Characterization of Citrus sinensis type 1 ... - Bioscience Reports

Biosci. Rep. (2010) / 30 / 59–71 (Printed in Great Britain) / doi 10.1042/BSR20080180

Characterization of Citrus sinensis type 1 mitochondrial alternative oxidase and expression analysis in biotic stress Lucas Damián DAURELIO*, Susana Karina CHECA†, Jorgelina Morán BARRIO†, Jorgelina OTTADO* and Elena Graciela ORELLANO*1 *Molecular Biology Division, IBR (Instituto de Biologia Molecular y Celular de Rosario), CONICET (Consejo Nacional de Investigaciones Cient´ıficas y Técnicas), Facultad de Ciencias Bioqu´ımicas y Farmacéuticas, Universidad Nacional de Rosario, Suipacha 531, (S2002LRK) Rosario, Argentina, and †Microbiology Division, IBR, CONICET, Facultad de Ciencias Bioqu´ımicas y Farmacéuticas, Universidad Nacional de Rosario, Suipacha 531, (S2002LRK) Rosario, Argentina

'

$

Synopsis The higher plant mitochondrial electron transport chain contains an alternative pathway that ends with the AOX (alternative oxidase). The AOX proteins are encoded by a small gene family composed of two discrete gene subfamilies. Aox1 is present in both monocot and eudicot plants, whereas Aox2 is only present in eudicot plants. We isolated a genomic clone from Citrus sinensis containing the Aox1a gene. The orange Aox1a consists of four exons interrupted by three introns and its promoter harbours diverse putative stress-specific regulatory motifs including pathogen response elements. The role of the Aox1a gene was evaluated during the compatible interaction between C. sinensis and Xanthomonas axonopodis pv. citri and no induction of the Aox1a at the transcriptional level was observed. On the other hand, Aox1a was studied in orange plants during non-host interactions with Pseudomonas syringae pv. tomato and Xanthomonas campestris pv. vesicatoria, which result in hypersensitive response. Both phytopathogens produced a strong induction of Aox1a, reaching a maximum at 8 h post-infiltration. Exogenous application of salicylic acid produced a slight increase in the steady-state level of Aox1a, whereas the application of fungi elicitors showed the highest induction. These results suggest that AOX1a plays a role during biotic stress in non-host plant pathogen interaction. Key words: alternative oxidase, Citrus sinensis, non-host response, Pseudomonas syringae pv. tomato, Xanthomonas axonopodis pv. citri, Xanthomonas campestris pv. vesicatoria

&

INTRODUCTION Plant mitochondria are different from those of animals as their electron transport chain is branched at the ubiquinone pool and contains a number of components that enable non-coupled respiration. The mitochondrial AOX (alternative oxidase) pathway is one of these non-energy-conserving pathways that bypasses the last two energy conservation sites associated with the cytochrome pathway by transferring electrons from the ubiquinone directly to oxygen [1–3]. Consequently, the contribution

%

of this pathway to energy balance is one-third that of the classic pathway. The ubiquitous presence of AOX in the plant mitochondria in addition to its sporadic distribution in fungi and protists is well established. Recently, the Aox gene has also been found in plastids [4,5]. Furthermore, Aox genes have also been found in both the eubacterial and animal kingdoms [6,7]. AOXs are nuclear encoded and consist of homodimeric di-iron proteins [5]. The AOX family is composed of a limited number of genes divided into two discrete subfamilies that exhibit highly conserved regions [8], and that can be grouped by molecular

.................................................................. ............................................................. ................................................................. .............................................................. ..............................................

Abbreviations used: ABA, abscisic acid; ABRE, ABA response element; AOX, alternative oxidase; AtAOX, Arabidopsis thaliana AOX; CFU, colony-forming units; GmAOX, Glycine max AOX; hpi, hours post-infiltration; HR, hypersensitive response; MRE, Myb requlatory element; MRR, mitochondrial retrograde response; ORF, open reading frame; Pst, Pseudomonas syringae pv. tomato; PtAOX, Populus tremula AOX; ROS, reactive oxygen species; RT–PCR, reverse transcription–PCR; SA, salicylic acid; SB, Silva Buddenhagen; UTR, untranslated region; VuAOX, Vigna unguiculata AOX; Xac, Xanthomonas axonopodis pv. citri; Xcv, Xanthomonas campestris pv. vesicatoria. 1 To whom correspondence should be addressed (email [email protected]). The nucleotide sequence data reported will appear in GenBank® , EMBL, DDBJ and GSDB Nucleotide Sequence Databases under the accession numbers EU723696, EU723697 and EU723698.

www.bioscirep.org / Volume 30 (1) / Pages 59–71

59

L. D. Daurelio and others

and functional characteristics [9]. Aox1 is present in both monocot and eudicot plants and is widely known for its induction by different types of stresses in many tissues. On the other hand, Aox2 is absent from the genomes of all monocot species examined to date and is usually constitutive or developmentally expressed in eudicot plants [9]. Differential tissue and developmental regulation of Aox genes have been reported in a number of plants: Arabidopsis, cowpea, soya bean, tomato, tobacco and rice [10–12]. Apart from its widely described role in thermogenesis [13], the biological function of AOX in non-thermogenic plants is not fully understood. Its role is generally associated with the increase of carbon flux through the tricarboxylic acid cycle, specifically when ADP supply limits cytochrome pathway activity [14,15]. In general, the proposed AOX function is to prevent or reduce ROS (reactive oxygen species) formation when the classic pathway is stressed or damaged [3,11,12,16]. Strong support for these physiological functions of AOX was recently obtained in tobacco plants and tobacco suspension cells lacking the Aox gene [17,18]. The regulation of AOX activity is complex and occurs at both the transcriptional and post-translational levels [19]. Specific inhibitors of the mitochondrial electron transport chain, hormones and signal molecules – particularly ROS, SA (salicylic acid) and nitric oxide – modify AOX expression [11,20,21]. Furthermore, Aox genes also respond differentially to various biotic and abiotic stresses [15,22]. Nevertheless, the significance of the alternative respiratory pathway particularly during biotic stress [12,23] is still unclear. Several lines of evidence indicate that Aox genes have a role in signalling during defence against different kinds of pathogen-like viruses, bacteria, fungi etc. [22,24]. Simons et al. [24] established that the rapid induction of the AOX in the interaction of Arabidopsis with different Pseudomonas syringae strains was associated with necrosis and ethylene production and suggested that the increase in the activity of the alternative respiration pathway could be associated primarily with symptom expression rather than resistance reaction [24]. Furthermore, AOX from Arabidopsis thaliana increased transiently within the first hour during the HR (hypersensitive response) produced by avirulent Xanthomonas campestris pv. campestris [25]. Several stresses increase tissue production of ROS and frequently result in a concomitant increase in AOX protein amount [3,15]. SA also plays a central role in the plant resistance response, including the activation of SAR (systemic acquired resistance), an inducible defence response against a broad spectrum of pathogens [10,26]. Besides, SA induces Aox expression in voodoo lily (Sauromatum guttatum) appendix tissue [27,28] during thermogenesis. Moreover, SA addition to cell suspensions or to intact leaves of tobacco induces Aox gene expression [29,30]. Treatment of plants with SHAM (salicylhydroxamic acid), an inhibitor of AOX activity, prevents SA-induced resistance to viruses, at least in tobacco [31,32]. Taking into consideration these results, and since SA acts as a signal in the resistance response and induces AOX expression, we suggest that the alternative pathway might be associated with the resistant status.

Although the AOX enzyme has been characterized in many plants, it has been studied only in a few tree species. For this reason we decided to analyse this mitochondrial enzyme in citrus plants, mostly important for the production of fresh fruit and juice consumed worldwide. Moreover, the participation of this enzyme in response to biotic stress has been studied mainly in plant–virus interactions and in a small number of cases with bacteria and fungus. In this context the expression analysis of this gene during the citrus canker will allow us to elucidate the role of this enzyme in bacterial pathogenesis. In the Citrus genus, no characterization of the Aox gene family members has been reported. In the present study, we isolated and investigated structural and regulatory aspects of the Aox1 gene from citrus plants. We found that this gene belongs to the plant gene Aox1a family containing four exons and three introns. Aox1a expression was analysed in orange plants during host interaction with Xac (Xanthomonas axonopodis pv. citri) and non-host interaction with Pst (Pseudomonas syringae pv. tomato) and Xcv (Xanthomonas campestris pv. vesicatoria). Also we examined the Aox1a responses after treatment with SA and fungal elicitors as signalling molecules.

MATERIALS AND METHODS Bacterial strains, culture condition and media Xac (Xcc99-1330), Pst and Xcv strains were grown at 28◦ C in SB (Silva Buddenhagen) medium (5 g/l sucrose, 5 g/l yeast extract, 5 g/l peptone and 1 g/l glutamic acid, pH 7). All the strains were kindly provided by Dr Blanca I. Canteros (INTA Bella Vista). Xac was supplemented with ampicillin (25 μg/ml).

Plant material and pathogen inoculations Citrus sinensis cv. petropolis orange plants were used throughout the present study and were gently provided by Catalina Anderson (INTA Concordia). They were grown in the greenhouse at 26◦ C with a photoperiod of 16 h. One-month-old leaves were used in all experiments. Xac were grown in SB broth to D600 (attenuance) of 1, harvested by centrifugation (4000 g, 10 min at 20◦ C) and resuspended in 10 mM MgCl2 at 107 CFU (colony-forming units)/ml. For disease symptoms and HR assays, bacterial suspensions were infiltrated into leaves with needleless syringes and samples were extracted at the times indicated in the Figures. For pathogen infiltration experiments, dilutions of 107 CFU/ml for Xac or 108 CFU/ml for Pst and Xcv were used. SA treatments were carried out with 1 and 5 mM dilutions. For assays with elicitors, autoclaved cellulase (120◦ C, 20 min) Onozuka R10 (Yakuruto Biochemicals, Tokyo, Japan) was used [33]. Sterile MgCl2 (10 mM) was employed as the control and diluent for the inoculations. The bacteria, SA, elicitors or control solutions were pressure infiltrated into the abaxial side of the leaves using a needleless syringe [34].

..........................................................................................................................................................................................................................................................................................................................................................................

60

C The

Authors Journal compilation

C 2010

Biochemical Society

Citrus alternative oxidase characterization and expression studies

Genomic DNA extraction, PCR and fragment analysis Standard microbiological and molecular genetic techniques were employed [35], unless otherwise specified. Samples of frozen leaves were ground in liquid nitrogen using a mortar and pestle and DNA was extracted by the method of Dellaporta et al. [36]. PCR was carried out using P1–P2 primers of Saisho et al. [37] and orange genomic DNA as a template. Amplification was made with a Mastercycler Gradient thermal cycler (Eppendorf) for 20 cycles, each consisting of 15 s at 94◦ C for denaturation, 90 s at 60◦ C for annealing and extension, and subsequently 20 cycles, each consisting of 15 s at 94◦ C for denaturation, 90 s at 60◦ C, adding to each cycle 5 s for annealing and extension. PCR products were electrophoresed on 2% (w/v) agarose gels that had been ethidium bromide stained. The band was purified with spin columns (Qiagen, Valencia, CA, U.S.A.), cloned in pGEM-Teasy (Promega) and screened by PCR using P1–P2 primers. Positive clones were sent to the University of Maine Sequencing Facility for sequencing. Restriction analysis of P1–P2 fragment with AluI and DdeI enzymes (Promega) was made using 200 ng of amplified DNA and 1 unit of each enzyme in 1× their respective buffers as supplied by the manufacturer, during 3 h at 37◦ C, and then they were separated in 2% (w/v) agarose gels that were ethidium bromide stained.

Southern-blot hybridization For Southern-blot hybridization, 10 μg of orange genomic DNA was digested with EcoRI overnight at 37 ◦ C. Digested DNA was separated on 0.8% (w/v) agarose gel at 20 V overnight, transferred overnight on to positively charged nylon membranes (Hybond N+; Amersham Biosciences) with 10× SSC (1× SSC is 0.15 M NaCl/0.015 M sodium citrate) and then fixed by baking for 2 h at 80◦ C [38]. Radioactive AoxOra1 probe was synthesized by random primer labelling [α-32 P]dATP using the Prime-a-Gene kit (Promega) according to the manufacturer’s instructions. Filter blot was hybridized overnight at 65◦ C in hybridization buffer [6×SSC, 0.5% (w/v) SDS and 5× Denhardt’s solution (0.02% Ficoll 400/0.02% polyvinylpyrrolidone/0.02% BSA)] containing 106 c.p.m./ml AoxOra1 probe and washed at room temperature (25◦ C) [twice for 5 min with 2×SSC+0.1% SDS, once for 20 min with 1×SSC+0.1% SDS and once for 20 min with 0.2×SSC+0.1% SDS]. Radioactive images were obtained with a high-resolution phosphoimager scanner (Storm; Amersham Biosciences).

Subgenomic DNA library construction, screening and DNA sequencing For Aox1a cloning, an orange subgenomic library was constructed. Genomic DNA digestion and electrophoresis were performed as described above. A gel band of 2000 bp was excised from the agarose gel and DNA was purified with spin columns (Qiagen). Purified fragments were cloned in pBluescript® II KS+ Phagemid vector (Stratagene) and transformed in Escherichia coli DH5α. The library was screened with AoxOra1 probe used in Southern-

blot analysis. Plasmids were isolated and sent to the University of Maine Sequencing Facility for sequencing.

RNA extraction, semi-quantitative and competitive-quantitative RT–PCR (reverse transcription–PCR) analysis Total RNA was isolated from orange infiltrated leaves using TRIzol® reagent (Invitrogen) according to the manufacturer’s instructions. At least 100 mg of frozen tissue was used for each total RNA extraction and samples were stored at –80◦ C until used. For cDNA first-strand synthesis, 1 μg of total RNA was heated to 70◦ C for 10 min and then cooled on ice for 2 min. The mix reaction containing 200 units of MMLV (Moloneymurine-leukaemia virus) reverse transcriptase (Promega), 2.5 μg of primer dT22 or primer dN6 , 0.4 mM dNTPs and 1 mM dithiothreitol (20 μl reaction volume) was added and incubated for 2 h a 42 ◦ C. The two oligonucleotides used for PCR of orange Aox1a (AoxNar5 up: 5 -TCCCCAAGAAACAACAAAAGC-3 and AoxNar5 compdown: 5 -CGTGGTGCTTCTTCAAATCA3 ) were designed to amplify from the 5 -UTR (5 -untranslated region) to exon 2, generating a 477 bp product. PCR was performed with 1 μl of cDNA template, 1 unit of GoTaq (Promega), 1× GoTaq buffer (Promega), 0.4 mM dNTPs, 10 pmol of each primer (25 μl reaction volume) and performed in a Mastercycler gradient thermal cycler (Eppendorf), under the following conditions: 94◦ C for 3 min, followed by 30 cycles of 94◦ C for 1 min, 58◦ C for 1 min, and 72◦ C for 1 min, and final extension at 72◦ C for 10 min. Template quantity and number of PCR cycles were determined to ensure that the amplification stays in the linear range. RT–PCRs were normalized by including a primer pair to amplify a 286 bp fragment of 18S rRNA (18S-F, GAACAACTGCGAAAGCATTTGC, and 18S-R, CCTGGTAAGTTTCCCCGTGTTG) in the same tube at cycle number 5 to avoid product saturation [39]. Competitive quantitative RT–PCR was performed to quantify the number of Aox1a transcripts expressed. The plasmid harbouring the orange Aox1a gene previously isolated was quantified and used as a competitor. The same primers for Aox1a semiquantitative RT–PCR were employed, which amplify a 587 bp product from the competitor (it contains intron 1). The amount of competitor added to gain identical intensities of PCR products for the Aox1a competitor and cDNA was used to quantify the amounts of transcripts. Competitive RT–PCR was used to quantify the induction of Aox on treated samples and a quantification factor was used to multiply the normalized net intensities for the other samples as described in [39], and results were analysed using multifactorial ANOVA and a Tukey multiple comparison test. The PCR products (20 μl) were electrophoresed on a 2% (w/v) agarose gel and photographed in a FOTO/Analyst® Investigator Eclipse® (Fotodyne). Gel-Pro Analyzer Software 3.1 (Media Cybernetics) was used to measure the intensity of each band.

Sequence analysis, alignments and phylogeny ORF (open reading frame) analysis and protein prediction were made using NetGene2 (http://www.cbs.dtu.dk/services/

..........................................................................................................................................................................................................................................................................................................................................................................


61


NetGene2) and by alignments with exons from Aox reported from other species with MEGA 3 software [40]. Translation was carried out using Transseq (http://www.ebi.ac.uk/emboss/transeq). Signal peptide and cleavage site were predicted using PSORT (http://psort.nibb.ac.jp/) and SignalP programs (http://www.cbs. dtu.dk/services/SignalP/). Subcellular localization was analysed using ProtComp v6.0 (http://www.softberry.com, Protein location/patterns/Epitops, ProtComp) and TargetP (http://www. cbs.dtu.dk/services/TargetP/). Transcription and translation initiation sites were inferred with ProScan (http://thr.cit.nih.gov/ molbio/proscan/) and NetStar (http://www.cbs.dtu.dk/services/ NetStart/) respectively. The theoretical pI and mass values for complete protein were calculated with the PeptideMass program (http://us.expasy.org/tools/peptide-mass.html). Based on the neighbour-joining method [41], a phylogenetic tree (1000 bootstraps) was generated with MEGA 3 program. Sequences from the following list (GenBank® accession numbers in parentheses) were used for the phylogenetic analyses: C. sinensis AOX1 (EU723698); A. thaliana AOX1a (Q39219), AOX1b (O23913), AOX1c (O22048), AOX1d (NP_564395) and AOX2 (O22049); C. sativus AOX2a (AAP35170), D. vulgaris AOX (BAD51465); GmAOX1 (Glycine max AOX1) (X68702), AOX2a (U87906), and AOX2b (U87907); L. esculentum AOX1a (AY034148), AOX1b (AY034149), AOX2 (AAP92755) and plastidic AOX (AAG02286); Mangifera indica AOX2 (X79329); Nicotiana tabacum AOX1a (S71335); Nicotiana attenuata (AAR37364); Oryza sativa AOX1a (AB004864), AOX1b (AB004865) and AOX1c (AB074005); P. bipinnatifidum AOX (BAD51467); Populus tremula AOX1a (AJ251511) and AOX1b (AJ271889); S. officinarum AOX1a (AY64465), AOX1b (AY64466), AOX1c (AY64467) and AOX1d (AY64468); S. guttatum AOX1 (M60330); S. tuberosum AOX1a (ABB76768.1); T. aestivum AOX1a (AB078882) and AOX1c (AB078883); VuAOX1 (Vigna unguiculata AOX1) (AAZ09197), AOX2a (AJ319899) and AOX2b (AJ421015); Z. mays AOX1a (AY059647), AOX1b (AY059648) and AOX1c (AY059646); Novosphingobium aromaticivorans AOX1a (79040925); C. neoformans AOX (AAM22475); T. brucei AOX0B (BAB72256); P. aphanidermatum AOX (CAE11918); C. reinhardtii AOX0A (AAG33633) and AOX0B (7446498); C. albicans AOX0A (AAC98914) and AOX0B (AF116872); P. anomala AOX (BAA90763); P. anserina AOX (AAK58849); Y. lipolytica AOX (CAD21442); V. inaequalis AOX (AAK61349); A. niger AOX (AAN39883); A. capsulatus AOX (AAD29681); A. fumigatus (AAL87459); E. nidulands AOX (AAN39883); B. fuckeliana AOX (CAD42731); M. fructicola AOX (AAL24516); B. graminis AOX (AAL56983); M. grisea AOX (AAG49588); N. crassa AOX0B (Q01355); Gelasinospora AOX (AAN39884); D. discoideum AOX (BAB82989). Putative cis-acting regulatory elements in the promoter region were localized using PLACE (http://www.dna.a.rc.go.jp/ PLACE/) and plantCARE (sphinx.rug.ac.be:8080/PlantCARE/ cgi/index.html) software. To search for common Aox promoter elements, Motif-Sampler software was used for subsequent sequence analysis (http://homes.esat.kuleuven.be/∼thijs/Work/ MotifSampler.html) [42]. The background distribution of nucle-

otides was predicted by using a third order model of pre-compiled intergenic regions from Arabidopsis [43]. Motif lengths (w) of 6, 7, 8 and 9 bp were analysed. For each run, the number of different motifs per sequence was fixed to a value of 2. The prior probability of finding one motif was fixed at 0.2 and the maximum number of copies per sequence for a given motif (Cmax ) was unset. Both DNA strands were always scanned. The algorithm was iterated 500 times for each combination of parameters.

RESULTS Analysis of C. sinensis Aox family To elucidate the Aox gene family composition in orange, we performed PCR amplification on isolated C. sinensis var. Petrópolis genomic DNA using the degenerate primers reported in [37] named P1 and P2, corresponding to a highly conserved region of exon 3 from the Aox gene. As expected, only one fragment of approx. 440 bp was obtained and cloned. The clones obtained were divided into two groups after AluI restriction analysis (Figure 1A). The nucleotide sequence for each group was determined and the sequences obtained were named AoxOra1 and AoxOra2 (accession numbers EU723696 and EU723697 respectively). AoxOra1 was not cut by AluI, whereas AoxOra2 possessed two recognition sites for this enzyme (Figure 1B). BLAST search against all sequences in the non-redundant databases showed that AoxOra1 presents high homology with Aox1a-type genes (identities higher than 80% and E value lower than 10−25 within the first ten sequences), whereas the AoxOra2 sequence shared homology with Aox2-type genes (identities higher than 85% and E-value lower than 10−30 within the first ten sequences). In addition, BLAST searches using AoxOra1 and AoxOra2 against citrus the EST (expressed tag sequence) database revealed that AoxOra1 has an EST homologue (accession number EY747469) that spans only the 3 -end of AoxOra1 (Supplementary Figure S1 at http://www.bioscirep.org/bsr/030/bsr0300059add.htm). AoxOra2 showed four EST homologues (accession numbers CK934060, CF838892, CF838550 and EY666192), which in addition to AoxOra2 allowed us to build a hypothetical citrus Aox2-type complete sequence (Supplementary Figure S1). In order to further analyse the genomic Aox1 subfamily, a genomic DNA Southern blot from orange was carried out. DNA was digested with EcoRI and hybridized with the AoxOra1 fragment. Two bands of similar intensity were obtained after hybridization with the specific probe, corresponding to fragments of approx. 5500 and 2000 bp respectively (Figure 1C). Both bands were purified from agarose gel run in parallel and used as a template for P1–P2 PCR amplification to confirm Aox identity. We analysed the two PCR products with DdeI restriction enzyme and the digested patterns indicated that both fragments correspond to Aox1-type gene (Figure 1B), the upper band being not digested, whereas the lower band displayed a 220 bp fragment indicating that at least the latter has one of the previously mentioned restriction recognition sites (Figure 1D). The 5500 bp fragment was named Aox1b and the 2000 bp fragment Aox1a. Taken together,

..........................................................................................................................................................................................................................................................................................................................................................................

62

C The


C 2010

Biochemical Society


Figure 1

Analysis of the C. sinensis Aox gene family (A) Gel electrophoresis of PCR products using P1–P2 primers on C. sinensis genomic DNA (1), plasmids carrying AoxOra1 and AoxOra2 digested with AluI (lanes 2 and 3 respectively). Arrows indicate the fragments detected. (B) Restriction maps of AoxOra1, AoxOra2 and citrus Aox1a P1–P2 fragment with AluI and DdeI (fragment sizes in base-pairs are shown in parentheses). (C) Southern-blot analysis of citrus Aox type 1. Genomic DNAs from C. sinensis var. Petrópolis (10 μg) were digested with the restriction enzyme EcoRI (lane 1) and hybridized with a 444 bp fragment (AoxOra1). Arrows indicate the alleles detected. pGEM-T vector with AoxOra1 insert, digested with the restriction enzyme PstI, was used as a positive control (lane 2). Molecular size markers are shown on the right. (D) Gel electrophoresis of PCR products using P1–P2 primers over the 2000 bp or Aox1a (2) and the 5500 bp or Aox1b (3) alleles digested with DdeI. The same product without digestion is shown (1). Arrows indicate the fragments detected.

all these results support the idea that both Aox subfamilies are present in citrus plants, the Aox1-type subfamily bearing two genes, whereas the Aox2-type subfamily bears at least one copy.

Isolation and characterization of Citrus Aox1a gene The gel band where the Aox1a migrated (2000 bp) was excised and cloned in pBluescript® II KS+ plasmid to construct a sublibrary. Screening of 3000 clones with the probe used in the Southern blot led to the isolation of two positive clones, which were sequenced. One of them contains a 2013 bp fragment (accession number EU723698), which covers 1749 bp of the Aox1a codifying sequence and 354 bp of the upstream region spanning part of the promoter. The codifying sequence includes a complete 5 -UTR, four exons, three introns and part of the 3 -end UTR (Figure 2). The putative transcription and translation start sites were located, allowing us to define exactly the 5 -UTR region. Exons and introns were distinguished by in silico positioning of the splicing sites and by homology with exons of plant Aox1a-type reported. No polyadenylation signal or polyadenylation sites were detected. The putative cDNA Aox1a sequence was assembled and translated. This fragment revealed a precursor protein of 336 amino

acid residues that codifies for a 36 kDa protein with a theoretical pI of 8.35. Conserved regions from the deduced AOX proteins from different plants were identified (Figure 2): (i) two cysteine residues that are assumed to be involved in redox regulation of AOX activity and Cys-108, the nearest one to the N-terminal end, that is known to be involved in dimerization by S–S bond formation; (ii) four helical regions, rich in glutamate and histidine residues, presumably involved in the formation of a hydroxo-bridged binuclear iron centre; and (iii) two hydrophobic helices that have been proposed to form a membrane-binding domain [12]. Also, cleavage site and mitochondrial localization was predicted via PSORT software, including the presence of a VRLFST sequence in the signal peptide, similar to the conserved VRSEST motif [44] (Figure 2). The citrus Aox1a, like most of the Aox1 plant genes, consists of four exons interrupted by three introns (Figure 2). The lengths of the first, second and third introns were 111, 420 and 89 bp respectively, whereas the exons were 333, 129, 489 and 60 bp long (Figure 2). The relative positions of introns/exons and their sizes are highly conserved among eudicot Aox1 genes sequenced. All introns present typical structural characteristics of plant introns, being A + T-rich (73% for intron 1, 74% for intron 2 and 65% for intron 3) and containing 5 -splice donor GT and 3 -splice acceptor AG signals (Figure 2). This citrus AOX1a

..........................................................................................................................................................................................................................................................................................................................................................................


63


Figure 2

C. sinensis Aox1a genomic nucleotide sequence and predicted amino acid sequence The 5 - and part of the 3 -UTR regions are indicated in grey italic letters; the translation initiation and stop codons are boxed; and the regions corresponding to the exons are in boldface. The donor (GT) and acceptor (AG) sites for splicing are underlined. The initiation sites of each exon are shown in black numbers under the sequence. Deduced amino acid sequence is shown below the nucleotide sequence in boldface letters. The region corresponding to the mitochondrial transit peptide is exposed in grey italics, with the putative cleavage site boxed. The four helical regions are shown underlined with grey background boxes indicating two highly conserved cysteine residues and the histidine and glutamate residues corresponding to the active site. The possible membrane-binding domains are double underlined.

precursor protein presents the highest homologies in BLAST searches with AtAOX1a (A. thaliana AOX1a) (accession number Q39219) and P. tremula AOX1a (accession number AJ251511) proteins (4 × 10−146 and 9 × 10−145 E-values respectively). These homologies were maintained using either the mature protein or the active site region, but increasing the identity values due to an augment in conserved domains.

A phylogenetic tree with 62 AOX complete proteins from plants, fungi, protists and green algae was constructed by the neighbour-joining method (Figure 3). The deduced AOX1a polypeptide of C. sinensis grouped with the AOX1a type from eudicots, particularly linked to the homologues from PtAOX1a, AtAOX1a, AtAOX1b, AtAOX1c, GmAOX1 and VuAOX1 (Figure 3). In this context, the AOX1a from C. sinensis may be

..........................................................................................................................................................................................................................................................................................................................................................................

64

C The


C 2010

Biochemical Society


Table 1 Cis-acting elements of the citrus Aox1a promoter and their respective functions, positions and strands Name

Function

Position

Strand

G-box

Light responsiveness

– 170, – 253

+, +

I-box


– 195

+

MRE


– 143

+, +

GT1 motif


– 86

–

ABRE

ABA responsiveness

– 253

–

W-box

Associated with pathogen defence

– 168

–

GC motif

Anoxic-specific inducibility

– 177

+

PR-box

PR-box

– 123

–

E2F-2

Cell cycle-related genes

– 75

+

GCC-box

Ethylene-related motif

– 173

+

SEF1 motif

Involved in young tissue development

– 293

–

Dof motif

Plant-specific process

– 65

–

considered orthologous to AOX1a from poplar, Arabidopsis, soya bean and cowpea although the smallest distances were observed for Arabidopsis AOX1a and cowpea AOX1. Similar results were obtained constructing the phylogenetic tree with mature AOX proteins or only the region corresponding to the active site, indicating that despite the differences in signal peptide, homologies in conserved regions define the groups.

Promoter sequence analysis As mentioned, the 354 bp fragment belonging to the upstream citrus Aox1a region was analysed (Figure 4) to find plant-specific cis-acting regulatory elements by manual search and by using the PLACE and PlantCARE databases (see the Materials and methods section). Numerous regulatory motifs were recognized, suggesting the complex nature of Aox1a gene regulation in orange. The most relevant sites are highlighted in Figure 4 and summarized in Table 1. These include a TATA-box at –30 relative to the transcription start site (+1) and the element common to plant promoters CAAT at –60. Motifs involved in the recognition of transcription factors that participate in different processes such as response to light [G-box, I-box, MRE (Myb regulatory element) and GT1 motif], hormones {ABRE [ABA (abscisic acid) response element] and GCC-box}, stress (GC motif), cell cycle (E2F-2) and tissue development (SEF1 motif) were found. In addition, we identified specific regulatory motifs known to respond to pathogens (W-box and PR-box), which are present in numerous biotic stress-activated plant promoters [45]. In the case of WRKY motif, it is conserved in orange as well as in GmAox2b from soya bean, in AtAox1a and AtAox1b from Arabidopsis and in Aox1a from maize and rice [46]. On the other hand, the citrus Aox1a promoter sequence was compared with other Aox promoters sequenced using MotifSampler software [42] and four overrepresented regions were observed (Figure 4). Three motifs were reported previously [21]:

one has been functionally characterized (TTAGATAAC) and two have not been characterized yet (AGAAGATTG and CGGTTGA). The fourth motif CCTTAAAC is reported for the first time in the Aox promoter region, and an identical motif was found in GmAox1 from G. max and CrAox1 from Catharanthus roseus. Noticeably, when citrus Aox1a promoter was compared with the MRR (mitochondrial retrograde response) region of Arabidopsis Aox1a [47,48], even with little sequence homologies between them, all transcription factor-binding motifs found in the MRR region were present in the promoter, except for the CCA1-binding site involved in the circadian clock [46]. Actually, in this region of Aox1a, a site related to SA regulation was not found. In accordance, Ho et al. [46] showed that the promoter of Aox1a from A. thaliana did not have a cis-element related to SA. However, they observed Aox1a changes in transcript abundance by SA treatment and concluded that the regulation of this gene accounts for post-transcriptional modifications [10,46].

Expression of Aox1a in compatible and incompatible plant–bacteria interactions, fungal elicitors and SA treatment To evaluate expression patterns of citrus Aox1a in compatible and incompatible plant–pathogen interactions, first we performed Northern-blot analyses. However, the low levels of expression prevented transcript detection. Therefore the expression level of the citrus Aox1a gene was determined by semi-quantitative RT– PCR using Aox-specific primers and relativized to an amplified 18S rRNA internal control. The amplified product was 477 bp for Aox1a and 286 bp for the 18S rRNA. The Aox product was obtained using AoxNar5 up and AoxNar5 compdown oligonucleotides. These primers span the 5 -UTR to exon 2 regions. This reduces cross-amplification with other Aox family genes due to the low homology found in this region among the Aox1 and Aox2 groups and also allows us to detect DNA genomic contamination. The expression of the citrus Aox1a gene was analysed in the compatible interaction with Xac and in non-host response with Pst and Xcv. In all experiments the infiltrations were performed in 1-month-old leaves with 107 CFU/ml of Xac or 108 CFU/ml for Xcv and Pst. Total RNA samples were taken at 0, 2, 8, 24, 48 and 72 hpi (hours post-infiltration). In all experiments mock treatment with MgCl2 (10 mM) resulted in faint bands showing little induction in control conditions and 18S rRNA transcript levels were similar in all samples. The Aox1a level in orange leaves infiltrated with Xac increased in all the samples (2–72 hpi) compared with the control (Figure 5A). The induction was low and no differences were observed between them. In short, in host interaction between orange and Xac, a slight and steady induction of the transcription level of Aox1 was observed (Figure 5A). On the other hand, when orange leaves were inoculated with Xcv and Pst, a strong induction of Aox1a was observed at 8 hpi with both pathogens (Figure 5B). In the case of Pst, 6-fold induction was observed at 8 hpi, whereas for Xcv, 8-fold induction was detected at the same time. At 24 or 48 hpi just before the lesion was visible, Aox transcript levels

..........................................................................................................................................................................................................................................................................................................................................................................


65


Figure 3

For legend see facing page

..........................................................................................................................................................................................................................................................................................................................................................................

66

C The


C 2010

Biochemical Society


Figure 4

Nucleotide sequence of the orange Aox1a promoter The promoter spans 354 nt upstream of the transcription initiation +1 (boldface and italic letters). Promoter motifs are in boldface and underlined, with names over or under the sequence (+ or – strand respectively). The TATA-box and the CAAT region are boxed. Motifs identified using a motif sampler are indicated in grey background.

remained induced, whereas at 72 h AOX expression returned to basal levels. Identical results were obtained in independent replicates. In order to analyse if SA regulates the citrus Aox1a expression, we studied the effect of SA in orange leaves. Our results revealed that the application of SA produced a slight increase in the steady-state level of Aox1a mRNA at 8 h of treatment with both concentrations of SA (1 and 5 mM) and then decayed to an undetectable level (Figure 5C). Finally, we analysed the citrus Aox1a induction after treatment with chitin and chitin oligomers that have been used as elicitors of various defence responses in plants. A slight induction of Aox1a was observed at 8 h after treatment with the elicitor, whereas a strong induction was observed at 24 h, diminishing finally at 48 h (Figure 5C).

Figure 3

Competitive RT–PCR quantification of Aox1a transcripts In order to quantify Aox1a expression levels during plant– pathogen interaction, competitive RT–PCR was performed. Aox1a transcript levels were analysed under the same conditions as in RT–PCR. The plasmid containing the DNA fragment corresponding to citrus Aox1a was precisely quantified and used as competitor. The same specific primer pair for the Aox1a gene was used for amplifications of cDNA template in the sample, yielding a 447 bp DNA fragment and the competitor producing a 587 bp product due to the presence of intron 1. In Figure 6, the transcript amount of Aox1a is presented. Values of approx. 3 × 106 Aox1a molecules of cDNA/μg of total RNA in Xac–orange interaction for all times post infection were observed. Slight induction was observed for all the times related

Phylogenetic tree of 62 deduced AOX proteins from different species The six distinct groups are indicated next to the brackets. The sequence corresponding to C. sinensis is grey boxed. A phylogram was constructed by the neighbour-joining method of MEGA 3 program and the bootstrap values on nodes indicate the percentage of times that each grouping occurred with 1000 replicates (values below 50% were omitted). Branches are drawn in proportion to genetic distance. The branch corresponding to eudicot plant Aox type 1 is amplified (right). The accession numbers are given in the Material and methods section.

..........................................................................................................................................................................................................................................................................................................................................................................


67


Figure 5

RT–PCR using specific primers for Aox1a and 18S rRNA from the citrus plant Treatments with Xac (A), Pst and Xcv (B), elicitors and SA (1 and 5 mM) (C) and time in hpi are indicated above the gels. Each treatment is shown with its respective control. Amplified products for Aox1a and 18S rRNA were 477 and 286 bp respectively. M, 100 bp DNA ladder molecular mass marker.

to the control condition, with significant differences at 2, 24, 48 and 72 hpi (P < 0.05 in all comparisons). The Aox1a was induced in Pst and Xcv interactions, from ‘no detectable’ to a maximal value at 8 hpi of 15 × 106 and 25 × 106 Aox1a molecules of cDNA/μg of total RNA respectively, diminishing slowly to the basal level at 72 hpi, showing significant differences compared with control and Xac–orange interaction at 8, 24 and 48 hpi (P < 0.01 in all comparisons). In the case of the elicitor, a maximum of 37 × 106 molecules of Aox1 cDNA/μg of total RNA was observed at 24 hpi, with 12 and 18 × 106 copies at 8 and 48 hpi respectively, differences that were significant compared with control and Xac–orange interaction at 8, 24 and 48 hpi (P < 0.01 in all comparisons). In the case of SA, no differences were observed for 1 or 5 mM in all times studied similar to the control, reaching a maximum of 5 × 106 molecules at 8 hpi and returning to the basal level at 48 hpi.

DISCUSSION Until now only a few Aox genes from tree plants were reported [15] and no information about the AOX enzyme from the Rutaceae family was available. In the present study, we analysed the C. sinensis Aox family and characterized specifically the Aox1a gene. The results presented here show that C. sinensis has at least three Aox genes, two encoding Aox1-type homologues and one encoding Aox2-type genes. The presence of only one Aox type 2

in the genus is in concordance with the other related plant species [37]. The analysis of the Aox1a sequence from citrus plants indicates that the ORF has a typical organization identified so far in most of the AOX in plants consisting of four exons and three introns [22,29,37,49]. It also appears to have a high degree of homology with Aox1a of eudicots and other plants such as poplar, Arabidopsis, soya bean and cowpea [12,15]. An alignment of the intron/exon structure of the C. sinensis and other Aox1 reveals a conservation in intron positioning as observed for AOX plant species [9]. The C. sinensis Aox exons and introns present a high degree of identity in length and nucleotide composition with other Aox genes. Otherwise, the introns are fixed in specific protosplice sites, which have the consensus sequence (A/C) AG|GT found in several species [50]. The intron/exon structure of Aox multigene families has been well characterized in Arabidopsis, rice and soya bean showing a large degree of conservation in intron positioning. With the exception of Arabidopsis Aox2 (which presents an additional intron intervening the first exon of other Aox genes), rice Aox1b and Arabidopsis Aox1d (which lacks an intron at the second conserved position), all other Aox genes present three introns at conserved positions [9,37]. The analysis of the deduced amino acid sequence revealed structural features usually found in most of the higher plant AOXs. Furthermore, the phylogenetic analysis showed that Aox1a from citrus plants actually belongs to the Aox1 type, clustering with soya bean, cowpea and poplar Aox1a. The participation of the AOX1a in biotic stress has been controversial since AOX induction during plant–pathogen

..........................................................................................................................................................................................................................................................................................................................................................................

68

C The


C 2010

Biochemical Society


Figure 6 Expression patterns of Aox1a from C. sinensis leaves in response to phytopathogenic bacteria (A) and SA and elicitor treatments (B) The results were normalized by means of 18S rRNA amplification products and quantified by competitive RT–PCR. The numbers of Aox1a molecules per μg of total RNA are indicated. Values shown are means + − S.E.M.

interaction led to an increase in total respiration as well as an induction of Aox transcript and protein levels [24,53]. Our results together with these previous reports open the question of whether AOX1a function in plant resistance is a consequence of the increase in ROS produced during the HR. Consequently, the slight induction of Aox1a in the compatible response could be most likely associated with delayed necrosis of the plant tissue. Another plausible scenario might be that the AOX1a is involved in the resistance response. Our results point to the first hypothesis since a very low induction of this gene was observed in citrus canker compatible interaction and in orange leaves after SA treatment. The lack of Aox1a induction in SAtreated leaves may be explained by the fact that in its promoter the SA-binding motif does not exist suggesting that this gene is unlikely to be regulated by this signal molecule. Similarly, cotton, Nicotiana glutinosa and Arabidopsis Aox1a have a similar behaviour to SA [22,54]. In the present study, we showed that during the bacterial nonhost interactions as well as with fungal elicitors a strong induction of Aox1a was observed in citrus leaves. Since it has been previously shown that AOX expression is induced in the oxidative stress [24,51], we suggest that this gene is involved in the plant response to this altered status. Taking together all the results concerning the Aox1a participation in plant–pathogen interaction, we propose that the orange Aox1a could participate in the HR originated by the bacteria and could also act in the response to fungi and arthropods. However, further investigation should be performed in order to have a clearer picture of the functional roles and action mechanism of AOX in biotic stress.

ACKNOWLEDGEMENTS

interactions and plant defence could be involved in the restraint of lesions and in the regulation of plant defence reactions, both associated with the rapid cell death that occurs during an HR [24,30,51,52]. Lacomme and Roby [25] have shown by differential screening analysis in A. thaliana that several genes, including AOX, are early induced during HR. Vidal et al. [23] studied the transcript and protein levels of AOX during treatment with elicitors that induce cell death in wild-type and in a mitochondrial mutant in complex I of tobacco leaves. They showed that the respiratory burst was essential for cell death and observed a 5-fold induction of AOX activity. This rapid enhancement of AOX activity appeared to be mainly controlled by post-translational mechanisms [23]. Remarkably, the citrus Aox1a promoter sequence characterized in the present study possesses the regulatory motifs related to pathogen response WRKY and PR-box, suggesting that this enzyme might be implicated in the response to pathogen attack. Accordingly, we observed a slight induction of Aox1a in the compatible interaction that produces citrus canker, whereas a major raise in its transcription level was observed in the incompatible interaction with HR between citrus leaves and Xcv and Pst as well as with the treatment with fungal elicitors. Similar results were obtained by Simons et al. [24] with Arabidopsis plants inoculated with Pst that showed that this plant–pathogen

We thank Dr Blanca I. Canteros for kindly providing the Xac Xcc991330 strain and Catalina Anderson, Gastón Alanis and Rubén D´ıaz Vélez (Proyecto El Alambrado) for the citrus plants used in the present study. We also thank Professor Dr Eduardo Ceccarelli (Molecular Biology Division, IBR, CONICET, Rosario, Argentina) for phylogenetic tree considerations. S. K. C., E. G. O. and J. O. are staff members and L. D. D. and J. M. B. are Fellows of the CONICET.

FUNDING

This work was supported by the Agencia Nacional de Promoción Cient´ıfica y Tecnológica [grant numbers PICT01-12783 (to E. G. O.), PICT2006-0678 (to J. O.)].

REFERENCES 1

2

Affourtit, C., Albury, M. S., Crichton, P. G. and Moore, A. L. (2002) Exploring the molecular nature of alternative oxidase regulation and catalysis. FEBS Lett. 510, 121–126 Affourtit, C., Krab, K. and Moore, A. L. (2001) Control of plant mitochondrial respiration. Biochim. Biophys. Acta 1504, 58–69

..........................................................................................................................................................................................................................................................................................................................................................................


69


3 Finnegan, P. M., Soole, K. L. and Umbach, A. L. (2004) Alternative mitochondrial electron transport proteins in higher plants. In Plant Mitochondria: From Gene to Function (Day, D. A., Millar, A. H. and Whelan, J., eds), pp. 163–230, Kluwer, Dordrecht, The Netherlands 4 McDonald, A. E., Amirsadeghi, S. and Vanlerberghe, G. C. (2003) Prokaryotic orthologues of mitochondrial alternative oxidase and plastid terminal oxidase. Plant Mol. Biol. 53, 865–876 5 Umbach, A. L., Ng, V. S. and Siedow, J. N. (2006) Regulation of plant alternative oxidase activity: a tale of two cysteines. Biochim. Biophys. Acta 1757, 135–142 6 Stenmark, P. and Nordlund, P. (2003) A prokaryotic alternative oxidase present in the bacterium Novosphingobium aromaticivorans. FEBS Lett. 552, 189–192 7 McDonald, A. and Vanlerberghe, G. (2004) Branched mitochondrial electron transport in the Animalia: presence of alternative oxidase in several animal phyla. IUBMB Life 56, 333–341 8 Vanlerberghe, G. C. and McIntosh, L. (1997) Alternative oxidase: from gene to function. Annu. Rev. Plant Physiol. Plant Mol. Biol. 48, 703–734 9 Considine, M. J., Holtzapffel, R. C., Day, D. A., Whelan, J. and Millar, A. H. (2002) Molecular distinction between alternative oxidase from monocots and dicots. Plant Physiol. 129, 949–953 10 Polidoros, A. N., Mylona, P. V., Pasentsis, K., Scandalios, J. G. and Tsaftaris, A. S. (2005) The maize alternative oxidase 1a (Aox1a) gene is regulated by signals related to oxidative stress. Redox Rep. 10, 71–78 11 Clifton, R., Millar, A. H. and Whelan, J. (2006) Alternative oxidases in Arabidopsis: a comparative analysis of differential expression in the gene family provides new insights into function of non-phosphorylating bypasses. Biochim. Biophys. Acta 1757, 730–741 12 Arnholdt-Schmitt, B., Costa, J. H. and de Melo, D. F. (2006) AOX–1a functional marker for efficient cell reprogramming under stress? Trends Plant Sci. 11, 281–287 13 Wagner, A. M., Krab, K., Wagner, M. J. and Moore, A. L. (2008) Regulation of thermogenesis in flowering Araceae: the role of the alternative oxidase. Biochim. Biophys. Acta 1777, 993–1000 14 Day, D. A. and Wiskich, J. T. (1995) Regulation of alternative oxidase activity in higher plants. J. Bioenerg. Biomembr. 27, 379–385 15 Borecky, J. and Vercesi, A. E. (2005) Plant uncoupling mitochondrial protein and alternative oxidase: energy metabolism and stress. Biosci. Rep. 25, 271–286 16 Purvis, A. C. (1997) Role of the alternative oxidase in limiting superoxide production by plant mitochondria. Physiol. Plant 100, 165–170 17 Robson, C. A. and Vanlerberghe, G. C. (2002) Transgenic plant cells lacking mitochondrial alternative oxidase have increased susceptibility to mitochondria-dependent and -independent pathways of programmed cell death. Plant Physiol. 129, 1908–1920 18 Umbach, A. L., Fiorani, F. and Siedow, J. N. (2005) Characterization of transformed Arabidopsis with altered alternative oxidase levels and analysis of effects on reactive oxygen species in tissue. Plant Physiol. 139, 1806–1820 19 Millenaar, F. F. and Lambers, H. (2003) The alternative oxidase: in vivo regulation and function. Plant Biol. 5, 2–15 20 Clifton, R., Lister, R., Parker, K. L., Sappl, P. G., Elhafez, D., Millar, A. H., Day, D. A. and Whelan, J. (2005) Stress-induced co-expression of alternative respiratory chain components in Arabidopsis thaliana. Plant Mol. Biol. 58, 193–212 21 Thirkettle-Watts, D., McCabe, T. C., Clifton, R., Moore, C., Finnegan, P. M., Day, D. A. and Whelan, J. (2003) Analysis of the alternative oxidase promoters from soybean. Plant Physiol. 133, 1158–1169 22 Wang, J., Wang, X., Liu, C., Zhang, J., Zhu, C. and Guo, X. (2008) The NgAOX1a gene cloned from Nicotiana glutinosa is implicated in the response to abiotic and biotic stresses. Biosci. Rep. 28, 259–266

23 Vidal, G., Ribas-Carbo, M., Garmier, M., Dubertret, G., Rasmusson, A. G., Mathieu, C., Foyer, C. H. and De, P. R. (2007) Lack of respiratory chain complex I impairs alternative oxidase engagement and modulates redox signaling during elicitor-induced cell death in tobacco. Plant Cell 19, 640–655 24 Simons, B. H., Millenaar, F. F., Mulder, L., Van Loon, L. C. and Lambers, H. (1999) Enhanced expression and activation of the alternative oxidase during infection of Arabidopsis with Pseudomonas syringae pv. tomato. Plant Physiol. 120, 529–538 25 Lacomme, C. and Roby, D. (1999) Identification of new early markers of the hypersensitive response in Arabidopsis thaliana. FEBS Lett. 459, 149–153 26 Delaney, T. P., Uknes, S., Vernooij, B., Friedrich, L., Weymann, K., Negrotto, D., Gaffney, T., Gut-Rella, M., Kessmann, H., Ward, E. and Ryals, J. (1994) A central role of salicylic acid in plant disease resistance. Science 266, 1247–1250 27 Raskin, I., Ehmann, A., Melander, W. R. and Meeuse, B. J. (1987) Salicylic acid: a natural inducer of heat production in Arum lilies. Science 237, 1601–1602 28 Elthon, T. E., Nickels, R. L. and McIntosh, L. (1989) Monoclonal antibodies to the alternative oxidase of higher plant mitochondria. Plant Physiol. 89, 1311–1317 29 Rhoads, D. M. and McIntosh, L. (1993) The salicylic acid-inducible alternative oxidase gene aox1 and genes encoding pathogenesisrelated proteins share regions of sequence similarity in their promoters. Plant Mol. Biol. 21, 615–624 30 Lennon, A. M., Neuenschwander, U. H., Ribas-Carbo, M., Giles, L., Ryals, J. A. and Siedow, J. N. (1997) The effects of salicylic acid and tobacco mosaic virus infection on the alternative oxidase of tobacco. Plant Physiol. 115, 783–791 31 Chivasa, S., Murphy, A. M., Naylor, M. and Carr, J. P. (1997) Salicylic acid interferes with tobacco mosaic virus replication via a novel salicylhydroxamic acid-sensitive mechanism. Plant Cell 9, 547–557 32 Wong, C. E., Carson, R. A. and Carr, J. P. (2002) Chemically induced virus resistance in Arabidopsis thaliana is independent of pathogenesis-related protein expression and the NPR1 gene. Mol. Plant Microbe Interact. 15, 75–81 33 Sugimoto, K., Takeda, S. and Hirochika, H. (2000) MYB-related transcription factor NtMYB2 induced by wounding and elicitors is a regulator of the tobacco retrotransposon Tto1 and defense-related genes. Plant Cell 12, 2511–2528 34 Daurelio, L. D., Tondo, M. L., Dunger, G., Gottig, N., Ottado, J. and Orellano, E. G. (2008) Hypersensitive response. In Plant Bioassays. Section II. Plant–Microorganisms Interactions (Narval, S.S., Catalán, C. A. N., Sampietro, D. A., Vattuone, M. A. and Polyticka, B., eds), chapter 10, Studium Press, Houston 35 Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Plainview, NY 36 Dellaporta, S. L., Wood, J. and Hicks, J. B. (1983) A plant DNA minipreparation: version II. Plant Mol. Biol. Rep. 1, 19–21 37 Saisho, D., Nambara, E., Naito, S., Tsutsumi, N., Hirai, A. and Nakazono, M. (1997) Characterization of the gene family for alternative oxidase from Arabidopsis thaliana. Plant Mol. Biol. 35, 585–596 38 Ausubel, F., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. and Struhl, K. (1990) Current Protocols in Molecular Biology. Greene Publishing, New York 39 Betz, C., McCollum, T. G. and Mayer, R. T. (2001) Differential expression of two cinnamate 4-hydroxylase genes in ‘Valencia’ orange (Citrus sinensis Osbeck). Plant Mol. Biol. 46, 741–748 40 Kumar, S., Tamura, K. and Nei, M. (2004) MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief Bioinform. 5, 150–163 41 Saitou, N. and Nei, M. (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425

..........................................................................................................................................................................................................................................................................................................................................................................

70

C The


C 2010

Biochemical Society


42 Thijs, G., Marchal, K., Lescot, M., Rombauts, S., De, M. B., Rouze, P. and Moreau, Y. (2002) A Gibbs sampling method to detect overrepresented motifs in the upstream regions of coexpressed genes. J. Comput. Biol. 9, 447–464 43 Thijs, G., Lescot, M., Marchal, K., Rombauts, S., De, M. B., Rouze, P. and Moreau, Y. (2001) A higher-order background model improves the detection of promoter regulatory elements by Gibbs sampling. Bioinformatics 17, 1113–1122 44 Tanudji, M., Sjoling, S., Glaser, E. and Whelan, J. (1999) Signals required for the import and processing of the alternative oxidase into mitochondria. J. Biol. Chem. 274, 1286–1293 45 Eulgem, T. and Somssich, I. E. (2007) Networks of WRKY transcription factors in defense signaling. Curr. Opin. Plant Biol. 10, 366–371 46 Ho, L. H., Giraud, E., Uggalla, V., Lister, R., Clifton, R., Glen, A., Thirkettle-Watts, D., Van, A. O. and Whelan, J. (2008) Identification of regulatory pathways controlling gene expression of stress responsive mitochondrial proteins in Arabidopsis. Plant Physiol. 147, 1858–1873 47 Dojcinovic, D., Krosting, J., Harris, A. J., Wagner, D. J. and Rhoads, D. M. (2005) Identification of a region of the Arabidopsis AtAOX1a promoter necessary for mitochondrial retrograde regulation of expression. Plant Mol. Biol. 58, 159–175

48 Rhoads, D. M. and Subbaiah, C. C. (2007) Mitochondrial retrograde regulation in plants. Mitochondrion 7, 177–194 49 Finnegan, P. M., Whelan, J., Millar, A. H., Zhang, Q., Smith, M. K., Wiskich, J. T. and Day, D. A. (1997) Differential expression of the multigene family encoding the soybean mitochondrial alternative oxidase. Plant Physiol. 114, 455–466 50 Sverdlov, A. V., Rogozin, I. B., Babenko, V. N. and Koonin, E. V. (2004) Reconstruction of ancestral protosplice sites. Curr. Biol. 14, 1505–1508 51 Overmyer, K., Brosché, M. and Kangasjärvi, J. (2003) Reactive oxygen species and hormonal control of cell death. Trends Plant Sci. 8, 335–342 52 Chivasa, S. and Carr, J. P. (1998) Cyanide restores N gene-mediated resistance to tobacco mosaic virus in transgenic tobacco expressing salicylic acid hydroxylase. Plant Cell 10, 1489–1498 53 Lam, E., Kato, N. and Lawton, M. (2001) Programmed cell death, mitochondria and the plant hypersensitive response. Nature 411, 848–853 54 Li, F., Zhang, Y., Wang, M., Zhang, Y., Wu, X. and Guo, X. (2008) Molecular cloning and expression characteristics of alternative oxidase gene of cotton (Gossypium hirsutum). Mol. Biol. Rep. 35, 97–105

Received 23 December 2008/25 February 2009; accepted 3 March 2009 Published as Immediate Publication 3 March 2009, doi 10.1042/BSR20080180

..........................................................................................................................................................................................................................................................................................................................................................................


71

Biosci. Rep. (2010) / 30 / 59–71 (Printed in Great Britain) / doi 10.1042/BSR20080180

SUPPLEMENTARY ONLINE DATA

Characterization of Citrus sinensis type 1 mitochondrial alternative oxidase and expression analysis in biotic stress Lucas Damián DAURELIO*, Susana Karina CHECA†, Jorgelina Morán BARRIO†, Jorgelina OTTADO* and Elena Graciela ORELLANO*1 *Molecular Biology Division, IBR (Instituto de Biolog´ıa Molecular y Celular de Rosario), CONICET (Consejo Nacional de Investigaciones Cient´ıficas y Técnicas), Facultad de Ciencias Bioqu´ımicas y Farmacéuticas, Universidad Nacional de Rosario, Suipacha 531, (S2002LRK) Rosario, Argentina, and †Microbiology Division, IBR, CONICET, Facultad de Ciencias Bioqu´ımicas y Farmacéuticas, Universidad Nacional de Rosario, Suipacha 531, (S2002LRK) Rosario, Argentina

Figure S1

AoxOra1 and AoxOra2 homologies in citrus EST databases The alignment of AoxOra1 (A) and AoxOra2 (B) with the homologous ESTs found is shown. Regions with similarities are indicated along with the number of base-pairs. The E-values are indicated on the right. The AoxOra2 alignment corresponding to the consensus region for a putative Aox type 2 is indicated and the respective protein sequence is shown below.

Received 23 December 2008/25 February 2009; accepted 3 March 2009 Published as Immediate Publication 3 March 2009, doi 10.1042/BSR20080180

1 To whom correspondence should be addressed (email [email protected]). The nucleotide sequence data reported will appear in GenBank® , EMBL, DDBJ and GSDB Nucleotide Sequence Databases under the accession numbers EU723696, EU723697 and EU723698.
