significant capital outlay. This is achieved when a selected strain can synthesize a higher proportion of the product using the same amount of raw materials [34]. Strain mutation is a very good alternative for raising process productivities. Mutations are abrupt and so are the hereditary modifications in the genetic material. The organisms that contain the DNA are not static molecules, and their bases are frequently exposed to natural or artificial agents that can cause modifications in their structure or in chemical composition. The most


128


frequently used method is induction by UV irradiation. Therefore, the mutations induced by this method can randomly provide a strain with a higher capacity of CA production when compared to the control strain [35-37]. Table 2. CA production in SSF with different alternative substrate Strain A. niger NRRL2001 A. niger NRRL 2270 A. niger NRRL 599 A. niger NRRL 328 A. niger NRRL 567 A. niger BC1 A. nigerATCC 9142 A. niger NRRL 2270 A. niger LPB-21 A. niger LPB-21 A. nigerCFTRI 30 A. niger A. niger BC A. niger BC A. niger B3 mutant A. niger B6 mutant A. niger B6 mutant A. niger CFTRI 30 A. nigerNRRL2001 A. nigerNRRL 2001 A. nigerCFTRI 30 A. niger NRRL2001 A. niger NRRL 2270 A. niger NRRL 599 A. niger NRRL 328 A. niger NRRL 567 A. niger NRRL 567 A.niger YANG no 2

Raw material Apple pomace

Carob pod Carrot waste Cassava bagasse Flasks Semi-pilotscale Cellulose hydrolysate and sugar cane Citric pulp Cocoa husk Citric pulp Citric pulp Cocoa husk Coffee husk Corncob De-oiled rice bran Grape pomace

Kiwifruit peel Kumara (starch containing)

CA 766 g/kga 816 g/kga 771 g/kga 798 g/kga 883 g/kga 124 g/kg 264 g/kg 29 g/kga 347 g/kgb 260 g/kgb 234 g/kg 29 g/kg

Yield (%) 80 60 36 67 -

445.4 g/kg 390.3 g/kg 537.6 g/kg 616.5 g/kg 978.52 g/kg 150 g/kgb 250 g/kg 603.5 g/kg 92 g/kg 413 g/kga 511 g/kga 498 g/kga 523 g/kga 600 g/kga 100 g/kga 103 g/kgb

-


44

85 50 88 -

Citric Acid Production Using Alternative Substrates Strain A. niger DS1 Clarified Non-clarified molasses Strain A. niger A.niger A. niger A. niger ATCC 1015 A. niger ACM 4942 A. nigerCFTRI 30 A. niger CFTRI 30 A. niger CFTRI 30

Raw material Molasses (sugarcane bagasse) Raw material Mussel processing Wastes (polyurethane foams) Okara (soy residue) Orange waste Pineapple waste

129

CA

Yield (%)

198 g/kg 179 g/kg CA 300 kg/kg

64.5 62.5 Yield (%) -

51 g/kga 46 g/kg 132 g/kgb 194 g/kgb 127 g/kg 174 g/kgb 116 g/kg

53 74 -

Rice bran Sucrose (Sugar cane bagasse) Sugarcane-pressmud and Wheat bran (4:1) A. niger CFTRI 30 Wheat bran 85 g/kg Source: Adapted from Soccol et al. [4] and Vandenberghe et al. [6]. abased on sugar consumed; b based on dry matter.

-

Ultraviolet-irradiation (UV), ethyl methane sulfonate (EMS) and acridine orange (AO) were used to induce CA overproduction mutations in Aspergillus niger UMIP 2564. Among fifteen strains, eight of the mutant derivatives showed higher CA production from sucrose in batch cultures. Maximum product yield (60.25%) was recorded by W5, a stable UV mutant, with approximately 3.2- fold increase when compared to the parental wild type strain. In terms of the kinetic parameters for batch fermentation processes, the mutation doubled the specific substrate uptake rate and achieved 4.5- and 7.5-fold improvements in CA productivity and specific productivity, respectively [36]. Despite the employment of A. niger strain being a traditional way of producing CA, co-cultures is also a possibility. The co-culture fermentation was experimented with glucose as substrate using A. niger and Candida guilliermondii in the presence of trace elements. Single culture fermentation was performed with only A. niger under identical experimental conditions as control essays. Results showed that mixed culture fermentation promoted the production of higher quantities of CA than with single culture. The metabolic changes in A. niger were evaluated,


130


from the protein and lipid estimations study, remaining unaffected while performing co-culture fermentation [8, 38].

EXAMPLES OF CA PRODUCTION USING ALTERNATIVE SUBSTRATE Case 1. CA Production by SmF with Wastewater An integrated CA-methane fermentation process was developed to solve the problem of wastewater pollution in the CA industry. CA wastewater was initially treated by anaerobic digestion. After subsequent ultrafiltration and nanofiltration, the anaerobic digestion effluent (ADE) was recycled as process water for CA production while eliminating wastewater discharge and reducing water consumption. The effects on CA fermentation of components in the ADE were investigated. Production was inhibited when Na+ and Mg2+ concentrations in recycled ADE were > 200 mg/L and >40 mg/L, respectively. This problem was resolved by treating the ADE using ultrafiltration and nanofiltration to reduce Na+ and Mg2+ concentrations to acceptable levels. After treating ADE, CA production and yield increased by 10.2%, to 143.2 g/L and 10.1%, to 90.66%, which was comparable to the control (141.3 g/L and 89.43%). In addition, residual sugar decreased to 21.4 g/L, again comparable to the control (23.7 g/L). It is clear that ultrafiltration and nanofiltration treatment completely removed inhibitors from ADE and permits unrestricted CA production, indicating the technical feasibility of the proposed recycling process [39]. Wastewater from CA fermentation was then used to produce methane through anaerobic digestion. Afterwards, the anaerobic digestion effluent was further treated with air stripping and electro dialysis before recycled as process water for the later CA fermentation. The process was performed for 10 batches and the average CA production in recycling batches was 142.4 ± 2.1 g/L. Anaerobic digestion was also efficient and stable in operation. The average chemical oxygen demand (COD) removal rate was



131

95.1 ± 1.2% and methane yield approached to 297.7 ± 19.8 mL/g TCOD removed [40].

Case 2. CA production by SmF with cassava peel hydrolysate Mutation by UV-radiation and medium optimization were used to enhance production of CA through the screening of five strains of Aspergillus niger using hydrolyzed cassava peel medium [41] (Adeoye et al., 2015). Mutant strain FUO110, which was obtained after 10 min of exposure to UV-radiation, yielded 9.4 g/L that means an improvement of 4.87 fold. Physico-chemical parameters (substrate concentration, process time, inoculum size and initial pH) were further optimized using Central Composite Design (CCD) of Response Surface Methodology. After process optimization CA production by the mutant strain (FUO110) attained 88.73 g/L, an improvement of 45.97 fold over the wild strain.

Case 3. CA Production by SmF with Corn Stover Feedstock Zhou, Meng and Bao [42] studied CA fermentation by the strain Aspergillus niger SIIM M288 using corn stover feedstock after dry dilute sulfuric acid pretreatment and biodetoxification. CA production reached 100.04 g/L with the yield of 94.11%, which was comparable to the starch or sucrose based CA fermentation. No free wastewater was generated in the overall process from the pretreatment to CA fermentation. Abundant divalent metal ions as well as high titer of potassium, phosphate, and nitrogen were found in corn stover hydrolysate. Further addition of extra nutrients showed no impact on CA synthesis except minimum nitrogen source that was required. This study provided a biorefining process for CA fermentation from lignocellulose feedstock with maximum CA yield.


132


Case 4. CA Production by SSF with Cassava Bagasse Cassava (Manihot esculenta Crantz) (CB) is a solid residue generated in the starch extraction process and is widely produced in Brazil. Its disposal in the environment can cause serious pollution problems due to its high organic material content and biodegradability [32]. Vandenberghe et al. [6, 7, 33] used Erlenmeyer flasks and glass columns for CA production with gelatinized cassava bagasse. Higher yields (347 g of CA/kg dry cassava bagasse) were obtained in flasks with aeration by diffusion. Equivalent yields (309 g/kg of dry cassava bagasse) were obtained in column bioreactors with forced aeration. In a tentative to scale-up CA production process [17, 43], SSF process was carried out in trays with 0, 40, 60, 80 and 100% of thermal treated CB. In this case, medium height of 2, 4 and 6 cm of substrate were tested. The best result that were obtained i tray type bioreactor was 263 g of CA/kg of dry CB with 80% treated CB with 4 cm medium height. No CA production was detected with the use of 100% raw CB. These results showed the importance of starch gelatinization, which makes the starch structure more accessible to A. niger attacks (Table 3). However, a certain percentage of non-treated CB may facilitate air diffusion throughout the medium for fungal growth. Highly gelatinized structures may create a very compact medium and promote mas transfer difficulties. Table 3. CA Produced by Aspergillus niger in SSF tray-type bioreactor using different % of non treated-treated CB Nontreated CB (%)

Treated CB (%)

0 20 40 60 100

100 80 60 40 0

Tray-type bioreactor (g CA/Kg dry CB) Substrate thickness 2 cm 4 cm 144 181 184 263 168 224 98 161 7 8


6 cm 219 260 240 214 7


133

Case 5. CA Production by SSF with Citric Pulp Citric pulp (CP) is a solid by-product of the juice industry obtained from the orange juice extraction. Among these residues are rinds, seeds, and orange pulps, representing 50% of the fruit weight. Since these citric residues are rich in carbohydrates and other nutrients, they are viable substrates to CA production by SSF. It is largely used in animal feed supplements, especially those for cattle [44]. After physical-chemical parameters optimization of fermentation using A. niger LPB BC, a 17.5% increase in CA production was obtained by Rodrigues et al. [44]. CA synthesis raised from 383.5 g of CA/kg of dry CP to 450 g of CA/kg of dry CP. This production was reached with pH of 5.5, 65% initial moisture obtained with the addition of sugar molasses (108 g/L of total sugars) and 4% methanol (v/w) at 30° C in Erlenmeyer flasks for 4 days. SSF was also carried in tray- type bioreactors at the same conditions where 362,44 g CA/kg CP and 410 g CA/kg of dry CP were produced with 3 and 5 cm of medium height, respectively (Figure 1).

Figure 1. CA production in tray-type bioreactor using CP as alternative substrate.


134


Figure 2. Growth of A. niger and halo formation in Foster medium.

400

350

CA production (g/Kg of dry CP)

300

250

5 days 4 days

200

150

100

50

0 A4

B3

B4

B6

B7

B8

D1

D3

D4

D7

Strains

Figure 3. CA production by different U. V. mutant strains.


control


135

A. niger LPB BC strain passed through mutation induced by UV in an attempt to obtain a mutant that could produce higher CA concentrations. Ten mutant strains (Figure 2) were tested in SSF in non-optimized conditions. These strains were called, A. niger LPB A4, A. niger LPB B3, A. niger LPB B4, A. niger LPB B6, A. niger LPB B7, A. niger LPB B8, A. niger LPB D1, A. niger LPB D3, A. niger LPB D4, A. niger LPB D7. Fermentation results on the 4th and 5th days of fermentation are presented in Figure 3. Two mutant strains were chosen: A. niger LPB B3 and A. niger LPB B6 to be used in an SSF kinetics using CP as substrate with the same optimized conditions adopted for A. niger LPB BC. The results obtained were promising for both mutant strains: A. niger LPB B3 produced 537.6g of CA/kg of CP on the 6th day of fermentation (3,73 g/kg.h), whereas A. niger LPB B6 produced 616.5g of CA/kg of CP on the 4th day of fermentation (6,42 g/kg.h). The production and productivities of CA were much higher when compared to the production obtained by the parental strain A. niger LPB BC, which was around 450 g of CA/kg of CP with a productivity of 4,68 g/kg.h. A material containing above 300 g of CA/Kg of dry matter is considered suitable for its direct application in animal feed, for example, or extraction. The optimization of physical-chemical conditions of the process and the mutagenesis induced by UV can be useful. It is a simple method to increase the efficiency of producing biotechnological products and adding value to different Brazilian agricultural residues and by-products [44].

Case 6. CA Production by SSF with Cocoa Husks Cocoa husks are the residues obtained during the processing of cocoa fruit for chocolate production. These husks represent 80% of the total dry weight of the fruit [45], they have a high nutrient content, such as proteins (12 – 18 g 100 g-1), amino acids (315 mg), lipid content (3 g/100 g), sugars (3 g/100 g-) and several minerals [46, 47]. More than 40% of the husk composition refers to the pectic fraction and, approximately, 35% refers to


136


the lignocellulosic structure [48]. Currently, this residue is underutilized, remaining in cocoa planting area. As it provides nutrients for microbial growth, this material is readily contaminated, which is harmful to the culture itself that is the case of the fungus Moniliophthora perniciosa, named “witches-broom” [49]. Cocoa husks from the northern region of Brazil were used as support and substrate for the CA production in SSF with two strains of Aspergillus niger LPB B6 (CCT 7717), previously screened by Rodrigues et al. [44] as an excellent CA producer, and Aspergillus niger LPB BC (CCT 7716) strain. The strains, belonging to the bank of the Bioprocess Engineering and Biotechnology Department of the Federal University of Paraná, are cataloged by the Collection of Tropical Cultures, the Andre Tosello Foundation. Preliminary tests were conducted to determine the best CA producing strain. SSF was carried out in Erlenmeyer flasks containing 3.5 g of cocoa husks at 65% moisture, saline solution composed by KH2PO4 1 g/L, ZnSO4.7H2O 0.2 g/L, 4% methanol (v/v) [44] and an inoculation rate of 107 spore/ g. Flasks were kept at 30°C during 4 days. Aspergillus niger LPB B6 strain reached higher CA production (413,66 g CA/kg cocoa husks) compared to Aspergillus niger LPB BC strain (390,29 g CA/kg cocoa husks) (Table 4). Cocoa husks were used as the only carbon source and also as a solid support, proving to be a suitable substrate for CA production. Kinetics study of CA production was then followed during 168 hours of fermentation with the same conditions (Figure 4). A productivity of 13.59 g CA/ kg.h was achieved, which corresponds to a production of 978.52 g CA/kg cocoa husk. During 168 hours of fermentation, the moisture was maintained at 67% and pH fell till 3.11. This is certainly a positive factor for the process, since it is a difficult parameter to be controlled in SSF [43]. CA production reached high yields of 0.8542 g CA kg-1 of cocoa husks, which demonstrates the viability of using cocoa husks as a promising substrate in the production of biomolecules of global importance.



137

Figure 4. Time course of CA production by SSF using cocoa husks by Aspergillus niger LPB B6.

Table 4. Time course of CA production with cocoa husks by Aspergillus niger LPB B6 (CCT 7717) strain Time (h) 0 24 48 72 96 120 144 168

pH

Moisture (%)

5.55 ± 0.01 4.33 ± 0.07 3.32 ± 0.06 3.12 ± 0.04 3.10 ± 0.02 2.88 ± 0.05 3.24 ± 0.06 3.42 ± 0.02

65.83 ± 0.003 66.21 ± 0.01 68.22 ± 0.01 66.91 ± 0.005 66.99 ± 0.013 66.65 ± 0.02 65.69 ± 0.01 67.38 ± 0.003

Strain A. niger LPB BC (CCT 7716) A. niger LPB B6 (CCT 7717)

Reducing sugars (g/kg) 40.1 ± 0.006 34.3 ± 0.008 25.8 ± 0.001 19.6 ± 0.01 19.7 ± 0.01 16.6 ± 0.02 19.1 ± 0.03 21.2 ± 0.001

pH 3.30 ± 0.03 3.25 ± 0.02

Total sugars (g/kg) 48.9 ± 0.002 37.2 ± 0.003 24.7 ± 0.001 24.8 ± 0.003 24.8 ± 0.001 22.2 ± 0.004 25.7 ± 0.004 24.3 ± 0.003

Moisture (%) 64.87 ± 0.03 67.48 ± 0.003

CA production (g/kg)

Production (g CA kg-1) 390.29 413.66

CONCLUSION There is a great demand for citric acid (CA) due to its wide versatility for diverse industrial applications and low toxicity. CA production by fermentation is a well-established process using two main fermentation


138


techniques: submerged fermentation and solid-state fermentation. Both techniques were exhaustively studied; however, submerged fermentation remains the preferred technique by the industry employing the fungus Aspergillus niger. Different substrates can be used for CA production, from synthetic media to agro-industrial substrates such as cassava bagasse, citric pulp, cocoa husks, corn stover feedstock hydrolysate, waste water and others. The employment of these substrates makes the process economically attractive, mainly for agricultural countries that generate a great volume of raw materials, and with less environmental problems. Simple and effective solutions such as strain amelioration, by UV or chemical mutagenesis, co-culture of high producing strains and the use of cheap and highly available substrates can bring alternative solutions for CA production.

REFERENCES [1] [2]

[3] [4]

[5]

[6]

Citrique Belge. (2015). “Citrics.” Acessed August 7. http://www. citriquebelge.com/products/citrics. Markets and Markets. 2014. “Citric Acid Market worth 3.6 Billion USD by 2020.” Acessed August 7. http://www.marketsandmarkets. com/PressReleases/citric-acid.asp. IHS Markit. (2015). “Citric Acid” Acessed August 7. https://www. ihs.com/products/citric-acid-chemical-economics-handbook.html. Soccol, Carlos R., Vendenberghe, Luciana P. S., Rodrigues, Cristine, and Ashok Pandey. 2006. “New perspectives of citric acid production and applications.” Food Technology and Biotechnology 44: 141-149. Dhillon, Gurpreet S., Kaur, Surinder, Sarma, Saurabh J., and Satinder K. Brar. 2013. “Integrated process for fungal citric acid fermentation using apple processing wastes and sequential extraction of chitosan from waste stream.” Industrial Crops and Products 50: 346– 351. Vandenberghe, Luciana P. S., Soccol, Carlos R., Pandey, Ashok P., and Jean-Michel Lebeault. (1999). “Review: Microbial production of



[7]

[8]

[9] [10]

[11]

[12]

[13] [14]

[15]

[16]

139

citric acid.” Brazilian Archives of Biology and Technology 42: 263276. Papagianni, Maria. 2007. “Advances in citric acid fermentation by Aspergillus niger: biochemical aspects, membrane transport and modeling.” Biotechnology Advances 25: 244-263. Angumeenal, A. R., and Venkappayya, D. 2013. “An overview of citric acid production.” LWT - Food Science and Technology 50: 367-370. Grewal, H. S. and Kalra, K. L. 1995. “Fungal production of citric acid.” Biotechnology Advances 13: 209-234. Rohr, Max, and Christian P. Kubicek. 1981. “Regulatory aspects of citric acid fermentation by A. niger.” Process Biochemistry 16: 3437. Xu, Ding-Bang, Madrid, Cynthia P., Rohr, Max, and Christian P. Kubicek. 1989. “The influence of type and concentration of the carbon source on production of citric acid by Aspergillus niger.” Applied Microbiology and Biotechnology 30: 553-558. Hossain, M., Brooks, J. D., and I. S. Maddox. 1984. The effect of the sugar source on citric acid production by Aspergillus niger. Applied Microbial Biotechnology 19: 393-397. Kubicek, Christian P. and Max Rohr. 1986. “Citric acid fermentation.” Critical Reviews in. Biotechnology 3: 331-373. Pintado, J., Murado, M. A., González, M. P., Miron, J, and L. Pastrana. 1993. “Joint effect of nitrogen and phosphorus concentrations on citric acid production by different strains of Aspergillus niger grown on an effluent.” Biotechnology Letters 15: 1157-1162. Pintado, J., Lonsane, B. K., Gaime-Perraud, Isabelle, and Sevastianos Roussos. 1998. “On-line monitoring of citric acid production in solid-state culture by respirometry.” Process Biochemistry 33: 513518. Roukas, T., and P. Kotzekidou. 1987. “Influence of some trace metals and stimulants on citric acid production from brewery wastes


140

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

Luciana Porto de Souza Vandenberghe et al. by Aspergillus niger.” Enzyme Microbiology and Technology 9: 291294. Vandenberghe, Luciana P. S., Soccol, Carlos R., Prado, Flávera C., and Ashok Pandey. 2004. “Comparison of citric acid production by solid-state fermentation in flask, column, tray and drum bioreactor.” Applied Biochemistry and Biotechnology 118: 1-10. Maddox, I. S., and P. J. Kingston. 1983. “Use of immobilized cells of yeast, Saccharomycopsis lipolytica, for the production of citric acid.” Biotechnology Letters. 5: 795-798. Khare, S. K., Jha, K., and A. P. Gandhi. 1995. “Citric acid production from okara (soy-residue) by solid state fermentation.” Bioresource Technology 54: 323-325. Lima, V. L. A. G., Stamford, T. L. M., and A. A. Salgueiro. 1995. Produção de ácido cítrico utilizando Aspergillus niger em resíduo de abacaxi (Ananascomosus (L) Merril) por fermentação em estado sólido. Brazilian Archives of Biology and Technology 38: 773-783 [Production of citric acid using Aspergillus niger with ananas residue (Ananascomosus (L) Merril) Brazilian Archives of Biology and Technology 38: 773-78]. Lu, M. J. D. Brooks, and I. S. Maddox. 1997. “Citric acid production by solid-state fermentation in a packed-bed reactor using Aspergillus niger.” Enzyme Microbiology and Technology 21: 392-397. Pallares, J., Rodriguez, S., and A. Sanroman. 1996. “Citric acid production in submerged and solid state culture of Aspergillus niger.” Bioprocess Engineering 15: 31-33. Soccol, Carlos R., and Luciana P. S. Vandenberghe. 2003. “Overview of applied solid-state fermentation in Brazil.” Biochemical Engineering Journal 13: 205-218. Pandey, Ashok, Soccol, Carlos R., and Christian Larroche. 2008. “General and fundamental aspects of SSF – Introduction.” In Current developments in solid-state fermentation” Edited by Ashok Pandey, Carlos R. Soccol, and Christian Larroche, 13-25. New Delhi: Springer.



141

[25] Dawson, M. W., Maddox, I. S. and J. D. Brooks. 1986. “Effect of interruption of oxygen supply on citric acid production by Aspergillus niger.” Enzyme and Microbial Technology 8: 37-40. [26] Pandey, Ashok, and Carlos R. Soccol. 1998. “Bioconversion of biomass: A case study of lignocellulosics bioconversion in solid state fermentation.” Brazilian Archives of Biology and Technology 41: 379-390. [27] Pandey, Ashok. 1991. “Aspects of fermenter design for solid-state fermentation.” Process Biochemistry 26: 355-361. [28] Pandey, Ashok. 1992. “Recent Process Developments in Solid State fermentation.” Process Biochemistry 27: 109-117. [29] Pandey, Ashok. 1994. “Solid state fermentation: An overview.” In Solid State Fermentation, edited by Ashok Pandey, 3-10. New Delhi: Wiley Eastern Publishers. [30] Michael Mattey. 1992. “The production of organic acids.” Critical Reviews Biotechnology 12: 87-132. [31] Ikeno, Y., Masuda, Y. M., Tanno, K., Oomori, I., and N. Takahashi. 1995. “Citric acid production from various raw materials by yeasts.” Journal of Fermentation Technology 53: 752-756. [32] Pandey, Ashok., Soccol, Carlos R., Nigam, Poonam. Vandenberghe, Luciana P. S., and Radjiskumar Mohan. 1999. “Biotechnological potential of agro-industrial residues: II Cassava bagasse.” Bioresource Technology 74: 81-87. [33] Vandenberghe, Luciana P. S., Soccol, Carlos R., Pandey, Ashok, and Jean-Michel Lebeault. 2000. “Solid-state fermentation for the synthesis of citric acid by Aspergillus niger.” Bioresource Technology 74: 175-178. [34] Chemical Economics Handbook. 2015. “Citric acid.” Acessed August 8. https://www.ihs.com/products/citric-acid-chemicaleconomics-handbook.html. [35] Rodrigues, Cristine, Vandenberghe, Luciana P. S., Teodoro, Juliana; Pandey, Ashok, and Carlos R. Soccol. 2009. “Improvement on citric acid production in solid-state fermentation by Aspergillus niger LPB


142

[36]

[37]

[38]

[39]

[40]

[41]

[42]

[43]

Luciana Porto de Souza Vandenberghe et al. BC mutant using citric pulp.” Applied Biochemistry Biotechnology 158: 72–87. Lotfy, Walid A., Ghanem, Khaled M. and Ehab R. El-Helow. 2007. “Citric acid production by a novel Aspergillus niger isolate: I. Mutagenesis and cost reduction studies.” Bioresource Technology 98: 3464–3469. Ikram-Ul-Haq., Khurshid, Samina, Ali, Sikander, Ashraf, Hamad, Qadeer, M. A., M. Ibrahim Rajoka. 2001. “Mutation of Aspergillus niger for hyperproduction of citric acid from blach strap molasses” World Journal of Microbiology & Biotechnology 17: 35-37. Anastassiadis, Savas, Morgunov, Igor G., Kamzolova, Svetlana V., and Tatiana V. Finogenova. 2008. “Citric acid production patent review.” Recent Patents in Biotechnology 2(2): 107-127. Zhang, Hongjian, Xu, Jian., Su. Xianfeng, Bao, Jiawei, Wang, Ke, and Zhonggui Mao. 2017. “Citric acid production by recycling its wastewater treated with anaerobicdigestion and nanofiltration.” Process Biochemistry 58: 245–251. Xu, Jian, Su, Xian-F., Bao, Jia- W., Zhang, Hong-J., Zeng, Xin, Tang, Lei, Wang, Ke, Zhang, Jian-H., Chen, Xu.-S., and Zhong-G. Mao. 2016. “A novel cleaner production process of citric acid by recycling its treated wastewater.” Bioresource Technology 211: 645– 653. Adeoye, A. O., Lateef, A., and E. B. Gueguim-Kana. 2015. Optimization of citric acid production using a mutant strain of Aspergillus niger on cassava peel substrate. Biocatalysis and Agricultural Biotechnology 4: 568–574. Zhou, Ping-P., Meng, Jiao, and Jie Bao. 2017. “Fermentative production of high titer citric acid from corn stover feedstock after dry dilute acid pretreatment and biodetoxification.” Bioresource Technology 224: 563–572. Vandenberghe, Luciana P. S., Prado, Flávera, C., Lisboa, Camila, Paca, Jan., Pandey, Ashok, and Carlos R. Soccol. 2004. “Relation between Citric Acid Production and Respiration Rate of Aspergillus



[44]

[45]

[46] [47] [48]

[49]

143

niger in Solid-State Fermentation.” Engineering in Life Sciences 4:179-186. Rodrigues, Cristine, Vandenberghe, Luciana P. S., Teodoro, Juliana, Pandey, Ashok, and Carlos R. Soccol. 2009. “Improvement on Citric Acid Production in Solid-state Fermentation by Aspergillus niger LPB BC Mutant Using Citric Pulp.” Applied Biochemistry and Biotechnology 158: 72-87. Figueira, Antonio, Janick, J., and J. N. Bemiller. 1993. “New products from Theobroma cacao: seed pulp and pod gum.” In New Crops, edited by J. Janick and J. E. Simon, 475-478 New York: Wiley. Adomako, Daniel. 1972. “Cocoa pod husk pectin.” Phytochemistry 3: 1145-1148. Bonvehí, J. S., F. V. Coll. 1999. “Protein quality assessment in cocoa husk.” Food Research International 32: 201-208. Adamafio, N. A. 2013. “Theobromine toxicity and remediation of cocoa by-products: an overview.” Journal of Biological Sciences 13: 570-576. Thomazella, D. P., Teixeira, P. J., Oliveira, H. C., Saviani, E. E., Rincones, J., Toni, I. M., Reis, O., Garcia, O., Meinhardt, L. W., Salgado, I., and G. A. Pereira. 2012. “The hemibiotrophic cacao pathogen Moniliophthora perniciosa depends on a mitochondrial alternative oxidase for biotrophic development.” New Phytologist 194: 1025-1034.




Chapter 5

THE CULTIVATION, COMPOSITION AND USAGE OF WILD GINGER (SIPHONOCHILUS AETHIOPICUS (SCHWEINF) B.L. BURTT) Ngozichukwuka P. Igoli, PhD Centre for Food Technology and Research, Benue State University, Makurdi, Nigeria

ABSTRACT Wild ginger (Siphonochilus aethiopicus (Schweinf) B.L. Burtt) is a perennial herb of the family Zingiberaceae which is lesser known than its counterpart ginger (Zingiber officinale Roscoe). Nevertheless, it is also used as a spice and medicinally just like ginger. It improves the flavour of food and could act as a food preservative in view of its antimicrobial and antifungal properties. Additionally, it is highly prised medicinally and there is an accumulation of evidence for its usage as an antiinflammatory, anti-plasmodial, anti-thrush and an indication for allergies, asthma, candidiasis, headache, influenza, menstrual cramps, sinusitis and sore throat among other conditions. There have been investigations to optimise its cultivation since it was going extinct in the wild in certain areas mainly due to over harvesting for medicinal usage. Research to identify the active constituents, verify the pharmacological actions and to


146

Ngozichukwuka P. Igoli ascertain the potent odourants and flavour properties is also ongoing. This article thus aims at reviewing the available data on these investigations and the basis for its usage in food flavouring as well as in several diseases and conditions.

Keywords: wild ginger, cultivation, constituents, flavour, medicinal properties

1. INTRODUCTION Wild ginger (Siphonochilus aethiopicus) is a geophytic herb native to sub-Saharan Africa. It belongs to the family Zingiberaceae and as is the case with some other species in the genera Siphonochilus, its habitat is the open, semi-shaded or shaded savannas, grasslands, woodlands as well as the Lowveld Sour Bushveld of Southern Africa (Burkill, 2000; Crouch et al., 2007; Conference of the parties Johannesburg, South Africa (Cop), 2017). The genus derives its name from the Greek words siphono (tube) and chilos (lip) which describe the flower while the species is named aethiopicus, an ancient name for Africa. It has perennial tuberous roots giving rise to annual leafy pseudo-stems and the leafy shoots grow to about 35cm high after flowering (Burkill, 2000). The plant has been described as having ‘rhizoma subglobosum’ (Wood and Franks, 1911) but Hartzell, 2011 has described it as having rhizomatous corms. Additionally, the underground parts have a terrific scent of violets and ginger and the rhizomes which are spindle shaped are about 5cm by 1cm; arranged radially on lateral roots that spread fairly readily underground bearing narrowly elongate tubers (Smith, 1998; Burkill, 2000). The Nigerian variety flowers beginning from April after the early rains and the flowers, which may appear before the leaves, come up in considerable quantity followed by the leaves and the pseudo-stem (Igoli, 2009). The flowers, just borne above ground level in inflorescences separate from the leafy shoot, are purple with a white corolla tube and a yellow flare on the central petal and are 7-10cm long (Burkill, 2000). Pink-coloured fruit pods have also been observed above the ground (Igoli, 2009). The leafy shoot dries up


The Cultivation, Composition and Usage of Wild Ginger …

147

between September to December after which it falls off leaving the plant dormant till the following rainy season. The herb is found in the wild and is also cultivated locally around the Middle Belt of Nigeria (Igoli, 2009). Similarly, the Southern African variety is a deciduous aromatic plant, currently classified as Critically Endangered (CR A4acd) in South Africa (Lötter et al., 2006) and Endangered (EN A1d) in Swaziland (Dlamini & Dlamini, 2002 cited in Cop, 2017, p. 1). It grows up to 1m high and sprouts annually from the underground stem in spring as from September (Manzini, 2005; Hartzell, 2011). The leaves are glabrous and 30-400 x 5090mm in size, light green, lance shaped and borne on the end of stem-like leaf bases (Kiew, 1980; Manzini, 2005). Between September to March, it gives faintly scented flowers (bisexual or female) that are white to bright pink with yellow markings on lip, white corolla tubes 30-40mm long and tepal lobes 60 – 80mm wide (Kiew, 1980; Gordorn-Gray et al., 1989, Hartzell, 2011). They may also vary in colour from bright pink, purplepink, yellow to white with a yellow centre and are also delicately scented. Up to 25 flowers may be produced sequentially per plant over the flowering season, each usually lasting a single day with the bisexual larger than the female (Cop, 2017). However, pictures from wild plants in Mozambique suggest that more than one flower may appear simultaneously on the plant (Hartzell, 2011). Nevertheless, Siphonochilus aethiopicus is the only member of the genus that produces bisexual flowers as well as female flowers (Gordon-Gray et al., 1989) and there are reports of the inconsistent production of both the bisexual and the female flower on the same rhizome but not at the same time (Wood and Franks, 1911; Cop, 2017). The tremendously attractive flowers often appear before the leaves in spring, perhaps to allow them to be more visible to pollinators (Nichols, 1989). While self- pollination of the bisexual flowers seems likely, successfully pollinated plants produce bright maroon or plumcoloured, small, berry like fruits born below or above the ground (Gordorn-Gray et al., 1989). The seeds which are whitish and trigonous with a basal elaiosome are viable for a year (Gordorn-Gray et al., 1989; Nichols, 1989).


148

Ngozichukwuka P. Igoli

The rhizomes, tubers and roots of wild ginger are variously used for their aroma and medicinal properties by different people groups. This may be because within a species, the intensity of scent and rootstock flavour may vary, influencing traditional usage patterns regionally. This is also the case with the dried and powdered roots of Siphonochilus kirkii which are used as seasoning in Malawi with the tuber used as chicken stuffing both for spice as well as for colouring while the Tonga of the central Zambesi river show no interest as they consider it useless (Crouch et al., 2007). Thus, while wild ginger is used as a spice by the Igede people of Benue State of Nigeria (Igoli et al., 2005) and in East Africa (Cop, 2017), others mainly use them in traditional medicine. Traditionally, among the Tiv people of Benue state of Nigeria, aqueous decoctions of the roots and rhizomes of wild ginger are used to treat stomach disturbances (Igoli, 2009) and in the Republic of Benin, they are used for feminine infertility and endometritis (Noudogbessi et al., 2012). In Southern Africa, the rhizomes may either be chewed fresh or the aqueous decoctions used to relieve colds, coughs, influenza, hysteria, pain, malaria and for several other traditional and cultural practises including usage as protective charms (Holzapfel et al., 2002; Manzini, 2005; Lategan et al., 2009; Cop, 2017). Wild ginger is also used by Zulu people as a protection against lightning and snakes (Hutchings, 1989). Infusions of the rhizome and roots are antiinflammatory (prostaglandin-synthetase inhibition), bronchodilatory, smooth muscle relaxant, mild sedative, anti-candidal and are also used to treat headache, influenza, mild asthma, sinusitis, sore throat, thrush, epilepsy, hysteria and relieve dysmenorrhea (Manzini, 2005) or administered to horses as prophylactics against horse sickness (Watt & Breyer-Brandwijk, 1962). Commercialisation of wild ginger has resulted in branded tablets, tinctures and oils (some made from freeze-dried rhizomes and roots) in various dosage forms which are currently sold by companies within and outside Africa (Hartzell, 2011; Van Wyk, 2011). There are also seven international patents mostly for the treatment of asthma and allergies which involve wild ginger (Cop, 2017). Taylor et al., 2003 had reported that crude extracts of South African wild ginger were found to cause DNA damage as detected by the comet assay; nevertheless, the results were later



149

questioned as they could have been due to a non-DNA mediated process or the increased sensitivity of the assay (Verschaeve and Van Staden, 2008). This is more so as not all comet-positive tests reflect a true genotoxic effect and other assays such as: Ames, VITOTOX, Umu-C and the micronucleus test showed negative genotoxicity (Verschaeve and Van Staden, 2008). Wild ginger is in such popular demand for medicinal uses in South Africa that coupled with the method of harvesting which involves removal of the entire rhizome that it has become extinct in the KwaZuluNatal area (Viljoen et al., 2002).

2. CULTIVATION Wild ginger may be cultivated using seeds or by vegetative propagation. Moreover, the cultivation of wild ginger is a necessity due to its increasing demand and extinction or near extinction in the wild in certain areas (Cop, 2017). This threat is mainly due to over exploitation for food and medicinal purposes though natural habitat destruction through farming and urban developmental activities play roles. In response to urban demand for medicines, plants are commonly uprooted and sold (Cunningham, 1993). The result is an increasing deleterious cross-border trade of wild ginger from Swaziland, Mozambique and Zimbabwe into South Africa (Cop, 2017). However, wild ginger is exceptionally easy to cultivate and has commercial production potential (Nichols, 1989; Cunningham, 1993; Van Wyk, 2008). Nonetheless, cultivation needs to yield cheap and large quantities of material to take harvesting pressures off wild stocks and serve as a viable alternative to its over-exploitation. While the small scale commercial production of wild ginger exists at various locations in South Africa (Hartzell, 2011; Van Wyk, 2011), there is still illegal large-scale commercial exploitation from the wild to supply the herbal medicine trade (Cop, 2017). Thus, cultivation still has problems of profitability and is not competing favourably with commercial medicinal plant gatherers who are just out for profit and have no input for cultivation costs (Cunningham, 1993; Hartzell, 2011). There is therefore an urgent


150


need for the present unsustainable high levels of exploitation of wild ginger to change to large scale commercial cultivation and sustainable use. While national and international policies continue to seek ways of conserving wild ginger (Cop, 2017), research in South Africa at the Silverglen Municipal Nursery, Kirstenbosch Research Centre, University of Pretoria and the University of KwaZulu-Natal has made useful contributions towards its cultivation (Gordon-Gray et al., 1989; Nichols, 1989; Manzini, 2005; Hartzell, 2011). Gordon-Gray et al., 1989 reported that while female flowers do not produce fruits, some bisexual flowers may produce fruits and up to 15 fruits may be produced per rhizome though an average of 2 to 4 is usual. While mature fruit pods decay and disintegrate if underground, they dry and dehisce to expose seeds if above the ground. Again, up to 30 seeds may be produced per capsule and the seeds which mature 5 -8 weeks after flowering may take from 2 months to a year to germinate (Gordon-Gray et al., 1989; Nichols, 1989). These seeds may be used for cultivation especially when planted in furrows with spacing of 18cm apart and 72cm between rows (Department of Agriculture, 2009). When the germinating seedlings are given reasonable care, they are almost indistinguishable from the mature plants by the second year except for rhizome development (Gordon-Gray et al., 1989). Nevertheless, as the seedlings are susceptible to slow growth and damping off (Gordon-Gray et al., 1989; Department of Agriculture, 2009), such a method of cultivation would not yield the best harvests. Vegetative propagation is therefore, the most efficient way of cultivation given the ease of the method as well as the scarcity and long germinating period of seeds (Gordon-Gray et al., 1989; Nicholls, 1989). Tissue culture protocols which have been in use at botanical gardens and display nurseries in South Africa since the 1980s, supply unlimited numbers of plants (Nichols, 1989). Nevertheless, due to the high cost of tissue-cultured plants, this is not a viable method for most farmers (Hartzell, 2011). Cultivating rhizomes in a tropical or sub-tropical environment makes wild ginger one of the easiest plants to grow. Simple rhizome splitting without removing all the roots is recommended as the tuberous swellings



151

on the root are necessary water and nutrient storage for subsequent flower and leaf production (Nichols, 1989). Research to determine the basic parameters needed for farming wild ginger rhizomes has focussed on the appropriate rhizome size, spacing, mulching, fertiliser, irrigation, antifungal and biocontrol agents, shading requirement, the optimal time of harvesting as well as the necessary machinery among others (Manzini, 2005; Hartzell, 2011). Wild ginger prefers high temperatures and well tilled soil (Department of Agriculture, 2009) so, manual or rotavator land preparation to obtain suitably loose, friable and well- drained soil is required for cultivation (Nichols, 1989). Hartzell, 2011 reported that split rhizomes about 4 - 5cm, spaced 30cm apart in non-mulched furrows yielded better results in open-sun field trials. Also, irrigation as well as the usage of anti-fungal and biocontrol agents are recommended during the growing period (Department of Agriculture, 2009). The plant responds well to high compost levels (Nichols, 1989) and may be harvested manually or with a potato filter (Department of Agriculture, 2009). Optimal harvest time is when senescence has set in by May in South Africa (Hartzell, 2011) or by September in Nigeria. Plants grew better under a shade and were susceptible to sunburn, rust and leaf spot as well as Erwinia soft rot especially when grown in the open sun (Department of Agriculture, 2009; Hartzell, 2011). Nevertheless, it is resistant to common field diseases and pests (Nichols, 1989). Again, there have been questions as to whether elephants which are known to travel long distances to dig up rhizomes play a role in the dispersal of the plant by vegetative propagation as populations were found beneath marula (Sclerocarya birrea subsp. caffra) trees whose fruits are favoured by the elephants in Kruger National Park, South Africa (Crouch et al. 2000 cited in Cop, 2017, p. 4).

3. CONSTITUENT PHYTOCHEMICALS Principal component analysis of the volatile components of the solvent extract of the Nigerian wild ginger using GC reportedly show that the constituents are mostly sesquiterpenoids as against monoterpenoids and


152


diterpenoids. (Igoli and Obanu, 2011; Igoli et al., 2012). The essential oils of wild ginger from Benin Republic and South Africa also analysed by GC are again reported to be low in monoterpenoids and high in sesquiterpenoids. Out of seventy compounds identified in the roots and sixty in the rhizomes of the South African variety, 20% was the sesquiterpenoid, siphonochilone and that from Benin Republic containing 44 compounds had the sesquiterpenoids: curzerenone (12 - 51%) and intermedeol (8 – 31%) (Holzapfel et al., 2002; Viljoen et al., 2002; Noudogbessi et al., 2012). While β-phellandrene (35%) and β-pinene (15%) were reportedly the most abundant monoterpenes in the distillate of the solvent extract of the fresh Nigerian rhizomes, β-pinene (6-45%) was the most abundant monoterpene in the essential oil of the Benin variety, and in the essential oil of the South African variety, 1,8-cineole (9-16%) together with cis-alloocimene (7-10%) were reported as the most abundant monoterpenes (Viljoen et al., 2002; Igoli and Obanu, 2011; Noudogbessi et al., 2012). Furthermore, different sesquiterpenoids have been reportedly isolated for the different varieties of wild ginger: eudesmane sesquiterpenoids for the South African and elemane together with germacrane types for the Nigerian. Thus, five eudesmane sesquiterpenoids as shown in Figure 1: 4aαH-3,5α,8aβ-trimethyl-4,4a,8a,9-tetrahydronaphtho[2,3b]-furan-8-one (siphonochilone); 2-hydroxy-4aαH-3,5α,8aβtrimethyl-4,4a,8a,9-tetrahydro-naphtho[2,3b]- furan-8(5H)-one; 4aαH3,5α,8aβ-trimethyl-4,4a,8a,9-tetrahydronaphtho-([2,3b]-dihydrofuran-2one)-8-one; 9aβ-hydroxy-4aαH-3,5α,8aβ-trimethyl-4,4a,8a,9-tetrahydronaphtho-([2,3b]-dihydrofuran-2-one)-8-one and 4aαH-3,5α,8aβ-trimethyl4,4a,8a-trihydronaphtho-([2,3b]-dihydrofuran-2-one)-8-one were isolated as the constituents of the South African variety (Holzapfel et al., 2002; Lategan et al., 2009). However, the elemane sesquiterpenoids: curzerenone and epi-curzerenone, the germacrane sesquiterpenoids: furanodiene (8,12epoxy-1(10)E,4E,7,11-germacratetraene; isofuranodiene (8,12-epoxy1(10)E,4Z,7,11-germacratetraene and furanodienone (8,12-epoxy1(10)E,4Z,7,11-germacratetraen-6-one) together with the labdane diterpenoids: 8(17),12E-labdadiene-15,16-dial, 15-Hydroxy-8(17),12Elabdadiene-16-al, and 16-Oxo-8(17), 12E-labdadiene-15-oic acid (Zerumin



153

A) as also shown in Figure 1 were isolated from the Nigerian variety (Igoli et al., 2012; Igoli and Obanu, 2011). Again, a diarylheptanoid whose relative and absolute stereochemistry has not yet been established has also been reported from the South African wild ginger (Vela, 2008). Thus, the studied varieties from the West African countries of Nigeria and Benin Republic seem to have some similar chemical constituents while there has not yet been a report of similarity of isolated chemical constituents between the South African and the Nigerian varieties.

4. FLAVOUR EVALUATION Flavour is one of the most important attributes of food. The consumer selection and ingestion of any food depends on its flavour along with its appearance and texture (Zellner et al., 2008) and this informs the usage of wild ginger to season foods by different people groups. Flavour is also a multisensory perception originating from the brain after the interpretation of sensory inputs detected through smell, taste and the oral somatosensation / trigeminal system among other modalities (Auvray and Spence, 2008; Rolls, 2005; Laing and Jinks, 1996; Taylor and Linforth, 1996). Nevertheless, the core flavour senses are those experienced in the mouth (Stevenson, 2009; Taylor and Linforth, 1996). Though we do not experience taste in isolation, taste begins on the tongue and it is the basis for rejection or acceptance of food (Scott, 2005). Flavour which is an example of chemoreception (Durán and Costell, 1999), is a complex phenomenon due to extremely complex mixtures of many different substances and the cross-modal interactions in foods. Nevertheless, aroma is believed to be more important than taste in determining food flavour (Auvray and Spence, 2008; Taylor and Linforth, 1996) and the sense of smell is well developed in humans as we have millions of cells sensitive to odour in the nose. Thus, methods for analysing flavour components have tended to concentrate on volatile components (Taylor and Linforth, 1996). However, the identification of components responsible for a given flavour


154


1

1

O

9

2 3

CH3

15

15

10

8

5

7

4

6

3

11

8

5

7

6

H

O

14

10 4

13

H

14

Curzerenone

O

9

2

12

O 12 11 13

H3C

O

O

CH3

Furanodienone

Epicurzerenone R

CH3 O

OHC

1 R = CHO: Labdadiene dial 2 R = OH 3 R = COOH: Zerumin A

CH3

H3C

CH2

CH3

1(10)E,4E: Furanodiene (1) 1(10)E,4Z: Isofuranodiene (2)

H3C

CH3

O CH3 O

O R

CH3

R O

CH3

1 R = H: 4aαH-3,5α,8aβ-trimethyl-4,4a,8a,9-tetra O

CH3

hydronaphtho-([2,3b]-dihydrofuran-2-one)-8-one

2 R = OH:

R = H: Siphonochilone (1) R = OH (2)

CH3

CH3

O CH3 O O

CH3

CH3

4aαH-3,5α,8aβ-trimethyl-4,4a,8a-trihydrona phtho-([2,3b]-dihydrofuran-2-one)-8-one

Figure 1. Isolated compounds from Siphonochilus aethiopicus.



155

is often a difficult task as the odour-active components are to be identified among the many odourless compounds present in foods (Gallagher et al., 2008). The distinction of the more potent odourants from the volatiles having low odour activity leads to odour active compounds being arranged in an order of decreasing flavour significance in flavour analysis (Acree et al., 1984; Grosch, 1994). This requires the application of sensory techniques capable of associating flavour description with chemical composition/constituents, combining olfactometry and gas chromatography (Gallagher et al., 2008; Plutowska and Wardencki, 2008; Zellner et al., 2008). Thus, gas chromatography/olfactometry (GC/O), which combines an instrumental detector and a sensory panel for the qualitative and quantitative evaluation of the intensity of odours is a commonly used technique. Aroma extract dilution analysis (AEDA) employing the (GC/O) technique was reportedly used for the organoleptic evaluation of the odourants from the Nigerian variety together with their odour quality and quantification from GC-FID/GC-MS profiles (Igoli and Obanu, 2011). Thus, the sensory perception of wild ginger reportedly depends on a variety of odourants from the classes of: esters, monoterpenes, sesquiterpenes, aldehydes, pyrazines and thiophenes (Igoli and Obanu, 2011). The identification of most of the reported flavour components was based on a comparison of their retention indices (RI) relative to n-alkanes on two different GC column materials DB-5 and DB-FFAP with literature however, the sesquiterpene, curzerenone, was also identified after isolation. These odourants are important for the mild and pleasant aroma both in the fresh and roasted Nigerian spice as against the hot/pungent flavours of ginger and other Zingiberaceae (Igoli and Obanu, 2011). Thus, the sweet/fruity ester flavours, methyl-2-/-3-methyl butanoates, derivatives of the apple flavour were reported to be the most important odourants and character impact compounds perceived at the highest dilution of the aroma extract of the fresh Nigerian spice (Igoli and Obanu, 2011). These were reportedly followed by the monoterpene β-phellandrene which has a terpenish/woody odour and is also important for the aroma of ginger and dill (Kirk, 1991; Belitz and Grosch, 1999; Igoli and Obanu, 2011). Another


156


sweet/fruity flavour propyl-2-methylbutanoate also an apple flavour was reportedly next in importance before the roasty/earthy smelling 2isopropyl-3-methoxypyrazine and 2-isobutyl-3-methoxypyrazine which are known to have a hot/paprika taste and are also present in paprika pepper and chillies (Kirk, 1991; Belitz and Grosch, 1999; Bruice, 2007; Igoli and Obanu, 2011). Roasty/potato-like methional and the sesquiterpene, curzerenone (sweet/coconut-like), were reportedly perceived at the next significant dilution and curzerenone is also reported as a character impact compound due to its prevalence in the spice (Igoli and Obanu, 2011). In the roasted sample, terpenish/woody β-phellandrene was reported as the most important odorant followed by the roasty/earthy smelling 2isopropyl-3-methoxypyrazine and 2-isobutyl-3-methoxypyrazine before the sweet/fruity flavoured methyl-2-/-3-methyl butanoates. The pungent smelling principle 2-acetyl thiophene which is absent in the fresh sample, was reportedly perceived at the next significant dilution together with the sweet/fruity flavour propyl-2-methylbutanoate before the sesquiterpene, curzerenone (sweet/coconut like), which was perceived together with the roasty/potato-like methional at the last significant dilution (Igoli and Obanu, 2011). Therefore, twelve important odourants were reported as identified in the fresh wild ginger while thirteen were reportedly identified in the roasted spice which is preferred by the Igede people of Nigeria (Igoli et al., 2005). This preference which could be due to the prevalence of higher percentages of the roasty and pungent smelling principles in the roasted spice than in the fresh, forms the basis for the usage of wild ginger in food flavouring by the local people (Igoli and Obanu, 2011). The South African wild ginger is also aromatic and the constituent mono and sesquiterpenoids have been reported to contribute to the flavour and other properties of its essential oils (Viljoen et al., 2002).

4.1. Bioactivity Antibacterial and antifungal properties have been reported for the leaf and rhizome extracts of S. aethiopicus (Coopoosamy et al., 2010).



157

However, the activities of the ethanol extracts of the leaf are reportedly much lower than those of the rhizome extracts which inhibited Bacillus subtilis, Micrococcus kristinae, Bacillus cereus, Staphylococcus aereus, Staphylococcus epidermidis and Klebsiella pneumoniae and showed antifungal properties against Aspergillus flavus, Aspergillus glaucus, Candida albicans, Candida tropicalis, Trichophyton mentagrophytes and Trichophyton rubrum (Stafford et al., 2005; Coopoosamy et al., 2010). Thus, the reportedly similar chemical composition of the essential oils of the leaf and rhizome (Viljoen et al., 2002) may not explain this observation. Again, the antifungal activities of some of the constituents isolated from the Nigerian variety such as: epi-curzerenone and furanodienone against Candida albicans, and 8(17),12E-labdadiene-15,16dial against Candida tropicalis and Candida guilliermondii have been reported (Dolara et al., 2000; Morita et al., 1988). Igoli et al., 2012 also reported the moderate antibacterial activity of the crude rhizome extract and isolated diterpenes: 8(17),12E-labdadiene-15,16-dial and 15-hydroxy8(17),12E-labdadiene-16-al against Mycobacterium tuberculosis. The in vitro anti-proliferative properties of the essential oils of wild ginger from Benin Republic against MCF-7 cancer cells was reported by Noudogbessi et al., 2013 and, it has been suggested that the presence of antiseptic monoterpenoids contribute to its bioactivity (Manzini, 2005). Additionally, Igoli et al., 2012 reported in vitro cytotoxicity determinations for the crude rhizome extract and isolated constituents of the Nigerian wild ginger using five cell lines: SH-SY5Y, Jurkat, L929, Hep G2 and Hs 27. Epi-curzerenone and furanodienone were reportedly inactive against the five different cell lines tested while two of the diterpenes were reported to have specific cytotoxic effects. 8(17),12E-Labdadiene-15,16-dial reportedly had moderate effect on the normal cell line Hs 27 and was cytotoxic to SH-SY5Y, the cancerous Jurkat and L929. However only Jurkat and SH-SY5Y were reportedly affected by 15-hydroxy-8(17),12Elabdadiene-16-al. A pharmacological report of different South African medicinal plants used in the treatment of pain and inflammation by McGaw et al., 1997 showed that ethanolic extracts of wild ginger were found to exhibit a


158


higher inhibitory activity than indomethacin, a standard, antiinflammatory, pharmaceutical drug. Similarly, Fouche et al., 2011 reported in vitro anti-inflammatory properties and in vivo anti allergic effects of S. aethiopicus from South Africa. The diethyl ether extract of the rhizome and the isolated furanoterpenoid, siphonochilone, reportedly showed in vitro inhibition of glucocorticoid and histamine H1 receptor binding and phosphodiesterase IV activity. OVA-sensitised and challenged mice reportedly showed significantly reduced lung inflammation and reduced percentage of eosinophils in bronchoalveolar lavage fluid after administration of S. aethiopicus extracts but airway hyper reactivity was not influenced. Again, Fouche et al., 2013 reported that the extract showed significant in vitro inhibition in the NF-κB transcription response cellular assay with no cytotoxic effects (IC50 of 14.3 μg/ml) as well as immunesuppressing properties in vitro by suppressing the release of the cytokine IL-8. This suggests that an extract from this plant may be used to inhibit specific activity of the NF-κB transcription response, thereby inhibiting the release of various pro-inflammatory and inflammatory mediators that are responsible for the inflammatory pathway of asthma. These may therefore support anecdotal accounts of effectiveness against asthma, sinusitis, colds and flu (Fouche et al., 2011; Fouche et al., 2013). Zschocke et al., 2000 also reported the anti-inflammatory properties of the extracts of various parts of S. aethiopicus. The in vitro cyclooxegenase-1 (COX-1) inhibition of the stem and leaf extracts were reportedly higher than that of the rhizome. Again, Lindsey et al., 1999 screened plants used by southern African traditional healers in the treatment of dysmenorrhea for prostaglandin-synthesis inhibitors and uterine relaxing activity and reported that the highest activity was obtained with ethanolic extracts of wild ginger. High inhibition of cyclooxygenase and hence the prostaglandin pathway which should prevent uterine contraction and relieve dysmenorrhea was reported for the leaves and tubers of wild ginger. However, in vitro reduction of pre-contracted uterine muscle was reportedly not observed. Additionally, in vitro anti-protozoal properties have been observed for S. aethiopicus. Lategan et al., 2009 reported in vitro anti-plasmodial



159

activity for the ethanolic extracts and isolated eudesmane sesquiterpenoids of South African S. aethiopicus rhizomes against the chloroquine-sensitive and chloroquine resistant strains of Plasmodium falciparum. The substitution of the OH group in the sesquiterpene structure with hydrogen resulted in a three-fold increase in activity against the chloroquine-resistant strain and an introduction of a double bond further improved the activity (Lategan et al., 2009). It is suggested that the anti-plasmosdial activity is due to the furan moiety (Pillay et al., 2007; Lategan et al., 2009). The in vitro anti-trypanosomal property of S. aethiopicus was also reported by Igoli et al., 2012 against Trypanosoma brucei brucei (S427) blood stream forms in the crude rhizome extract which increased with the pure components: 8(17),12E-labdadiene-15,16-dial, epi-curzerenone and furanodienone.

CONCLUSION Overall, organoleptic studies encourage the increased utilisation of wild ginger to flavour foods. Moreover, a significant number of in vitro and laboratory animal studies support and explain the folk medicinal usage of this herb / spice. It has anti-fungal, anti-microbial, anti-inflammatory and in some instances anti-plasmodial and anti-cancer actions. As studies are increasingly determining the basic parameters needed for farming wild ginger, it is expected that the present unsustainable high levels of exploitation of wild ginger would change to large scale commercial cultivation and sustainable use.

REFERENCES Acree, T. E., Bernard, J. and Cunningham, D. G. A. (1984). A procedure for the sensory analysis of gas chromatographic effluents. Food Chemistry, 14, 273-286.


160


Auvray, M. and Spence, C. (2008). The multisensory perception of flavour. Consciousness and Cognition, 17, 1016-1031. DOI: 10.1016/j.concog. 2007.06.005. Belitz, H. D., and Grosch, W. (1999). Food Chemistry. Berlin: SpringerVerlag. Bruice, P. Y. (2007). Organic Chemistry. (5th ed.). New Jersey: Pearson. Coopoosamy, R. M., Naidoo, K. K., Buwa, L. and Mayekiso B. (2010). Screening of Siphonochilus aetiopicus (Schweinf.) B. L. Burtt for antibacterial and antifungal properties. Journal of Medicinal Plants Research, 4, 1228-1231. DOI: 10.5897/JMPR10.240. Conference of the parties, 2017. Convention on International Trade in Endangered Species of Wild Fauna and Flora. Seventeenth meeting of the Conference of the parties. Johannesburg, South Africa, 24 September – 5 October 2016. [pdf] Available from: https://cites.org/ sites/default/files/eng/cop/17/prop/060216/E-Cop17-Prop-61.pdf [Accessed: 08.06.2017]. Crouch, N. R., Smith, G. F., and Condy, G. (2007). Siphonochilus kirkii. In G. Germishuizen, E. du Plessis, and G.S. Condy (Eds.), Flowering Plants of Africa [online]. (volume 60, pp.46-50) Pretoria: SANBI. Available from: biodiversityadvisor.sanbi.org/wp-content/uploads/ 2015/11/FPA60_2007.pdf. [cited 2017.06.17]. Cunningham, B. A. (1993). African medicinal plants: setting priorities at the interface between conservation and primary health care. In People and Plants Working Paper 1. [On-line serial] Paris: UNESCO. Available from: unesdoc.unesco.org/images/0009/000967/096707E. pdf [cited 2017.06.17]. Department of Agriculture. Wild ginger [online]. 2009 [cited: 2017.06.08]. Pretoria: Department of Agriculture, Forestry & Fisheries. Available from: URL: www.nda.agric.za/docs/Brochures/wildginger.pdf. Dolara, P., Corte, B., Ghelardini, C., Pugliese, A. M., Cerbal, E., Menichetti, S. and Lo Nostro, A. (2000). Local Anaesthetic, Antibacterial and Antifungal Properties of Sesquiterpenes from Myrrh. Planta Medica, 66, 356-358. DOI: 10.1055/s-2000-8532.



161

Durán, L. and Costell, E. (1999). Revision: Percepción del gusto. Aspectos fisicoquímicos y psicofísicos [Review: Perception of taste. Physiochemical and psychophysical aspects]. Food Science and Technology International, 5, 299 – 309. DOI: 10.1177/108201329900 500402. Fouche, G., Nieuwenhuizen, N., Maharaj, V., van Rooyen, S., Harding, N., Nthambeleni, R., Jayakumar, J., Kirstein, F, Emedi, B. and Meoni, P. Investigation of in vitro and in vivo anti-asthmatic properties of Siphonochilus aethiopicus [online]. 2011[cited: 2017-09-14]. Available from: URL: http://researchspace.csir.co.za/dspace/bitstream/ 10204/5647/1/Fouche_2011.pdf. Fouche, G., van Rooyen, S. and Falaeschini, T. (2013). Siphonochilus aethiopicus, a traditional remedy for the treatment of allergic asthma. Tang International Journal of Genuine Traditional Medicine, 3, 1-6. DOI: http://dx.doi.org/10.5667/tang.2012.0040. Gallagher, M., Dalton, P., Sitvarin, L. and Preti, G. (2008). Sensory and analytical evaluations of paints with and without Texanol. Environmental Science & Technology, 42, 243-248. DOI: 10.1021/ es071555y. Gordon-Gray, K. D., Cunningham, A. B. and Nichols, G. R. (1989). Siphonochilus aethiopicus (Zingiberaceae): observations on floral and reproductive biology. South African Journal of Botany, 55, 281-287. DOI: 10.1016/S0254-6299(16)31177-2. Grosch, W. (1994). Determination of potent odourants in foods by aroma extract dilution analysis (AEDA) and calculation of odour activity values (OAVs). Flavour and Fragrance Journal, 9, 147 - 158. DOI: 10.1002/ffj.2730090403. Hartzell, J. F. Response of the endangered medicinal plant Siphonochilus aethiopicus (Schweinf) B.L. Burt to Agronomic practices. MSc. University of KwaZulu-Natal. [online]. 2011 [cited: 2017.06.06]. Available from: URL: researchspace.ukzn.ac.za/xmlui/bitstream/ handle/10413/10047.


162


Holzapfel, C. W., Marais, W., Wessels, P. L. and Van Wyk, B. E. (2002). Furanoterpenoids from Siphonochilus aethiopicus. Phytochemistry, 59, 405-407. DOI: 10.1016/S0031-9422(01)00402-2. Hutchings, A. A. (1989). Survey and analysis of traditional medicinal plants as used by the Zulu, Xhosa, and Sotho. Bothalia., 19, 111-123. DOI: 10.4102/abc.v19i1.947. Igoli, N. P. (2009). Identification of the flavour components of wild ginger (Siphonochilus aethiopicus (Schweinf) B.L. Burtt). PhD. University of Nigeria, Nsukka. Igoli, N. P. and Obanu, Z. A. (2011). The volatile components of wild ginger (Siphonochilus aethiopicus (Schweinf) B.L. Burtt). African Journal of Food Science, 5, 541-549. Igoli, N. P., Obanu, Z. A., Gray, A. I. and Clements, C. (2012). Bioactive Diterpenes and Sesquiterpenes from the rhizomes of Wild ginger (Siphonochilus aethiopicus (Schweinf) B.L. Burtt). African Journal of Traditional, Complementary and Alternative Medicine, 9, 88-93. DOI: 10.4314/ajtcam.v9i1.13. Kirk, R. S. (1991). Pearson’s Composition and Analysis of Foods. R. S. Kirk, & R. Sawyer (Eds), (9th ed). Essex: Longman. Laing, D. G. and Jinks, A. (1996). Flavour perception mechanisms. Trends in Food Science & Technology, 7, 387-389. DOI: 10.1016/S09242244(96)10049-2. Lategan, C. A., Campbell, W. E., Seaman, T. and Smith, P. J. (2009). The bioactivity of novel furanoterpenoids isolated from Siphonochilus aethiopicus. Journal of Ethnopharmacology, 121, 92-97. DOI: 10.1016/j.jep.2008.10.007. Lindsey, K., Jäger, A, K., Raidoo, D. M. and van Staden, J. (1999). Screening of plants used by Southern African traditional healers in the treatment of dysmenorrhea for prostaglandin-synthesis inhibitors and uterine relaxing activity. Journal of Ethnopharmacology, 64, 9-14. DOI: 10.1016/S0378-8741(98)00097-X. Lötter, M., Burrows, J. E. and von Staden, L. Siphonochilus aethiopicus (Schweinf.) B.L.Burtt. National Assessment: Red List of South African



163

Plants version 2017.1. [online]. 2006 [cited: 2017.10.06]. Available from: URL: sanbi.redlist.org/species.php?species=2061-1. Manzini, T. Z. Production of wild ginger (Siphonochilus aethiopicus) under protection and indigenous knowledge of the plant from traditional healers. MSc. Pretoria. University of Pretoria. [online]. 2005 [cited: 2017.06.06]. Available from: URL: http://hdl.handle.net/ 2263/27497. Mcgaw, L. M., Jäger, A. K. and Van Staden, J. (1997). Prostaglandin synthesis inhibitory activity in Zulu, Xhosa and Sotho medicinal plants. Phytotherapy Research, 11, 113-117. Morita, H. and Itokawa, H. (1988). Cytotoxic and antifungal diterpenes from the seeds of Alpinia galanga. Planta Medica, 54, 117-120. DOI: 10.1055/s-2006-962365. Nichols, G. R. (1989). Some notes on the cultivation of Natal ginger (Siphonochilus aethiopicus) [online]. Veld and Flora, 75, 92-93. [cited 2017.06.23]. Available from: URL: journals.co.za/content/veld/ 75/3/AJA00423203_1855. Noudogbessi, J. P., Yedomonhan, H., Alitonu, A. G., Chalard, P., Figueredo, G., Adjalian, E., Avlessi, F., Chalchat, J. C. and Sohounhloué, D. (2012). Physical characteristics and chemical compositions of the essential oils extracted from different parts of Siphonochilus aethiopicus (Schweinf.) B. L. Burtt (Zingiberaceae) harvested in Benin. Journal of Chemical and Pharmaceutical Research, 4, 4845-4851. Noudogbessi, J. P., Delort, L., Chalard, P., Billard, H., Figueredo, G., Ruiz, N., Chalchat, J. C., Sohounhloué, D. and Chézetquée, F. C. (2013). Anti-proliferative activity of four aromatic plants of Benin. Journal of Natural Products India, 6, 123-131. Pillay, P., Vleggar, R., Maharaj, V. J., Smith, P., Lategan, C. A., Chouteau, F. and Chibale, K. (2007). Antiplasmodial hirsutinolides from Vernonia staehelinoides and their utilization towards simplified pharmacophore. Phytochemistry, 68, 1200-1205. DOI: 10.1016/j.phytochem.2007.02.019.


164


Plutowska, B. and Wardencki, W. (2008). Application of gas chromatography-olfactometry (GC-O) in analysis and quality assessment of alcoholic beverages: A review. Food Chemistry, 107, 449-463. DOI: 10.1016/j.foodchem.2007.08.058. Rolls, E. T. (2005). Taste, olfactory, and food processing in the brain, and the control of food intake. Physiology & Behaviour, 85, 45-56. DOI: 10.1016/j.physbeh.2005.04.012. Stafford, G. I., Jäger, A. K. and van Staden. J. (2005). Effect of storage on the chemical composition and biological activity of several popular South African medicinal plants. Journal of Ethnopharmacology, 97, 107-115. DOI: 10.1016/j.jep.2004.10.021. Scott, K. (2005). Taste Recognition: Food for Thought. Neuron, 48, 455464. DOI: 10.1016/j.neuron.2005.10.015. Smith, R. M. (1998). FSA contributions II: Zingiberaceae [online]. Bothalia, 28, 35-39. [cited 2017.19.06]. Available from: URL: abcjournal.org/index.php/ABC/article/download/611/557. Stevenson, R. J. (2009). The Psychology of flavour. Oxford: Oxford University Press. Taylor, A. J and Linforth, R. S. T. (1996). Flavour release in the mouth. Trends in Food Science & Technology, 7, 444-448. DOI: 10.1016/S0924-2244(96)10046-7. Taylor, J. L. S., Elgorashi, E. E., Maes, A., Van Gorp, U., De Kimpe, N., van Staden, A. and Verschaeve, L. (2003). Investigating the safety of plants used in South African traditional medicine: Testing for genotoxicity in the micronucleus and alkaline comet assays. Environmental and Molecular Mutagenesis, 42, 144-154. DOI: 10.1002/em.10184. Van Wyk, B. E. (2008). A broad view of commercially important Southern African medicinal plants. Journal of Ethnopharmacology, 119, 342 – 355. DOI: 10.1016/j.jep.2008.05.029. Van Wyk, B. E. (2011). The potential of South African plants in the development of new medicinal products. South African Journal of Botany, 77, 812 – 829. DOI: 10.1016/j.sajb.2011.08.011.



165

Vela, N. M. Approaches to the total synthesis of a novel diarylheptanoid [online]. 2008 [cited 2017.07.05]. Available from: URL: researchspace.ukzn.ac.za/xmlui/bitstream/handle/10413/216/Vela%20 Ph%20D.pdf?sequence=1. Verschaeve, L. and Van Staden, J. (2008). Mutagenic and antimutagenic properties of South African traditional medicinal plants. Journal of Ethnopharmacology, 119, 575 – 587. DOI: 10.1016/j.jep.2008.06.007. Viljoen, A. M., Demirci, B., Baser, K. H. C. and Van Wyk, B-E. (2002). The essential oil composition of the roots and rhizomes of Siphonochilus aethiopicus. South African Journal of Botany, 68, 115116. DOI: 10.1016/S0254-6299(16)30467-7. Watt, J. M. and Breyer-Brandwijk, M. G. (1962). The medicinal and poisonous plants of Southern and Eastern Africa. (2nd ed). London: Livingstone. Wood, J. M. and Franks, M. Plantarum novarum in herbario horti regii conservatarum [online]. 1911 [cited 2017.06.24]. Available from: URL: https://archive.org/stream/mobot37153002257134#page /274/ mode/1up. Zellner, B. D., Dugo, P., Dugo, G. and Mondello, L. (2008). Gas chromatography-olfactometry in food flavour analysis. Journal of Chromatography A. 1186, 123 – 146. DOI:10.1016/j.chroma. 2007.09.006. Zschocke S., Rabe, T., Taylor, J. L. S., Jäger, A. K. and van Staden, J. (2000). Plant part substitution – a way to conserve endangered medicinal plants? Journal of Ethnopharmacology, 71, 281-292. DOI: 10.1016/S0378-8741(00)00186-0.




Chapter 6

HYDROSOLS AND FLUIDOLATES® DERIVED FROM LAVANDULA ANGUSTIFOLIA GROWN IN POLAND Krzysztof Śmigielski1, Renata Prusinowska1 and Alina Kunicka-Styczyńska2,* 1

2

Institute of General Food Chemistry, Institute of Fermentation Technology and Microbiology, Faculty of Biotechnology and Food Sciences, Lodz University of Technology, Lodz, Poland

ABSTRACT Lavandula angustifoila essential oil is recognized as the most commonly used worldwide, mainly utilized as a substantial component of flavorings in cosmetics and perfumery. Due to its antimicrobial properties, lavender essential oil of different origin serves as a valuable compound of preservative systems in cosmetic formulations. The main goal of the chapter are essential oil’s coproducts derived from Lavandula angustifolia. Obtained during lavender essential oil commercial *



168

K. Śmigielski, R. Prusinowska and A. Kunicka-Styczyńska production lavender hydrosol is rich in bioactive compounds. Hydrosol is condensate water produced during steam- or hydrodistillation of a plant material, which is often treated as wastes. Although the hydrosols contain much smaller amounts of volatile compounds in comparison with essential oils, the presence of soluble in water phytocompounds makes them useful for cosmetic industry. The chapter focuses on the unique characteristics of lavender hydrosols obtained from Polish cultavations of Lavandula angustifolia and describes a new lavender derivative fluidolate® acquired in an innovative technology relied on raw material drying. Fluidolate®, on the contrary to hydrosol, is the only water from plant material containing all volatile organic compounds lost in conventional drying processes. This product has the scent architecture of a “live” lavender. So far, the criterion of qualitative assessment of plant origin preparations was to preserve a raw material sensory characteristics at the maximum preparation volume per one mass unit of the raw material. In the studies, we demonstrate that such a philosophy of production is given to a product with a very low biological activity. In the chapter, the relationship of preparation volume acquired from the raw material mass unit for his performance, with particular regard to biological activity is discussed.

Keywords: lavender, hydrosol, fluidolate, antimicrobial activity, cosmetic preparations

INTRODUCTION Lavender Lavandula angustifolia grown in Poland is not only an interesting color accent of landscape architecture, a component of pharmaceutical preparations or decorative-floristic forms, but also a valuable plant material to obtain high-quality essential oils (KunickaStyczyńska et al., 2009; Kunicka-Styczyńska et al., 2011), hydrosols or fluidolates®, new or innovative components with both sensory functions and natural antimicrobials (Śmigielski et al., 2013; Kunicka-Styczyńska et al., 2015; Prusinowska et al., 2016). An essential oils compounds profile of Lavandula angustifolia grown in Poland, estimated by the near-infrared spectroscopy (NIR), is closest to the sensory best essential oil originated from France (the correlation coefficient 90.39%). The main compounds are linalool (26.5-34.7%),


Hydrosols and Fluidolates® …

169

linalyl acetate (19.7-23.4%), terpinen-4-ol (2.0-4.9%), α-terpineol (2.85.1%), β-ocimen (2.9-10.7%) and geranyl acetate (1.7-2.8%). In the largest quantities are derivatives of monoterpene hydrocarbons, mainly alcohols (Śmigielski et al., 2011). Performance of essential oils with fresh flowers or herb of lavender is in the range from 1.59% to 0.73%, and after the drying process of 0.88% to 0.47%. The content of essential oil in lavender complies with the criterion of the European Pharmacopoeia 8.0 (European Pharmacopeia 8.0) (1.11-1.16%) and it is at a similar level as in the raw materials of the cultivations in France (0.32-2.00%) or Bulgaria (1.251.30%) (Kara and Baydar, 2012). According to our studies, both gram-negative bacteria Pseudomonas aeruginosa ATCC 1555 and Escherichia coli ATCC1627, as well as grampositive Bacillus subtilis ATCC 6633 and Staphylococcus aureus ATCC 1803, were sensitive to lavender essential oils derived from Lavandula angustifolia grown in Poland (the MIC values 0.4-2.0 μl/ml). The oils were more active against Candida ŁOCK0008 yeast with the MICs 1.5-5 times lower. Molds Aspergillus niger ŁOCK 0436 and Penicillium expansum ŁOCK 0535 varied in sensitivity to the oils and the MIC value was 2 μl/ml for the oil from dried flowers to 5 μl/ml oil of fresh flowers or fresh or dried herb. The essential oil from the fresh herb expressed the greatest antioxidant properties (IC50 180 mg/l), and the dried herb oil was of the lowest activity (IC50 513 mg/l). As a result of the lavender essential oils isolation by hydro-distillation, another valuable component referred to as hydrosol (floral water), water with volatile organic compounds, is also produced. In the currently used technologies the only one kind of hydrosol is produced. So far, the criterion of qualitative assessment of plant origin preparations was to preserve a raw material sensory characteristics at the maximum preparation volume per one mass unit of the raw material. However, our studies have shown that the sensory and biological hydrosol properties depend on the hydrosol volume derived from the unit mass of the raw material. The aim of the work is to show the relationship of hydrosol or fluidolate® volume acquired from the raw material mass unit with his performance, with particular regard to biological activity.


170

K. Śmigielski, R. Prusinowska and A. Kunicka-Styczyńska

HYDROSOLS CHEMICAL COMPOSITION The plant material (Lavandula angustifolia L.) was originated from Poland (Wielkopolska), Herb Factory KAWON-HURT. Plant specimen identification was performed at the Quality Control Department of KAWON-HURT (voucher specimen 16/11/2 deposited in KAWONHURT, Gostyn, Poland). The hydrosols were obtained from both fresh and dried flowers and herbs by hydro-distillation method. With a certain amount of Polish lavender flower or herb before or after the drying process four types lavender hydrosols in volumes 400, 800, 1200 and 1600ml were produced. In the study, 197 g of fresh flowers corresponded to 60 g of dried flowers and 180 g of fresh herb were equivalent to 60 g of dried herb. The main chemical compounds of hydrosol variants are linalool (24.253.0%), terpinen-4-ol (2.9-8.0%), borneol (3.1-10.7%) and α-terpineol (4.1-8.8%) (Table 1 and 2) (Śmigielski et al., 2013). In the largest quantities are oxygen derivatives of monoterpene hydrocarbons, mainly alcohols. The presence of sesquiterpene hydrocarbons and linalyl acetate found in lavender essential oils (19.7% to 23.4% and 2.3%-5.1%, respectively) were not detected in hydrosols. Due to linalyl acetate hydrolysis in the technological process, linalool concentration increased. Along with an increase in fresh flowers hydrosols volume, changes in the contents of some volatile compounds: linalool (from 47.6% to 26.5%) and terpinen-4-ol (from 5.6% to 3.7%) have been noted. An increase in aerobic hydrocarbon-derived sesquiterpene - santalol (from 0.7% to 2.5%), carotol (from 0 to 2.4%) and δ-cadinol (from 1.4% to 6.5%) contents have been found. However, the hydrosols of dried flowers are characterized by a large amount of linalool oxide (18.3-23.7%). Linalool oxide, which is a linalool derivative, is a minor component of hydrosols derived from fresh flowers and fresh or dried herbs.



171

Table 1. Chemical composition of hydrosols derived from flowers of Lavandula angustifolia grown in Poland estimated by GC-MS method – liquid-liquid extraction (LLE)

No

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27

Chemical compound octan-3-one lavender lactone 1,8-cineole linalool oxide linalool oct-1-en-3-yl acetate nopinone camfor trans-pinocarveol 4-izopropylocycloheksanone verbenol neryl oxide pinocarvone cryptone terpinen-4-ol borneol lavandulol myrtenal α-terpinol isopulegol myrtenol verbenone 2.6-dimethylocta3,5,7-triene-2-ol carveol nerol 2-methyl-3phenylpropanal cumin aldehyde

Hydrosol from lavender flowers (ml) 400 800 1200 1600 fresh dried fresh dried fresh dried fresh dried (%) 1.6 1.6 0.3 0.2 2.6 0.1 8.4 0.5 0.1 0.3 0.2 0,6 0,3 0,6 0.3 0.6 4.4 2.7 2.0 2.7 4.0 3.2 0.3 3.9 1.4 18.3 1.6 18.5 2.1 25 2.1 23.7 47.6 39.2 48.0 30.5 44.5 24.2 26.5 28.3

RI log

RI lit

965 999 1017 1057 1088

952 996 1025 1080 1093

1.2

0.3

0.9

1.4

1.6

0.7

1.5

1.1

1093 1109

0.2 nd 0.1

0.3 1.3 0.4

0.4 1.3 0.3

0.3 1.3 0.5

0.3 2.7 0.5

0.3 1.6 0.5

0.3 1.0 0.5

0.3 1.5 0.5

1106 1108 1118 1121 1121 1131

nd

nd

0.8

nd

nd

nd

nd

nd

1131 1132

nd 0.2 0.4 1.0 5.6 6.6 1.6 0.3 7.5 nd 0.2 0.7

0.3 0.3 0.3 3.6 5.5 4.8 nd 0.1 7.1 0.2 0.3 0.6

nd 0.2 0.7 2.8 5.4 5.2 1.8 0.3 8.5 nd 0.2 1.3

0.3 0.6 nd 1.1 6.2 9.8 nd 0.3 8.0 0.1 0.3 0.5

nd 1.1 0.8 3.0 3.9 4.0 2.7 0.2 5.8 nd 0.4 0.8

0.3 0.7 nd 1.2 7.1 10.7 nd 0.2 6.5 nd 0.3 0.2

nd 1.2 0.9 3.1 3.7 4.6 1.0 0.2 4.1 nd 0.7 0.7

0.2 0.8 nd 1.2 6.9 8.6 nd 0.3 7.3 0.1 0.2 0.5

1127 1137 1139 1156 1168 1161 1165 1168 1173 1176 1178 1180

nd

0.4

nd

0.4

nd

0.3

nd

nd

1185 1187

0.8 0.4

0.3 0.9

0.4 1.1

0.3 nd

0.2 1.4

0.3 nd

0.1 0.4

0.3 0.1

1197 1192 1209 1209

nd

0.4

nd

0.1

nd

nd

nd

0.5

1211 1224

0.4

nd

0.6

nd

0.7

nd

0.8

nd

1215 1214


1136 1125 1140 1153 1160 1163 1167 1169 1172 1156 1180 1183

172

K. Śmigielski, R. Prusinowska and A. Kunicka-Styczyńska Table 1. (Continued)

No

28 29 30 31 32 33 34

Chemical compound

Hydrosol from lavender flowers (ml) 400 800 1200 1600 fresh dried fresh dried fresh dried fresh dried (%) nd 0.4 nd 0.6 nd 0.3 nd 0.5 nd 2.9 nd 2.0 nd 1.4 nd 1.8 0.1 nd 0.1 nd 0.8 nd 0.8 nd 0.2 0.4 0.4 2.0 0.5 0.1 1.0 0.3 2.1 nd 1.5 nd 0.5 nd 0.9 nd 0.1 0.6 0.2 1.5 2.2 0.7 0.1 1.0

RI log

RI lit

carvone 1215 1215 geraniol 1234 1232 citral 1241 1240 cuminol 1264 1266 bornyl acetate 1268 1268 lavandulol acetate 1269 1270 7a-methyl1,4,5,6,7,7nd 0.2 nd 0.3 nd 0.4 nd 0.3 1277 1237 heksahydro-2inden-2-one 35 8nd nd 0.2 nd nd nd nd nd 1364 1366 hydroksylinalool 36 verbenol 0.1 nd 0.1 nd 0.3 nd 0.5 nd 1131 1137 37 geranyl acetate 0.1 nd 0.1 nd 0.2 nd 0.4 nd 1248 1250 38 neryl acetate 0.6 0.1 0.2 0.2 0.1 0.1 0.1 0.1 1340 1342 39 2,6-dimethylocta2,6-dien-8-yl nd 0.4 nd 0.8 nd 0.4 nd 0.4 1357 1352 acetate 40 santalol 0.7 nd 1.0 nd 2.4 nd 2.5 nd 1455 1454 41 2,6-dimetyloctand 0.1 nd 0.9 nd 1.2 nd 0.7 1510 1513 2,7-diene-1,6-diol 42 carotol nd 0.1 nd 0.5 0.2 0.5 2.4 0.3 1591 1593 43 caryophyllene 0.6 0.4 0.5 1.1 0.9 0.7 4.4 nd 1580 1582 oxide 44 cubenol nd nd nd nd nd nd nd nd 1605 1605 45 δ-cadinol 1.4 nd 0.9 0.4 1.3 0.5 6.5 nd 1622 1628 Total (%) 88.3 94.1 89.5 94.3 93.0 90.5 82.0 93.0 Total organic 609 712 379 574 247 463 151 219 compounds (µg/ml) Linalool (µg/ml) 290 279 182 175 110 112 41 62 nd – not detected, RI log – experimental retention index, RI – literature retention index, GC-MS – gas chromatography with mass spectroscopy method.



173

Table 2. Chemical composition of hydrosols derived from herbs of Lavandula angustifolia grown in Poland estimated by GC-MS method – liquid-liquid extraction (LLE)

No

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23

Chemical compound

Hydrosol from lavender herbs (ml) 400 800 1200 1600 fresh dried fresh dried fresh dried fresh dried (%) 1.1 1.0 1.5 1.2 1.9 1.3 2.0 1.6 2.9 2.7 3.7 3.3 4.2 3.5 4.6 3.8 0.4 0.6 0.2 0.5 0.2 0.5 0.4 0.4 53.0 48.0 50.6 44.3 48.3 43.6 43.7 42.8 0.9 1.5 0.8 1.8 0.8 1.6 1.3 2.0 nd 0.6 nd 0.5 nd 0.4 nd 0.5 5.3 5.8 3.1 5.9 4.7 6.4 6.9 6.5 3.9 6.6 6.1 7.6 6.7 7.1 8.0 8.1 8.5 8.8 7.1 8.3 6.7 7.6 6.1 7.4 1.0 1.1 0.6 0.6 0.9 0.6 0,8 0.5 0.2 0.2 0.4 0.2 0.2 0.3 0,2 0.3 0.9 0.8 0.7 0.8 0.7 0.7 0.6 0.6 0.5 1.0 0.8 1.1 1.0 1.5 1.1 1.6 0.5 0.6 0.8 0.6 0.4 0.5 0.6 0.6 0.4 0.1 0.3 0.1 0.1 0.1 0.1 0.1 4.2 5.0 3.5 4.9 3.3 4.5 3.2 4.4 0.1 0.2 0.2 0.3 0.3 0.4 0.2 0,4 0.3 0.6 0.4 0.5 0.4 0.4 0.4 0.4 0.1 nd 0.2 nd 0.1 nd 0.1 nd 0.8 0.9 0,3 0.7 0.5 0.6 0.5 0.6 1.0 1.1 0.9 0.9 0.8 0.7 0,9 0.7 1.5 1.9 1.3 1.6 1.2 1.5 1.2 1.5

RI log

RI lit

octan-3-one 965 952 1,8-cineole 1017 1025 linalool oxide 1072 1080 linalool 1088 1093 camfor 1118 1121 verbenol 1127 1136 borneol 1161 1152 terpinen-4-ol 1168 1160 α-terpineol 1173 1172 verbenone 1180 1183 myrtenol 1192 1190 carveol 1197 1192 nerol 1209 1209 carvone 1240 1215 cumin aldehyde 1240 1238 geraniol 1234 1232 citral 1241 1245 cuminol 1264 1266 verbenol 1131 1137 β-santalol 1455 1458 carotol 1591 1593 δ-cadinol 1622 1628 caryophyllene 0.6 1.0 0.9 1.1 1.1 1.3 1.0 1.3 1580 1582 oxide Total (%) 88.1 90.1 84.4 86.8 84.6 85.1 83.9 86.1 Total organic 479 460 320 334 205 211 124 105 compounds (µg/ml) Linalool (µg/ml) 254 221 162 148 99 92 54 45 nd – not detected, RI log – experimental retention index, RI – literature retention index, GC-MS – gas chromatography with mass spectroscopy method.


174


The quantity of volatile organic compounds of hydrosols ranges from 105 µg/ml (1600 ml variant) to 712 µg/ml (400 ml variant). The main chemical compound linalool content is from 41 µg/ml (1600 ml variant) to 290 µg/ml (400 ml variant). The total volatile organic compounds in the fresh lavender flowers hydrosol 400 ml is 4 times higher than in the option with the highest volume (1600 ml) (Table 1). It was found that hydrosol 1600 ml of dried flowers is 3 times lower in volatile organic compounds and 4 times lower in linalool in relation to the variant 400 ml. Hydrosol of volume of 400 ml obtained with fresh herb is nearly 4 times richer in volatile organic compounds and linalool, and the variant of 400 ml of dried herbs is over 4 times richer in volatile organic compounds and 5 times richer in linalool than the relevant ones of 1600 ml volume (Table 2). Acidity of hydrosols expressed as pH value was from 4.1 (dried flowers) to 8.0 (fresh herb) and was stable during 9 months of storage at 4°C. Hydrosols of fresh lavender herbs showed a wide range of pH, from slightly acidic (5.4) of 400 ml variant to weakly alkaline (8.0) of 1600 ml variant. On the other hand, the pH values of the dried flowers hydrosols do not differ so much, from 4.5 to 4.1 for 400 ml and 1600 ml variants, respectively. Components with pH from slightly acidic to neutral are preferred for their usage in cosmetic formulations due to their potential compatibility with natural pH of the human skin. This criterion is met by the dried flowers hydrosols of all variants and two types of the fresh herbs hydrosols (400 and 800 ml variants), making them potential valuable compounds of cosmetics.

BIOLOGICAL ACTIVITY OF HYDROSOLS Antimicrobial activity of lavender hydrosols were tested in the concentration range 1-50% and evaluated by the macro-dilution method. The set of strains tested was composed as follows: S. aureus ATCC 1803, B. subtilis ATCC 6633, P. aeruginosa ATCC 1555, E. coli ATCC 1627, Candida sp. ŁOCK 0008 and Aspergillus niger ŁOCK 0436. The microorganisms originated from ATCC and the Collection of Pure



175

Cultures of the Institute of Fermentation Technology and Microbiology, Lodz University of Technology, ŁOCK 105. Among eight tested hydrosols obtained fron dried plant material the only 1600 ml dried herb hydrosol was not effective against any of the tested microorganisms. It should be underlined that the other hydrosols half-diluted (50%) were active against bacteria and do not inhibit fungal growth: Candida sp. yeast and A. niger mould (Table 3). Gram-positive bacteria S. aureus were the most susceptible to the hydrosols and surprisingly, even their 1% solution inhibited the growth of this bacterium. The similar effect was observed for dried herbs hydrosols (400, 800 and 1200 ml variants) against gram-negative bacteria E. coli as well as two dried flowers hydrosols (800 and 1600 ml variants) and 400 ml dried herbs hydrosol against gram-positive bacteria B. subtilis. Gram-negative bacteria P. aeruginosa, considered as the most resistant to antimicrobial agents, were intact even at the presence of 50% hydrosol solutions tested. Table 3. Antimicrobial activity of hydrosols derived from herbs of Lavandula angustifolia grown in Poland expressed as MIC (minimal inhibitory concentration) in % v/v estimated by the macro-dilution method

Microorganism Escherichia coli ATCC 1627 Pseudomonas aeruginosa ATCC 1555 Staphylococcus aureus ATCC 1803 Bacillus subtilis ATCC 6633 Candida sp. ŁOCK 0008 Aspergillus niger ŁOCK 0436

Hydrosol (ml) dried flowers dried herbs 400 800 1200 1600 400 800 1200 1600 >50 50 50 30 1 1 1 >50 >50

>50

>50

>50

>50

>50

>50

>50

1

1

1

1

1

1

1

>50

>50 >50 >50

1 >50 >50

>50 >50 >50

1 >50 >50

1 >50 >50

>50 >50 >50

>50 >50 >50

>50 >50 >50


176


Hydrosols are liquids with low concentration of biologically active compounds and in general their antimicrobial activity is not significant (Moon et al., 2006). In contrast, according to our findings some lavender hydrosols are potent antibacterial agents. However, there are examples of plant hydrosols other than lavender (thyme, oregano, savory) with considerable antibacterial activity in vitro (Sagdic, 2003; Sagdic and Özcan, 2003). The antifungal activity of hydrosols vary substantially and depends on their chemical compositions (Boyraz and Özcan, 2005; Wójcik-Stopczyńska et al., 2012). Antimicrobial activity of the tested lavender hydrosols depends on a part of the plant (flowers, herb) and hydrosol volume obtained per mass unit of the raw material (400 ml, 800 ml, 1200 ml, 1600 ml), and to a lesser extent the applied hydrosol concentration (1%, 5%, 10%, 30%, 50%). Hydrosols activity can be attributed to the presence of linalool, α-terpineol, borneol and terpinen-4-ol, chemicals with proven antimicrobial effectiveness. The variety of interactions between volatile organic compounds may also be the cause of differences in antimicrobial activity of the hydrosol variants. An important aspect in the evaluation of biological activity of components introduced to the cosmetic is the antioxidant potential. Antioxidant activity was specified by using the 2,2 acid-azynobis-3etylobenzotiazolino-6-sulphonic acid (ABTS). Dried flowers lavender hydrosol in 400 ml variant expressed the greatest antioxidant properties (22.75% inhibition) and was approximately two times more active than the variant 1600 ml and over two times more effective than some variants of fresh flowers (800 ml, 1200 ml, 1600 ml). Hydrosol 400 ml of the fresh and dried lavender herbs, were of similar antioxidant activity (14.18 and 18.82%, respectively). Antioxidant properties of the herb lavender hydrosols depend on both the total volatile organic compounds and linalool concentrations (Geun-Hye et al., 2016).



177

FRAGRANCE OF HYDROSOLS All hydrosols have the floral fragrance with a natural accent of a “live” lavender. The hydrosols obtained from flowers are described as sweet and green and the ones obtained from herbs as herbal and green. All hydrosol variants have a distinct architecture smell of lavender. Hydrosols of fresh raw material has also an active note of freshness. Respondents assessing the hydrosols stated that with the increase in the volume of hydrosol derived from raw plant material mass unit smell becomes less and less noticeable (Figure 1).

Figure 1. Oflactograms of hydrosols of Lavandula angustifolia grown in Poland: A fresh flowers hydrosols, B – dried flowers hydrosols, C- fresh herbs hydrosols, D – dried herbs hydrosols; solid line - 400 ml, dots – 800 ml, semi-line – 1200 ml, semiline and dots – 1600 ml.


178


The most sensory precious are the hydrosols of 400 ml volume variants and the least valuable are these of a volume of 1600 ml, which is justified by the total amounts of volatile organic compounds and linalool contents. Linalool is a desirable compound of any fragrance compositions giving light, refreshing, wood-floral, gentle citrus notes. Linalool levels in the hydrosols of a capacity of 1600 ml are from 4 to 7 times lower than in the other variants. It was found that the sesory quality of the hydrosol depends on its volume obtained from a mass units of the plant material. Variants of 400 ml lavender hydrosols gained a very good sensory assessment legitimatising their usefulness as an element of the cosmetic preparations, replacing water used as a base.

COSMETICS WITH LAVENDER HYDROSOLS Microbiological quality of cosmetics is a key element of safety for the user. Microbiological stability is particularly important in the case of products with a high water content, due to the risk of contamination by micro-organisms. Moisturizing body gels containing lavender hydrosols as a watery base were prepared according to the formula: extract of Aloe vera (Naturex s.c., Katowice, Poland) 40.0 g, glycerol (Surchem Sp zo.o., Lodz, Poland) 30.0 g, Carbomer Ultrez 21 (Azelis Poland sp. z o.o, Poznań, Poland) 3.76 g, SESAFLASH (glycerin, acrylates copolymer, VP/polycarbamyl polyglycol ester, hydrolyzed sesame protein PG-propyl methylsilanediol) (Seppic, Warsaw, Poland) 10.0 g, TEA (triethanolamine) (POCH S. A., Gliwice, Poland) 1.80 g, lavender hydrosol 914.44 g. The 400 ml variants of four lavender hydrosols (fresh and dry herbs or flowers) were used in formulations due to the large amount of volatile organic compounds. A challenge test (European Pharmacopoeia 5.0, 2005) was applied for the evaluation of antimicrobial activity of cosmetics and the following microorganisms were used as contaminants: S. aureus ATCC 6538, E. coli ATCC 1627, Candida sp. ŁOCK 0008 and Aspergillus brasiliensis ATCC 16404 (Kunicka-Styczyńska et al., 2015).



179

Moisturizing body gel containing dried flowers hydrosol fulfilled Criterion A for fungi Candida sp. and A. brasiliensis as well as Criterion B for bacteria E. coli and S. aureus. Pharmacopoeal 5.0 Criterion A for fungi means the reduction of the fungal contaminant inoculum by 2 logarithmic units within 14 days with no increase up to the 28th day. The Criterion B for bacteria is equal with the reduction of the bacterial inoculum by 3 logarithmic units within 14 days with no increase up to the 28th day. The fresh herb lavender hydrosol in the cosmetic formulation was satisfying Criterion B for bacteria but did not act against the tested fungal strains, which placed it under the acceptance of Pharmacopoeal limits. The chemical composition of hydrosols was substantially different but linalool was the main compound. It is worth mentioning that the most active in the cosmetic formulation was the dry flowers hydrosol, with the lowest linalool content but with quite high amounts of linalool oxide and 1,4-cineole. The fresh herbs lavender hydrosol expressing noteworthy antibacterial activity in moisturizing body gel was characterized by the highest linalool level. The preservative activity of linalool and the probable synergistic effect of linalool with other hydrosol compounds (Alviano et al., 2005, Cha et al., 2007, Gopanraj et al., 2005) may explain the obtained results. Lavender hydrosols are promising cosmetic components with a potential action in microbiological stabilization of the formulation but their real usefulness should be tested in regard to a specific cosmetics. In moisturizing body gels with lavender hydrosols no visual changes were observed during a storage, both in fast-track and in traditional trials. In the first month of storage of a reference cosmetic sample (without hydrosols), transparency deterioration was observed and after 60 days it become yellow with a dissection of the ingredients, indicating the cosmetic destabilization. In the sensory analysis, cosmetic with the fresh flowers hydrosol (with high amount of volatile organic compounds and linalool) was best assessed in terms of adhesion and spreading. The gel containing fresh herbs hydrosol gained a high rate in the assessment of distribution, and was rated as the most effective in the rate of absorption. The lowest rated cosmetic was the moisturizing body gel without lavender hydrosols (Figure 2 and 3).


180


Figure 2. Sensory analysis of moisturizing body gels with hydrosols of Lavandula angustifolia grown in Poland: solid line – a body gel withot hydrosol, dots – a body gel with fresh flowers hydrosol, thick semi-line – a body gel with fresh herbs hydrosol, semi-line and dots – a body gel with dried flowers hydrosol, thin semi-line – a body gel with dried herbs hydrosol.

Figure 3. Hedonistic analysis of moisturizing body gels with hydrosols of Lavandula angustifolia grown in Poland: solid line – a body gel withot hydrosol, dots – a body gel with fresh flowers hydrosol, thick semi-line – a body gel with fresh herbs hydrosol, semi-line and dots – a body gel with dried flowers hydrosol, thin semi-line – a body gel with dried herbs hydrosol.



181

The sensory and hedonistic testing indicate the moisturizing body gel with the fresh herb hydrosol as the most desired by consumers. This cosmetic gained the highest score in three of six distinguishing features in the sensory evaluation and in all hedonistic discriminants. Fresh herb hydrosol is characterized by the highest percentage of linalool (53%, 254 µg/ml). The cosmetic with the dried flowers hydrosol was distinguished in consistency quality, distribution, colour, feeling after application and overall rating. The chosen lavender hydrosols in cosmetic formulations meet both consumer sensory demands and may act as natural preservatives allowing to reduce or eliminate both synthetic fragrances and preservatives.

FLUIDOLATES® A new component on the market is lavender fluidolate® produced in an innovative technology of plant material drying in a closed system (Śmigielski et al., 2013; Śmigielski et al., 2014). Fluidolate ® is water containing biologically active volatile substances, condensed or resublimated from fresh plant material in a closed circuit drying agent. It should be underlined, the fluidolate® contains water originated from raw plant materials in contrast to technological water being the main ingredient of hydrosols (Catty, 2001). The process was carried out at different temperatures of the drying agent (-10°C, 10°C, 30°C or 50°C) and for various degrees of water loss (25%, 55%, 85%). 550 g lavender fresh herbs were processed to obtain from 102 to 387 ml fluidolate®, depending on the process parameters (Krempski-Smejda et al., 2015). The main compounds of the fluidolate® are linalool (38.6-83.5%), αterpineol (0.3-14.3%), lavandulol (0.4%-8.6%), coumarin (0.2%-21.8%) and octane-3-one (0.4%-4.0%) (Table 4). The percentage share of linalool in fluidolates® is much higher than in hydrosols (24-39%). In the fluidolates® small amounts of linalool acetate (up to 1.9%) were found. Interestingly, linalool acetate was not detected in hydrosols but it was


182


found in essential oils (19.7-22%). In addition, coumarin was the compound of fluidolates®, however it was absent both in essential oils and hydrosols. Fresh lavender herbs contain some phenolic acids, including coumarin acid. Probably, coumarin acid is enzymatically transformed to a cyclic ester, coumarin, through intermolecular cyclization but it undergoes hydrolysis subjected to hydro-distillation when both essential oils and hydrosols are obtained. The highest amount of linalool (above 80%) was found in the fluidolates® obtained in the drying agent temperature 50°C and 25% water loss. The fluidolates® obtained at any temperatures applied and 55% water loss were also characterized by large linalool quantities. The fluidolates ® with the highest level of coumarin (9.6-21.8%) were produced irrespective of the process temperature but the water loss established at 85%. Evaluation of the antimicrobial activity of the fluidolates® was carried out by the agar-diffusion method (Daferera et al., 2003) with the estimation of radial growth inhibition of microorganism in the medium containing the fluidolate® at the concentration 10, 20 or 30%. The following strains were used: B. subtilis ATCC 6633, S. aureus ATCC 1803, E. coli ATCC 1627, P. aeruginosa ATCC 1555, Candida sp. ŁOCK 0008 and A. niger ŁOCK 0436. Tha antimicrobial activity of the tested fluidolates ® differed depending on the fluidolate® and its concentration in the medium. The most effective was the fluidolate® obtained at the temperature of 30°C and 85% water loss with the highest coumarin content, showing the best antibacterial and antifungal properties. Complete growth inhibition of bacteria E. coli, S. aureus and fungi Candida sp., A. niger were observed at the lowest tested fluidolate® concentration (10%). The increase in the fluidolate® concentration up to 20% resulted in the inhibition of all the tested strains except for gram-positive sporeforming bacteria B. subtilis. All the fluidolates® expressed the antioxidant activity (ABTS method) in the range 51% inhibition (-10°C, 25% water loss) and 12% inhibition (50°C, 85% water loss).



183

Table 4. Chemical composition of fluidolates® derived from fresh herbs of Lavandula angustifolia grown in Poland No 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23

Chemical compound oct-1-en-3-ol octan-3-one octan-3-ol cimen cineol linalool camfor 4-izoprophylocyclohexanol borneol lavandulol terpinen-4-ol cryptone α-terpineol geraniol linalool acetate lavandyl acetate eugenol coumarin 2-hexyldecanol cubedol cadinol 7-methoksycoumarin 2-octyldodecan-1-ol

Percentage share (%) min max 0.0 3.0 0.4 4.2 0.0 2.5 0.0 1.5 0.0 1.6 38.6 76.9 0.0 0.8 0.0 0.1 0.0 5.6 0.4 8.6 0.3 14.3 0.0 0.6 0.0 0.8 0.0 0.4 0.0 1.9 0.0 0.3 0.0 2.8 0.2 21.8 0.0 1.7 0.0 0.6 0.0 3.2 0.0 5.9 0.0 1.2

The lavender fluidolates® have floral-herbal scent. The ones obtained at a temperature of 30°C or 50°C and 55% or with 85% water loss have received high scores for herbal, floral, fresh and green discriminants. The fluidolates® organoleptic evaluation rating increased with the increase in the temperature of drying agent applied (Figure 4).


184


Figure 4. Oflactograms of fluidolates® of Lavandula angustifolia grown in Poland: A – 55% water loss, B – 85% water loss; solid line – -10ºC, dots – 10ºC, semi-line – 30ºC, semi-line and dots – 50ºC.

The fluidolates® graded as the best ones in the sensory assessment were characterized by a high linalool level (63-83.5%), the compound bringing light, refreshing and wood-floral fragrance. The fluidolate® obtained in 10°C and 85% water loss was evaluated very well, especially in terms of freshness or herb determinants. The fluidolates® obtained from the fresh lavender herb (Lavandula angustifolia) grown in Poland are graded as very good in sensory quality assessment and express antimicrobial and antioxidant abilities, which points to the possibilty of their use in the cosmetic industry as biologically active natural components.

CONCLUSION Lavender hydrosols obtained from Polish cultavations of Lavandula angustifolia due to their unique characteristics are valuable compounds of cosmetic formulations. The oflactometric analysis and biological activity assessments of hydrosols indicate their potential role as cosmetic fragrances and natural preservatives. The new lavender derivative fluidolate® expressesing the scent architecture of a “live” lavender was acquired in an innovative technology relied on raw material drying. This new product is condensed or re-sublimated water from fresh plant material



185

containing biologically active volatile substances, lost in conventional drying procesesses. The fluidolates® obtained from the fresh lavender herb on the grounds of their high sensory quality as well as antimicrobial and antioxidant abilities are precious cosmetic constituents and may be used in formulations instead of pure water. The relationship of preparation volume acquired from the raw material mass unit is the measure of hydrosols and fluidolates® performance and preserve the raw plant material sensory characteristics.

REFERENCES Alviano, W. S., Mendonça-Filho, R. R., Alviano, D. S., Bizzo, H. R., Souto-Padrón T. & Rodrigues, M. L. (2005). Antimicrobial activity of Croton cajucara Benth linalool-rich essential oil on artiﬁcial bioﬁlms and planktonic microorganisms. Oral Microbiol. Immunol., 20, 101105. Boyraz, N. & Özcan, M. (2005). Antifungal effect of some spice hydrosols. Fitoterapia, 76, 661-665. Catty, S. (2001). Hydrosols: The next Aromatherapy. Rochester Vermont: Healing Arts Press. Cha, J. D., Jung E. K., Kil, B. S. & Lee, K. Y. (2007). Chemical composition and antibacterial activity of essential oil from Artemisia feddei. J. Microbiol. Biotechnol., 17, 2061-2065. Daferera, D. J., Ziogas, B. N. & Polissiou, M. G. (2003). The effectiveness of plant essential oils on the growth of Botrytis cinerea, Fusarium sp. and Clavibacter michiganensis subsp. michiganensis. Crop Protection, 22, 39-44. European Pharmacopoeia 5.0, 2005. European Pharmacopoeia 8.0, 2014. Geun-Hye, S., Hui Su, L. & Geun Hee, S. (2016). Antioxidant activity of linalool in patients with carpal tunnel syndrome. BMC Neurol., 16:17, 1-6.


186


Gopanraj, G., Dan, M., Shiburaj, S., Sethuraman, M. G. & George, V. (2005). Chemical composition and antibacterial activity of the rhizome oil of Hedychium larsenii. Acta Pharmaceutica, 55, 315-322. Kara, N. & Baydar H. (2012). Determination of lavender and lavandin cultivars (Lavandula sp.) containing high quality essential oil in Isparta, Turkey. Turk. J. Field Crops., 18, 58-65. Krempski-Smejda, M., Stawczyk, J., Śmigielski, K. & Prusinowska, R. (2015). Drying of herbal product in closed system. Drying Technol.: Int. J., 33, 1671-1677. Kunicka-Styczyńska, A., Sikora, M. & Kalemba, D. (2009). Antimicrobial activity of lavender, tea tree and lemon oils in cosmetic preservative systems. J. Appl. Microbiol., 107, 1903-1911. Kunicka-Styczyńska, A., Sikora, M. & Kalemba, D. (2011). Lavender, tea tree and lemon oils as antimicrobials in washing liquids and soft body balms. Int. J. Cosmet. Sci., 33, 53-61. Kunicka-Styczyńska, A., Śmigielski, K., Prusinowska, R., Rajkowska, K., Kuśmider, B. & Sikora, M. (2015). Preservative activity of lavender hydrosols in moisturizing body gels. Lett. Appl, Microbiol., 60, 27-32. Moon, T., Wilkinson, J. M. & Cavanagh, H. M. A. (2006). Antibacterial activity of essential oils, hydrosols and plant extracts from Australian grown Lavandula spp. Int. J. Aromatherapy, 16, 9-14. Prusinowska, R., Śmigielski, K., Stobiecka, A. & Kunicka-Styczyńska, A. (2016). Hydrolates from lavender (Lavandula angustifolia) - their chemical composition as well as aromatic, antimicrobial and antioxidant properties. Natural Prod. Res., 30, 386-393. Sagdic, O. & Özcan, M. (2003). Antibacterial activity of Turkish spice hydrosols. Food Control, 14, 141-143. Sagdic, O. (2003). Sensitivity of four pathogenic bacteria to Turkish thyme and oregano hydrosols. Food Sci. Technol., 36, 467-473. Śmigielski, K. (2012). Fluidolat. Prawo Ochronne na Znak Towarowy 242893. [Fluidolate. Trademark Protective Entitlement 242893]. Śmigielski, K., Prusinowska, R., Krosowiak, K. & Sikora, M. (2013). Comparison of qualitative and quantitative chemical composition of



187

hydrolate and essential oils of lavender (Lavandula angustifolia). J. Essent. Oil Res., 25, 291-299. Śmigielski, K., Prusinowska, R., Raj, A., Sikora, M. & Wolińska, K. (2011). Effect of drying on the composition of essential oil from Lavandula angustifolia. J. Essent. Oil Bear. Pl., 14, 532-542. Śmigielski, K., Sikora, M., Stawczyk, J., Piątkowski, M. & Krosowiak, K. (2013). Sposób suszenia świeżych surowców roślinnych. Patent R. P., P-392734. [Mode of fresh raw plant material drying. Patent R. P., P392734]. Śmigielski, K., Sikora, M., Stawczyk, J., Piątkowski, M. & Krosowiak, K. (2014). Nowy komponent preparatów kosmetycznych. Patent R. P., P218298. [New component of cosmetic preparations. Patent R. P., P218298]. Wójcik-Stopczyńska, B, Jakowienko, P. & Wysocka, G. (2012) The estimation of antifungal activity of essential oil and hydrosol obtained from wrinkled-leaf mint (Mentha crispa L.). Herba Pol., 58, 5-15.




Chapter 7

ECOLOGICAL CHARACTERISTICS OF TARA (CAESALPINIA SPINOSA), A MULTIPURPOSE LEGUME TREE OF HIGH ECOLOGICAL AND COMMERCIAL VALUE Sheena Sangay-Tucto1,2,3 and Robin Duponnois2 1

Universidad Peruana Cayetano Heredia, Facultad de Ciencias y Filosofía, Unidad de Biomineria y Medioambiente, Lima, Perú 2 IRD, Laboratoire des Symbioses Tropicales et Méditerranéennes, Montpellier, France 3 Laboratorio de EcologíaMicrobiana y Biotecnología “Marino Tabusso,” Dpto. Biología, Facultad de Ciencias, Universidad Nacional Agraria – UNALM, Lima, Perú

ABSTRACT Tara (Caesalpinia spinosa) has been cultivated for many years by managing natural forests, mainly for pod and seed extraction, and is highly appreciated for its multiple uses since ancient times. However it


190

Sheena Sangay-Tucto and Robin Duponnois has been reported that limited regeneration process resulting from excessive seed collection or grazing was detected in most of Tara stands examined in different localities in Peru. Little is known about the ecology and conservation status of Tara forests. The aims of this chapter are to review the scientific knowledge acquired on this species in order to sustainably manage the Tara plantations and increase their productivity and stability. The botanical description of this tree species as well as its ecology (geographical distribution, ecological preferences, susceptibility to pathogens and pests, etc.) will be addressed. Showing the economical values of its products and the description of the strong demands for Tara products will assess the economic importance of the Tara. Then the cultural practices used for the management of Tara plantations will be characterized. This chapter will be concluded by some recommendations to better manage the Tara plantations.

Keywords: Tara, Caesalpinia spinosa, ecology, cultural practices, economic importance

1. INTRODUCTION Tara has been cultivated for many years by managing natural forests, mainly for pod and seed extraction (Larrea, 2011). Although this tree species is highly appreciated for its multiple uses since ancient times, little is known about the ecology and conservation status of tara forests, limiting the development of sustainable management practices (Larrea, 2011). The aims of this chapter are to review the scientific knowledge acquired on this species in order to sustainably manage the Tara plantations and increase their productivity.

2. GENERAL KNOWLEDGE ON TARA The name of Tara comes from the Aymara language meaning “flattened” or “crushed” because of the shape of the sheath (Redfor, 1996; Mancero, 2009). Other denominations have been sometimes found in South America. In Peru it is also called “Taya”; in Colombia: “Dividivi of


Ecological Characteristics of Tara (Caesalpinia spinosa) …

191

cold soil,” “guarango,” “cuica,” “serrano”; in Ecuador: “Guarango,” “Vinillo,” “Campeche”; in Bolivia: “Tara”; in Chile, Venezuela and in Europe, it is also known as: “Dividi of The Andes,” “Acacia amarilla” or “Caroube del Perú” (30th JECFA, 1986). Cassieae: Dialiinae

Papilionoideae Gymnocladus Gleditsia Umtiza Tetrapterocarpon Arcoa Acrocarpus Ceratonia

Umtiza clade

Cassieae: Casslinae Pterogyne Haematoxylum, Cordeauxia, Stuklmannia, Mezoneuton, Pterolobium, Tara, Coulteria, Caesalpinia, Pomaria, Erythrostemon, Poincianella, Cenostigma, Guilandina

Pterogyne group

Caesalpinia group

Libidibia, Stahlia, Hoffmannseggia, Stenodrepanum, Zuccagnia, Lophocarpinia, Baisamocarpon, Moulavia Batesia Recordoxylon Melanoxylon

Batesia group

Moldenhawera

Moldenhawera group

Tachigali Arapatiella Jasqueshuberia

Tachigali group

Schizolobium, Bussea Peltophorum, Parkinsonia, Conzattia, Delonix, Colvillea, Lemuropisum

UNPLACED TAXA Campslandra Chidlowia Diptychandra Orphanodendron Vouacapoua

Pachyelasma Erythrophleum Dimorphandra Mora Burkea Stachyothyrsus Sympetalandra

core-Peltophorum group

Dimorphandra group

Mimosoideae

Figure 1. Diagram of relationships between genera and informal groups of Caesalpinieae based on the analyses of Polhill & Vidal (1981); Polhill (1994); Lewis & Schrire Kajita et al. (2001); Bruneau et al. (2001); Herendeen et al. (2003a & Figure(1995); 1 b); Simpson & Lewis (2003); Simpson et al. (2003). From Lewis et al. (2005).


192

Sheena Sangay-Tucto and Robin Duponnois

The scientific name of Tara is Caesalpinia spinosa (Molina) Kuntze or Caesalpinia tinctoria, in honor to Andrea Caesalpini, Italian botanist and Spinosa, from the Latin spinus-a-um, with presence of thorns (De la Cruz Lapa 2004). Tara is a tree belonging to the family Caesalpiniaceae, the order Fabales (also known as the order of legumes) (Roskov et al., 2017). As shown in Figure 1, at a taxonomic level, the closest species to Tara are Coulteria (Lewis et al., 2005) or Pterolobium stellatum in Africa.

2.1. Botanical Description Tara is a small or medium tree, which can reach a height of 15 m, highest tree recorded of 25 m (Barriga, 2017) with a diameter of 15 to 50 cm for the larger specimens (Reynel et al., 2007). Its crown can reach more than 6 meters in diameter. The stem may be unique or have several stems and shoots that are short, cylindrical or winding (Aleman, 2009) and its bark is dark brown thorny provided with triangular flattened prickles (Reynel et al., 2007), with a dense wood. Its leaves are composed, bipinnate, alternating, arranged in spiral, of about 8 pairs of small leaflets with thick and waxed cuticle, of a total length of around 11 cm. The flowers are gathered in bunches of about 20cm long (Aleman, 2009) with 40 to 100 hermaphrodite flowers having a cup 5 petals and a corolla of 5 yellow sepals with red spots, 10 stamens and a bent pistil extending in an ovary (Fosefor-Intercooperation-Samiri, 2006). Tara blooms from September to March and the fruits are harvested from March to September according to rainfall or areas (Aleman, 2009). In some areas and in plantations, it is possible to have two harvests per year, with 5 months between the tara blooms to the fruit harvesting (Barriga, 2017). The fruits are indehiscent pods (Figure 2), flattened and recurved, 5 to 10 cm long and 1 to 3 cm wide, going from green to red in the course of maturation, weighing 2 to 5 grams and the composition (mass) is approximately: Seed: 40%, Shell: 38%, and endosperm: 22% (Pastor, 1977; Coppen, 1995). They contain up to 10 coffee brown seeds when ripe and have a waterproof



193

wax coated epidermis (Fosefor-Intercooperation-Samiri, 2006; Aleman, 2009). The number of seeds per kilogram of pods fluctuates between 3000 and 4500 (Peñarrieta & Aleman, 2009). The root system is composed of taproots that can penetrate the ground up to 5 m (Aleman, 2009) and numerous secondary roots. The prospected surface can reach up to 10 square meters (De la Cruz Lapa, 2004).

Figure 2. Pods of Tara (Sangay, S.).

2.2. Ecology 2.2.1. Geographical Distribution Caesalpinia spinosa, this native tree from the Peruvian Andes, has perfectly adapted to the climate of the rest of South America, between 4°N and 32°S, from Venezuela to northern Chile (Narváez et al., 2009; Mancero, 2009). Its predilection area is located on the Atlantic slope between 800 and 2800 m (Melo et al., 2013) and the Pacific slope between 1600 and 2800 m. However, on the western slope of the Andes mountain range and within the inter-Andean valleys, it can be found up to 3200 m.


194


above sea level while Tara has also been recorded within the "cloud forests" at 500 m.a.s.l (Barriga, 2008). Caesalpinia spinosa has been introduced and is cultivated in northern and eastern Africa, United States, Brazil and Argentina (Macbride, 1943; Duke, 1981; Brako & Zarucchi, 1993; Coppen, 1995; Ulibarri, 1996; Jørgensen & León-Yánez, 1999).

2.2.2. Ecological Preferences Tara is a xerophytic species, which means that it is well adapted to dry environments. We find Tara within zones where the rains vary between 230 and 500 mm/year. However, its optimum development requires an annual rainfall of 400 to 600 mm, as it is the case in plantations (De la Cruz Lapa, 2004; Nieto & Barona, 2007; Barriga, 2008). The success of Tara in the particular case of cloud forests (high cloud immersion rate) comes from its ability to intercept cloud water. Tara is found within regions where average annual temperatures vary between 12°C and 20°C, with an optimum range of 16°C within the valleys (De la Cruz Lapa, 2004). According to Villanueva (2007), the presence of Tara is primarily the result of weather conditions (which are heavily dependent on altitude), largely irrespective of the origin and soil quality. In such a way that Tara can grow on clayey, loamy, or sandy soils. In most cases, it is found on top soils and soils with high stoniness which are not suitable for agricultural activity (De la Cruz Lapa, 2004; Nieto & Barona, 2007; Barriga, 2008). In addition, we can find it on degraded soils suggesting that Tara is an interesting plant for the ecological restoration of soils. 2.2.3. Pathogens and Pests Tara is very resistant to pathogens and pests. However, Bustamante & Bustamante (2009), cited in the thesis of Polo Villanueva (2016) indicate that pests of Tara are mainly insects and mites belonging to the orders of Lepidoptera, Diptera, Homoptera, Orthoptera, Acarina. The aphids (Aphis craccivora) attack the leaves, flowers, green pods and stem; the maggots, Pinnaspis sp. and Icerya purchasi attack branches and stems; and the whitefly of the Aleurodidae family, which is a sucking-biting insect that



195

attacks the underside of the leaves producing sugary secretions that are associated with the fungus called “sooty mold.” Ants and aphids attacks are a problem in certain regions (Novoa & Ramirez, 2007; Mancero, 2009). The appearance of pests often depends on the association of Tara with other crops (as in the case of custard apples, citrus, avocado, olive and mango (Polo Villanueva, 2016), beans, beets, cucurbits, brassicas, peanuts (Sánchez & Vergara, 2003); tomato, potato, marigold, alfalfa, lima beans and squash (Villanueva, 2007), cited in the thesis of Polo Villanueva (2016). The most common diseases are due to Fumagina, Oidium (De la Cruz Lapa, 2004; Mancero, 2009) and Rhizoctonia molds (Mancero, 2009). Epiphytic plants of the genus dodder can parasitize the Tara by gradually "asphyxiating" it, especially in natural forests (Mancero, 2009). It is the case of the "pacha pacha" that adheres to the pods and forms the "angel hair" or to the huijunto and túllanla that wraps around the branch (De la Cruz Lapa, 2004).

2.2.4. Ecological Community/Habitats In natural forest, in arid and semiarid areas, Tara is often associated with other shrub species such as Schinus molle (Molle), Prosopis laviegata, Acacia macracantha, Acacia visco, Opuntia sp.,ficus indica, Dodonaea viscosa, Jacaranda mimosifolia, Baccharis sp., (Aleman, 2009) and grasses of the genus Eragrostis, Chloris, Pennisetu, clandestinum, Cynodon dactylon, Calliandra sp., Rubus sp., Croton sp., among others (De la Cruz Lapa, 2004; Aleman, 2009; Marien & Delaunay, 2010). Within cloud forests, it is found in association with 80 species grouped in 37 families and notably endemic plants (Cano et al., 1999). In the lomas ecosystem, an archipelago of fog oases in the Peruvian Coastal Desert, the predominant specie is Tara (Moutarde, 2008; Balaguer et al., 2011). The Tara is commonly used in agroforestry because it exerts very little competition with other agricultural crops because its pivoting roots prospect the soil in depth (whereas the roots of agricultural crops develop mainly in the superficial layers of the soil) and also, because of its sparse crown, it allows the light to pass through. Therefore it is often planted with other agricultural species such as tunas, Opuntia ficus-indica, for growing


196


cochineal. Tara can also be associated with various other crops as Saccharum officinarum (sugar cane), Zea mays (maize), Pisum sativum (green peas) (Ermis Vigo & Quiroz, 2006; Aleman, 2009; Mancero, 2009), Phaseolus vulgaris (bean) (Aleman, 2009), Solanum tuberosum (potato), Vicia faba (broad beans), Medicago sativa (alfalfa), Sorghum spp (sorghum). It is also possible to find it as isolated trees in the fields of cereals (wheat, barley) (Aleman, 2009; Mancero, 2009). The surfaces of agricultural plots are very small (usually less than 1 ha) and so could resemble a living fence system (Marien & Delaunay, 2010) within which Tara can play the role of barrier (Mancero, 2009). We also find it associated to orchards of Malus domestica (apple), Pyrus spp. (pear), Prunus persica (plum) (Aleman 2009) and Annona cherimolia (cherimoya) (Chuquiruna & Germán, 2010). Persea Americana (avocado) orchard benefits from the attractive tara flowers by increasing the presence of bees, pollinating the less attractive avocado flowers.

2.3. Uses and Trade Tara was used by the pre-Inca and Inca populations for the elaboration of dyes for the textile or ceramics, in the tannery and also even for medicinal purposes. Currently, Tara is a multi-use species (firewood, agricultural tools, carpentry, fruits, fodder, fencing) (Marien & Delaunay, 2010). For the past 15 years, it has been an economic interest spot for the economic value of its products, mainly food gum from its endosperm and tannins from the pod for the industry. Tara tannins are easily hydrolyzable by the action of tannase enzyme (Alvarez & de Ugaz, 1992). These tannins are used in the leather industry because of its tannic power, which allows a wide variety of light-colored leathers, which differ in terms of flexibility and high resistance (De la Cruz Lapa, 2004; Barriga, 2017). The greatest advantage of the Tara tannin is its natural origin, thus avoiding resorting to the use of industrial chrome, particularly toxic during tanning (Michiels, 2013). For these reasons, once



197

leathers are dyed, they are destined for the luxury market. According to the requirements of international demand, the ideal concentration of tannins in pods of Tara is located between 58% and 62% (Mancero, 2009). In the tanning industry, other vegetable tannins are in competition with the Tara, as is the case of "Quebracho" (Schinopsis spp) from Argentina, or chestnut (Castanea sativa) or “Mimosa” Acacia mollisima. To extract the tannin from these species, the bark and/or wood of the tree is used, sacrificing the whole tree, unlike Tara whose tannins come from its pods. Tannin production does not destroy the trees and production has to be more sustainable (Mancero, 2009). Tara gum is a white to yellowish-white powder consisting essentially of galactomannan type polysaccharides. This is used as a thickener and stabilizer in various food applications (Coppen, 1995). Since 1995, Tara gum has been recognized internationally as an additive (E417) for the production of ice cream, gelatin, sauces, yogurt, bakery products, and meat products. Its cost is higher than starch or gelatin, but much less is needed, and Tara gum does not affect taste or color as other gums that come from exudates of forest species (Michiels, 2013; Barriga, 2017). Thus, Tara gum has entered the hydrocolloids world market as an alternative gum product to Caroubier (Ceratonia siliqua), produced in Spain and the Middle East (De la Cruz Lapa, 2004), although its main competitor in price and use is Guar gum (Cyamopsis tetragonoloba) (Barriga, 2017). The strong demand for Tara and its derivatives is growing steadily: if in 2003 it reached 42300 tons, in 2008 it reached 49000 tons (Flores et al., 2005). This leads to a rise in prices, so in 90’s the price of the tara increased to US $ 1050 /t from what was previously at US $ 350 / t. In 2002, the price still rose and remained above US $ 1100 /t. Currently, the national production of 38000 t of tara in the pod is 75% of which comes from natural forests and 25% from plantations (Barriga, 2017). The current average price of Tara’powder is US $ 1450 /t and Tara gum, with an average price of US $ 3400 /t (Barriga, 2017). From 2015 to 2016, exports grew by 11%. The main importers were Argentina, Switzerland, and the United States (Table 1). Tara gum exports increased by 114% over the previous year to 2800 tonnes, generating $ 8.9


198


million in revenue for Peru. In 2016, it was possible to export US $ 51 million dollars (Barriga, 2017). Table 1. Major importing countries of flour of pods of Tara from Peru to 2015 (expressed in kilograms and dollars) (According to Peru Forestales en Numeros, 2015) Country Argentina Switzerland United States Belgium Italy Brasil Germany Uruguay France Austria Mexico

Quantity (Kg) 1 056,500 1 007,270 1 070,201 736,1 735,075 475,5 363,625 350 278 161,837 54

US$FOB 1 179,820 442,706 1 153,252 844,836 828,005 559,56 422,292 379,26 336,4 191,74 57,9

The reference price in FOB dollars of 1 kg of Tara sheath powder is 1.48 (Koo, 2017) and Tara seed gum powder of 3.44 (Barriga, 2017). To meet this demand, Peru has 6 000 ha of Tara surface (ATFFSSERFOR, 2014) cited in Agronoticias (2016), of which 22% are new plantings. The main producing departments are Huánuco (24% of production), La Libertad (18% of production), Ayacucho (17.5%) and Cajamarca (14% of production). The other departments constitute 26% of domestic production (ATFFS-SERFOR, 2014) cited in Agronoticias (2016). In Cajamarca, in some years, the harvest per tree has progressed approximately 45%. Revenues for workdays of more than 6000 producers in the region have risen from 0.85 dollar per day to $ 3.15 per day (Michiels, 2013). Tara plays a major part in generating revenue. However, much of the international demand remains unsatisfied and there is currently a strong interest to increase production by creating new plantations of Tara (Aleman, 2009).



199

Besides its two main uses, Tara seed is also a source of edible due to its content in oleic and linoleic oil (in butter, margarine and liquid oil), protein flours, soaps, paints, varnishes, enamels dyes, etc. Gallic acid, extracted from Tara, can be used as an antioxidant and as bleaching agent in the industrial production of oil or beer. In medicine, gallic acid is an active molecule in drugs to treat gastric ulcers but also as healing, anti-inflammatory, antiseptic, antibacterial, anti-ascorbic and antidysenteric agent (Lewis et al., 2005; Mancero, 2009). Tara wood is used for rural constructions, in the making of tool handles, or as firewood due to its high density that gives it the heat property (calorific value = 7000 cal/Kg) (Padilla, 1995, Lojan, 1992) cited by Flores et al. (2005). Within the urban landscape, Tara represents an ornamental tree, for the beauty of its flowers (Villanueva, 2007).

2.4. Cultivation of Tara In natural forests of Tara, forestry does not really exist. The harvest of its fruits resembles more to a process of handmade harvesting, although there are efforts to carry out a forest management plan. At the moment, most of the production comes from these forests and 25% from managed plantations.

2.4.1. Management of Natural Forests Generally speaking the natural forests of Tara are completely neglected: full of weeds, shrubs and trees, all of them in abundant density competing for nutrients, water and light. Cleaning should start by removing weeds, shrubs and trees from the root, thus allowing a greater proportion of light. A thinning should also be practiced, which consists of the final elimination of weaker or too close plants, ensuring adequate spacing between the best plants. Then, the pruning is done, which is the cutting of branches to obtain a better production of the plant. It is recommended to do it before the beginning of the rainy season and depending on the state of each plant. Subsequently, the parasite and host plants (achupallas, tuyos,


200


salvajina, lichens) that are in the branches of the crown of the tree or in its stem should be eliminated. It is necessary to control pests and diseases correctly, followed by preparation of the soil to reduce erosion and finally a suitable manuring (Ermis Vigo & Quiroz, 2006). It has been reported that in the case of wild plants grouped in small areas or isolated, their production reaches up to 10 kg/plant that could increase with proper irrigation and fertilization (De la Cruz Lapa, 2004).

2.4.2. Management of Tara Plantations For the establishment of plantations, it is necessary to take into account several aspects such as: the place of planting, density, preparation of the ground, installation of seedlings and replanting. Plantations must be made at the beginning of the rainy season, in the case of planting in semiarid areas, it is necessary to take provisions to improve water infiltration into the soil (De la Cruz Lapa, 2004). The management of Tara plantations consists of pruning when it reaches a height of 70 cm that consists of a cut to stimulate the production of pods. The irrigation of the plantation should be carried out with a frequency of at least 3 to 4 times per month. It is recommended to fertilize the soils after a year of planting just before the start of the first rains. The type of management in agroforestry systems consists of pruning in the first years, avoiding the laying of the stem, controlling pests and/or diseases. The recommended spacing is 4 x 5 m, which can be found between 500 and 600 plants per hectare (De la Cruz Lapa, 2004). 2.4.3. Performance Tara in Peru has a great variability of production, because there are trees that produce 5 kg and others that produce 40 kg. Those that are isolated, very large and with a good availability in water can produce 120 kg/year. However, tannin content and the amount of gums also vary among plants (Barriga, 2008). The yield per tree of Tara is on average 20 kg to 40 kg of pods, with two harvests per year (De la Cruz Lapa, 2004). Pods are harvested when they become ripe and dry the moment they turn red. They are then dried in the sun before being processed. In general, the first



201

harvest of Tara within managed plantations is performed from the third year, in the natural state it is performed at the fourth year. Although the first harvest can be given in the second year, this is minimal (Barriga, 2017). Their average life span is 100 years (De la Cruz Lapa, 2004), a productive tree is estimated to 35 years (Aleman, 2009). The yield at the industrial level, for every 100 kg of harvested Tara pods, is between 60 and 64% of Tara powder, between 34 and 38% of seeds and 2% of residues (Sanchez, 2007) cited by Mancero (2009).

2.4.4. Concentration of Tannins in Tara Narváez et al. (2009), after evaluating a population of Tara in Ecuador, concluded that the production of tannins is a genetically determined factor and therefore independent of the interaction with the environment. However, in Peru, it has been possible to differentiate various ecotypes producing pods of different qualities. The pod contains up to 2.8% of proteins, 73% of carbohydrates, 60 to 70% of tannins, while the seeds contain 19% protein, 67% carbohydrates, 4% tannin and energetic values of the pod and Tara are of 318-400 kcal/100 g, respectively (Aleman, 2009). Thus, on less acidic soils Tara has a higher concentration of tannins (Mancero, 2009). It has been found that, within the natural distribution, the best tannin quality is obtained from Ayacucho, where the soils are alkaline. With an annual rainfall of 600-650 mm, the amount of tannin is 60% to 62%, while in Cajamarca, with slightly acid soils and higher precipitation (900 to 1100 mm) the amount of tannin varies from 48% to 52%. For the hills of southern Peru (Ilo-Lomas de Tacahuay) tannins on the order of 48% (Barriga, 2008) were obtained. From the industrial point of view, tara powder gives between 45 and 50% of tannin extract, and from seeds it is obtained about 24% of Tara gum (Sanchez, 2007) cited by Mancero (2009). Desirable and selectable features that improve Tara, are the high amount of high tannins and an intense production of pods (Narváez et al., 2009). The improvement should focus on the higher production of fruits with greater production of gums and tannins.


202


CONCLUSION Although the knowledge gained on Tara shows that this tree species is of great ecological and economic importance, there are still many gaps that need to be filled in order to define cultural practices capable of ensuring productivity and stability of Tara plantations. In particular, it will be necessary to implement agro-ecological practices in order to limit inputs of chemical inputs into Tara plantations. The microbial resources of the soil can ensure the mineral nutrition of the Tara (e.g., mycorrhizal fungi) but knowledge about the mycorrhizal status of the Tara in its natural area is practically non-existent. Hence research must be undertaken in order to control certain natural components of the ecosystem likely to affect the development of Tara.

ACKNOWLEDGMENTS I would like to thank Vivien Bonnesoeur and Cesar Barriga, for their valuable contributions and comments in this bibliographical synthesis. I would like also to thanks Doris Zuñiga for having welcomed me in her laboratory.

REFERENCES Agronoticias (2016). TARA.pdf. N°. 423. 16-20 pp. Lima. Aleman, F. (2009). La tara Caesalpinea spinosa (Mol.) O. Kuntze, especie prodigiosa para los sistemas agroforestales en valles interandinos. Acta Nova. 1er Congreso Nacional de Sistemas Agroforestales. Vol. 4, N° 2-3 Caesalpinia spinosa (Mol.) [O. Kuntze, prodigious species for agroforestry systems in inter-Andean valleys. New Act. 1st National Congress of Agroforestry Systems.] Vol. 4, No. 2-3.



203

Alvarez, C. A. and de Ugaz, O. L. (1992). Taninos. Rev Quím 6:47– 63.Universidad Pontificia Católica del Perú. Balaguer, L., Arroyo-García, R., Jiménez, P. and Jiménez, M. D. (2011). Villegas L., Cordero I., Rubio de Casas R., Fernández-Delgado R., Ron M. E., Manrique E., Vargas P., Cano E, Pueyo J., Aronson J. Forest restoration in a fog oasis: evidence indicates need for cultural awareness in constructing the reference. PloS One 6:e23004. doi: 10.1371/journal.pone.0023004. Barriga, C. (2008). Cultivos y aprovechamiento de la tara Caesalpinia spinosa en la región andina (documento de trabajo). ECOBONA. Lima. [Lima Cultivation and use of Caesalpinia spinosa in the Andean region (working document).] ECOBONA. Lime. Brako, L. and Zarucchi, J. L. (1993). Catalogue of the Flowering Plants and Gymnosperms of Peru. Syst Bot Mo Bot Gard 45:1–1286. Cano, A. C., Roque, J., Arakaki, M., Arana, C., La Torre, M., Llerena, N. and Refulio, N. (1999). Diversidad florística de las Lomas de Lachay (Lima) durante el evento “El Niño 1997-98.” Rev Perú Biol 6:125–132 [Floristic diversity of Lomas de Lachay (Lima) during the event “El Niño 1997-98.”] Rev Peru Biol 6: 125-132. Chuquiruna, D. and Germán, P. (2010). Forestación piloto con la tara en la microcuenca de San Juan (Alto Jequetepeque) Cajamarca. Tesis para optar el título profesional de Ingeniero Industrial. Universidad Nacional Mayor de San Marcos. [Lima Forestation pilot with the tara in the San Juan micro watershed (Alto Jequetepeque) Cajamarca. Thesis to choose the professional title of Industrial Engineer.] National University of San Marcos. Lime. Coppen, J. J. W. (1995). Non-wood forest products. Gums, resins and latexes of plant origin. Food and Agriculture Organization of the United Nations. ISBN 92-5-103757-4. Rome. De la Cruz Lapa, P. (2004). Aprovechamiento integral y racional de la tara Caesalpinia spinosa - Caesalpinia tinctoria. Rev Inst Investig Fac Ing Geológica Minera Met Geográfica, 7: 64-73. [Comprehensive and rational use of the Caesalpinia spinosa - Caesalpinia tinctoria.] Rev Inst Investig Fac Geological Met Geographical Met, 7: 64-73.


204


Duke, J. A. (1981). Caesalpinia spinosa. In: Handbook of Legumes of World Economic Importance, Plenum Press. New York. Ermis, V. and Quiroz, V. (2006). Manual El cultivo de Tara en Cajamarca. Programa Desarrollo Rural Sostenible de la Cooperación Técnica Alemana - GTZ, en colaboración con la Asociación Civil Tierra. Cajamarca. Perú. [The cultivation manual of Tara in Cajamarca. Sustainable Rural Development Program of the German Technical Cooperation - GTZ, in collaboration with the Earth Civil Association.] Cajamarca. Peru. Flores, F., Chávarry, L. and Vega, D. (2005). Criterios y pautas para la selección de arboles plus. Caesalpinia spinosa (Molina) Kuntze “tara” o taya.” [Criteria and guidelines for the selection of trees plus. Caesalpinia spinosa (Molina) Kuntze “tara” the taya.”] Fosefor-Intercooperation-Samiri. (2006). La Tara en el Ecuador. Caesalpinia spinosa. Cartilla técnica. [The Tara in Ecuador. Caesalpinia spinosa. Technical card.] Universidad Técnica del Norte, ESPOCH, Fundación Arco Iris. Ecuador. JECFA Joint FAO/WHO Expert Committee on Food Additives. 30th report. (1986). Jørgensen, P. M. and León-Yánez, S. (1999). Catalogue of the vascular plants of Ecuador. Syst Bot Mo Bot Gard 75:1–1182. Koo, W. (2017). Tara en Polvo archivos. [ Tara in Dust files.] In: Agrodataperu. https://www.agrodataperu.com/category/exportaciones/ tara-en-polvo-exportacion. Accessed 23 May 2017. Larrea, M. (2011). La tara, guarango o taya (Caesalpinia spinosa) en la Región Andina: criterios ambientales para la sustentabilidad de su aprovechamiento y manejo en Bolivia, Ecuador y Perú. Ecobona, Serie de Capacitación No. 5. Programa Regional Ecobona-Intercooper, Quito, Peru. [Tara, guarango or taya (Caesalpinia spinosa) in the Andean Region: environmental criteria for the sustainability of their use and management in Bolivia, Ecuador and Peru. Ecobona, Training Series No. 5. Ecobona-Intercooper Regional Program, Quito, Peru.]



205

Lewis, G., Schrire, B., Mackinder, B. and Lock, M. (2005). Legumes of the World. Royal Botanic Gardens, Kew. ISBN 1900347806 9781900347808. UK. Bath Press. Macbride, J.F. (1943). Leguminosae, Flora of Peru. Field Mus Nat Hist Bot 13(3/1): 1-506. Mancero, L. (2009). La Tara (Caesalpinia spinosa) en Perú, Bolivia y Ecuador: Análisis de la Cadena Productiva en la Región. Programa Regional Ecobona-Intercooperation, Quito. Quito, febrero 2009. La Tara (Caesalpinia spinosa) in Peru, Bolivia and Ecuador: [Analysis of the Productive Chain in the Region. Ecobona-Intercooperation Regional Program, Quito. Quito, February 2009.] Marien J. N. and Delaunay, G. (2010). La tara, Caesalpinia spinosa: espèce agroforestière emblématique des vallées interandines au Pérou. [The tara, Caesalpinia spinosa: an emblematic agroforestry species of the interandine valleys in Peru.] Bois for Trop, 2: 8-12. Melo, M., Glorio, P. and Tarazona, G. (2013). Revista de la Sociedad Química del Perú - Efecto de la madurez en los componentes de valor comercial (taninos y goma) de tara Caesalpinia spinosa (Molina) Kuntze. Rev. Soc. Quím. Perú vol.79 no.3 Lima jul./set. 2013. [Journal of the Chemical Society of Peru - Effect of maturity on the components of commercial value (tannins and gum) of tara Caesalpinia spinosa (Molina) Kuntze. Rev. Soc. Peru vol.79 no.3 Lima jul./set. 2013.] Michiels, C. (2013). Tara, un petit arbre porteur de grandes promesses. Un produit équitable pour l'industrie? Bruxelles. www.issuu.com/tradefor developmentcentre/docs/tara_petitarbregrandespromesses. [Tara, a small tree carrying great promises. A fair product for the industry? Brussels]. Moutarde, F. (2008). Les lomas péruviennes et chiliennes. Fiche 39.197 199 pp. Chapitre Freiner l'évaporation et retenir les brouillards. Agricultures singulières.IRD éditions. Paris. [Peruvian and Chilean lomas. Sheet 39.197 199 pp. Chapter Curb evaporation and retain fog. Singular agriculture. IRD editions. Paris].


206


Narváez, A, Calvo, A, Troya, A.M. (2009). Las poblaciones naturales de la tara (Caesalpinia spinosa) en el Ecuador: una aproximación al conocimiento de la diversidad genética y el contenido de taninos por medio de estudios moleculares y bioquímicos. Serie Investigación y Sistematización N°. 7. Programa Regional Ecobona-Intercooperation 23. Laboratorio de Biotecnología Vegetal. Escuela de Ciencias Biológicas Pontificia Universidad Católica del Ecuador PUCE. Quito. [The natural populations of tara (Caesalpinia spinosa) in Ecuador: an approach to the knowledge of genetic diversity and tannin content through molecular and biochemical studies. Research and Systematization Series N°. 7. Ecobona-Intercooperation Regional Program 23. Plant Biotechnology Laboratory. School of Biological Sciences Pontificia Universidad Católica del Ecuador PUCE. Quito]. Nieto, C. and Barona, N. (2007). El guarango. Una opción agroindustrial y de exportación para conservación productiva. Fundación Desde El Surco Quito Ecuador 1–20. The guarango. [An agroindustrial and export option for productive conservation. Foundation from El Surco Quito Ecuador 1-20]. Novoa, S. and Ramírez, K. (2007). Evaluación del estado de conservación de la Tara Caesalpinia spinosa en el departamento de Ayacucho. [Evaluation of the conservation status of the Tara Caesalpinia spinosa in the department of Ayacucho]. Pastor, A. A. (1977). Extracción por solventes, caracterización y refinación del aceite de semilla de Tara (Caesalpinia tinctorea). Tesis para optar el título de Ingeniero en Industrias Alimentarias. Universidad Nacional Agraria La Molina. Lima. Perú. [Solvent extraction, characterization and refining of Tara (Caesalpinia tinctorea) seed oil. Thesis. National Agricultural University La Molina. Lime. Peru]. Peñarrieta, J. and Aleman, F. (2009). Manejo silvicultural de la Tara Caesalpinia spinosa (Molina) Kuntze, en los valles interandinos de Cochabamba, Potosí y Chuquisaca. Cochabamba, Bolivia. [Silvicultural management of Tare Caesalpinia spinosa (Molina)



207

Kuntze, in the interandan valleys of Cochabamba, Potosí and Chuquisaca. Cochabamba, Bolivia]. Perú Forestal en Números 2015 (2016). Anuario Forestal 2015. SERFOR Servicio Nacional Forestal y de Fauna Silvestre. 1ra edición. Lima. [Forestry Yearbook 2015. SERFOR National Forest and Wildlife Service. 1st edition. Lime]. Polo, F.D. (2016). Insectos y Acaros perjudiciales de una plantación de Tara (Caesalpinia spinosa) durante la primavera en Lurín. Tesis para optar título de Ingeniero Forestal. Universidad Nacional Agraria La Molina. [Insects and harmful mites of a Tara plantation (Caesalpinia spinosa) during spring in Lurín. Thesis. National University Agraria La Molina]. Reynel, C., Pennington, T.D., Pennington, R.T., Marcelo, J.L. and Daza A. (2007). Árboles útiles del Ande peruano: una guía de identificación, ecología y propagación de las especies de la sierra y los bosques montanos en el Perú. [Useful trees of the Peruvian Ande: a guide of identification, ecology and propagation of the species of the mountain range and the mountain forests in Peru]. Roskov, Y., Zarucchi, J., Novoselova, M. and Bisby F. (†) (eds.). (2017). ILDIS World Database of Legumes (version 12, May 2014). In: Roskov Y., Abucay L., Orrell T., Nicolson D., Bailly N., Kirk P.M., Bourgoin T., DeWalt R.E., Decock W., De Wever A., Nieukerken E. van, Zarucchi J., Penev L., eds. (2017). Species 2000 & ITIS Catalogue of Life, 30th April 2017. Digital resource at http://www.catalogueoflife.org/col/details/species/id/eb41e5d0a6d927 3819e07df482a6726f. Species 2000: Naturalis, Leiden, the Netherlands. ISSN 2405-8858. Sánchez, G. and Vergara, C. (2003). Plagas de hortalizas. Universidad Nacional Agraria La Molina. [Pests of vegetables. National University Agraria La Molina]. Ulibarri, E.A. (1996). Sinopsis de Caesalpinia y Hoffmannseggia (Leguminosae - Caesalpinioideae) de Sudamérica. Darwiniana. [Synopsis of Caesalpinia and Hoffmannseggia (Leguminosae Caesalpinioideae) from South America. Darwinian].


208


Villanueva, C. (2007). La Tara El Oro Verde de los Incas, 1° Edición. AGRUM. Universidad Nacional Agraria La Molina, Lima. [The Tara The Green Gold of the Incas, 1st Edition. AGRUM. National University Agraria La Molina, Lima].



Chapter 8

SOME PRECIPITATION PATTERNS THAT AFFECT AGRICULTURAL PRACTICES IN THE PLAINS OF BUENOS AIRES (ARGENTINA) Alfredo Luis Rolla2 and Marcela Hebe González1,2, 1

Departamento de Ciencias de la Atmósfera y los Océanos, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Buenos Aires, Argentina 2 Centro de Investigaciones del Mar y la Atmósfera, CONICET-UBA, Buenos Aires, Argentina

ABSTRACT The Buenos Aires plain in central-east Argentina generates economic resources based on agriculture, which is strongly influenced by precipitation. In this work factors of different rainfall interannual variability have been studied using monthly precipitation in 22 stations for the period 1950-2012. They showed that it depends heavily on the 



210

Alfredo Luis Rolla and Marcela Hebe González area and the season. El Niño, El Niño Modoki, the positive phase of the Indian Ocean Dipole and the shift to the south of the South Atlantic High are related to an increase of spring precipitation in central Buenos Aires. The weakening of westerlies associated with the negative phase of the Antarctic Oscillation and the weakening of the South Atlantic High favor the autumn precipitation in the east of the province. The positive phase of the Antarctic Oscillation and the intensification of the South Atlantic High is are associated with increased the increased winter precipitation in central and northwestern Buenos Aires.

Keywords: precipitation, Buenos Aires, climate, variability, trends

INTRODUCTION Climatic adversities faced by the agricultural sector during the production process generate a high degree of uncertainty about the outcome of the activity, which carries a high level of risk associated with farms. Given the diversity of climates and soils in Argentina, all farmers face the risk of losses due to climatic factors such as drought, frost, hail, excess of water, strong winds and floods, among other adversities. The results of agricultural production depend on forecasts and the strategies adopted, which usually take into account a normal behavior of the climate variables. These strategies are developed by the farmer himself on his own farm and fundamentally tend to reduce the vulnerability of farms to adverse weather conditions. An example of these strategies is the active crop protection. For example, it is possible to mention the application of sprinkler irrigation as a method to reduce the impact of frost or the application of supplemental irrigation to reduce water deficit or to evaluate the ideal climatic conditions for planting or fertilizing or the time of procurement of machinery for harvesting crops (because of precipitation excess) among others. So, a good knowledge of the precipitation interannual variability is important for decision-makers, particularly for the implementation of these strategies on crops. Annual precipitation in subtropical Argentina decreases towards the west. A shift to the west of the isohyets of annual precipitation in


Some Precipitation Patterns That Affect Agricultural Practices … 211 subtropical Argentina (Barros et al., 2008, Liebmann et al., 2004, Saurral et al., 2016, among others) has been detected since the mid-twentieth century. Therefore, semi-arid areas in the western region began to be suitable for crops. However, data from recent decades show some evidence of change in this behavior in specific regions, which brings about economic losses and increasing social problems. For example, negative precipitation trends have been observed in some localized areas in the Argentinean Chaco region (González et al., 2012a). In this changing scenario, it is important to detect the climate forcings that influence rainfall interannual variability. It is known that El Niño-Southern Oscillation (ENSO) has a great influence over the precipitation of Southeastern South America (Grimm et al., 2002, Vera et al., 2004, Barreiro, 2010, Garbarini et al., 2016, among others). Ashok et al., (2007) defined a special type of El Niño, which was called El Niño Modoki, where heating is confined to the tropical Central Pacific while to the east and west of this central area there are cooling zones, and an index (EMI) was defined to describe it. These events do not produce the same effects on precipitation than those recorded by the traditional El Niño events. There are other climate forcings that influence rainfall variability apart from ENSO. Another oscillation linked to the sea surface temperature (SST) is the Indian Ocean Dipole (IOD) (Saji et al., 1999), whose positive phase is defined by the heating of the South western Indian Ocean and the cooling of the Northeastern Indian Ocean. These geographical areas were considered to define the IOD index that describes this process. Chan et al., (2008) found that in South America the positive phase of the IOD is manifested as a dipole of anomalies of precipitation, with increases in the La Plata Basin and decreases in the region of central Brazil. The Antarctic Oscillation (AAO) (Thompson and Wallace, 2000), has a positive phase defined by negative pressure anomalies around the South Pole and subpolar low and also positive pressure anomalies forming a ring around the area of the subtropical high. The index is defined as the normalized difference in pressure between 40°S and 70ºS (Nan and Li, 2003). The positive phase is associated with an intensification of the zonal flow in the Pacific and therefore, a lower exchange between high and


212

Alfredo Luis Rolla and Marcela Hebe González

middle latitudes. This pattern is currently known as the Southern Annular Mode (SAM). There are several works that investigate the AAO effects on the South America climate. Reboita et al., (2009) found that the frontogenesis function is high during the negative AAO phase meanwhile the path of the cyclone moves to the South during the positive phase of the AAO. González and Vera (2010), González et al., (2010), González and Dominguez (2012) and González (2015) found a significant relationship between the negative phases of the AAO and winter precipitation in Comahue in the Southern Andes. The combined influence of both ENSO and AAO signals on spring precipitation variability over Southeastern South America was explored by Silvestri and Vera (2003) and they found that AAO changes provide a significant modulation of the precipitation response to ENSO. The Dipole of South Atlantic (SAODI) (Nnamchi et al., 2011) is an oscillation that has been defined in the Atlantic Ocean. Its positive phase is defined as the warming of the northeast (coast of Africa) and the cooling of the southwest South tropical Atlantic Ocean (coast of Brazil). This effect is related to the position and intensity of the semi-permanent anticyclone of the South Atlantic (Atlantic High). The study area selected for this work is the province of Buenos Aires and surrounding areas. It belongs to the Pampas, which is the main agricultural production area in Argentina. From an economic point of view, three-quarters of the total value of the agricultural production correspond to this area, which covers 5 million hectares. Only the provinces of Buenos Aires, Santa Fe and Córdoba generate 70% of the agricultural production in the country. Many authors have studied rainfall behavior in Pampas plains. For example, Penalba and Rivera (2016) detected some sea surface temperature patterns related to droughts in La Niña events but they pointed out that to consider only the ENSO as the solely responsible factor for the precipitation temporal variability over the Southern South America prevents the development of a successful prediction tool, hence, other modes of variability should be considered on several time scales. Penalba et al., (2016) performed the analysis of surface circulation types that contribute to wet and dry cases and they concluded that they depended on


Some Precipitation Patterns That Affect Agricultural Practices … 213 the region. Silvestri and Vera (2003) pointed out that the analysis of the influence of the AAO variability on to precipitation anomalies over Southeastern South America shows that AAO signal is significantly strong during both winter and late spring although of opposite sign. The main objective of this paper is to study the variability of both annual and seasonal precipitation anomalies from interannual to longer timescales in Buenos Aires plains in order to detect possible predictors for seasonal precipitation. This chapter is organized as follows: the methodologies and data used, the main results and the conclusions.

METHODOLOGY AND DATA The data used were the monthly precipitation from 22 stations (Figure 1a and 1b) belonging to the measuring network of the Argentina National Weather Service (NWS) and the National Agricultural Technology Institute (INTA), for the period 1950-2012 with a common period 19732010. These data were consistent and only those with high quality were used. Missing data did not exceed 1% of the total data. Series of annual and seasonal accumulated precipitation were generated (DJF December to February, summer; MAM March to May, autumn; JJA June to August, winter; SON September to November, spring). To calculate the annual and seasonal precipitation trends, a linear fit was performed using the method of least squares with a significance of 95% confidence and it was tested using a Normal test. The dominant periodicity ranges of the variability were calculated using a spectral analysis and smoothing by a Hann window (Blackman and Tukey, 1958). The significance of the spectral analysis was calculated using the square Chi/nu distribution (to find the confidence bands) and the Anderson test was used to prove whether spectral noise was red or white (Mitchell et al., 1971). The relationship between interannual variability of seasonal precipitation and different climate indices was analyzed using the methodology of correlation for the common period 1973-2010. The


214


correlations had a significance of 95% reliability using a Normal test when the value exceeded 0.3. The SST data used to evaluate the average SST in the EN3.4 region and SAODI came from the HadISST1 file produced by Hadley Centre; the AAO index was obtained from Climate Prediction Center (CPC; http://www.cpc.ncep.noaa.gov); the IOD and the Niño Modoki indices (EMI) were obtained from the Japan Agency for MarineEarth Science and Technology (JAMSTEC; http://www.jamstec.go.jp/e/). The latitudinal position of the semi-permanent anticyclone of the Atlantic Ocean (AALAT) was obtained by locating the maximum of 1000 hPa geopotential height over the South Atlantic Ocean, using ERA-interim reanalysis from the European Centre for Medium-Range Weather Forecasts (ECMWF).

Figure 1a. Study area location of weather stations.


Some Precipitation Patterns That Affect Agricultural Practices … 215

Figure 1b. Mean Annual precipitation cycle.

It was defined as “extremes” above normal (below normal) to those years when the index was above the threshold of the fourth septile (it was less than the threshold of the third septile). Thus, the normal values were those between the third and fourth septiles. This criterion was adopted to have a sufficiently large number of years in each group of extremes. The extreme composite fields of some meteorological variables (geopotential height, wind, precipitable water and specific humidity), obtained from ECMWF, were used to exemplify the results.

RESULTS Annual and seasonal accumulated precipitation in stations distributed over the area of study were analyzed during the common period 1973-2010 to detect linear trends. Besides, the available series were analyzed for the longest available period to assess the presence of significant cycles.


216


The seasonal precipitation accumulated in DJF, MAM, JJA and SON in the common period 1973-2010 was used to assess the relationship between interannual variability and different atmospheric forcing. The results are detailed below.

The Precipitation Variability in Larger Than Interannual Timescales Figure 2 shows the annual precipitation linear trends in the study area calculated over the period 1973-2010. They were positive only in the northeast of the province of Buenos Aires, however they were not significant at 95% confidence level (r values greater than 0.3).Only two stations showed significant negative annual precipitation trends: CNNJ and CNVT, located in central and northwestern Buenos Aires(see Figure 1bfor station names),with a decrease of more than 5 mm/year respectively.

Figure 2. Annual precipitation trends (mm/year) (1973/2010). Shaded areas (white) indicate negative trends (positive).


Some Precipitation Patterns That Affect Agricultural Practices … 217 Trend analysis was performed for all normalized climate indices used in this study, applying a linear least square method for the common period 1973-2010. A very detailed study of these indices was available in González et al., (2016). All the indices have no significant (95% confidence level) linear trends except for IOD. To work with stationary series, the IOD and precipitation detrended series were used to perform the calculations. The annual precipitation cycle over the entire region was calculated using the whole period of observations from each station (see Figure 1b). Winter precipitation is lower than in summer and a doubled relative maximum can be found in the transition seasons. This cycle is much more marked in the west and decreases towards the east of the region. Besides, precipitation is higher in the northeastern Buenos Aires all over the year than in the rest of the region. The spectral analysis methodology was applied to the longest available annual data record and other significant (at the 95% confidence level) periodicities were detected, only in 11 of the 22 stations used. A periodicity of about 10 to 15 years and another of 4 years were found in most of the region, a 24 year periodicity was detected only in two locations to the west of the province. Figure3 shows the periodicities found in each station; the most significant was plotted above the station point and the second significant one was plotted below it. It is important to note that the period used to perform the spectrums is different for each station. That was done to use the largest record to detect all the periodicities present in the series.

The Interannual Variability of Precipitation The interannual variability of precipitation in Buenos Aires is associated with some different factors. It is known that SST anomalies of distant oceans, like the tropical Pacific and the Indian oceans, act through teleconnections, altering atmospheric circulation and creating zones with vertical velocity anomalies associated with anomalous precipitation areas.


218


Also, it is well known that the presence of the semi-permanent anticyclone of the South Atlantic, which is located towards the northeastern Buenos Aires, regulates moisture advection from the Atlantic Ocean either by its intensity, its position or its ability to transport water vapor present in the atmosphere from the ocean into the continent. It is important to point out that these factors are not independent: the South Atlantic Anticyclone can be modulated by the activity of the large-scale climate patterns as ENSO or SAM (Penalba and Rivera, 2016; Silvestri and Vera, 2003; among others). However, the correlation between some climate indices and seasonal rainfall will be considered in order to detail the individual influence of each factor.

Figure 3.First (top) and second (below) significant periodicity plotted on the location of the station.

The spatial correlation fields between seasonal accumulated precipitation and the EN3.4 index are shown in Figure 4, where shaded areas indicate significant correlations. Precipitation is favored by the warm phase of ENSO in the southern and central areas of study in winter and in


Some Precipitation Patterns That Affect Agricultural Practices … 219 the northern and central ones in spring. The correlations are not significant in autumn and summer. To assess the influence of "El Niño Modoki" events, the correlation fields between seasonal precipitation and the EMI index were considered. Figure 5 shows that El Niño Modoki favors precipitation in spring, especially in central and eastern Buenos Aires, also it is favored in northwestern areas in winter; in the other seasons the correlations are not significant.

Figure 4. Correlation between seasonal rainfall and El Niño 3.4 (Niño3.4). Shaded areas indicate significant correlations at 95% confidence level.


220


Figure 5. Same as Figure 4 for El Niño Modoki (EMI).

Precipitation also increases during the positive phase of IOD, but the correlation was significant only in a small area in the center of the province in spring and in the north in summer (Figure 6). These climate forcings (ENSO, Modoki and IOD) are associated with SST anomalies in the tropical oceans (The Pacific and The Indian respectively) producing Rossby wave trains moving towards mid-latitudes and to the southeast through the Pacific Ocean. This pattern is called “Pacific South American Pattern” and was studied in detail by Kidson (1999), Mo (2000), Nogues Paegle and Mo (2002), Grimm and Ambrizzi (2009), Barreiro (2010), among others. These waves reach southern South America, where the height of the Andes mountains allows an easy movement, enter Argentina


Some Precipitation Patterns That Affect Agricultural Practices … 221 and displace towards the northeast. Some authors have studied the joint effect of ENSO and IOD, for example, Weng et al., (2011) detected the possible influences of the coupled ocean-atmosphere phenomena in the Indo-Pacific Ocean on summer climate in China and they detected that the path between them is related to the low level tropospheric circulation and the monsoon. Wang and Wang (2014) determined different impacts of various El Niño events on the Indian Ocean dipole and Wang et al., (2016) studied the forcing mechanisms of IOD in the absence of ENSO signal. Other authors (Drumond and Ambrizzi, 2008; Taschetto and Ambrizzi, 2012) showed the relationship between SST anomalies in The Indian Ocean and South America precipitation.

Figure 6. Same as Figure 4 for the Indian Ocean Dipole (IOD).


222


Figure 7. Same as Figure 4 for the Antarctic Oscillation (AAO).

The correlation fields between seasonal precipitation and AAO show that precipitation is favored by the negative phase of the AAO especially in central and eastern Buenos Aires in autumn (Figure 7). This is associated with the fact that when the negative phase of AAO occurs, the western zonal flow in the Pacific weakens and therefore, there is a greater chance of energy exchange between high and middle latitudes. In addition, winter precipitation is favored by the positive phase of the AAO, especially in central and northwestern Buenos Aires. The same result was observed when the correlation between seasonal precipitation and the intensity of the Atlantic High (AAINT) is analyzed (Figure 8).



Figure 8. Same as Figure 4 for the Intensity of South Atlantic High (AAINT).

Winter precipitation increases in central and northern Buenos Aires when the Atlantic High is more intense than normal while autumn precipitation increases in the east when the Atlantic High is weakened. Both factors (AAO and AAINT) are not independent. A possible explanation for this fact is that the intensity and the position of the Atlantic High regulate the preferential area where rainfall systems can develop. For a better understanding of this situation, Figure 9 shows the composite field of 500 hPa geopotential height anomaly, the 500 hPa wind and the sea level pressure for winter in years when both AAO and AAINT (AAO positive phase and intensified Atlantic High) were classified as above normal (Figure 9a) and for the years classified as below normal (AAO negative phase and weakened Atlantic High) (Figure 9b). Table 1 lists the years in each of the groups. Figure 9a shows a wave train with anticyclonic


224


anomalies in the Atlantic, the east of Argentina and inside the continent that surely determines a greater chance of precipitation within the continent as opposed to what happens in the case that both indices (AAO and AAINT) are below normal (Figure 9b). In the latter case, it is observed that the South Atlantic Ocean, on the coast of Argentina, is affected by cyclonic anomalies that favor the chance of precipitation over the Atlantic Ocean. Sea level pressure and 500 hPa winds show the intensification (weakening) of the westerly wind belt, about 50ºS, over the Pacific Ocean in the cases where AAO is above (below) normal as can be seen in Figure 9a (9b). The difference between winter 500 hPa geopotential height fields and u-wind for samples above and below normal were tested using a T- Student test. It can be pointed out that the sub-polar low belt area (where AAO is defined) and the South Atlantic ocean, east of Argentina (where the semi-permanent Atlantic High is positioned), are areas where the correlation is significant at 95% confidence level, indicating that the differences of the values in the two composites (above and below) for both, 500hPa geopotential and uwind, are statistically significant.

Figure 9a. Composite of winter geopotential height (500 hPa) anomalies (light contours, shaded) (dash lines represent negative values and solid lines positive values), sea level pressure (dark contours) and wind (vectors) for the years with AAO and AAINT above normal (1982/1989/1998/2004).



Figure 9b. Same as Figure 9a for the years with AAO and AAINT below normal (1980/1988/1996/2009).

Figure 10. Schematic graphic summarizing the possible joined effect of AAO and Atlantic High intensity over winter precipitation anomalies. Left: AAO positive phase; Atlantic High intensity strong. Right: AAO negative phase; Atlantic High intensity weak.

The above analysis, for winter precipitation anomalies, is summarized in a graphic scheme (Figure 10), which details the simultaneous contribution of the Atlantic High and AAO. When the positive phase of


226


AAO develops, the westerly winds are intensified; if the intensity of the Atlantic High is above normal too, the chance of winter precipitation is greater within the continent (see Figure 7 and 8). Meanwhile, if westerly winds and the Atlantic High are weakened, the preferential precipitation areas take place towards the east over the Atlantic Ocean.

Figure11a. Composite of winter precipitable water (in Kg/m2) for the years with AAO and AAINT above normal (1982/1989/1998/2004).

Also, the behavior of precipitable water in winter has been analyzed. It can be seen that, when the indices were both above normal (Figure 11a), the values of precipitable water in Buenos Aires province and continental Argentina are higher (between 14 and 18 Kg/m2) than in the case that the indices were both below normal (Figure 11b) (values lower than 14 Kg/m2).



Figure11b. Same as Figure 11a for the years with AAO and AAINT below normal (1982/1989/1998/2004).

Figure12a. Composite of winter moisture transport (in g m/Kg s), intensity (shaded) and direction (vector) for years with AAO and AAINT above normal (1982/1989/1998/2004).


228


Figure12b. Same as Figure 12a for years with AAO and AAINT below normal (1982/1989/1998/2004).

Additionally, moisture transport in winter calculated as the product of specific humidity and wind integrated into the whole column atmosphere (1000 to 300 hPa) was evaluated. The composite fields corresponding to years above normal (Figure 12a) and below normal (Figure 12b) show that the moisture transport is greater over the continent when the indices are above normal than in the case of below normal years, especially in subtropical Argentina. It is important to point out that the moisture transport from the north is relevant for precipitation, although it is more important in summer than in winter. It can be observed (Figure 12a), that the maximum moisture transport (about 20ºS over the continent) is greater than in Figure 12b.This configuration is consistent with slight increased moisture transport in western Buenos Aires for the years above normal compared to years below normal. Besides, the moisture transport from the west over Southern Andes around 40°S is greater in the above (Figure 12a) than in the below (Figure 12b) normal case.



Figure 13. Same as Figure 4 for the South Atlantic Dipole (SAODI).

Similar results have been detailed for other regions of Argentina: for example, spring precipitation in the Chaco plain is affected by the ENSO and AAO (Gonzalez et al., 2012b) and they also affect winter precipitation in Patagonia (Gonzalez, 2013). In greater scales, AAO modulates ENSO response to spring precipitation in Southeastern South America (Silvestri and Vera, 2003). Precipitation also increases when the negative phase of SAODI occurs, especially in the northeast of Buenos Aires in winter and in the northwest in spring (Figure13). Also, spring precipitation is favored when the south Atlantic anticyclone is displaced towards the south from its mean position (negative AALAT) throughout the province (Figure 14), while autumn precipitation is favored when the anticyclone is located northern from its


230


mean position (positive AALAT). These two factors (SAODI and AALAT) do not seem to be independent. The common occurrence of both of them for spring is listed in Table 1. Other authors have found a close relation between SST in the tropical Atlantic Ocean and the Atlantic High and have described an ocean-atmosphere coupled mode in such ocean (Bombardi et al., 2014).

Figure 14. Same as Figure 4 for Latitude of the South Atlantic High (AALAT).

Figure 15 summarizes the result of both effects. Therefore, a possible mechanism to explain the spring precipitation behavior is that when the negative phase of SAODI develops, the southwestern tropical Atlantic Ocean heats, and so evaporation increases. Then, if the anticyclone moves to the south, moisture advection intensifies in northern Argentina and produces higher precipitation in Buenos Aires. Also, when the positive


Some Precipitation Patterns That Affect Agricultural Practices … 231 phase of SAODI develops and the Atlantic High moves towards the north, the ocean nearby Argentina is cold and moisture advection decreases.

Figure 15. Schematic graphic summarizing the joint effect of AALAT and SAODI. The main horizontal humidity transport, the horizontal flow associated with the Atlantic High and the SST anomalies related to SAODI phase are depicted in the scheme. Left: SAODI negative phase; South Atlantic High displaced towards the south. Right: SAODI positive phase; Atlantic High displaced towards the north.

Figure 16a. Composite of spring moisture transport (in g m/Kg s), intensity (shaded) and direction (vector) for years with SAODI and AALAT above normal (1981/1984/1989/1993/2003/2008).


232


Figure 16b. Same as Figure 16a for years with SAODI and AALAT below normal (1980/1982/2000/2001).

To support the previous result, Figure 16 shows the spring composite field of moisture transport for the case when the SAODI and AALAT indices are above normal (positive phase SAODI and Atlantic High moved to north) (Figure 16a) and the same composite field for years below normal (Figure 16b), both in spring. It can be seen the moisture transport from the Brazilian forest, towards northern and central Argentina is greater in the below normal case than in the above normal case. This moisture transport is necessary to generate precipitation, all along subtropical Argentina, especially in spring and summer. Indeed, the amount of moisture transport towards northern Buenos Aires is between 0.6 and 0.8 g/Kg m/s in the case of below normal indices and does not exceed 0.6 g/Kg m/s in the case of above normal indices. It must be pointed out that the moisture transport difference is significant with more than a 90% confidence level all along the north of the country.


Table 1. Years with AAO and AAINT (winter), SAODI and AALAT (spring) classified as above/ below normal. "1" ("0") indicates that the criterion expressed in the first column is true (false). The years with joint effect (AAO – AAINT), (SAODI – AALAT) are shaded


234


CONCLUSION Annual precipitation trends were negative but not statistically significant in most of Buenos Aires over the period 1973 to 2010. Instead, dominant periodicities of 12 and 4 years were detected. Several factors affecting the interannual variability of rainfall were analyzed and showed that it depends heavily on the area and the season. In particular the warm phase of ENSO or “El Niño Modoki” and the positive phase of the IOD increase spring precipitation in central Buenos Aires and so do the shift to the south of the South Atlantic High (negative AALAT). The combined effect of the weakening of westerlies related to the negative phase of AAO and the weakening of the South Atlantic High (negative AAINT) favor the autumn precipitation in the east of the province. In addition, the positive phase of AAO and the intensification of the South Atlantic High are associated with increased winter precipitation in central and northwestern Buenos Aires. The combined effect of the AAO positive phase and the above normal AAINT determines more precipitation over the continent, meanwhile, if the westerlies and AAINT are weakened precipitation will occur eastward. Besides, a possible mechanism to explain the spring precipitation is that when the negative phase of SAODI develops and the Atlantic High moves to the south, the ocean nearby Argentina heats and moisture advection increases, raising precipitation in Buenos Aires. These results suggest that there are climate factors which can be associated with the predictability of seasonal precipitation and this fact can be used to define predictors for seasonal precipitation forecast using statistical methods.

ACKNOWLEDGMENTS To National Weather Service (SMN) and The National Agricultural Technology Institute (INTA) of Argentina for providing the precipitation data.


Some Precipitation Patterns That Affect Agricultural Practices … 235 To the European Centre for Medium-Range Weather Forecasts (ECMWF) for the reanalysis data. To UBACYT 2017-2019 20020160100009BA, CONICET PIP 20152017 projects for funding this work.

REFERENCES Ashok, K., Behera, S., Rao, S., Weng, H., Yamagata, T., 2007. El Nino Modoki and its possible teleconnection. J. Geophys. Res., 112, C11007, doi: 10.1029/2006JC003798. Barreiro, M., 2010. Influence of ENSO and The South Atlantic Ocean on climate predictability over Southeastern South America. Clim. Dyn., 35, 1493-1508. Barros V., Doyle M. and Camilloni, I., 2008. Precipitation trends in southeastern South America: relationship with ENSO phases and the low-level circulation. Theoretical and Appl. Climatology, 93, 1-2, 1933. Blackman, R.B. and Tukey, J.W., 1958. The measurement of power spectra from the point of view of communication engineering. Dover Publications. Bombardi, R.J., Carvalho, L.M., Jones, C. and Reboita, M.S. 2014 Precipitation over eastern South America and the South Atlantic Sea surface temperature during neutral ENSO periods. Clim. Dyn., 42, 1553–68 Chan, S.C., Behera, S.K., and Yamagata, T., 2008. Indian Ocean Dipole influence on South American rainfall, Geophys. Res. Lett.,35, L14S12, doi: 10.1029/2008GL034204. Drummond, A. R. and Ambrizzi, T. 2008: The role of the South Indian and Pacific Oceans in South American monsoon variability. Theoretical and Appl. Climatology, 94, 125-137. Garbarini E., Skansi M., Gonzalez M.H. and Rolla A.L., 2016. ENSO Influence over Precipitation in Argentina, Advances in Environmental Research, Chapter 7, Volume 52, NOVA Publisher, NY, USA.


236


González, M.H. and Vera, C.S. 2010. On the interannual winter rainfall variability in Southern Andes. International Journal of Climatology, 30, 643-657. González, M.H., Skansi, M.M and Losano, F., 2010. A statistical study of seasonal winter rainfall prediction in the Comahue region (Argentine), ATMOSFERA, 23, 3, 277-294. González, M.H. and Domínguez, D. 2012. Statistical Prediction of wet and dry periods in the Comahue Region (Argentina), Atmospheric and Climate Sciences, 2, 1, 2160-0414. González, M.H., Domínguez, D. and Núñez, M., 2012a. Long term and interannual rainfall variability in Argentinean Chaco plain region, Rainfall: Behavior, Forecasting and Distribution, Chapter 4876, Nova Science Publishers Inc. González, M.H., Cariaga, M.L. and Skansy, M.M., 2012b. Some factors that influence precipitation in Argentinean Chaco. Advances in Meteorology, 2012, 359164, doi: 10.1155/2012/359164. González, M.H., 2013. Some indicators of interannual rainfall variability in Patagonia (Argentine), Climate Variability‐ Regional and Thematic Patterns, Chapter 6. Intech. González, M.H., 2015. Statistical seasonal rainfall forecast in Neuquen river basin (Comahue Region, Argentina). Climate 3, 349-364. González, M.H., Garbarini E.M., Rolla A.L. and Eslamian, S., 2016. Meteorological Drought Indices: Rainfall Prediction in Argentina en Handbook of Drought and Water Scarcity: Vol. 1, Principle of Drought and Water Scarcity, Chapter 29, 540-567, Taylor& Francis Publishing (CRC Group), Abingdon, United Kingdom. Grimm, A., Barros, V. and Doyle, M., 2002. Climate variability in Southern South America associated with El Niño and La Niña events. J. Climate, 13, 35-58. Kidson, J., 1999. Principal modes of southern hemisphere low frequency variability obtained from NCEP-NCAR reanalysis. J. Climate, 1, 1177-1198. Liebmann, B., Vera C.S., Carvalho, L., Camilloni, I., Hoerling, M., Allured, D., Barros, V., Báez, J. and Bidegain, M. 2004. An Observed


Some Precipitation Patterns That Affect Agricultural Practices … 237 Trend in Central South American Precipitation. J. Climate, 17, 22, 4357-4367. Mitchell, J.M., Dzerdzeevsku, B., Flohn, H., Lamb, H.H., Rao, K.N. and Wallín, C.C., 1971. Climatic Change. OMM, Technical Note Nº 79. Mo K.C., 2000. Relationships between low frequency variability in the Southern Hemisphere and sea surface temperature anomalies. J. Climate, 13, 3599-3610. Nan, S. and Li, J. 2003. The relationship between summer precipitation in the Yangtse River Valley and the previous Southern Hemisphere Annular Mode, Geophys. Res. Lett., 30, 24, 2266. Nnamchi, H.C., Li, J.P. and Anyadike, R.N., 2011. Does a dipole mode really exist in the South Atlantic Ocean? J. Geophys. Res., 116, doi: 10.1029/2010JD015579. Nogues Paegle, J and Mo, KC. 2002. Linkages between Summer Rainfall Variability over South America and Sea Surface Temperature Anomalies. J. Climate, 15, 1389 – 1407. Penalba, O., Rivera, J., Pántano, V. and Bettolli, M., 2016, Extreme rainfall, hydric conditions and associated atmospheric circulation in the southern La Plata Basin, Climate Research, 68: 215–229, doi: 10.3354/cr01353. Penalba, O. and Rivera, J. 2016. Precipitation response to El Niño/La Niña events in Southern South America – emphasis in regional drought occurrences. Advances in Geosciences, 42, 1–14, 2016 www.advgeosci.net/42/1/2016/ doi:10.5194/adgeo-42-1-2016. Reboita, M.S., Ambrizzi, T. and Da Rocha, R.P., 2009. Relationship between the Southern Annular Mode and the Southern Hemisphere Atmospheric Systems. Revista Brasileira de Meteorología, 24, 1, 48-55. Saji, N.H., Goswami, B.N., Vinayachandran, P.N. and Yamagata, T., 1999. A Dipole Mode in the tropical Indian Ocean. Nature, 401, 23,360–363. Saurral, R., Camilloni, I. and Barros, V., 2016. Low-frequency variability and trends in centennial precipitation stations in southern South America, Int. J. Climatol., Wiley Online Library, DOI: 10.1002/joc.4810.


238


Silvestri, G. and Vera, C., 2003. Antarctic Oscillation signal on precipitation anomalies over southeastern South America, Geophysical Research Letters, 30, 21, 2115, doi:10.1029/2003GL018277. Taschetto, A.S. and Ambrizzi, T. 2012. Can Indian Ocean SST anomalies influence South America precipitation? Clim. Dyn. 38, 1615-1628. Thompson, D.W. and Wallace, J.M. 2000. Annular modes in the extratropical circulation. Part I: month-to-month variability. J. Climate, 13, 1000-1016. Vera, C., Silvestri, G., Barros, V. and Carril, A. 2004. Differences in El Niño response in the Southern Hemisphere. J. Climate 17, 9: 17411753. Weng, H, Wu, G., Lui, Y., Behera, S. and Yamagata, T., 2011. Anomalous summer climate in China influenced by the tropical Indo-Pacific Oceans. Clim. Dyn. (2011) 36:769–782 DOI 10.1007/s00382-0090658-9. Wang, H., Murtugudde, R. and Kumar, A., 2016. Evolution of the Indian Ocean dipole and its forcing mechanisms in the absence of ENSO, Clim. Dyn., in press, DOI 10.1007/s00382-016-2977-y. Wang X. and Wang C., 2014. Different impacts of various El Nino events on the Indian Ocean dipole. Clim. Dyn. 42, 991–1005. doi:10.1007/s00382-013-1711-2.



Chapter 9

PLANT PRODUCTION THROUGH SOMATIC EMBRYOGENESIS OF THEOBROMA CACAO L. LEAF CULTURES Esther E. Uchendu PhD, Omolola O. Oso and Victor O. Adetimirin PhD Department of Agronomy, Faculty of Agriculture, University of Ibadan, Ibadan, Oyo State, Nigeria

ABSTRACT Theobroma cacao L. is a crop of global economic importance. It is traditionally propagated by rooted cuttings and grafting but these methods are inefficient due to low propagation rates. A high percentage of cacao plants is derived from seeds which produces considerable yield variation, a consequence of the crop’s heterozygosity. Clonal micropropagation protocols involving somatic embryos derived from floral parts were developed but resulted in many abnormal embryos. Many genotypes failed to produce somatic embryos and/or convert to plants. In this study,





240

Esther E. Uchendu, Omolola O. Oso and Victor O. Adetimirin an efficient protocol for somatic embryogenesis using leaf explants was developed with three elite cacao cultivars (CRIN TC1, CRIN TC2 and CRIN TC5). The zygotic embryos of these cultivars were aseptically excised and cultured on Murashige and Skoog (MS) basal medium without growth regulators. Young leaves were excised from 4-week-old seedlings and segments (~5 mm in length) cultured abaxially on MS medium with 2, 4-D with or without sucrose for 4 weeks. Embryogenic callus was subcultured for 4 weeks. Somatic embryos were grown in growth regulator-free medium containing activated charcoal. Leaf segments of CRIN TC2 on 0.002 or 0.005 mM 2,4-D and 30 gL-1sucrose produced 100% embryogenic callus. The leaf segments of CRIN TC5 on 0.005 mM 2,4- D and 30 gL-1sucrose produced the highest number of somatic embryos (235.5). CRIN TC1 produced embryogenic callus and somatic embryos at low levels only on medium containing 0.009 mM 2,4D and 30 gL-1 sucrose. In general, leaf segments on 30 gL-1 sucrose produced significantly higher number of somatic embryos than the nonsucrose control. Somatic embryos formed within 18 to 28 days and converted to quality plants on medium with activated charcoal. Nearly 100% of these plants survived acclimatization in the green house. This is the first report on the production of plants from leaf-derived somatic embryos of T. cacao, indicating that leaves are important source for micropropagation of elite T. cacao cultivars.

Keywords: cocoa, 2,4-dichlorophenoxyacetic micropropagation, somatic embryogenesis

acid,

germplasm,

INTRODUCTION Theobroma cacao is traditionally propagated by seeds obtained from pods (Figures 1A and 1B), which usually result from open pollination. Consequently, cocoa plants derived from seeds are highly heterozygous with wide genetic variation and a large proportion of low yielding trees observed in a plantation (Irizarry and Rivera, 1998). In Nigeria, there has been a decline in production and productivity due to a number of factors that include low yield due to aging plantations, increased disease incidence and pest attack. Elite cacao varieties that are high yielding and disease resistant have been developed, but there is a severe shortage of planting


Plant Production through Somatic Embryogenesis …

241

materials due to rapidly increasing demand. Several classical vegetative propagation methods such as budding, grafting and rooted cuttings have been applied to increase cacao production, but with limited success (Pereira et al., 2000; Alvarenga et al., 2002). In addition, there are a number of disadvantages associated with the propagation of cocoa plants via rooting or grafting of plagiotropic cuttings; these include the spread of diseases, particularly the Cocoa Swollen-Shoot Virus Disease (CSSVD), intensive labor and associated costs (Figueira and Janick, 1995). There is an urgent need to develop fast and highly efficient biotechnology systems to aid or back-up the propagation of superior cacao cultivars selected in breeding programs. Micropropagation of T. cacao would provide a reliable biotechnology method for rapid production of high-quality clonal plants. A micropropagation protocol using Linsmaier and Skoog medium (1965) with GA3 (5-10 mg/dm-3) was reported for dormant buds of T. cacao shoot apices (Orchard et al., 1979). Advanced biotechnological methods such as somatic embryogenesis have potential for large scale micropropagation of plants. Somatic embryogenesis involves the formation of embryo-like structures from somatic cells. It is a type of vegetative propagation based on plant cell totipotency, and it offers a superior alternative to traditional vegetative propagation methods such as cuttings or grafting. In the case of T. cacao, somatic embryogenesis can allow the rapid propagation of selected self-incompatible clones and F1 hybrids, thereby avoiding conventional hybrid-seed production and cuttings which are costly and difficult to produce. It can also be used for elimination of CSSVD in infected cacao trees (Quainoo et al. 2008). The major steps of a somatic embryogenesis protocol include: (a) induction of embryogenic callus; (b) multiplication of the embryogenic cells (undifferentiated phase); (c) regeneration of large numbers of somatic embryos from these cells (embryogenic phase) and (d) conversion of the mature somatic embryos into plants (Li et al., 1998; Figueira and Janick, 1995; Traore et al., 2003). The first report of somatic embryogenesis of T. cacao described a protocol for immature zygotic embryos (Esan, 1977). A number of T.


242

Esther E. Uchendu, Omolola O. Oso and Victor O. Adetimirin

cacao somatic embryogenesis studies have been reported using floral tissues (Alemanno et al., 1996, 1997; Li et al., 1998). Through research conducted at Plant DNA Technology, CIRAD, Montpellier, France and the Pennsylvania State University, the production of somatic embryos using floral parts followed by plantlet production is now optimized for a large number of genotypes (Maxinova et al., 2002; 2005; Tan and Furtek, 2003; Ajijah et al., 2016). However, abnormalities often occur with this technique (Tan and Furtek, 2003). A major problem affecting somatic embryogenesis in T. cacao is low conversion rate of somatic embryos to plants (Ajijah et al., 2016). Somatic embryogenesis in cacao is believed to be under specific genetic control. Recent advances suggest an important role of a transcription factor ‘Baby Boom’ gene (Florez et al., 2015). A protocol for production of somatic embryos from T. cacao leaves was previously reported but did not result in plant regeneration (Litz, 1986). The micropropagation of T. cacao is limited by a number of factors including endogenous bacterial contamination, and high polyphenolic exudation (Alvarenga et al., 2002). Endogenous contamination makes it difficult or impossible to use leaves directly from field trees (Arnold et al., 2003), so the best leaf explants are probably those from seedlings of elite cultivars grown under aseptic conditions. A recent study confirmed that during tissue culture, T. cacao turned brown, which adversely affected the growth performance of the cultures (Niemenak et al., 2012). Browning is caused by oxidation of phenolic compounds. Oxidized phenolics may become cytotoxic to tissue cultured plants (Agropolis et al., 2003). The inclusion of antioxidants such as ascorbic acid and activated charcoal in the culture medium is known to minimize phenolic exudation (Uchendu et al., 2010; 2011). The use of antioxidants in the tissue culture medium of several plants significantly reduced colour changes and improved growth (Uchendu et al., 2012). The objective of the present study was to develop a somatic embryogenesisbased protocol for the micropropagation of T. cacao cultivars using leaf cultures derived from seedlings and to test the efficacy of activated charcoal during in vitro-plant production from somatic embryos.



243

MATERIALS AND METHODS Plant Materials and Explant Preparation Cocoa pods from three elite cultivars (CRIN TC1, CRIN TC2, and CRIN TC5) were collected from the genebank collections of the Cocoa Research Institute of Nigeria (CRIN), Idi-Ayunre, Ibadan, Oyo State, Nigeria. The seeds were removed from the pods and the mucilage on each seed was carefully removed without damage to the seeds. The seeds were soaked in 70% ethanol (Sigma Aldrich, Nigeria) for 2 minutes and then rinsed thrice with sterile distilled water. Thereafter, they were soaked in 40% commercial bleach [Clorox® regular bleach (5.25% sodium hypochlorite)] with tween 20 for 15 minutes and again rinsed thrice with sterile distilled water. After the sterilization process, the seeds were kept in sterile distilled water prior to embryo extraction and culture.

Dissection, Culture Techniques and Conditions Twenty zygotic embryos per treatment per replicate were carefully excised from the seeds and placed in glass jars (13 cm × 7 cm) capped with plastic lids. The growth medium used was without growth regulators and contained commercial powder of Murashige and Skoog (MS, 1962) basal medium with MS vitamins, 30 gL-1 sucrose and 7 gL-1 agar at pH 5.7. Embryo cultures were incubated for about 30 days. Young leaves were excised from 4-week old seedlings and cut horizontally across the mid axis. The leaf segments (~5 mm length) were placed abaxially on the culture medium in each of 4 Petri dishes (5 leaf segments per Petri dish consisting of a mixture of distal and proximal ends). There were three replicates per treatment. Each Petri dish (9 cm in diameter) contained 25 ml of culture medium (described below). All cultures were maintained in a growth room at 24 ± 2ºC, about 70% relative humidity and a 16 h photoperiod with a light intensity of 30 μmol m-2 s-1 (LI-250A, LI-COR ®


244


Biosciences, Lincoln, NE) provided by cool white fluorescent bulbs (Ledii Illumination, Shenzhen City, China).

Embryogenic Callus, Somatic Embryo and Plantlet Production The leaf segments were cultured on MS basal medium with MS vitamins, 2, 4-Dichlorophenoxylacetic acid (2,4-D; 0, 0.002, 0.005, 0.007 and 0.009 mM), 0.2 mg/L 6-benzylaminopurine (BAP), 1 gL-1 casein hydrolysate, sucrose (0, and 30 gL-1) and 6 gL-1 agar. These concentrations were chosen based on findings in relevant literature. The experiment involved 10 treatments obtained from a factorial combination of the levels of 2,4-D and sucrose concentrations. All culture media were adjusted to pH 5.7 with 1N NaOH and autoclaved at 121oC and 15 psi for 15 minutes. After 4 weeks of initial leaf culture, all the embryogenic calli of each treatment (from each leaf segment that produced embryogenic callus) were transferred into same but fresh culture medium for an additional 4 weeks before mature somatic embryos were harvested for further studies. Ten randomly selected cotyledonary-stage somatic embryos from each treatment that produced somatic embryos were transferred into growth regulator-free MS basal medium with sucrose (30 gL-1), activated charcoal (2 and 4 gL-1) and agar (6 gL-1) at pH 5.7 for 8 weeks, for the conversion of the somatic embryos into plantlets. Each treatment was replicated three times (n = 10). All chemicals were sourced from Sigma Aldrich, Nigeria. Sucrose was sourced from a local store. All somatic embryo derived plantlets were evaluated under culture room conditions described above and then transplanted into 4 x 4 cm polyethylene bags with sterile top soil in the greenhouse. They were nursed under shade created with banana leaves and watered daily as required depending on weather conditions.



245

Data Collection and Statistical Analysis The experimental design used was a completely randomized block design. Data were collected on the number of leaf explants with embryogenic callus (expressed as a percentage of the total number of explants cultured per treatment), number of days to embryogenic callus production, number of days to somatic embryo production, the number of somatic embryos produced per treatment, and number of somatic embryos that converted into plants (expressed as a percentage of the total number of somatic embryos). The embryogenic callus and somatic embryo observation, count and photos were done with the aid of the customized software of amoebaTM Dual Purpose Digital Microscope at 200X (Celestron, USA). Data were subjected to analysis of variance (ANOVA) using GENSTAT for Windows 17th Edition (Genstat, Hemel Hempstead, UK 2010). Differences among means were considered significant at p ≤ 0.05. Separation of means was done using Duncan's multiple range test.

RESULTS Embryogenic Callus Production The leaf segments of CRIN TC1 only produced embryogenic callus (66.67%) with the highest 2,4-D concentration and sucrose (treatment T10) (Table 1). The leaf segments of CRIN TC2 produced ≥80% embryogenic callus on medium with 2,4-D and sucrose with the best response on moderate 2,4-D concentration (T7 and T8). The leaf segments of CRIN TC5 produced embryogenic callus (Figure 1C) on most treatments; production was especially good on media with 2,4-D and sucrose with 80% on four treatments (T2, T6, T9, T10), and 66.7% on five others (Table 1).


246


Days to Callus Formation Leaf segments of CRIN TC2 and CRIN TC5 on all media with sucrose that produced embryogenic callus required 10 to 12 days regardless of the treatment; those without sucrose required 16 to 21.5 days (Table 1). Differences in response to sucrose concentrations varied with the genotype. The only treatment which produced callus on CRIN TC1 required 16 days (Table 1). Table 1. Embryogenic callus production on leaf segments of T. cacao cultivars in response to 2,4-D and sucrose concentrations in media % of explants with embryogenic callus

Treatments

CRIN TC2 0e 66.7c 0e 0e 6.7e 40.0d 100.0a 100.0a 80.0b 80.0b

CRIN TC5 0d 80.0a 6.67c 66.7b 13.3c 80.0a 66.7b 66.7b 80.0a 80.0a

T1 0 0 0b 0c b T2 0.002 0 0 18.3a b T3 0.005 0 0 0c T4 0.007 0 0b 0c T5 0.009 0 0b 16.0ab b T6 0 30 0 11.7b b T7 0.002 30 0 10.7b b T8 0.005 30 0 11.7b b T9 0.007 30 0 10.3b a T10 0.009 30 16.0 10.3b Means with same letters for each cultivar are not significantly different by Duncan’s multiple range test at p ≤ 0.05. (n = 30 leaf segments).

0c 18.3ab 21.5a 19.0a 18.0ab 11.7b 10.5b 10.0b 11.0b 10.7b

T1 T2 T3 T4 T5 T6 T7 T8 T9 T10

2,4-D (mM) 0 0.002 0.005 0.007 0.009 0 0.002 0.005 0.007 0.009

Sucrose (gL-1) 0 0 0 0 0 30 30 30 30 30

CRIN TC1 0b 0b 0b 0b 0b 0b 0b 0b 0b 66.7a

Number of days to callusing



247

Days to Somatic Embryos Production In general, the treatments with sucrose produced somatic embryos in less time than those without (Table 2). It took 20.5 days for leaf segments of CRIN TC1 on medium with 0.009 mM 2,4-D + 30 gL1 sucrose to produce somatic embryos. For CRIN TC2 and CRIN TC5, somatic embryos were produced in 18 to 20 days on media with sucrose, while media without sucrose took 24 to 28 days. Table 2. Somatic embryo production in three T. cacao cultivars in response to 2,4-D and sucrose concentration in media Number of days to somatic embryo production

Treatments 2,4-D (mM) T1 0 T2 0.002 T3 0.005 T4 0.007 T5 0.009 T6 0 T7 0.002 T8 0.005 T9 0.007 T10 0.009

Sucrose (gL-1) 0 0 0 0 0 30 30 30 30 30

CRIN TC1 0b 0b 0b 0b 0b 0b 0b 0b 0b 20.5a

CRIN TC2 0c 26.3a 0c 0c 25.0a 19.3ab 19.7ab 18.0b 18.0b 18.0b

CRIN TC5 0c 27.3a 28.0a 27.5a 24.0ab 20.3ab 18.5b 20.0ab 18.7b 18.3b

Number of somatic embryo produced per treatment T1 0 0 0b 0h 0g T2 0.002 0 0b 21.7f 20.0e T3 0.005 0 0b 0h 59.3b T4 0.007 0 0b 0h 35.3d T5 0.009 0 0b 6.0g 13.0f T6 0 30 0b 57.3e 58.7b T7 0.002 30 0b 94.3b 45.7c T8 0.005 30 0b 73.7c 235.5a T9 0.007 30 0b 63.3d 66.0b T10 0.009 30 7.7a 139.3a 62.7b Means with same letters in a column are not significantly different by Duncan’s multiple range test at p ≤ 0.05.


248


Somatic Embryo Production Only one treatment (0.009 mM 2,4-D + 30 gL-1 sucrose) supported the production of somatic embryos (7.7) for CRIN TC1 (Table 2). This was also the best treatment for production of somatic embryos (139.3) in CRIN TC2. The highest number of somatic embryos (235.5) was produced on medium with 0.005 mM 2,4-D + 30 gL-1 sucrose by CRIN TC5 (Table 2, Figure 1D). This value was significantly higher than those of other treatments. The results of the present study indicate genotype x media interaction for somatic embryo production. In effect, the three genotypes would require different concentrations of 2,4-D and sucrose for optimum somatic embryo production (Table 2).

Figure 1. (A) Freshly harvested ‘CRIN TC5’ pod with seeds, (B) Mature cocoa seeds, (C) Mass of embryogenic callus observed within 4 weeks of leaf culture initiation, (D) Mass of somatic embryos observed within 12 weeks of initial leaf culture initiation, (E) Somatic embryos with shoots and roots (in circle) at 14 weeks of initial culture of explants (C, D, E, 200x).



249

Conversion of Somatic Embryos to Plantlets All the somatic embryos of CRIN TC1 (T10) converted to plants (100%). For CRIN TC2, a combination of 2,4-D and sucrose resulted in significantly higher number of plants than sucrose alone. With CRIN TC2 and CRIN TC5, all somatic embryos produced on media with 2,4-D and sucrose resulted in 100% plants. With CRIN TC5, there were no significant differences among sucrose treatments on the percentage of somatic embryos converted to plants (Table 3). The 2 and 4 gL-1 activated charcoal (data not shown) results were similar. Most of the somatic embryos produced a single shoot and root (Figure 1E). All the somatic embryo-derived plants appeared morphologically normal after subculture (Figure 2). Most plants transplanted in the green house survived (data not shown). Table 3. Effects of 2, 4-D and sucrose in media with activated charcoal (2 g/L) on conversion of somatic embryos to plantlets in three T. cacao varieties Treatments

2,4-D (mM)

Sucrose (gL-1)

CRIN CRIN CRIN TC5 TC1 TC2 T1 0 0 T2 0.002 0 100a 80c T3 0.005 0 100a T4 0.007 0 100a T5 0.009 0 90b 90b T6 0 30 80c 100a T7 0.002 30 100a 100a T8 0.005 30 100a 100a T9 0.007 30 100a 100a T10 0.009 30 100a 100a 100a Means with the same letters in each column are not significantly different by Duncan’s multiple range test at p ≤ 0.05.


250


Figure 2. Four-week old somatic-embryo derived plantlets of CRIN TC5 (1x) cultured on Murashige and Skoog (MS, 1962) basal medium with MS vitamins, sucrose (30 gL-1), activated charcoal (2 gL-1) and agar (6 gL-1) at pH 5.7.

DISCUSSION This study demonstrated that somatic embryos derived from cacao leaf cultures could be an important explant for micropropagation of cacao plants. Somatic embryogenesis is a reliable clonal propagation method for several tropical plants, particularly cacao (Maximova et al., 2002). Floral and nucellar (inner layer of ovule) tissues, immature zygotic embryos and cotyledons of primary somatic embryos are some of the common explant sources for somatic embryo production. Micropropagation of cacao following these methods have certain limitations (Esan, 1977; Maximova et al., 2002). For example, the histological study of cacao somatic embryos derived from floral tissues revealed a high number of abnormal embryos (Alemanno et al., 1996; 1997). This is the first report on the production of plants from somatic embryos derived from cacao leaf cultures. Previous studies on leaf-derived somatic embryos of T. cacao found that the embryos were unable to convert to plants (Litz, 1986). The plants resulting from somatic embryos in our study appeared normal.



251

Somatic embryo production in T. cacao typically takes about 6 to 8 months from initial culture initiation to somatic embryo production (Niemenak et al., 2008). There was a significant reduction in time to about 3 months following the protocols of this study. The findings of this study make important contribution towards improving the production of T. cacao plants by providing a rapid vegetative regeneration method for improved varieties. Since the past three decades that the work on leaf-derived T. cacao somatic embryos was reported, several leaf-derived somatic embryos including plantlet production has been demonstrated with other plant types including Lycium barbarum commonly known as goji or wolfberry using 1.0 mg/L 2,4-D and 0.1 mg/L BAP in MS medium (Osman et al., 2013). Joshee et al. (2007) worked on somatic embryogenesis and plant production with Centella asiatica L. using the leaf and the stolon tips as explants. The results showed that 4.52 µM 2,4-D favoured the induction of somatic embryos on the leaf culture. The stolon tips produced embryogenic calli with 9.04 μM 2,4-D. A number of factors, including genotype, can influence the results of somatic embryogenesis (Rout et al., 2006). In the current study, two of the three cacao cultivars produced more somatic embryos with 30 gL-1 sucrose than treatments without sucrose. This result is similar to reports from other studies that sucrose supports the production of somatic embryos of T. cacao and/or its conversion to plants (Traore et al., 2003; Traore and Guiltinan, 2006). The sucrose concentrations in those studies varied depending on the Theobroma cultivar used. For cacao cultivar Scavina6, more somatic embryos (157) were produced on a 30 gL-1 sucrose treatment than those on 40 gL-1 sucrose which produced 79 somatic embryos (Niemenak et al., 2008). In this study also, treatments with 0.005 mM 2,4D and 30 gL-1 sucrose produced the highest number of somatic embryos (235.5). This study and those of others confirm the important role of sucrose in combination with 2, 4-D in the T. cacao embryogenesis process. Activated charcoal is an important component of cacao tissue culture medium. It is known to adsorb phytochemical exudates that may be toxic to plant growth, and also promotes plant growth (Uchendu et al., 2011). There was no significant difference between the effects of 2 and 4 gL-1


252


activated charcoal on regeneration of plants from cacao somatic embryos. Lower concentrations of activated charcoal may not be good for plant development. For example, Kariyana and Kariyana (2013) showed that 2 gL-1 activated charcoal produced more in vitro shoots of a banana (Musa acuminata L.) cultivar Barangan than 0.5 and 1 gL-1 activated charcoal treatments. Also, Beshir et al., (2012) showed the importance of activated charcoal during in vitro culture of banana. The authors compared the effects of activated charcoal (1, 2.5 and 5 gL-1) on growth of banana tissue culture and found that charcoal promoted shoot growth with significantly more shoots produced at 5 gL-1 activated charcoal compared to 2.5 gL-1 whereas the reverse was the case for the number of roots. Activated charcoal higher than 4 gL-1 was not tested during this study. Excellent results were obtained with the activated charcoal treatments tested in the current study for plant regeneration from cacao somatic embryos. No deleterious browning of tissues was observed on any of the three cultivars. We did not carry out a study on the somatic embryo-derived plantlets to determine its genetic status. Since they originated from juvenile leaves of seed-derived seedlings of improved cultivars, results of these preliminary studies provided basic information on a working protocol that could be used on the juvenile leaves from high yielding trees of these elite cultivars. The somatic embryos derived from this study can be used as germplasm to develop a long term conservation system through cryopreservation.

ACKNOWLEDGMENTS This project was made possible through financial and material supports received by the Department of Agronomy from the National Biotechnology Development Agency (NABDA), Abuja, Nigeria and the Alliance for a Green Revolution in Africa (AGRA) towards the improvement of the Biotechnology Laboratory in which this study was carried out, and also a research grant from the Tertiary Education Trust Fund (TETFUND), Nigeria awarded to Esther E. Uchendu PhD.



253

REFERENCES Agropolis A, Botanique L, De Pharmacie A, De Mycologie P and Cefe U (2003). Localization and identification of phenolic compounds in Theobroma cacao L. somatic embryogenesis. Annals of Botany 92: 613-623. Ajijah N, Hartati RS, Rubiyo R, Sukma D and Sudarsono S (2016). Effective cacao somatic embryo regeneration on kinetin supplemented DKW medium and somaclonal variation assessment using SSRs markers. AGRIVITA 38(1): 80-92. Alemanno L, Berthouly M and Michaux-Ferrière N (1996). Histology of somatic embryogenesis from floral tissues cocoa. Plant Cell Tissue and Organ Culture 46 (3): 187-194. Alemanno L, Berthouly M and Michaux-Ferriere N (1997). A comparison between Theobroma cacao L. zygotic embryogenesis and somatic embryogenesis from floral explants. In Vitro Cellular and Developmental Biology-Plant 33 (3): 163-172. DOI:10.1007/s11627997-0016-8. Alvarenga VS, de Bem Bianchetti L, López González PE, Sandoval OE and Zacher de Martínez MB (2002). Cacao. In: Pence VC, Sandoval JA, Villalobos AVM and Engelmann F (eds). In Vitro Collecting Techniques for Germplasm Conservation. IPGRI Technical Bulletin No. 7. International Plant Genetic Resources Institute, Rome, Italy. Arnold AE, Mejı LC, Kyllo D, Rojas EI, Maynard Z, Robbins N and Herre EA (2003). Fungal endophytes limit pathogen damage in a tropical tree. Proceedings of the National Academy of Sciences of the United States of America 100 (26):15649-15654. Beshir I, Sharbasy SE, Safwat G and Diab A (2012). The effect of some natural materials in the development of shoot and root of banana (Musa spp.) using tissue culture technology. New York Science Journal 5 (1): 132-138. Esan EB (1977). Tissue culture studies on cacao (Theobroma cacao L.). A supplementation of current research. In: Proceedings of the 5th


254


International Cacao Research Conference 1975, Ibadan, Nigeria. pp 116-125. Florez SL, Erwin RL, Maximova SN, Guiltinan MJ and Curtis WR (2015). Enhanced somatic embryogenesis in Theobroma cacao using the homologous BABY BOOM transcription factor. BMC Plant Biology 15: 121. Figueira A and Janick J (1995). Somatic embryogenesis in cacao (Theobroma cacao L.). In: Jain S, Gupta P, Newton R (eds). Somatic Embryogenesis in Woody Plants. The Netherlands: Kluwer Academic Publishers. Vol. 2, pp 291-310. Irizarry H and Rivera E (1998). Early yield of five cacao families at three locations in Puerto Rico. Journal of Agriculture of the University of Puerto Rico 82: 163-171. Joshee N, Biswas BK and Yadav AK (2007). Somatic embryogenesis and plant development in Centella asiatica L., a highly prized medicinal plant of the tropics. HortScience 42(3):633-637. Kariyana N and Kariyana K (2013). Effect of ascorbic acid, activated charcoal and light duration on shoot regeneration of banana cultivar barangan (Musa acuminata L.) in vitro culture. International Journal of Recent Research and Applied Studies 15 (1): 13-17. Li Z, Traore A, Maximova S, Guiltinan M (1998). Somatic embryogenesis and plant regeneration from floral explants of cacao (Theobroma cacao L.) using thidiazuron. In Vitro Cellular and Developmental Biology-Plant 34:293–299. Linsmaier EM and Skoog G (1965). Organic growth factor requirements of tobacco tissue cultures. Physiologia Plantarum 18 (1): 100-127. Litz RE (1986). Tissue culture studies with Theobroma cacao. In: Dimick, P. S. (ed) Cacao Biotechnology Symposium, Tropical Research and Education Center: University of Florida, IFAS Department of Food Science, College of Agriculture, The Pennsylvania State University. pp 111-120. Maximova SN, Alemanno L, Young A, Ferriere N, Traore A and Guiltinan M (2002). Efficiency, genotypic variability, and cellular origin of primary and secondary somatic embryogenesis of Theobroma cacao



255

L.: In Vitro Cellular and Developmental Biology-Plant 38 (3): 252259. Maximova SN, Young A, Pishak S, Miller C, Traore A and Guiltinan MJ (2005). Integrated system for propagation of Theobroma cacao L., In: Mohan JS; Gupta, P K (eds). Protocol for Somatic Embryogenesis in Woody Plants, Series: Forestry Sciences, Vol. 77. Springer, Dordrecht, The Netherlands. ISBN: 1-4020-2984-5. Murashige T and Skoog F (1962). A revised medium for rapid growth and bioassays with tobacco tissue cultures. Plant Physiology 15: 473-497. Niemenak N, Saare-Surminski K, Rohsius C, Ndoumou DO and Lieberei R (2008). Regeneration of somatic embryos in Theobroma cacao L. in temporary immersion bioreactor and analyses of free amino acids in different tissues. Plant Cell Reports 27(4): 667-676. Niemenak N, Awah TM and Lieberei R (2012). Establishement of suspension cultures in Theobroma cacao and polyamines associated with cacao embryogenesis. Plant Growth Regulation 67 (1):1-8. Orchard JE, Collin HA and Hardwick K (1979). Culture of shoot apices of Theobroma cacao. Physiologia Plantarum 47(4): 207-210. Osman NI, Awal A, Sidik NJ and Abdullah S, (2013). Callus induction and somatic embryogenesis from leaf and nodal explants of Lycium barbarum L. (Goji). Biotechnology 12: 36-45. DOI: 10.3923/ biotech. 2013.36.45. Pereira JL, Serôdio MH and Bezerra JL (2000). Proceedings of the ’Technical Meeting’: State of knowledge on mass production of genetically improved propagules of cocoa, October 19th to 23rd, 1998, Ilhéus, Bahia, Brazil, pp 156. Quainoo AK, Wetten AC and Allainguillaume J (2008). The effectiveness of somatic embryogenesis in eliminating the cocoa swollen shoot virus from infected cocoa trees. Journal of Virological Methods 149: 91-96. Rout GR, Mohapatra A and Jain SM (2006). Tissue culture of ornamental pot plant : A critical review on present scenario and future prospects. Biotechnology Advances 24:531-560.


256


Tan CL and Furtek DB (2003). Development of an in vitro regeneration system for Theobroma cacao from mature tissues. Plant Science 164 (3): 407-412. Traore A, Maximova SN and Guiltinan MJ (2003). Micropropagation of Theobroma cacao using somatic embryo derived plants. In Vitro Cellular and Developmental Biology-Plant 39 (3):332-337. DOI:10.1079/ IVP2002409. Traore A and Guiltinan MJ (2006). Effects of carbon source and explant type on somatic embryogenesis of four cacao genotypes. HortScience 41(3): 753-758. Uchendu C, Ambali SF and Ayo JO (2012). The organophosphate, chlorpyrifos, oxidative stress and the role of some antioxidants: A review. African Journal of Agricultural Research 7 (18): 2720-2728. Uchendu EE, Paliyath G, Brown DCW and Saxena PK (2011). In vitro propagation of the North American ginseng (Panax quinquefolius L.). In Vitro Cellular and Developmental Biology-Plant 47(6): 710-718. Uchendu EE, Leonard SW, Traber MG and Reed BM (2010). Vitamin E and C reduces lipid peroxidation and improves regrowth of blackberry shoot tips following cryopreservation. Plant Cell Reports 29(1): 25-35.



Chapter 10

SALT STRESS ALLEVIATION AND ANTIOXIDANTS CHANGES IN MYCORRHIZAL STRAWBERRY PLANTS Shiam Ibna Haque1 and Yoh-ichi Matsubara2, 1

The United Graduate School of Agricultural Science, Gifu University, Gifu, Japan 2 Faculty of Applied Biological Sciences, Gifu University, Gifu, Japan

ABSTRACT Salt tolerance and the changes of antioxidative ability in mycorrhizal strawberry plants were investigated. Arbuscular mycorrhizal fungi (AMF) Gigaspora margarita, were inoculated in strawberry (Fragaria × ananssa. Duch) plants. Plants were treated with no salt, 200mM and 500mM NaCl solution. Different morphological and physiological growth parameters were compared between mycorrhizal and nonmycorrhizal plants. The AMF symbiosis enhanced plant growth under salt stress condition. The Na+ accumulation was markedly lower in 



258

Shiam Ibna Haque and Yoh-ichi Matsubara mycorrhizal plants than the control plants. The mycorrhizal plants showed an increased activity of enzymatic antioxidant superoxide dismutase and the antioxidative molecule 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical scavenging activity than the control plants under salt stress conditions. Stress severities were not varying from 200mM to 500mM NaCl application. So, AMF can alleviate the salinity-induced negative impact on strawberry plant growth by reducing the oxidative damages.

INTRODUCTION Soil salinity is one of the major agricultural and environmental problems and nowadays it is increasing steadily in many parts of the world (Evelin et al., 2009; Porcel et al., 2012). The presence of excess Na+ in the soil caused osmotic stress that reduces the osmotic potential of the soil solution and prevents water absorption by the plant roots (Rasool et al., 2013). Strawberries (Fragaria × ananassa Duch.) dominate the world berry production and are cultivated in Europe, Asia, North and South America with a big commercial importance (Alkan Torun et al., 2014). Strawberry cultivation is suitable for both greenhouse and opens field condition, however, it is regarded as a salt-sensitive crop and it has been shown that salt stress conditions unfavourably affect plant growth and yield (Karlidag et al., 2009). In particular, salinity is a serious problem in greenhouse conditions due to the fact that a certain area of space is used continuously and intensively with the salt included fertilizers (Yildirim et al., 2009). Therefore, studies are needed to find cultivation strategies for strawberry in salt stress condition. Salt stress is also linked to an oxidative stress as a consequence of the generation of reactive oxygen species, such as superoxide ion, hydrogen peroxide and hydroxyl radicals, which are detrimental to plant survival under salt stress (Evelin et al., 2009). Plants have two antioxidative systems to counter the effects of reactive oxygen species (ROS): enzymatic and non-enzymatic scavenging systems. Enzymatic scavenging systems include superoxide dismutase, catalase, peroxidase, ascorbate peroxidase,


Salt Stress Alleviation and Antioxidants Changes ...

259

and glutathione reductase. Non-enzymatic antioxidants ascorbic acid, glutathione, α-tocopherol, and carotenoids are also played important roles in the removal of toxic byproducts of O2 (Gill and Tuteja, 2010). Arbuscular mycorrhizal fungi (AMF) establish symbiotic associations with the root of 70-90% of terrestrial plant species including halophytes, hydrophytes, and xerophytes (Ruiz-Lozano et al., 2012). This symbiosis makes the host plant more tolerant to abiotic stresses (Dodd and RuizLozano, 2012). AMF symbiosis helps plants to alleviate salt stress by enhancing the activities of antioxidant enzymes (Zhong et al., 2007). However, antioxidant enzyme activities vary with the plant organ (RiosGonzalez et al., 2002) as well as the severity and duration of stress (DOS) (Abogadallah, 2010). In this chapter, we discuss the influence of AMF on salt stress alleviation and antioxidants changes in strawberry plants.

ESTIMATION OF SALT TOLERANCE IN MYCORRHIZAL STRAWBERRY PLANTS Strawberry (Fragaria × ananassa Duch., cv. Tochiotome) runner plants were planted in plastic pots (10.5cm diameter) containing autoclaved (121C, 1.2kg/cm2, 30min) commercial potting media (Canadian sphagnum peat moss 85%, Perlite, Vermiculite, Dolomitic and calcitic limestone and wetting agent). At the time of transplanting plants were inoculated with 5g of AM fungus Gigaspora margarita inocula. The inocula were supplied by Idemitsu Agri. Co. Ltd. Tokyo, Japan. The uninoculated control plants received the same amount of autoclaved inocula. Plants were also fertilized with slow release granular fertilizer (13N-11P13K, 1g/plant) and grown in a greenhouse. Ten weeks after AMF inoculation, both control and mycorrhizal plants were treated with three salt conditions, no salt, 200mM, and 500mM NaCl solution. Each treatment contains 12 plants in a completely randomized design with 3 replications at a time. Three weeks of salt treatment, when plants showed salt stressed symptom (browning of compatible leaf and petiole),


260

Shiam Ibna Haque and Yoh-ichi Matsubara

all the plants were uprooted. After uproots, 6 plants from each treatment were used to measuring dry weight and others were preserved in liquid nitrogen and keep them -35C for further analysis. For the analysis of AMF colonization level, lateral roots of strawberry plants were preserved with 70% ethanol and stained according to Phillips and Hayman (1970). The rate of colonization in 1-cm segment of lateral roots (RFCSL) was calculated. Hence, RFCSL expressed the percentage of 1-cm AMFcolonized segments of lateral roots; the number of the total segment was 50 per plant. Average colonization was calculated from the value of 10 plants with 3 replications. Na+ content in leaves and roots were measured using COMPACT Na+ meter HORIBA, Ltd, Japan. Mean values were separated using t-test at P ≤ 0.05 for colonization level and others were by Tukey’s multiple tests at P ≤ 0.05. Thirteen weeks after AMF inoculation, within three weeks of salt stress, colonization occurred successfully in all the inoculated plants. Colonization level reached up to 60% (data not shown) in without salt stress conditions. However, the salt stressed plants showed significantly less colonization than the non-stressed plants. This decreased of colonization level most likely due to the direct effect of salinity on AM fungal hyphae growth and spore germination. Beyond this colonization, the mycorrhizal plants had higher shoots and roots dry weight than nonmycorrhizal plants (Figure 1a). The higher dry weight indicates the growth enhancement through symbiosis appeared in mycorrhizal plants. The beneficial effects of different AMF on plant growth and development under saline conditions have been shown in a number of plant species like lettuce and strawberry (Jahromi et al., 2008; Fan et al., 2011). Moreover, Jahromi et al. (2008) and Alenazi et al. (2015) stated that mycorrhizal lettuce and tomato plants grew better than non-mycorrhizal plants under salt stress conditions when AMF symbiosis was well established. In the present study, colonization confirmed under salt stress and higher dry weight indicates better growth of mycorrhizal plants.


Dry weight of shoots (g)

Salt Stress Alleviation and Antioxidants Changes ... 5 4

ab

2 1 C

GM

C

GM

C

200

0

GM 500

1 b

bc

2

ab ac a

a

3 Na⁺ content in leaves (mg/gFW)

ab

b

0 Dry weight of roots (g)

a

a

a

3

0

Na⁺ content in roots (mg/gFW)

261

(a)

1.8 a

b

1.2

0.6 c 0

d

d

d

C

GM

C

0

e

GM

C

200

0

GM 500

e

0.5

1

d c

1.5 2

a

b

(b)

Figure 1. (a) Dry weight of strawberry plants, (b) Na⁺content in leaves and roots of strawberry plants. C, control; GM, Gigaspora margarita; 0, no salt; 200, NaCl 200mM; 500, NaCl 500mM. Bars represent standard errors (n = 6). Columns denoted by different letters indicate significant according to Tukey’s test (P ≤ 0.05).


262


Under salt stress, Na+ content in plant leaves and roots were high, however, the mycorrhizal plants accumulate less Na+ compared with nonmycorrhizal plants (Figure 1b). A lower Na+ contents indicates the reduction of the negative effects of salt in plants. Previously, maize plants inoculated with AM fungus Glomus etunicatum showed a decreased Na+ level was mentioned by Zhu et al. (2010). The lower Na+ contents lead to better functioning of photosynthetic machinery. Therefore, higher dry weight and low Na+ contents indicate the alleviation of the negative effects of salt in strawberry plants.

EFFECTS OF AMF ON ANTIOXIDATIVE ABILITY Increase in antioxidants activity under salt stress is an important criterion of salt tolerance (Ahmad et al., 2010). As for enzymatic antioxidants, superoxide dismutase (SOD) is the first line of defence that catalyzes the disproportionate of O2− to H2O2 and O2. It removes O2− and hence decreases the risk of OH_ formation from O2− via the metalcatalyzed Haber-Weiss type reaction. In this study, SOD activity was determined using the nitro blue tetrazolium (NBT) reduction method (Beauchamp and Fridovich, 1971). One unit of SOD activity was defined as the amount of enzyme required to cause 50% inhibition of the rate of NBT reduction measured at 560nm using a spectrophotometer (U-1900, HITACHI, Tokyo, Japan). SOD activity was higher in mycorrhizal plants than the non-mycorrhizal plants under salt stress condition (Figure 2a). Higher SOD activity in mycorrhizal plants may be due to a stimulation of plant SOD enzyme or enzyme-encoding genes by the AMF symbiosis (Ruiz-Lozano et al., 2012). In present study, higher SOD activity was observed in mycorrhizal plants. This is consistent with previous observations on shoots of tomato plants colonized by Glomus intraradices subjected to NaCl salinity (Hajiboland et al., 2010).



SOD activty in leaves (unit/gFW)

240

a a

180

ab

b

b b

120

60

0 C

GM

C

GM

C

GM

200

0 SOD activty in roots (unit/gFW)

263

500

0

50

100

c

bc c

150

b

b

a

200

(a)

DPPH radical scavenging activity in leaves (mg/gFW)

25 a

a

a

b

15 10 5

d

0 C

GM

C

GM

GM

C

200

0 DPPH radical scavenging activity in roots (mg/gFW)

a

20

500

0 c

5 10 15 20 ab 25

a

a

b

b

(b)

Figure 2. (a) SOD activity and (b) DPPH radical scavenging activity in leaves and roots of strawberry plants. C, control; GM, Gigaspora margarita; 0, no salt; 200, NaCl 200mM; 500, NaCl 500mM. Bars represent standard errors (n = 6). Columns denoted by different letters indicate significant according to Tukey’s test (P ≤ 0.05).


264


1,1-Diphenyl-2-picrylhydrazyl (DPPH) is a common organic chemical compound and is a well-known radical scavenger. DPPH radical scavenging activity is a rapid, simple and inexpensive method to measure antioxidant capacity in biological compounds and involves the use of the free-radical DPPH (Marxen et al., 2007). In the present study, DPPH radical scavenging activity was measured according to the Burits and Bucar (2000). Plant samples were extracted with ethanol at a ratio of 0.15 g/3ml, and the extracts were mixed with 2.7ml of 20% ethanol solution of DPPH. After incubating for 30min, the absorbance of the sample was read at 520nm using a (HITACHI U-1900) spectrophotometer. DPPH radical scavenging activity was calculated as the percentage inhibition relative to the control. The analysis of strawberry plants under salt stress and without stress conditions revealed a mycorrhizal-induced DPPH radical scavenging activity which is concomitant with the enhancement of antioxidative activity by the mycorrhizal symbiosis (Figure 2b). Hichem et al. (2009) reported that an increased DPPH radical scavenging activity induced salt tolerance in maize plants. However, the AMF symbiosis affects antioxidants production under salt stress, the exact mechanism remain unclear. The growth of mycorrhizal strawberry plants was more vigorous than that of non-mycorrhizal plants, while antioxidants production was higher in mycorrhizal plants. From above fact, mycorrhizal symbiosis can alleviate ROS damages, resulted in the protection of plants against oxidation and improved growth under salt stress condition. We also consider that the stress severities were not varying in 200mM to 500mM NaCl application in strawberry plants. So, 200mM NaCl application might be enough stress for the measurement of salt tolerance in strawberry plants.

CONCLUSION Soil salinity is one of the important agricultural problem and during salinity stress within a plant, major processes, such as protein synthesis, energy, lipid metabolism, and photosynthesis are disrupted (Evelin et al., 2009). The salt stress tolerance in plants has been associated with the



265

induction of antioxidants and reduction of oxidative damages (RuizLozano et al., 2012). AMF are ubiquitous soil inhabitants and from a symbiotic relationship with the roots of most terrestrial plants. AMF promote host plant growth and showed tolerance from different biotic and abiotic stress factors. In this study, AMF inoculated strawberry plants accumulate a higher dry weight and low Na+ contents under salt stress conditions. So, AMF alleviated salt stress in strawberry plants. On the other hand, higher SOD and DPPH activity revealed that mycorrhizal symbiosis can alleviate common ROS damage, resulted in the protection of plants against oxidation and improved growth under salt stress condition. However, the other antioxidative enzyme like ascorbate peroxidise (APX), peroxidise (PX), glutathione reductase (GR), catalase (CAT) and antioxidative molecules polyphenols, ascorbic acid, carotenoids and glutathione activities under salt stress in mycorrhizal plants were still unclear. So, later details investigation will be needed to check the correlation of antioxidant capacity and salt tolerance in mycorrhizal strawberry plants.

REFERENCES Abogadallah, G. M. (2010). Antioxidative defense under salt stress. Plant Signal and Behavior. 5, 369-374. Ahmad, P., Jaleel, C. A., Salem, M. A., Nabi, G. and Sharma, S. (2010). Roles of enzymatic and non-enzymatic antioxidants in plants during abiotic stress. Critical Reviews in Biotechnology, 30, 161-175. Alenazi, M., Egamberdieva, D. and Ahmad, P. (2015). Arbuscular mycorrhizal fungi mitigates NaCl induced adverse effects on Solanum Lycopersicum. L. Pakistan Journal of Botany, 47, 327-340. Alkan Torun, A., Aka Kacar, Y., Bicen, B., Erdem, N. and Serce, S. (2014). In vitro screening of octoploid Fragaria chiloensis and Fragaria virginiana genotypes against iron deficiency. Turkish Journal of Agriculture and Forestry, 38, 169-174.


266


Beauchamp, C. and Fridovich, I. (1971). Superoxide dismutase: improved assays and an assay applicable to acrylamide gels. Analytical Biochemistry, 44, 276-287. Burits, M. and Bucar, F. (2000). Antioxidant activity of Nigella sativa essential oil. Phytotherapy Research, 14, 323-328. Dodd, I. C. and Ruiz-Lozano, J. M. (2012). Microbial enhancement of crop resource use efficiency. Current Opinion in Biotecnology, 23, 236-242. Evelin, H., Kapoor, R. and Giri, B. (2009). Arbuscular mycorrhizal fungi in alleviation of salt stress: a review. Annals of Botany, 104, 12631281. Fan, L., Dalpe, Y., Fang, C., Dube, C. and Khanizadeh, S. (2011) Influence of arbuscular mycorrhizae on biomass and root morphology of selected strawberry cultivars under salt stress. Botany, 89, 397-403. Gill, S. S. and Tuteja, N. (2010). Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiology and Biochemistry, 48, 909-930. Hajiboland, R., Aliasgharzadeh, N., Laiegh, S. F., and Poschenrieder, C. (2010). Colonization with arbuscular mycorrhizal fungi improves salinity tolerance of tomato (Solanum lycopersicum L.) plants. Plant and Soil, 331, 313-327. Hichem, H., Mounir, D. and Naceur, E. A. (2009) Differential responses of two maize (Zea mays L.) varieties to salt stress: changes on polyphenols composition of foliage and oxidative damages. Industrial. Crops and Produts, 30, 144-151. Jahromi, F., Aroca, R., Porcel, R. and Ruiz-Lozano, J. M. (2008). Influence of salinity on the in vitro development of Glomus intraradices and on the in vivo physiological and molecular responses of mycorrhizal lettuce plants. Microbial Ecology, 55, 45-53. Karlidag, H., Yildirim, E., Turan, M. (2009). Salicylic acid ameliorates the adverse effect of salt stress on strawberry. Scientia Agricola, 66, 180187. Marxen, K., Vanselow, K. H., Lippemeier, S., Hintze, R., Ruser, A. and Hansen, U. P. (2007) Determination of DPPH radical oxidation caused



267

by methanolic extracts of some microalgal species by linear regression analysis of spectrophotometric measurements. Sensors, 7, 2080-2095. Phillips, J. M. and Hayman, D. S. (1970). Improved procedures for clearing roots and staining parasitic and vesicular-arbuscular mycorrhizal fungi for rapid assessment of infection. Transactions of the British Mycological Society, 55, 158IN16-161IN18. Porcel R., Aroca, R., Ruiz-Lozano, J. M. (2012). Salinity stress alleviation using arbuscular mycorrhizal fungi. A review. Agronomy of Sustainable Development, 32, 181-200. Rasool, S., Ahmad, A., Siddiqi, T. O. and Ahmad, P. (2013). Changes in growth, lipid peroxidation and some key antioxidant enzymes in chickpea genotypes under salt stress. Acta Physiologiae Plantarum, 35, 1039-1050. Rios-Gonzalez, K., Erdei, L. and Lips, S. H. (2002). The activity of antioxidant enzymes in maize and sunflower seedlings as affected by salinity and different nitrogen sources. Plant Science, 162, 923-930. Ruiz-Lozano, J. M., Porcel, R., Azcón, C. and Aroca, R. (2012). Regulation by arbuscular mycorrhizae of the integrated physiological response to salinity in plants: new challenges in physiological and molecular studies. Journal of Experimental Botany, 63, 4033-4044. Yildirim, E., Karlidag, H., Turan, M. (2009). Mitigation of salt stress in strawberry by foliar K, Ca and Mg nutrient supply. Plant Soil and Environment, 55, 213-221. Zhong Qun, H., Chao Xing, H., Zhibin, Z., Zhirong, Z. and Huai Song, W. (2007). Changes in antioxidative enzymes and cell membrane osmosis in tomato colonized by arbuscular mycorrhizae under NaCl stress. Colloids and Surfaces B: Biointerfaces, 59, 128-133. Zhu, X. C., Song, F. B. and Xu, H. W. (2010). Arbuscular mycorrhizae improves low temp stress in maize via alterations in host water status and photosynthesis. Plant and Soil, 331. 129-137.



INDEX # 2,4-dichlorophenoxyacetic acid, 240

A acid, vii, xi, 16, 17, 20, 21, 22, 26, 39, 43, 83, 119, 120, 121, 122, 123, 124, 131, 137, 138, 139, 140, 141, 142, 152, 176, 182, 199, 201, 240, 242, 244, 254, 259, 265, 266 active compound, 155, 176 adaptation(s), vii, ix, 1, 2, 4, 6, 7, 22, 23, 24, 103, 107, 108, 109, 117 adverse effects, 76, 123, 265 adverse weather, 210 agar, 49, 51, 58, 67, 69, 182, 243, 244, 250 agricultural economics, 107 agricultural practices, 86, 88, 92, 111 agricultural sector, 210 agriculture, xiii, 4, 13, 16, 17, 88, 89, 91, 92, 93, 101, 104, 105, 106, 107, 108, 110, 111, 112, 114, 116, 205, 209 agro-industrial residues, 120, 126, 141 agro-industrial substrates, vii, xi, 120, 138

air pollutants, 25 air quality, 87 air temperature, 76, 77 alcohols, 14, 17, 19, 22, 169, 170 aldehydes, 14, 17, 155 alfalfa, 195, 196 AMF, xiv, 257, 259, 260, 262, 264, 265 amino acid, 25, 125, 135, 255 ammonium, 58, 66, 122 anaerobic digestion, 130 antibacterial activity, 157, 176, 179, 185, 186 antifungal, xi, 5, 13, 16, 17, 18, 19, 20, 21, 22, 24, 28, 33, 34, 35, 38, 47, 69, 82, 145, 156, 160, 163, 176, 182, 185, 187 antifungal properties, xi, 5, 13, 16, 145, 156, 160, 182 anti-inflammatory, viii, xi, 145, 148, 158, 159, 199 antimicrobial activity, 17, 19, 20, 21, 23, 36, 168, 174, 175, 176, 178, 182, 185, 186 antioxidant, xiv, 17, 19, 32, 169, 176, 182, 184, 185, 186, 199, 258, 259, 264, 265, 266, 267 antioxidative ability, viii, xiv, 257 antioxidative activity, 264


270

Index

anti-plasmodial activity, 158 anti-proliferative properties, 157 anti-trypanosomal property, 159 arbuscular mycorrhizal fungi, 266, 267 aroma, 17, 31, 148, 154, 155, 161 aromatic compounds, 22 aromatic hydrocarbons, 11, 12, 25, 36 ascorbic acid, 242, 254, 259, 265 Aspergillus niger, xi, 119, 120, 125, 129, 131, 132, 136, 137, 138, 139, 140, 141, 142, 143, 169, 174, 175 asthma, viii, xi, 18, 145, 148, 158, 161 atmosphere, 218, 221, 228, 230 atmospheric nitrogen, 94 augmentation, 96

B Bacillus subtilis, 44, 157, 169, 175 bacteria, x, 3, 5, 16, 26, 41, 43, 44, 47, 49, 54, 55, 57, 76, 97, 98, 125, 169, 175, 179, 182, 186 bactericides, 44, 45 bacterium, x, 41, 42, 83, 175 beverages, xi, 119, 120, 164 biocontrol, 5, 18, 23, 46, 47, 51, 52, 57, 60, 61, 81, 82, 151 biodegradation, ix, 2, 3, 4, 24, 27, 36 biodiversity, 88, 92, 108, 117 biological activity, xii, 88, 164, 168, 169, 176, 184 biological control, 44, 95, 113, 114 biologically active compounds, 176 biomass, 25, 122, 141, 266 biomolecules, 16, 136 bioremediation, vii, ix, 2, 4, 8, 12, 13, 24, 25, 27, 29, 35, 39 biosynthesis, 27, 38 biotechnology, 40, 241 biotic, 5, 47, 105, 265

Buenos Aires, vi, viii, xiii, 209, 210, 212, 213, 216, 217, 219, 222, 223, 226, 228, 229, 230, 232, 234

C cacao, vi, viii, xiii, 143, 239, 240, 241, 242, 246, 247, 249, 250, 251, 253, 254, 255, 256 Caesalpinia spinosa, xii, 189, 190, 192, 193, 202, 203, 204, 205, 206, 207 candidiasis, viii, xi, 145 carbamazepine, 12 carbohydrates, 22, 122, 133, 201 carbon, 3, 6, 15, 93, 94, 122, 123, 136, 139, 256 carotenoids, 259, 265 cassava bagasse, xi, 120, 127, 128, 132, 138, 141 cellulose, viii, 1, 3, 6, 12, 68, 122 chemical, ix, 2, 3, 4, 5, 9, 15, 20, 21, 22, 23, 44, 45, 46, 57, 76, 87, 96, 105, 124, 127, 130, 131, 133, 135, 138, 141, 153, 155, 157, 163, 164, 170, 174, 176, 179, 186, 202, 264 chromatography, 28, 155, 164, 165, 172, 173 circulation, 212, 217, 221, 235, 237, 238 citric acid, vii, xi, 119, 120, 137, 138, 139, 140, 141, 142 citric pulp, xi, 120, 127, 128, 133, 138, 142 climate, vii, x, 85, 93, 94, 99, 102, 104, 105, 107, 108, 109, 111, 116, 117, 193, 210, 211, 212, 213, 217, 218, 220, 234, 235, 236, 237, 238 climate change, vii, x, 85, 93, 94, 99, 102, 105, 108, 109, 111, 117 climatic factors, 77, 210 cocoa, xi, 107, 112, 120, 128, 135, 136, 137, 138, 143, 240, 243, 248, 253, 255 cocoa husks, xi, 120, 135, 136, 137, 138


Index commercial, xii, 96, 124, 125, 149, 159, 167, 205, 243, 258, 259 commercialisation, 148 compounds, viii, ix, xii, 1, 2, 4, 5, 6, 9, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 25, 31, 34, 42, 46, 47, 57, 122, 152, 154, 155, 168, 170, 172, 173, 174, 179, 181, 184, 242, 253, 264 conservation, xiii, 103, 108, 110, 112, 116, 160, 190, 206, 252 constituents, xi, 3, 27, 32, 36, 39, 145, 146, 151, 155, 157, 185 contamination, 123, 178, 242 corolla, 146, 147, 192 cosmetic, xii, 17, 167, 168, 174, 176, 178, 179, 181, 184, 186, 187 cosmetic preparations, 168, 178, 187 cosmetics, xii, 4, 16, 167, 174, 178, 179 crop cultivation, 86 crop demand, 97 crop production, vii, x, 86, 87, 89, 90, 92, 93, 97, 100, 103, 104, 105, 106, 107, 109, 113, 116, 117, 118 crop(s), vii, x, xiii, 42, 45, 46, 53, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 97, 98, 99, 100, 103, 104, 105, 106, 107, 108, 109, 110, 113, 114, 115, 116, 117, 118, 125, 195, 210, 211, 239, 258, 266 cryopreservation, 252, 256 cultivars, viii, xiv, 186, 240, 241, 242, 243, 246, 247, 251, 252, 266 cultivation, vi, x, xi, 23, 40, 42, 52, 60, 80, 81, 85, 86, 88, 90, 92, 103, 125, 145, 146, 149, 150, 151, 159, 163, 199, 203, 204, 258 cultural practices, xiii, 95, 190, 202 culture, 22, 25, 30, 31, 34, 37, 38, 40, 50, 51, 52, 56, 59, 60, 65, 66, 69, 70, 73, 75, 123, 129, 136, 138, 139, 140, 150, 242, 243, 244, 248, 251, 253, 254, 255 culture conditions, 25 culture media, 22, 50, 66, 73, 244

271

culture medium, 37, 242, 243, 244, 251 curzerenone, 152, 155, 157

D damping off, 150 decay, 6, 26, 30, 31, 34, 38, 150 decontamination, 9, 10, 22 degradation, vii, viii, ix, x, 2, 3, 5, 7, 8, 9, 10, 11, 12, 13, 23, 26, 28, 29, 32, 35, 36, 38, 40, 85, 90, 91, 92, 93, 95, 105, 110, 115, 117, 118, 121 degradation process, 12 degradation rate, 35 diseases, x, xii, 13, 16, 42, 47, 77, 87, 94, 98, 111, 115, 117, 146, 151, 195, 200, 241 distillation, 169, 170, 182 distilled water, 50, 243 distribution, xiii, 8, 179, 181, 190, 201, 213 diterpenoids, 152 diversity, 14, 16, 93, 94, 105, 116, 203, 206, 210 drought, 89, 91, 116, 210, 237 dry matter, 129, 135 drying, viii, xii, 168, 169, 170, 181, 182, 183, 184, 187 dyes, ix, 2, 9, 10, 11, 24, 25, 27, 30, 33, 34, 35, 36, 37, 196, 199 dysmenorrhea, 148, 158, 162

E earthworms, 90, 115 ecological preferences, xiii, 190 ecological restoration, 194 ecology, viii, xiii, 24, 25, 27, 28, 30, 31, 38, 79, 81, 83, 116, 190, 193, 207, 266 economic importance, xiii, 22, 190, 202, 239 economic losses, 211


272

Index

economic resources, xiii, 209 economics, 107, 138, 141 ecosystem, 87, 91, 92, 93, 94, 95, 195, El Niño, viii, xiii, 203, 210, 211, 219, 220, 221, 234, 236, 237, 238 embryogenesis, viii, xiv, 239, 240, 241, 242, 250, 251, 253, 254, 255, 256 energy, xi, 5, 6, 92, 119, 222, 264 environmental conditions, 98, 121 environmental degradation, vii, x, 85, 90, 92 environmental factors, 4 environmental quality, 6 environment(s), viii, xi, 2, 3, 4, 5, 10, 12, 16, 27, 56, 86, 96, 100, 105, 109, 115, 125, 132, 150, 194, 201 enzyme inhibitors, 47 enzyme(s), viii, ix, 2, 3, 5, 6, 7, 8, 9, 10, 11, 18, 19, 24, 25, 26, 32, 35, 37, 40, 44, 47, 54, 55, 60, 66, 74, 94, 121, 122, 125, 196, 259, 262, 265, 267 eosinophils, 158 epi-curzerenone, 152, 157, 159 erosion, 90, 92, 93, 200 ester(s), 14, 16, 27, 28, 30, 39, 155, 178, 182 ethanol, 122, 123, 125, 156, 243, 260, 264 evaporation, 92, 205, 230 evidence, xi, 56, 86, 107, 110, 145, 203, 211 exopolysaccharides, 43 experimental condition, 129 experimental design, 245 exploitation, 149, 159 extension education, 100 extinction, 149 extreme poverty, 116 exudate, 48, 50, 55, 56, 57

F farmers, vii, 42, 88, 89, 91, 97, 98, 101, 103, 104, 106, 109, 112, 116, 150, 210

farming, x, 48, 85, 87, 88, 91, 93, 96, 100, 101, 103, 104, 106, 110, 111, 114, 116, 117, 149, 151, 159 farms, 89, 94, 111, 210 feedstock, 131, 138, 142 female flowers, 147, 150 fermentation, vii, xi, 120, 121, 122, 123, 124, 125, 127, 129, 130, 131, 133, 135, 136, 138, 139, 140, 141 fertility, x, 85, 88, 91, 92, 93, 94, 95, 98, 99, 105, 107, 111, 114, 117 fertilization, 88, 200 fertilizers, 86, 125, 258 field diseases, 151 flavonoids, 17, 19 flavour, xi, 31, 145, 146, 148, 154, 155, 159, 160, 161, 162, 164, 165 floods, 94, 210 flowers, 42, 44, 47, 55, 146, 147, 150, 169, 170, 171, 172, 174, 175, 176, 177, 178, 179, 180, 181, 192, 194, 196, 199 fluidolate, viii, xii, 168, 169, 181, 182, 184, 186 food, x, xi, xii, 4, 15, 17, 85, 86, 88, 90, 91, 94, 95, 97, 99, 101, 103, 104, 105, 109, 110, 112, 113, 114, 117, 119, 120, 145, 146, 149, 154, 156, 164, 165, 196, 197 food flavouring, xii, 146, 156 food intake, 164 food production, 91, 99, 101 food safety, 88 food security, xi, 86, 90, 91, 99, 101, 105, 109, 113, 117 formation, 6, 43, 54, 121, 122, 123, 134, 241, 262 fructose, 122 fruits, ix, 41, 42, 45, 46, 48, 49, 50, 67, 147, 150, 151, 192, 196, 199, 201 fungal metabolite, 17, 35 fungal volatiles, 14, 15 fungi, vii, viii, ix, xiv, 1, 2, 3, 4, 5, 6, 7, 8, 9, 11, 12, 13, 14, 15, 16, 20, 22, 23, 24, 25,


Index 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 47, 51, 57, 82, 96, 98, 123, 125, 179, 182, 202, 257, 259, 265, 266, 267 fungus, x, xi, 15, 20, 25, 26, 29, 32, 35, 36, 37, 38, 40, 41, 45, 46, 80, 83, 119, 122, 125, 126, 136, 138, 195, 259, 262 furanodienone, 152, 157, 159

G genetic diversity, 206 genetic engineering, 116 genotype, 246, 248, 251 genus, 21, 47, 57, 61, 146, 147, 195 genus Streptomyces, 47, 61 germination, 46, 121, 260 germplasm, 240, 252, 253 Gifu, 257 Gigaspora margarita, viii, xiv, 257, 259, 261, 263 ginger, vii, xi, 145, 146, 148, 149, 150, 151, 154, 155, 157, 159, 160, 162, 163 ginseng, 256 global climate change, 93 global trade, 99 Glomus intraradices, 262, 266 glucose, 68, 121, 122, 129 glutathione, 259, 265 green revolution, 86, 109, 113, 252 greenhouse, 244, 258, 259 growth, viii, xiv, 5, 11, 15, 16, 18, 19, 20, 22, 30, 31, 39, 44, 47, 49, 51, 53, 57, 58, 59, 66, 67, 68, 69, 70, 74, 86, 91, 97, 99, 104, 107, 120, 122, 123, 124, 126, 132, 136, 150, 175, 182, 185, 240, 242, 243, 244, 251, 254, 255, 257, 258, 260, 264, 265, 267 growth factor, 47, 254 growth rate, 91

273 H

habitat, 95, 108, 126, 146, 149 habitats, 4, 13, 15 harvesting, xi, 91, 145, 149, 151, 192, 199, 210 healing, 30, 199 health, 18, 87, 105, 160 heavy metals, 12, 24, 29, 33, 36, 123 herb, xi, 145, 146, 159, 169, 170, 174, 175, 176, 179, 181, 184, 185 herbaceous legumes, 94, 114 herbal medicine, 149 humidity, 14, 67, 77, 215, 228, 231, 243 hydrocarbons, 20, 31, 125, 169, 170 hydrogen, ix, 2, 8, 159, 258 hydrogen peroxide, ix, 2, 8, 258 hydrolysis, 170, 182 hydrosol, xii, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 187 hydroxyl, 18, 258

I in vitro, vii, x, 16, 21, 30, 32, 33, 39, 41, 42, 49, 76, 157, 158, 159, 161, 176, 242, 252, 254, 256, 266 in vivo, x, 16, 33, 41, 158, 161, 266 induction, 128, 241, 251, 255, 265 industries, 4, 13, 17 industry, xii, 4, 9, 12, 16, 17, 125, 127, 130, 133, 138, 168, 184, 196, 205 infection, 46, 64, 65, 67, 68, 71, 72, 75, 76, 77, 267 infertility, 92, 148 inflammation, 157 inflammatory mediators, 158 infrared spectroscopy, 168 infrastructure, 89, 99, 100, 102 ingredients, 16, 96, 179


274

Index

inhibition, 47, 57, 148, 158, 176, 182, 262, 264 inoculation, 82, 136, 259, 260 inoculum, 131, 179 insects, 6, 15, 17, 27, 194 interannual variability, viii, xiii, 209, 210, 211, 213, 216, 217, 234 International Atomic Energy Agency, 97, 111 ions, 5, 8, 10, 19, 121, 123, 131 iron, 47, 83, 265 irradiation, 128, 129 irrigation, 89, 91, 117, 151, 200, 210 isofuranodiene, 152 isolation, 35, 47, 50, 54, 58, 154, 155, 169 isoprene, 14, 20

lavender hydrosols, viii, xii, 168, 170, 174, 176, 178, 179, 181, 184, 186 Lepidoptera, 15, 194 lesions, 71, 75, 77 light, 52, 54, 58, 67, 147, 178, 184, 195, 196, 199, 224, 243, 254 lignin, viii, ix, 1, 2, 3, 4, 5, 7, 8, 9, 10, 26, 32 lignin peroxidases, 8, 9, 10 ligninases, vii, viii, 2, 4, 7, 8, 9, 10, 11 lipid metabolism, 264 lipid peroxidation, 256, 267 liquids, 176, 186 livestock, 13, 100 lysis, 61, 68, 69, 71

M J Japan, 126, 214, 257, 259, 260, 262

K ketones, 14, 22 kinetic parameters, 129 kinetics, ix, 2, 36, 123, 135

L laccases, 7, 9 landscape, 168, 199 lateral roots, 146, 260 Lavandula angustifolia, vi, viii, xii, 167, 168, 169, 170, 171, 173, 175, 177, 180, 183, 184, 186, 187 lavender, viii, xii, 167, 168, 169, 170, 171, 172, 173, 174, 176, 177, 178, 179, 181, 182, 183, 184, 186, 187 lavender essential oils, 169, 170 lavender fluidolate®, 181

manganese, 8, 9, 10, 33 mannitol, 68, 122 marine environment, 3 mass, xii, 28, 96, 168, 169, 172, 173, 176, 177, 178, 185, 192, 255 mass spectrometry, 28 materials, xi, 3, 6, 10, 23, 49, 119, 121, 125, 127, 138, 141, 155, 169, 181, 240, 253 meat, 52, 54, 60, 197 medicinal properties, 146, 148 medicine, 4, 13, 148, 149, 164, 199 membrane permeability, 123 metabolites, ix, 2, 4, 5, 13, 17, 18, 19, 20, 21, 22, 23, 24, 28, 33, 34, 35, 38, 40, 47, 55, 57, 125 metal ion, 10, 123, 131 metals, 10, 12, 24, 29, 33, 36, 123, 125, 139 methanol, 123, 133, 136 microhabitats, 29 micronucleus, 149, 164 microorganism(s), x, 13, 16, 25, 31, 41, 42, 44, 49, 51, 57, 58, 59, 120, 122, 123, 125, 126, 174, 175, 178, 182, 185


Index micropropagation, xiii, 239, 240, 241, 242, 250, 256 moisture, 46, 124, 133, 136, 218, 227, 228, 230, 231, 232, 234 mold, 38, 195 molecules, 7, 9, 13, 14, 15, 16, 18, 20, 47, 127, 265 monoterpenoids, 151, 157 mutagenesis, 135, 138 mutant, xi, 119, 128, 129, 131, 134, 135, 142 mutation(s), 127, 128, 129, 135 mycelium, ix, 2, 4, 5, 6, 10, 11, 12, 14, 35, 39, 46, 58, 61, 62, 67, 68, 69, 74

N Na+, xiv, 130, 257, 258, 260, 262, 265 NaCl, viii, xiv, 257, 259, 261, 262, 263, 264, 265, 267 National Academy of Sciences, 253 national product, 197 natural enemies, 42, 96 natural habitats, 15 natural isolates, 67 natural resource management, 107 negative effects, 18, 98, 262 NGOs, 89, 106 Nigeria, 92, 100, 145, 147, 148, 151, 153, 156, 162, 239, 240, 243, 244, 252, 254 Nigerian variety, 146, 153, 155, 157 nitrogen, 3, 5, 11, 89, 91, 94, 97, 108, 122, 131, 139, 260, 267 non-enzymatic antioxidants, 265 non-mulched furrows, 151 nutrient efficacy, 97 nutrient media, 62 nutrient supply, 97, 267 nutrient(s), viii, 1, 4, 5, 6, 10, 11, 22, 49, 58, 60, 62, 66, 69, 86, 87, 89, 90, 92, 93, 94,

275

97, 104, 114, 122, 126, 131, 133, 135, 136, 151, 199, 267 nutrition, 42, 88, 104, 202

O oceans, 217, 220 odourants, xi, 146, 155, 161 OECD, 90, 99, 115 oil, x, xii, 12, 23, 39, 71, 85, 88, 91, 92, 105, 126, 152, 165, 167, 168, 169, 185, 186, 187, 199, 206, 266 olive oil, 23 organic acid, xi, 119, 120, 123, 125, 141 organic compounds, xii, 26, 28, 31, 35, 38, 42, 168, 169, 172, 173, 174, 176, 178, 179 organic crops, 86, 88, 89 organic farming, 42, 86, 88, 89, 93, 111, 117 organic food, 88 organic matter, 89, 92, 93, 105, 109 organism, 5, 55, 56, 61, 125 osmosis, 267 osmotic stress, 258 oxidation, 6, 242, 264, 265, 266 oxidative damage, xv, 258, 265, 266 oxidative stress, 256, 258 oxygen, 11, 123, 130, 141, 170, 258, 266

P parasite(s), 15, 47, 66, 96, 199 pathogens, xiii, 7, 15, 16, 18, 19, 42, 47, 50, 58, 93, 105, 113, 190, 194 PCR, ix, 41, 43, 48, 49, 50, 54, 55, 78 perennial, xi, 145, 146 peroxidation, 256, 267 peroxide, ix, 2, 8, 258 pest populations, 96 pesticide, 37, 95


276

Index

pests, xiii, 18, 80, 87, 94, 95, 107, 115, 151, 190, 194, 200, 207 pH, 11, 14, 51, 120, 122, 123, 131, 133, 136, 137, 174, 243, 244, 250 phenol, 12, 26 phenolic compounds, 19, 23, 242, 253 phosphate, 14, 48, 49, 120, 122, 131 photosynthesis, 264, 267 plant disease, 82, 87, 111, 113 plant growth, xiv, 47, 92, 97, 251, 257, 258, 260, 265 plants, viii, xiii, xiv, 6, 7, 8, 17, 19, 20, 42, 47, 48, 49, 52, 56, 57, 76, 94, 97, 98, 120, 147, 149, 150, 157, 160, 162, 163, 164, 165, 195, 199, 200, 204, 239, 240, 241, 242, 245, 249, 250, 251, 252, 256, 257, 259, 260, 261, 262, 263, 264, 265, 266, 267 pollination, 147, 240 pollinators, 147 pollutants, ix, 2, 9, 11, 24, 25 pollution, 92, 130, 132 polycyclic aromatic hydrocarbon, 11, 12, 25, 36 polymer, 3, 5, 43 polymerase chain reaction, 48 polyphenols, viii, 2, 7, 265, 266 population, x, 85, 86, 90, 91, 92, 94, 99, 120, 201 population growth, 91, 99 potato, 151, 156, 195, 196 poverty, 86, 91, 99, 104, 107, 116 precipitation, vi, viii, xiii, 93, 201, 209, 210, 211, 212, 213, 215, 216, 217, 218, 221, 222, 223, 224, 225, 228, 229, 230, 232, 234, 235, 236, 237, 238 predators, 15, 96, 97 preservative, xi, xii, 145, 167, 179, 186 prostaglandin, 148, 158, 162 protection, 7, 36, 47, 57, 89, 91, 109, 148, 163, 210, 264, 265 protein synthesis, 264

proteins, 19, 43, 135, 201 pruning, 199, 200 pulp, xi, 49, 120, 127, 128, 133, 138, 142, 143 pungent smelling principle, 156 pure water, 185 pyrazines, 155 pyrophosphate, 20

R radiation, 105, 131 rainfall, viii, xiii, 46, 98, 114, 192, 194, 201, 209, 211, 212, 218, 219, 223, 234, 235, 236, 237 raw materials, xi, 119, 121, 125, 126, 127, 138, 141, 169 reactive oxygen, 258 recycling, 10, 93, 130, 142 regeneration, xii, 190, 241, 242, 251, 252, 253, 254, 256 regression analysis, 267 regrowth, 256 rehabilitation, 4, 118 remediation, 10, 22, 32, 143 repellent, 15, 18 reproduction, 6, 15, 68 residue(s), 3, 12, 13, 43, 93, 105, 120, 126, 129, 132, 133, 135, 136, 140, 141, 201 resilience, 89, 106, 109, 116 resistance, 47, 82, 196 resistant, 3, 5, 7, 95, 151, 159, 175, 194, 240 resources, xiii, 10, 23, 104, 202, 209 restoration, 194, 203 rhizome(s), 146, 147, 148, 150, 152, 156, 157, 158, 159, 162, 165, 186 rhizopus, 123 roasty/earthy smelling, 156 roasty/potato-like, 156 root growth, 47 root system, 193


Index root(s), 47, 87, 146, 148, 150, 151, 152, 165, 193, 195, 199, 248, 249, 252, 253, 258, 259, 260, 261, 262, 263, 265, 266, 267

S salinity, xv, 258, 260, 262, 264, 266, 267 salt stress, xiv, 257, 258, 259, 260, 262, 264, 265, 266, 267 salt tolerance, viii, 262, 264, 265 salts, 11 scent, xii, 146, 148, 168, 183, 184 sea level, 58, 194, 223, 224 secondary metabolites, ix, 2, 4, 5, 13, 17, 20, 21, 22, 23, 47, 57, 125 seedlings, x, xiv, 42, 52, 57, 62, 63, 64, 66, 67, 71, 72, 73, 74, 76, 150, 200, 240, 242, 243, 252, 267 seed(s), xi, xiii, 57, 101, 133, 143, 147, 149, 150, 163, 189, 190, 192, 198, 199, 201, 206, 239, 240, 241, 243, 248, 252 senescence, 151 sensory and hedonistic testing, 181 sesquiterpenoid(s), 38, 151, 152, 156, 158 shelf life, 66, 67, 73, 74 sinusitis, viii, xi, 145, 148, 158 siphonochilone, 152, 158 Siphonochilus aethiopicus, vi, vii, xi, 145, 146, 147, 154, 161, 162, 163, 165 skills and awareness, 86 soil erosion, 92, 93 soil health, 87, 105 solid state, 34, 140, 141 solid-state fermentation, vii, xi, 120, 124, 125, 138, 140, 141 somatic cell, 241 somatic embryogenesis, viii, xiv, 239, 240, 241, 242, 250, 251, 253, 254, 255, 256 South Africa, 85, 88, 89, 98, 102, 109, 113, 114, 116, 117, 146, 147, 148, 149, 150,

277

151, 152, 156, 157, 159, 160, 161, 162, 164, 165 South America, 13, 190, 193, 207, 211, 212, 220, 229, 235, 236, 237, 238, 258 Southern African variety, 147 species, vii, ix, xiii, 2, 3, 5, 6, 7, 8, 9, 11, 12, 14, 15, 16, 17, 18, 19, 20, 22, 24, 27, 30, 33, 34, 35, 37, 38, 45, 53, 94, 96, 146, 148, 163, 190, 192, 194, 195, 196, 197, 202, 207, 258, 259, 260, 266, 267 spice, xi, 145, 148, 155, 159, 185, 186 starch, 58, 66, 125, 126, 128, 131, 132, 197 sterile, 14, 49, 50, 51, 56, 62, 243, 244 strawberry, vi, viii, xiv, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267 submerged fermentation, vii, xi, 120, 123, 124, 125, 138 sub-Saharan Africa, v, 85, 86, 89, 90, 92, 93, 94, 97, 99, 101, 102, 103, 104, 106, 107, 108, 109, 111, 112, 113, 114, 115, 116, 117, 118, 146 sub-tropical, 150 sucrose, xiv, 49, 54, 122, 125, 129, 131, 240, 243, 244, 245, 246, 247, 248, 249, 250, 251 sugar beet, 127 sugarcane, 129 supplementation, 123, 253 supply chain, 89, 105, 109 sweet/coconut-like, 156 sweet/fruity, 155 symbiosis, xiv, 47, 82, 257, 259, 260, 262, 264, 265

T tannins, viii, 1, 17, 19, 196, 201, 205 Tara, vi, viii, xii, 189, 190, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207 TCC, 169, 175, 182


278

Index

temperature, 14, 37, 51, 67, 76, 77, 105, 107, 182, 183, 211, 212, 235, 237 terpenes, 14, 15, 17, 20, 22 terpenish/woody odour, 155 tertiary education, 100, 106 thiophenes, 155 threats, 3, 92, 117 tissue, 43, 45, 63, 150, 242, 251, 253, 254, 255 tissue culture protocols, 150 tobacco, 254, 255 trace elements, 123, 127, 129 treatment, x, 23, 25, 29, 32, 35, 37, 42, 52, 64, 66, 67, 72, 73, 74, 75, 76, 77, 127, 130, 148, 157, 161, 162, 243, 244, 245, 246, 247, 248, 251, 259 trends, 81, 108, 162, 164, 210, 211, 213, 215, 216, 217, 234, 235, 237 tricarboxylic acid, 120, 121, 124 tropical, 136, 150, 211, 212, 217, 220, 230, 237, 238, 250, 253, 254 tuberculosis, 13, 16, 157 tuberous, 146, 150

vitamins, 47, 121, 243, 244, 250 volatile organic compounds, xii, 25, 28, 31, 35, 38, 168, 169, 174, 176, 178, 179

W waste, 90, 127, 128, 129, 138 wastewater, 25, 26, 35, 130, 131, 142 water, xii, 14, 15, 50, 51, 52, 56, 62, 87, 88, 89, 91, 92, 94, 104, 116, 120, 125, 130, 138, 151, 168, 169, 178, 181, 182, 183, 184, 194, 199, 200, 210, 215, 218, 226, 243, 258, 267 wetlands, 113 white-rot fungi, vii, ix, 1, 2, 3, 4, 6, 7, 8, 9, 11, 12, 13, 15, 22, 23, 24, 29, 33, 35, 37, 39 wild ginger, vii, xi, 145, 146, 148, 149, 150, 151, 154, 155, 157, 159, 160, 162, 163 wood, viii, ix, 1, 2, 3, 4, 7, 8, 25, 26, 30, 31, 38, 40, 92, 178, 184, 192, 197, 199, 203

X U urban, 149, 199 UV irradiation, 128 UV-radiation, 131

x-ray analysis, 28

Y

V variability, viii, xiii, 200, 209, 210, 211, 212, 213, 216, 217, 234, 235, 236, 237, 238, 254 varieties, 42, 48, 49, 50, 53, 95, 104, 152, 240, 249, 251, 266 vegetables, 96, 98, 207 vegetative propagation, 149, 150, 151, 240, 241

yeast, 39, 81, 140, 169, 175 yield, xiii, 87, 89, 103, 129, 130, 131, 149, 150, 200, 201, 239, 240, 254, 258

Z zeolites, 120 zerumin A, 153 zinc, 12 zingiberaceae, xi, 145, 146, 155, 161, 163, 164
