Characterization of Bacillus thuringiensis subsp. kurstaki strain S93

Download PDF
0 downloads 0 Views 2MB Size Report
Comment
lyophilized powders of S93 or HD-1 and third instar larvae of S. frugiperda showed a 12.3-fold lower ... S93 strain when compared with the standard HD-1 strain.
464

Characterization of Bacillus thuringiensis subsp. kurstaki strain S93 effective against the fall armyworm (Spodoptera frugiperda) Joseilde O. Silva-Werneck, Marlene T. De-Souza, José M.C. de S. Dias, and Bergmann M. Ribeiro

Abstract: A Brazilian strain of Bacillus thuringiensis subsp. kurstaki, designated S93, was analyzed regarding its cry gene and protein contents and activity against the fall armyworm (Spodoptera frugiperda, Smith 1797). Bioassays using lyophilized powders of S93 or HD-1 and third instar larvae of S. frugiperda showed a 12.3-fold lower LC50 for the S93 strain when compared with the standard HD-1 strain. The spore–crystal mixture, analyzed by SDS–PAGE, showed two major polypeptides of 130 and 65 kDa, corresponding to Cry1 and Cry2 toxins, respectively. Western blot analysis showed that these proteins were immunologically related to the Cry1A protein from B. thuringiensis subsp. kurstaki HD-73. The polymerase chain reaction technique (PCR) using total DNA from the S93 strain and specific primers showed the presence of cry1Aa, cry1Ab, and cry1Ac genes, and a cry1A-type gene was localized in a plasmid of about 44 MDa. A cry1Ab gene was isolated from a S93 plasmid DNA library and completely sequenced. Computer analysis showed that the gene sequence (GenBank acession number AF059670) is identical to cry1Ab1 and has 91.6 and 85.9% identity with cry1Aa1 and cry1Ac1 genes, respectively. The deduced amino-acid sequence showed a high degree of similarity with the amino-acid sequences of the Cry1Ab1 (100%), Cry1Aa1 (93.8%), and Cry1Ac1 (90.6%) proteins. Key words: Bacillus thuringiensis, Spodoptera frugiperda, biological control, crystal protein, cry genes. Résumé : Une souche de Bacillus thuringiensis subsp. kurstaki provenant du Brésil et identifiée S93 a été étudiée en regard du gène cry et du contenu en protéines et pour son activité contre le légionnaire d’automne (Spodoptera frugiperda, Smith, 1797). Les bioessais utilisant des poudres lyophilisées de S93 ou de HD-1 et des larves du troisième âge de S. frugiperda ont montré une LC50 12.3 fois plus basse pour la souche S93 comparativement à la souche standard HD-1. Le mélange spores-cristaux, analysé par SDS-PAGE, a révélé deux polypeptides principaux de 130 et 65 kDa, correspondant aux toxines Cry1 et Cry2 respectivement. Le buvardage Western a confirmé que ces protéines étaient immunologiquement apparentées à la protéine Cry1A de B. thuringiensis subsp. kurstaki HD-73. La réaction en chaîne de la polymérase (PCR) utilisant l’ADN total de la souche S93 et des amorces spécifiques a confirmé la présence des gènes cry1Aa, cry1Ab, et cry1Ac et a permis de repérer un gène de type cry1A sur un plasmide ca. 44 Mda. Un gène cry1Ab a été isolé d’une banque d’ADN plasmidique S93 et il a été complètement séquencé. Une analyse informatisée a montré que la séquence de ce gène (code d’identification GenBank AF059670) était identique à celle de cry1Ab1 et qu’elle était à 91.6% et 85.9% identique à celle des gènes cry1Aa1 et cry1Ac1 respectivement. La séquence obtenue des acides aminés a révélé un degré élevé de similitude avec les séquences des protéines Cry1Ab1 (100%), Cry1Aa1 (93.8%), 35 Cry1Ac1 (90.6%). Mots clés : Bacillus thuringiensis, Spodoptera frugiperda, contrôle biologique, cristaux de protéine, gènes cry. [Traduit par la Rédaction]

Silva-Werneck et al.

471

Introduction Received November 10, 1998. Revision received February 25, 1999. Accepted March 8, 1999. 1

J.O. Silva-Werneck and J.M.C. de S. Dias. Embrapa Recursos Genéticos e Biotecnologia, C.P. 02372, CEP 70849–970, SAIN, Parque Rural, Brasília, DF, Brazil. M.T. De-Souza and B.M. Ribeiro. Depto. Biologia Celular, Universidade de Brasília, CEP 70910–900, Brasília, DF, Brazil. 1

Author to whom all correspondence should be addressed (e-mail: [email protected]).

Can. J. Microbiol. 45: 464–471 (1999)

Bacillus thuringiensis is an aerobic, gram-positive bacterium that synthesizes crystalline inclusions during sporulation (Bechtel and Bulla 1976). These inclusions are composed of one or more proteins, known as insecticidal crystal proteins (ICPs), δ-endotoxins, or Cry proteins (Höfte et al. 1988; Gill et al. 1992; Lereclus et al. 1993; Aronson 1995), which are highly toxic to a wide variety of agronomic, forestry, and health-related insect pests (Krieg and Langenbruch 1981; Feitelson et al. 1992; Aranda et al. 1996; Hansen et al. 1996). Bacillus thuringiensis strains can produce one or two © 1999 NRC Canada

Silva-Werneck et al.

inclusion bodies (Aronson 1995) that can, in some subspecies, account for 20–30% of the dry weight of the sporulated cells (Visser et al. 1988; Lereclus et al. 1989; Chambers et al. 1991). The cry genes, which code for the δ-endotoxins, are generally localized in large conjugative plasmids (>30 MDa) (González et al. 1982; Lereclus et al. 1982). Because of their high specificity and presumed environmental safety, Cry proteins have been successfully used as bioinsecticides against lepidopteran, dipteran, and coleopteran pests (Feitelson et al. 1992; Ceron et al. 1995; Aranda et al. 1996; López-Meza and Ibarra 1996; Bohorova et al. 1996). Strains with toxic activity towards nematodes (Edwards et al. 1990) and other organisms, such as platyhelminths, protozoans, procaryotes, and acarides, have been identifided (Feitelson et al. 1992; Payne et al. 1994; Ceron et al. 1995; Yudina and Burtseva 1997), and the activity spectrum of the toxins of B. thuringiensis is increasing as the result of the continual isolation and characterization of new strains (Carozzi et al. 1991; Feitelson et al. 1992; Bohorova et al. 1996). The fall armyworm (Spodoptera frugiperda, Smith 1797, Lepidoptera: Noctuidae) is the main pest of maize in Brazil (Ferraz 1991), as well as one of the most important pests of maize in South America, Central America, and Mexico, causing production losses from 15 to 37% (Embrapa 1997). Spodoptera frugiperda shows low susceptibility to the toxins from B. thuringiensis subsp. kurstaki frequently used to control lepidopteran pests (Morales and Novoa 1992; Nyouki et al. 1996; Bohorova et al. 1996). From 205 Bacillus isolates from Brazil, deposited in the Microbial Germplasm Bank of EMBRAPA – Genetic Resources and Biotechnology, a strain of B. thuringiensis subsp. kurstaki with increased activity against S. frugiperda larvae (Silva-Werneck et al. 1998) was selected. This strain was designated S93 and studied with the aim of developing a bioinsecticide for controlling larvae of S. frugiperda. The present work reports toxicity data, cry gene content, localization of cry1A-type genes, content and immunodetection of Cry proteins, as well as cloning and sequencing of a cry1Ab gene from this strain.

Materials and methods Bacterial strains and growth The HD-1 strain of B. thuringiensis subsp. kurstaki was kindly provided by Dr. M. Lecadet from the Institut Pasteur (Paris, France), and the S93 strain was isolated from a Brazilian soil sample using the procedures recommended by the World Health Organization (1985). The S93 strain was serotyped as B. thuringiensis subsp. kurstaki (Dias et al. 1993), and bipyramidal and cuboidal crystals were observed by scanning and transmission electron microscopy (De-Souza et al. 1999). The strain is deposited in the Microbial Germplasm Bank at EMBRAPA – Genetic Resources and Biotechnology. The strains were grown in nutrient broth (NYSM) at 30°C and 200 rpm for 48 h, for complete sporulation, or overnight, for harvesting the culture in the vegetative phase. For largescale DNA purification, the strains were grown in brain heart infusion (BHI) medium (Biobras Co.) at 37°C and 200 rpm.

Bioassays Powders from sporulated liquid cultures (freeze dried) were made using a commonly used standard protocol (McGaughey and

465 Johnson 1992; Tapp and Stotzky 1995; Bohorova et al. 1996). In brief, pellets from sporulated cultures centrifuged at 6084 × g (Sorvall rotor GS3) for 20 min at 4°C were washed with distilled water, frozen, and lyophilized (Labconco Lyphlock 18). Larvae of S. frugiperda were reared on artificial diet (140.4 g dry ground beans cv. Carioca, 43.0 g yeast powder, 67.4 g wheat germ, 4.3 g ascorbic acid, 1.4 g sorbic acid, 2.7 g nipagin (methyl-p-hydroxy benzoate), 10.6 mL 10% (v/v) formaldehyde, 15 g agar, and 1 L of water) at 26 ± 2°C, 70 ± 10% relative humidity, and a photoperiod of 14 h light :10 h dark. To calculate the LC50, five different concentrations of the lyophilized spore–crystal mixture and a control (Bacillus-free diet) were used, and for each concentration, 20 thirdinstar larvae were assayed. A constant volume of each suspension (1 mL) was incorporated (1:50 dilution) into freshly prepared artificial diet, free of sorbic acid, nipagin, and formaldehyde, at 50°C, and poured into a petri dish. After solidification, the diet was cut into 1-cm3 blocks; one block was placed into a 50-mL plastic cup, and one larva of S. frugiperda was added. The cups were covered with acrylic lids and incubated under the same conditions used for the rearing of the insects. Larval mortality was assessed at 2-day intervals until day 8. Test data were discarded if the mortality of the controls exceeded 20%. Each bioassay was repeated at least three times, and the average values of three sets of experiments are reported. The toxicity data were analyzed by probit analysis (Finney 1971).

Sodium dodecyl sulfate – polyacrylamide gel electrophoresis (SDS–PAGE) The spore–crystal mixtures of B. thuringiensis subsp. kurstaki strains HD-1 and S93 were prepared by a rapid washing procedure (De-Souza et al. 1993). In brief, samples (2 mL) of sporulated cultures were centrifuged at 11 750 × g in a microcentrifuge (Eppendorff model 5415C) for 5 min and washed once in 2 mL of 0.5 M NaCl and twice in cold sterilized water containing 1.25 mM of the protease inhibitor phenylmethylsulfonyl fluoride (PMSF). The pellets were resuspended in 0.5 mL of 1.25 mM PMSF and kept frozen at –20°C. The protein composition of the spore–crystal mixtures was determined by 10% SDS–PAGE analysis, as described by Laemmli (1970). The molecular masses of the proteins were estimated by comparison with protein molecular mass standards (Gibco BRL).

Western blot analysis Proteins from SDS–PAGE of the spore–crystal mixtures were transfered to a nitrocellulose membrane (Sigma; 0.45 µm) using a Transblot semi-dry transfer cell (BioRad) under a constant current of 5.5 mA/cm2 and 10 V for 30 min. The polyclonal antibody used as the first antibody, kindly supplied by Dr. Paul Jarret, was raised against the crystal protein (Cry1Ac) of B. thuringiensis subsp. kurstaki HD-73 (Ribeiro and Crook 1993). Immunodetection was performed as described by Bollag and Edelstein (1991). The membrane was blocked with 3% (w/v) BSA (bovine serum albumin) in PBS buffer (1 mM sodium phosphate, 10.5 mM potassium phosphate, 140 mM NaCl, 40 mM KCl), pH 6.2, overnight at room temperature, and washed 3 times with PBS-Tween (0.05% tween 20). The polyclonal antibody, diluted 1:2 000 (v:v) in PBS with 0.5% (w/v) BSA, was added to the solution and shaken slowly for 1 h. The membrane was washed three times with PBS–Tween for 5 min. The goat anti-rabbit IgG (premium quality phosphatase labeled; Gibco BRL) conjugated with alkaline phosphatase and diluted 1:10 000 (v:v) in PBS with 0.5% (w/v) BSA, was added to the solution and shaken slowly for 1 h. The membrane was washed again three times with PBS–Tween, incubated in alkaline phosphatase buffer (0.1 M Tris–HCl (pH 9.5), 0.1 M NaCl, 5 mM MgCl2) for 5 min. and developed with NBT/BCIP Stable Mix (Gibco BRL), following the instructions of the manufacturer. © 1999 NRC Canada

466

Can. J. Microbiol. Vol. 45, 1999 Table 1. Oligonucleotide primers (Kalman et al. 1993) used in the PCR screen for cry1A genes. Primer

Sequence (5′63′)

Gene

TYIAA TY1UNI2 TY6 TY14 TYIAC

GAGCCAAGCAGCTGGAGCAGTTTACACC ATCACTGAGTCGCTTCGCATGTTTGACTTTCTC GGTCGTGGCTATATCCTTCGTGTCACAGC GAATTGCTTTCATAGGCTCCGTC TCACTTCCCATCGACATCTACC

cry1Aa cry1 cry1Ab cry1Ab cry1Ac

DNA extraction and Southern blot analysis Cultures of S93 and HD-1 were grown to an A600 of 1.5–2.0 in BHI medium. Plasmid DNA was prepared by the alkaline lysis procedure and purified on a CsCl gradient as described by Sambrook et al. (1989), except that 4 mg/mL of lysozyme was used to lyse the cells for 45 min. For Southern blot analysis, plasmid DNA from the S93 and HD-1 strains was resolved on a 0.6% agarose gel and transferred onto a nylon membrane (Sigma; 0.2 µm) by the method of Southern (1975). DNA to be used as a probe was first amplified by PCR, as described by Carozzi et al. (1991), using the Lep1A/Lep1B primers (which amplify the 5′ end of a cry1A gene) and plasmid DNA from S93 strain as the template. The resulting fragments were labeled with digoxigenin using the Dig DNA Labeling and Detection Kit (Boehringer Mannheim). Hybridization and detection of cry1A-type genes were carried out according to the instructions of the manufacturer (Boehringer Mannheim).

PCR To identify the cry1A-type genes, the primer pairs, TYIAA/ TYIUNI2, TY6/TY14, and TYIAC/TYIUNI2, designed by Kalman et al. (1993) (Table 1), specific to cry1Aa, cry1Ab, and cry1Ac, respectively, were used in the PCR. Total DNA (1 µL, about 1– 10 ng) from the S93 or HD-1 strain was transferred to a 250-µL GeneAmp reaction tube (Perkin–Elmer Cetus) containing 1.8– 2.6 µM of each primer, 0.2 mM of each dNTP, 1× Taq DNA polymerase buffer, and 2.5 U of Taq DNA polymerase (CENBIOT/RS, Brazil) in a final volume of 25 µL. PCR amplification was performed with a Gene Amp PCR System 2400 thermal cycler (Perkin–Elmer Cetus) by using the step-cycle program set for an initial denaturation at 94°C for 5 min, followed by 25 cycles of denaturation at 94°C for 1 min, annealing at 65°C for 1.5 min, and extension at 72°C for 1.5 min; a final extension at 72°C for 7 min was then performed. A 5-µL aliquot of the product from each PCR reaction was electrophoresed on a 1% (w/v) agarose gel in Tris– borate buffer and stained with 0.5 µg/mL ethidium bromide, as described by Sambrook et al. (1989), and photographed.

Construction and screening of a plasmid DNA library for cry1A-type genes

About 21 µg of plasmid DNA from strain S93 (CsCl purified) was partially digested with 10 U of Sau3AI (Biolabs), precipitated with ethanol, and analyzed by agarose gel electrophoresis. The digested DNA was ligated to the BamHI-digested vector, λ-DASH II (Stratagene), using T4 DNA ligase, at a 1:4 molar ratio of DNA insert to vector, packed using Gigapack kit (Stratagene), and transfected into Escherichia coli XL1-Blue MRA (P2) host cells. Transformation and screening were carried out according to the manufacturer’s directions. Approximately 70 000 λ plaques blotted on nitrocellulose membranes (Gibco BRL) were screened for the presence of cry1A-type gene sequences. Prehybridization and hybridization were performed at 42°C in a solution containing 50% (v/v) formamide, 4× SSC (1× SSC = 0.15 M NaCl + 0.015 M sodium citrate), 0.1% (w/v) SDS, 5× Denhardt’s solution (0.1% BSA,

0.1% Ficoll, and 0.1% polyvinylpyrrolidone), and 500 µg/mL salmon sperm DNA, as described in Sambrook et al. (1989). The probe used was a PCR-amplified 490-bp fragment of the 5′ end of the cry1A gene present in the plasmid DNA of S93, using the Lep1A/Lep1B primers designed by Carozzi et al. (1991), at a concentration of 50 ng, and labeled with [32P]dCTP with the Rediprime DNA labeling system from Amersham, to a specific activity of 3.8 × 108 CPM/µg. After hybridization and washing, filters were exposed to Kodak X-Omat film. A secondary screening with seven selected clones, using [32P]dCTP labeled probes that were homologous to the 5′ and 3′ ends of the S93 cry1A gene, was carried out under the same conditions. DNA from four positive clones were prepared as described by Sambrook et al. (1989), analyzed by agarose gel electrophoresis, and screened for the presence of cry1A-type genes by PCR (Kalman et al. 1993). The DNAs were singly or doubly digested with the restriction endonucleases NdeI, NdeI/PstI, and NdeI/SalI (10–20 U/µL) (Biolabs and Pharmacia), and transferred to nylon membranes (0.2 µm; Sigma). The membranes were separately hybridized using the probes described above and exposed to Kodak X-Omat film.

Subcloning A 4.2-kb (kilobase pair) NdeI fragment from a positive clone that hybridized to the probes, which were homologous to the 5′ and 3′ ends of the S93 cry1A gene, was treated with Klenow polymerase (Pharmacia) and subcloned in the SmaI site of plasmid pUC18, using the Ready-To-Go pUC18 Sma I/BAP + ligase kit (Pharmacia), according to the manufacturer’s instructions. Transformation of E. coli DH5α cells was performed using standard techniques (Sambrook et al. 1989). Transformants were selected at 37°C on LB (10 g tryptone, 5 g yeast extract, 10 g NaCl, 15 g agar/L) agar plates containing 100 µg/mL ampicillin, 40 µL/plate 2% (w/v) X-Gal, and 5 µL/plate 100 mM IPTG. E. coli cells transformed with ampicillin-resistant plasmids were grown overnight at 37°C on LB medium containing 100 µg/mL ampicillin. Small-scale isolation of plasmid DNA from 25 recombinant colonies was performed by the boiling method described by Sambrook et al. (1989). DNA was transferred to a nylon membrane (0.45 µm; Amersham) using the Convertible Filtration Manifold System (Gibco BRL). To detect transformants sharing identity with the cry1A gene, hybridization was performed at 68°C in 6× SSC, 0.5% (w/v) SDS, 5× Denhardt’s solution, 10 µg/mL salmon sperm DNA, and the 5′ end of a cry1A gene fragment radioactively labeled (Ready-To-Go DNA labeling kit) as a probe. The plasmid pUCBt5 (Ribeiro and Crook 1993), containing a cry1Ab gene, was used as a positive control in the hybridization procedure. The membrane was then exposed to Kodak X-Omat film.

DNA sequencing and analysis DNA sequencing of the two strands of the cloned gene in pUCBtS93 was performed by the Core Facility for Protein/DNA Chemistry, DNA Sequencing Laboratory (Queen’s University, Kingston, Ont.). Sequence computer analysis was performed using the GCG package from the University of Winsconsin. © 1999 NRC Canada

Silva-Werneck et al.

467

Fig. 1. Electrophoretic and immunoblot analyses of crystal proteins of B. thuringiensis subsp. kurstaki strains HD-1 and S93. (A) Spore-crystal mixtures (10 µL) were analyzed on a 10% SDS – polyacrylamide gel and stained with Coomassie blue. Lane 1, strain HD-1; lane 2, strain S93. On the left, molecular mass marker (Gibco BRL pre-stained), in kDa. (B) Immunoblot of the gel shown in A, incubated with an antibody raised against the Cry1Ac protein of B. thuringiensis subsp. kurstaki strain HD-73 and detected with NBT/BCIP Stable Mix solution (Gibco BRL). Lane 1, strain- HD-1; lane 2, strain S93. Arrows indicate the main protein bands (130 and 65 kDa).

Results Bioassays Lyophilized powders of strains HD-1 and S93 were used in the bioassays with third-instar larvae of S. frugiperda. The average LC50 for strain S93 was 6.6 ng/mL, whereas the average LC50 for the standard HD-1 strain of B. thuringiensis subsp. kurstaki was 81.1 ng/mL (Table 2). Therefore, the strain S93 was about 12.3-fold better than HD-1 against this insect species. Crystal protein analysis SDS–PAGE analysis of the spore–crystal mixture of the S93 and HD-1 strains showed the presence of two major polypeptides with estimated molecular masses of 130 and 65 kDa (Fig. 1A). Western blot analysis Immunoblot analysis was used to detect similarity between the Cry1A proteins present in the S93 and HD-1 strains. A polyclonal antibody raised against the Cry1Ac toxin (Ribeiro and Crook 1993) reacted strongly with the 130-kDa protein and also reacted with the 65-kDa protein in preparations of S93 and HD-1 strains (Fig. 1B). A faint cross-reaction was observed in the intermediary region between the 130- and 65-kDa bands but only with S93 strain (Fig. 1B, lane 2). Southern blot analysis The plasmid content of strains S93 and HD-1 is similar (De-Souza et al. 1998). To determine the location of cry1A-

Table 2. Toxicity of powders from sporulated liquid cultures of strains S93 and HD-1 of Bacillus thuringiensis subsp. kurstaki against third instar larvae of Spodoptera frugiperda. Strain

LC50a (ng/mL)

95%CLb

S93 HD-1

6.6 81.1

2.9–14.7 20.5–334.0

a

50% lethal concentration. 95% confidence limit.

b

type genes in the S93 plasmids, the membrane containing the plasmid profiles was hybridized with a probe containing a nonradioactive labeled 490-bp PCR product from the 5′ end of the cry1A-type gene. A strong signal was detected in a plasmid of about 44 MDa in the plasmid profile of strains S93 and HD-1 (Fig. 2), suggesting that this plasmid carries at least one cry1A gene. PCR Total DNA of strain HD-1 was used as a control for the PCR, as it contains cry1Aa, cry1Ab, and cry1Ac genes (Höfte and Whiteley 1989; Ceron et al. 1994). Fragments of the expected size for cry1Aa (723 bp), cry1Ab (223 bp), and cry1Ac (619 bp) were produced from total DNA of both strains using specific primers (Kalman et al. 1993) (Fig. 3). Identification and isolation of a cry1A gene from the plasmid library A library constructed with plasmid DNA from strain S93, containing 4.1 × 107 PFU (plaque forming units)/mL, was © 1999 NRC Canada

468 Fig. 2. Southern blot analysis of cry1A-type gene sequences present in plasmid DNA of B. thuringiensis subsp. kurstaki strains HD-1 and S93. Plasmid DNA from strains HD-1 (lane 1) and S93 (lane 2) were electrophoresed, transferred to a nitrocellulose membrane, and hybridized to a probe comprising a 490-bp PCR fragment from the 5′ end of cry1A-type genes labeled using the Dig DNA labeling and detection kit (Boehringer Mannheim). The arrow indicates the plasmid that hybridized with the probe and its size in MDa.

Can. J. Microbiol. Vol. 45, 1999

lected by hybridization with a 5′ end cry1A-type gene probe and designated pUCBtS93. The full sequence of the cloned gene (GenBank data base accession number AF059670) and the deduced amino acid sequence were obtained. Computer analysis of the nucleotide sequence revealed an open reading frame with high identity with other cry1A subclass genes: 100% with cry1Ab1 (EMBL data base accession number M13898); 91.6% with cry1Aa1 (EMBL accession number M11250), and 85.9% with cry1Ac1 (EMBL accession number M11068). Comparison of the deduced amino acid sequence with the Cry1Ab, Cry1Aa, and Cry1Ac holotype toxins sequences showed 100, 93.8, and 90.6% similarity, respectively.

Discussion

screened with [32P]dCTP probes homologous to the 5′ and 3′ ends of a cry1A-type gene. Several clones were selected, and four (a–d) were singly or doubly digested with the endonucleases NdeI, NdeI/PstI, and NdeI/SalI. Southern blot analysis, using both probes separately, detected a NdeI fragment of about 4 kb in the DNA of the four clones (Fig. 4). PCR with DNA from these clones as template and with primers for cry1Aa, cry1Ab, and cry1Ac-type genes (Kalman et al. 1993) only showed the presence of a cry1Ab-type gene, and no products were obtained with the other primers (data not shown). Subcloning and sequence analysis of the crystal protein gene The 4-kb NdeI fragment containing the putative cry1Ab gene was treated with Klenow polymerase and subcloned into the SmaI site of pUC18. One positive clone was se-

Insects belonging to the genus Spodoptera (Noctuidae family) show, in general, low susceptibility to commercial products based on toxins from B. thuringiensis subsp. kurstaki HD-1 and to most of the δ-endotoxins (Visser et al. 1988; Moar et al. 1990; Inagaki et al. 1992; Navon 1993; Bai et al. 1993; Aranda et al. 1996; Lambert et al. 1996). Information regarding S. frugiperda susceptibility to Cry proteins indicates that this species also shows low susceptibility to HD-1-based products (Morales and Novoa 1992; Nyouki et al. 1996; Bohorova et al. 1996; Lambert et al. 1996). Aranda et al. (1996) reported that the Cry1C and Cry1D proteins are highly toxic to S. frugiperda, whereas the Cry1Ab protein is not toxic. The Cry1Ac protein is also considered to be nontoxic to this species (Garczynski et al. 1991; Lorence et al. 1995). Nevertheless, Aronson (1995) demonstrated the important role of the Cry1Ab protoxin in the solubility and toxicity of the proteins produced by a strain of B. thuringiensis subsp. aizawai against S. frugiperda. Bohorova et al. (1996), working with a selection of isolates of B. thuringiensis with activity against S. frugiperda, found that all the isolates causing mortality between 50 and 70% (6 out of 156) produced bypyramidal crystals containing Cry1 proteins. This work presents the characterization of strain S93 of B. thuringiensis subsp. kurstaki, from Brazil, which has been shown to be toxic to S. frugiperda (Silva-Werneck et al. 1993). The average LC50 for S93 was about 12.3-fold lower than that for HD-1, indicating the potential of this new strain as a basis of a bioinsecticide against S. frugiperda. The toxicity of the HD-1 and S93 strains demonstrated here can be attributed, in part, to spores presented in the lyophilized mixture incorporated into the diet, as synergism of HD-1 spores with Cry1A and Cry1C proteins on larval mortality has been reported (Moar et al. 1995; Johnson and McGaughey 1996; Tang et al. 1996; Nyouki et al. 1996). The S93 strain was shown to be similar to the HD-1 strain in several respects. SDS–PAGE of sporulated cultures showed the presence of two major polypeptides (130 and 65 kDa) also found in HD-1. Immunoblot analysis showed that the Cry1A proteins produced by S93 and HD-1 are related to the Cry1Ac protein (Ribeiro and Crook 1993). The immunological cross-reaction observed with the 65-kDa polypeptides and in the interval between the 65- and the 130-kDa polypeptides may be the result of the Cry1A anti© 1999 NRC Canada

Silva-Werneck et al.

469

Fig. 3. Agarose gel electrophoresis analysis of PCR products amplified from total DNA of B. thuringiensis subsp. kurstaki strains HD1 and S93. PCR was carried out using specific primers for cry1Aa (TYIAA/TYIUNI2, lanes 2, 3, and 4), cry1Ab (TY6/TY14, lanes 5, 6, and 7), and cry1Ac (TYIAC/TYIUNI2, lanes 8, 9, and 10) type genes and analyzed on a 1% agarose gel. Lane 1, λ-PstI marker; lanes 2, 5, and 8, no DNA; lanes 3, 6, and 9, strain HD-1; lanes 4, 7, and 10, strain S93.

Fig. 4. Southern blot analysis for cry1A-type genes sequences in the restriction fragments of positive clones from a plasmid library of B. thuringiensis subsp. kurstaki S93. Four clones were digested with the endonucleases NdeI (lanes 1–4), NdeI–PstI (lanes 5–8), and NdeI–SalI (lanes 9–12). Probes used were homologous to the 5′ end (A) and 3′ end (B) of the S93 cry1A-type gene. Lanes 1, 5, and 9, clone a; lanes 2, 6, and 10, clone b; lanes 3, 7, and 11, clone c; lanes 4, 8, and 12, clone d. Arrows indicate fragments that hybridized with the probes.

body reacting with degradation products of the 130-kDa protein. Plasmid profile (De-Souza et al. 1998), localization of cry1A-type genes, and cry1A gene content in strain S93 were also similar to strain HD-1. A cry1Ab gene from the strain S93 was cloned and sequenced, and its nucleotide and deduced amino-acid sequences were identical to those of the cry1Ab gene (EMBL accession number M13898). Although the reasons for the higher toxicity of strain S93 to S. frugiperda larvae are unknown, one possibility may be the presence of other toxins. The presence of other genes coding for proteins that can contribute to this toxicity, such as cry1Ia1 (Tailor et al. 1992) or vip3A (Estruch et al. 1996),

should be determined in the S93 genome, and their products expressed and tested against S. frugiperda.

Acknowledgements We thank Dr. Peter Inglis for reviewing the manuscript and Dr. Paul Jarret (Horticultural Research International, England, U.K.) for the cry1A polyclonal antibody. M.T.D.-S. was supported by a CNPq (Brazil) postdoctoral fellowship. This work was supported by a CNPq/PADCT (Brazil) grant. © 1999 NRC Canada

470

References Aranda, E., Sanchez, J., Peferoen, M., Güereca, L., and Bravo, A. 1996. Interactions of Bacillus thuringiensis crystal proteins with the midgut epithelial cells of Spodoptera frugiperda (Lepidoptera: Noctuidae). J. Invertebr. Pathol. 68: 203–212. Aronson, A. 1995. The protoxin composition of Bacillus thuringiensis insecticidal inclusions affects solubility and toxicity. Appl. Environ. Microbiol. 61: 4057–4060. Bai, C., Degheele, D., Jansens, S., and Lambert, B. 1993. Activity of insecticidal crystal proteins and strains of Bacillus thuringiensis against Spodoptera exempta (Walker). J. Invertebr. Pathol. 62: 211–215. Bechtel, D.B., and Bulla, L.A., Jr. 1976. Electron microscope study of sporulation and parasporal crystal formation in Bacillus thuringiensis. J. Bacteriol. 127: 1472–1481. Bohorova, N., Maciel, A.M., Brito, R.M., Aguilart, L., Ibarra, J.E., and Hoisington, D. 1996. Selection and characterization of Mexican strains of Bacillus thuringiensis active against four major lepidopteran maize pests. Entomophaga, 41: 153–165. Bollag, D.M., and Edelstein, S.J. 1991. Protein methods. WileyLiss, New York. Carozzi, N.B., Kramer, W.G., Warren, G.W., Evola, S., and Koziel, M.G. 1991. Prediction of insecticidal activity of Bacillus thuringiensis strains by polymerase chain reaction product profiles. Appl. Environ. Microbiol. 57: 3057–3061. Ceron, J., Covarrubias, L., Quintero, R., Ortiz, A., Ortiz, M., Aranda, E., Lina, L., and Bravo, A. 1994. PCR analysis of the cryI insecticidal crystal family genes from Bacillus thuringiensis. Appl. Environ. Microbiol. 60: 353–356. Ceron, J., Ortíz, A., Quintero, R., Güereca, L., and Bravo, A. 1995. Specific PCR primers directed to identify cryI and cryIII genes within a Bacillus thuringiensis strain collection. Appl. Environ. Microbiol., 61: 3826–3831. Chambers, J.A., Jelen, A., Gilbert, M.P., Jany, C.S., Johnson, T.B., and Gawron-Burke, C. 1991. Isolation and characterization of a novel insecticidal crystal protein gene from Bacillus thuringiensis subsp. aizawai. J. Bacteriol. 173: 3966–3976. De-Souza, M.T., Lecadet, M.M., and Lereclus, D. 1993. Full expression of the cryIIIA toxin gene of Bacillus thuringiensis requires a distant upstream DNA sequence affecting transcription. J. Bacteriol. 175: 2952–2960. De-Souza, M.T., Lima, M.I., Silva-Werneck, J.O., Dias, J.M.C.S., and Ribeiro, B.M. 1999. Ultrastructural and molecular characterization of the parasporal crystal proteins of Bacillus thuringiensis subsp. kurstaki S93 active against Spodoptera frugiperda. Biocell. 23(1): 43–49. Dias, S.C., Lopes, J.B., Silva-Werneck, J.O., and Dias, J.M.C.S. 1993. Isolamento, caracterização e avaliação da patogenicidade de 4 estirpes brasileiras de Bacillus thuringiensis. Congreso Latinoamericano e Nacional de Biotecnologia, 3rd. Comité Nocional de Biotecnologia de CONICYT (ed). Santiago, Chile. November 16–19, 1993. (Abstr.) p. 153. Edwards, D.L., Payne, J., and Soares, G.G. 1990. Novel isolates of Bacillus thuringiensis having activity against nematodes. U.S. Patent No. 4,948,734. EMBRAPA. (Centro Nacional de Pesquisa de Milho e Sorgo.) 1997. Recomendações técnicas para o cultivo do milho. 2nd ed. EMBRAPA-SPI, Brasília, Brazil. Estruch, J.J., Warren, G.W., Mullins, M.A., Nye, G.J., Graig, J.A., and Koziel, M.G. 1996. Vip3A, a novel Bacillus thuringiensis vegetative insecticidal protein with a wide spectrum of activities against lepidopteran insects. Proc. Natl. Acad. Sci. U.S.A. 93: 5389–5394.

Can. J. Microbiol. Vol. 45, 1999 Feitelson, J.S., Payne, J., and Kim, L. 1992. Bacillus thuringiensis: insects and beyond. Bio-Technology (N.Y.), 10: 271–275. Ferraz, J.M.G. 1991. Estudos bioecológicos de Spodoptera frugiperda (Abbot and Smith, 1797) (Lepidoptera: Noctuidae) como subsídio ao manejo integrado de pragas na cultura do milho. Ph.D. thesis, Universidade Estadual de Campinas, Campinas, São Paulo, Brazil. Finney, D.J. 1971. Probit analysis. 3rd ed. Cambridge University Press, Cambridge. Garczynski, S.F., Crim, J.W., and Adang, M. 1991. Identification of putative insect brush border membrane-binding molecules specific to Bacillus thuringiensis δ-endotoxins by protein blot analysis. Appl. Environ. Microbiol. 57: 2816–2820. Gill, S.S., Cowles, E.A., and Pietrantonio, P.V. 1992. The mode of action of Bacillus thuringiensis endotoxins. Annu. Rev. Entomol. 37: 615–636. Gonzáles, J.M., Jr., Brown, B.J., and Carlton, B.C. 1982. Transfer of Bacillus thuringiensis plasmids coding for delta-endotoxin among strains of B. thuringiensis and B. cereus. Proc. Natl. Acad. Sci. U.S.A. 79: 6951–6955. Hansen, B.M., Damgaard, P.H., Eilenberg, J., and Pedersen, J.C. 1996. Characterization of Bacillus thuringiensis. In Bacillus thuringiensis—ecology and environmental effects of its use for microbial pest control. Edited by Danish Environmental Protection Agency. Ministry of Environment and Energy, Copenhagen, Denmark. pp. 14–26. Höfte, H., and Whiteley, H.R. 1989. Insecticidal crystal protein of Bacillus thuringiensis. Microbiol. Rev. 53: 242–255. Höfte, H., Van Rie, J., Jansens, S, Van Houtven, A., Vanderbruggen, H., and Vaeck, M. 1988. Monoclonal antibody analysis and insecticidal spectrum of three types of lepidopteran-specific insecticidal crystal proteins of Bacillus thuringiensis. Appl. Environ. Microbiol. 54: 2010–2017. Inagaki, S., Miyasono, M., Ishiguro, T., Takeda, R., and Hayashi, Y. 1992. Proteolytic processing of δ-endotoxin of Bacillus thuringiensis var. kurstaki HD-1 in insensitive insect, Spodoptera litura: unusual proteolysis in the presence of sodium dodecyl sulfate. J. Invertebr. Pathol. 60: 64–68. Johnson, D.E., and McGaughey, W.H. 1996. Contribution of Bacillus thuringiensis spores to toxicity of purified Cry proteins towards Indian meal moth larvae. Curr. Microbiol. 33: 54–59. Kalman, S., Kiehne, K.L., Libs, J.L., and Yamamoto, T. 1993. Cloning of a novel cryIC-type gene from a strain of Bacillus thuringiensis subsp. galleriae. Appl. Environ. Microbiol. 57: 3057–3061. Krieg, A., and Langenbruch, G.A. 1981. Susceptibility of arthropod species to Bacillus thuringiensis. In Microbial control of pests and plant diseases 1970–1980. Edited by H.D. Burges. Academic Press, London. pp. 837–896. Laemmli, U.K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London), 227: 680–685. Lambert, B., Buysse, L., Decock, C., Jansens, S., Piens, C., Saey, B., Seurinck, J., Van Audenhove, K., Van Rie, J., Van Vliet, A., and Peferoen, M. 1996. A Bacillus thuringiensis insecticidal crystal protein with a high activity against members of the family Noctuidae. Appl. Environ. Microbiol. 62: 80–86. Lereclus, D., Lecadet, M.M., Ribier, J., and Dedonder, R. 1982. Molecular relationships among plasmids of Bacillus thuringiensis: conserved sequences through 11 crystalliferous strains. Mol. Gen. Genet. 186: 391–398. Lereclus, D., Bourgouin, C., Lecadet, M.M., Klier, A., and Rapoport, G. 1989. Role, structure, and molecular organization of the genes coding for the parasporal δ-endotoxins of Bacillus © 1999 NRC Canada

Silva-Werneck et al. thuringiensis. In Regulation of procaryotic development. Edited by I. Smith, R.A. Slepecky, and P. Setlow. American Society for Microbiology, Washington, DC. pp. 255–276. Lereclus, D., Delécluse, A., and Lecadet, M.M. 1993. Diversity of Bacillus thuringiensis toxins and genes. In Bacillus thuringiensis, an environmental biopesticide: theory and practice. Edited by P.F. Entwistle, J.S. Cory, M.J. Bailey, and S. Higgs. John Wiley and Sons, New York. pp. 37–69. López-Meza, J.E., and Ibarra, J.E. 1996. Characterization of a novel strain of Bacillus thuringiensis. Appl. Environ. Microbiol. 62: 1306–1310. Lorence, A., Darszon, A., Díaz, C., Liébano, A., Quintero, R., and Bravo, A. 1995. δ-endotoxins induce cation channels in Spodoptera frugiperda brush border membranes in suspension and in planar lipid bilayers. FEBS Lett. 360: 217–222. McGaughey, W.H., and Johnson, D.E. 1992. Indianmeal moth (Lepidoptera: Pyralidae) resistance to different strains and mixtures of Bacillus thuringiensis. J. Econ. Entomol. 85(5): 1594– 1600. Moar, W.J., Masson, L, Brousseau, R., and Trumble, J.T. 1990. Toxicity to Spodoptera exigua and Trichoplusia ni of individual P1 protoxins and sporulated cultures of Bacillus thuringiensis subsp. kurstaki HD-1 and NRD-12. Appl. Environ. Microbiol. 56: 2480–2483. Moar, W.J., Pusztai-Carey, M., Van Faassen, H., Bosch, D., Frutos, R., Rang, C., Luo, K., and Adang, M.J. 1995. Development of Bacillus thuringiensis CryIC resistance by Spodoptera exigua (Hübner) (Lepidoptera:Noctuidae). Appl. Environ. Microbiol. 61: 2086–2092. Morales, G.G., and Novoa, A.S. 1992. Seleccion de cepas de Bacillus thuringiensis para control de insectos lepidopteros. Southwest. Entomol. 17: 63–67. Navon, A. 1993. Control of lepidopteran pests with Bacillus thuringiensis. In Bacillus thuringiensis, an environmental biopesticide: theory and practice. Edited by P.F. Entwistle, J.S. Cory, M.J. Bailey, and S. Higgs. John Wiley and Sons, New York. pp. 125–146. Nyouki, F.F.R., Fuxa, J.R., and Richter, A.R. 1996. Spore-toxin interactions and sublethal effects of Bacillus thuringiensis in Spodoptera frugiperda and Pseudoplusia includens (Lepidoptera: Noctuidae). J. Entomol. Sci. 31: 52–62. Payne, J., Cannon, R.J.C., and Ralph, A.L. 1994. Bacillus thuringiensis isolates for controlling acarides. U.S. Patent No. 5,350,576.

471 Ribeiro, B.M., and Crook, N.E. 1993. Expression of full-length and truncated forms of crystal protein genes from Bacillus thuringiensis subsp. kurstaki in a baculovirus and pathogenicity of the recombinant viruses. J. Invertebr. Pathol. 62: 121–130. Sambrook, J., Fritsch, E.F., and Maniatis, T. 1989. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. Silva-Werneck, J.O., Abreu Neto, J.R.M.V., Faria, L.O., and Dias, J.M.C.S. 1993. Novo isolado de Bacillus thuringiensis efetivo contra Spodoptera frugiperda. Congresso Brasileiro de Microbiologia, 17th, Sociedade Brasileira de Microbiologia (ed), Tecpress. Santos, Brazil, November 7–11, 1993. (Abstr.) p. 22. Silva-Werneck, J.O., Abreu Neto, J.R.M.V., Tostes, A.N., Faria, L.O., and Dias, J.M.C.S. 1998. (Embrapa - Recursos Genéticos e Biotecnologia) Unpublished data. Southern, E. 1975. Detection of specific DNA sequences among DNA fragments separeted by gel electrophoresis. J. Mol. Biol. 98: 503–517. Tailor, R., Tippett, J. Gibb, G., Pells, S., Pike, D., Jordan, L., and Ely, S. 1992. Identification and characterization of a novel Bacillus thuringiensis δ-endotoxin entomocidal to coleopteran and lepidopteran larvae. Mol. Microbiol. 6: 1211–1217. Tang, J.D., Shelton, A.M., Van Rie, J., De Roeck, S., Moar, W.J., Roush, R.T., and Peferoen, M. 1996. Toxicity of Bacillus thuringiensis spore and crystal protein to resistant diamondback moth (Plutella xylostella). Appl. Environ. Microbiol. 62: 564–569. Tapp, H., and Stotzky, G. 1995. Insecticidal activity of the toxins from Bacillus thuringiensis subspecies kurstaki and tenebrionis absorbed and bound on pure and soil clays. Appl. Environ. Microbiol. 61(7): 1786–1790. Visser, B., Van Der Salm, T., Van Den Brink, W., and Folkers, G. 1988. Genes from Bacillus thuringiensis entomocidus 60.5 coding for insect-specific crystal proteins. Mol. Gen. Genet. 212: 219–224. World Health Organization. 1985. Informal consultation on the development of Bacillus sphaericus as a microbial larvicide. UNDP/World Bank/WHO Special Programme for Research and Training in Tropical Diseases (TDR). Geneva. Yudina, T.G., and Burtseva, L.I. 1997. Activity of δ-endotoxins of four Bacillus thuringiensis subspecies against prokaryotes. Microbiology, 66: 17–22.

© 1999 NRC Canada