Chondrogenesis of human periosteum-derived ... - Springer Link

Biotechnol Lett (2007) 29:323–329 DOI 10.1007/s10529-006-9240-2

ORIGINAL RESEARCH PAPER

Chondrogenesis of human periosteum-derived progenitor cells in atelocollagen Yong-Soo Choi Æ Sang-Min Lim Æ Hyun-Chong Shin Æ Chang-Woo Lee Æ Sang-Lin Kim Æ Dong-Il Kim

Received: 3 July 2006 / Revised: 17 October 2006 / Accepted: 17 October 2006 / Published online: 22 November 2006 Springer Science+Business Media B.V. 2006

Abstract Periosteum-derived progenitor cells (PDPCs) could be differentiated into cartilage using atelocollagen as a carrier and in the presence of transforming growth factor-b3 (TGF-b3). Chondrogenesis was verified by RT-PCR and Western blotting. Expression of the type II collagen mRNA was found from the differentiated PDPCs in atelocollagen 3 weeks after chondrogenic induction. The chondrogenic potential of the PDPCs was also verified by histochemical staining for type II collagen protein. Increased production of glycosaminoglycan shows that the PDPCs in atelocollagen could differentiate into chondrocytes under a chondrogenic environment. PDPCs can therefore be used as a cell source for cell-based therapies targeted toward the articular cartilage of the knee. Keywords Atelocollagen Cartilage Chondrogenesis Periosteum-derived Progenitor Cells Y.-S. Choi S.-M. Lim H.-C. Shin D.-I. Kim (&) Department of Biological Engineering, Inha University, Incheon 402-751, Korea e-mail: [email protected] C.-W. Lee Good Shepherd Hospital, Yeoksam-dong, Seoul 135-717, Korea S.-L. Kim Boryung Pharmaceutical Co. Ltd., Ansan 425-120, Korea

Introduction In native articular cartilage, the extracellular matrix (ECM) is comprised primarily of a network-like structure consisting of proteoglycans and type II collagen. Chondrocytes in the ECM are round and exist within small pockets throughout the tissue. Although the articular cartilage matrix has some mechanical strength, both the surface and the subchondral bone can be damaged by the imposition of substantial mechanical loads. Unfortunately, few attempts to treat injuries to this joint have been made (Schaefer et al. 2002). To resolve defects in the articular cartilage, researchers have isolated mesenchymal progenitor cells from bone marrow and have also employed synovial membranes, periosteal tissues and umbilical cord blood as cell sources for use in cell-based therapies (de Bari et al. 2001a; Fickert et al. 2003; Majumdar et al. 2000). The periosteum harbors a large quantity of progenitor cells that directly differentiate into chondrocytes (de Bari et al. 2001b; Ito et al. 2001). Recently, we investigated a variety of characteristic immunophenotypes reproducibly expressed on periosteum-derived progenitor cells (PDPCs) in an attempt to isolate chondrogenic cells efficiently (Lim et al. 2005). We also attempted to characterize the effects of passage number on this chondrogenic potential. The characterized PDPCs retained their

123

324

chondrogenic potential in pellet cultures up to the 15th passage from the primary cell cultures (Lim et al. 2005). Several researchers used atelocollagen as a scaffold to create a cartilage-like tissue. However, they used the chondrocytes of the actual patient derived from the knee of the patient as a cell source. This approach is limited with regard to the proliferation rate and the number of acquired chondrocyte cells. In this study, the possibility of PDPCs to differentiate into cartilage was assessed in atelocollagen, which is used as a carrier for PDPCs in transplantation, proliferation, and matrix synthesis for in vitro chondrogenesis. Our results showed that PDPCs can be employed as a cell source for cell-based therapies targeted toward the articular cartilage of the knee. Because a single piece of periosteum could provide a huge quantity of PDPCs, the possibility of allograft transplantation is thus augmented in the articular cartilage, which evidences minimal immune rejection characteristics.

Materials and methods Isolation, characterization, and cultivation of PDPCs

Biotechnol Lett (2007) 29:323–329

1 mM EDTA. At the end of the P3 passage, the detached cells were removed with PBS and incubated for 20 min at 4C with the following antibodies: anti-mouse-IgG, CD9, CD34, CD45, CD90, CD166, CD105, SH2, SH3, and SH4 monoclonal antibodies. All reaction mixtures were then analyzed via FACSCalibur flow cytometry (Becton-Dickinson, USA), and sorted using FACSVantage (Becton Dickinson, USA). Embedding of PDPCs into atelocollagen and in vitro chondrogenesis The atelocollagen–medium mixture was consisted of eight volumes of atelocollagen solution (2% type I collagen, Matrix-ASP) (Bioland Ltd., Korea), one volume of 10 · concentrated Ham’s F-12, one volume of 50 mM NaOH, 2.2% (w/v) NaHCO3, and 200 mM HEPES. The PDPCs were mixed thoroughly into the atelocollagenmedium mixture. The final cell density was 2 · 106–2 · 107 cells/ml. To induce chondrogenic differentiation, the PDPCs were cultured in basal media with supplements (hMSC Chondrogenic BulletKit, Cambrex Bio Science, USA) and TGFb3 (R&D System, USA). The cells were then cultured at 37C in 5% CO2 and 95% air. The medium was changed at 3-day intervals. RT-PCR

Periosteum acquired from surgical knee replacement procedures was harvested from the proximal tibial tissue provided by 27 human donors of various ages (40–72 ages). The periosteal samples were rinsed twice with phosphate-buffered saline (PBS) containing antibiotic-antimycotic solution (Sigma, USA) and cut into small slices. The PDPCs were isolated by characteristic surface markers as described by Lim et al. (2005). The minced periosteum explants were placed in a 100 mm culture dish with the cambium side (bone surface) of the periosteum positioned against the dish. The explants were then cultured for one week in low-glucose Dulbecco’s modified Eagle’s medium (DMEM) containing 10% (v/v) fetal bovine serum (FBS) and antibiotic-antimycotic solution at 37C in 95% humidified air and 5% CO2. Cells migrating from the explants were harvested by the treatment with 0.25% trypsin/

123

Total RNA was extracted with TRIzol reagent (Invitrogen, USA). The complementary DNA was synthesized from 1 lg of total RNA per sample with RNA PCR kit (Takara Bio Inc., Japan). The reaction was performed in a final volume of 20 ll, with 5 mM MgCl2, 1 mM each deoxynucleotide, 1.6 g oligo-(dT), 50 U RNase inhibitor/ml, and 20 U AMV reverse transcriptase/ml in 50 mM KCl and 10 mM Tris/HCl at a pH of 8.3. The mixture was incubated for 10 min at 25C, 42C for 60 min, heated to 99C for 5 min, and then flash-cooled to 4C. Initial denaturation was conducted for 5 min at 95C. PCR amplification was conducted at 95C for 30 s, at 58C for 30 s, and 72C for 30 s, for a total of 25 cycles, after which a final extension was conducted at 72C for 5 min using the GeneAmp PCR system (Applied Biosystems, USA). The specific primers used for type II collagen (Col II)


were as follows: forward primer (CTGGCTCCCAACACTGCCAACGTC), and reverse primer (TCCTTTGGGTTTGCAACGGATTGT); the primers used for GAPDH were: forward primer (GCTCTCCAGAACATCATCCCTGCC) and reverse primer (CGTTGTCATACCAGGAAATGAGCTT). The PCR products were then visualized on 1.8% agarose gel, stained with ethidium bromide, and compared against a 1 kb DNA ladder (Promega, USA), which was used as a molecular weight marker. Histology and immunochemistry The PDPCs cultured in the atelocollagen were fixed with 2% paraformaldehyde on the 21st day of culture and embedded using OCT freezing compound. The chondrogenesis tissue samples were stained with Alcian blue, Safranin-O, and immunohistochemical reagent (LSAB 2 SystemHRP, DakoCytomation, Denmark).

Western blot analysis Whole cell lysates were prepared by the extraction of proteins in lysis buffer. The proteins were separated by SDS-PAGE and transferred onto PVDF membranes (Invitrogen, USA). The membranes were blocked with 5% (v/v) skim milk in Tris buffered saline containing 0.1% Tween 20 and then sequentially incubated with antibodies against type II collagen (Chemichon International, USA) and peroxidase-conjugated secondary antibodies (KPL Inc., USA). The proteins were finally visualized using TMB membrane peroxidase substrate (KPL Inc., USA).

Glycosaminoglycan (GAG) analysis GAG was analyzed using a Blyscan GAG assay kit (Biocolor, Northern Ireland). This method used the specific binding of the cationic dye, 1,9-dimethylmethylene blue, to the sulfated GAG chains of proteoglycans. The samples (500 ll) were mixed with 500 ll Blyscan dye reagent for 30 min at room temperature. The GAG–dye complex was recovered by centrifugation. The pellets were

325

washed and resuspended in 1 ml dissociation buffer and absorbance was measured at 656 nm.

Results Figure 1a shows photographs of the PDPCsatelocollagen mixture after 3 weeks of chondrogenesis. In the 100, 200 and 300 ll mixtures, different sizes of similar shaped cartilage-like constructs were observed after 3 weeks in chondrogenic induction medium containing TGF-b (Fig. 1b). To monitor the chondrogenesis of the PDPCs, the atelocollagen was digested with 0.2% collagenase and the differentiated cells were harvested. As shown in Fig. 2, a change occurred in the expression of the type II collagen mRNA of the differentiated PDPCs after 3 weeks. The expression levels of type II collagen mRNA were clearly increased after chondrogenic induction. The chondrogenic potential of the PDPCs in the atelocollagen was also verified by histochemical staining including Alcian blue (Fig. 3a, d), Safranin-O (Fig. 3b, e), and immunohistostaining for type II collagen protein (Fig. 3c, f). During the confirmation of the chondrogenesis of the PDPCs in the 3-dimensional cultures using atelocollagen, we found the expression of type II collagen in monolayer cultures regardless of the number of cell passages or the age of the donors (Fig. 4). Figure 5 shows the total GAG representing the chondrocyte-specific ECM secreted by the differentiated PDPCs in the chondrogenic medium during chondrogenesis. The quantity of GAG was increased 3.6-fold compared to the normal condition. This result shows that the PDPCs embedded within the atelocollagen could differentiate into chondrocytes in a chondrogenic environment.

Discussion The periosteum harbors a large quantity of progenitor cells which differentiate directly into chondrocytes. Furthermore, the number of obtainable cells within an individual patient’s

123

326


Fig. 1 Photographs of tissue-engineered cartilage-like constructs. (a) The periosteumderived progenitor cells (PDPCs) embedded in 2% (w/v) atelocollagen; (b) Different sizes of constructs after 3 weeks in chondrogenic induction medium containing TGFb3. Initial volumes of artellocollagen were 100, 200 and 300 ll, respectively

Fig. 2 RT-PCR for PDPCs chondrogenesis. The atelocollagen gel was digested with 0.2% collagenase, after which the differentiated cells were harvested. After 3 weeks of chondrogenic induction, Coll. II mRNA was newly expressed. Lane 1, 1 kb DNA ladder; lane 2, chondrocyte (P0); lane 3, PDPCs (P0) in monolayer culture; lane 4, chondrogenesis of PDPCs (P5) for 3 weeks

articular cartilage tends to be rather limited. Therefore, a number of attempts have been made in recent years to find a new source of cells useful in cartilage repair to apply such a source to cellbased therapies. Given the obvious need for such cells, periosteum was selected as an alternative cell source as we could obtain a greater quantity of cells from the periosteum than from the articular cartilage of patients. The first successful cell-based therapy was reported in 1994, in an autologous chondrocyte transplantation for the treatment of a cartilage defect, in which a patient’s chondrocytes cultured and expanded ex vivo were transplanted in the

123

patient’s knee (Brittberg et al. 1994). However, this procedure remained somewhat risky because the chondrocytes in suspension could leak from the graft site after load-bearing activity was resumed. Another risk of this approach may be the insufficient number of cells harvested from the patient. Ochi et al. (2002) demonstrated that tissue-engineered cartilage could be successfully applied to the repair of defective cartilage. Atelocollagen gel was used to construct a three-dimensional scaffold and periosteal flat tissue obtained from the femoral condyle of the patient was also used. They reported that the repair sites assumed hyaline-like smooth surfaces. However, the cellular origins of this repaired tissue remained unclear, specifically with regard to whether the relevant cells had originated from the patient’s chondrocytes or from the periosteal tissue. In studies of the transplantation of mesenchymal progenitor cells into cartilage defects, a variety of scaffolds have been routinely utilized as successful carriers for cell delivery. One of the common scaffold materials is collagen which has immunogenicity and safety problems. The terminal 10–20 amino acid residues of collagen do not form a helical structure and the telopeptide regions of this residue are the primary cause of its immunogenicity (Lynn et al. 2004; Pontz et al. 1970). To circumvent this limitation, we


327

Fig. 3 Histological analysis of PDPCs after chondrogenesis in atelocollagen. (a), (d) Alcian blue; (b), (e) SafraninO; and (c), (f) immunostaining for anti-type II collagen.

PDPCs-atelocollagen gel were cultured for 3 weeks in (a– c) DMEM containing 10% FBS for negative control and (d–f) chondrogenic induction medium

employed atelocollagen without the telopeptides in our chondrogenic culture system. Atelocollagen has been utilized as a skin substitute (Yang et al. 2000) and as a carrier of bone morphogenic protein (Murata et al. 2000). Furthermore, many positive effects of atelocollagen in the healing of injured cartilage have been reported (Isawa et al. 2003; Ochi et al. 2001; Uchio et al. 2000). For these reasons, we decided to use an atelocollagenbased gel type scaffold for the utilization of

PDPCs. We could show that type I collagen– based atelocollagen gel was more similar to in vitro articular cartilage components. P0 and P1 periosteum-derived cells (PDCs) were previously obtained from young donors and the cells expressed type II collagen in monolayer cultures (de Bari et al. 2001b). They reported that this property was rapidly lost upon cell passaging and was not observed in PDCs from donors older than 30. On the contrary, we determined that

Fig. 4 Western blot analysis. (a) Type II collagen protein expression in PDPCs after chondrogenesis in atelocollagen for 2 weeks; (b) from monolayer cultures at serial passages (P3–15). M, marker; lane 1, chondrocytes (P0); lane 2, PDPCs cultured in monolayer; lane 3 and 4, PDPCs cultured in atelocollagen in chondrogenic induction

medium for 1 and 2 weeks; lane 5, human dermal fibroblasts cultured in atelocollagen. The levels of type II collagen protein were increased in the atelocollagen, and were still expressed in monolayer cultures by P15, without chondrogenic induction

123

328

Biotechnol Lett (2007) 29:323–329 20

Total GAG (µg/ml)

(a) (b)

15

10

5

0 0

2

4

6

8

10

12

Time (day)

Fig. 5 Time-course profiles of the synthesis of total GAGs by PDPCs in atelocollagen. (a) 10% FBS containing medium; (b) chondrogenic induction medium

PDPCs expressed type II collagen in monolayer cultures regardless of the number of cell passages or donor age (Fig. 4b). Because PDPCs have previously been characterized and isolated from PDCs using specific mesenchymal stem cell markers, the majority of these cells exhibit identical potential to that exhibited by PDCs obtained from young donors. In other words, we have successfully located a new source of PDPCs, from which type II collagen protein can be produced. Failure of detecting type II collagen mRNA by RT-PCR in our previous study could be explained by the fact that PDPCs harbor substantially less mRNA than do freshly isolated chondrocytes (data not shown). Perhaps the most remarkable advantages of using PDPCs are a sufficient supply of chondrogenic cells and the expression of type II collagen in their undifferentiated state in monolayer cultures. Moreover, periosteum is simpler to obtain from a patient than are chondrocytes or bone marrow. Consequently, using PDPCs coupled with several different types of scaffolds and patient-specific tissues in engineered cartilage-like constructs, we now have the ability to treat defective or damaged cartilage sites. However, due to the fact that such constructs have been generally tested for only short period in vitro, the ECM formed within and around these tissue-engineered cartilage-like constructs tends to be much less abundant than would be seen with native cartilage (data not shown). Therefore, in order to achieve functions comparable to native

123

articular cartilage, the constructs will need to be proven under longer-term conditions in future trials. Although further studies are underway to characterize this procedure under in vivo conditions, our results show that the PDPCs characterized in this study possess greater chondrogenic capability than the pool of PDCs. Moreover, atelocollagen should prove useful as a carrier of PDPCs in transplantation, proliferation, matrix synthesis, and differentiation. PDPCs could be a useful cell source for cell-based therapies for defective cartilage. Acknowledgements This work was supported by Korea Science and Engineering Foundation (KOSEF R01-2005000-10927-0) and also by Boryung Pharmceutical Co. Ltd., Ansan, Korea

References Brittberg M, Lindahl A, Nilsson A, Ohlsson C, Isaksson O, Peterson L (1994) Treatment of deep cartilage defects in the knee with autologous chondrocyte transplantation. N Engl J Med 331:889–895 de Bari C, Dell’Accio F, Tylzanowski P, Luyten FP (2001a) Multipotent mesenchymal stem cells from adult human synovial membrane. Arthritis Rheum 44:1928–1942 de Bari C, Dell’Accio F, Luyten FP (2001b) Human periosteum-derived cells maintain phenotypic stability and chondrogenic potential throughout expansion regardless of donor age. Arthritis Rheum 44:85–95 Fickert S, Fiedler J, Brenner RE (2003) Identification, quantification and isolation of mesenchymal progenitor cells from osteoarthritic synovium by fluorescence automated cell sorting. Osteoarthr Cartilage 11:790–800 Ito Y, Fitzsimmons JS, Sanyal A, Mello MA, Mukherjee N, O’Driscoll SW (2001) Localization of chondrocyte precursors in periosteum. Osteoarthr Cartilage 9:215–223 Iwasa J, Ochi M, Uchio Y, Katsube K, Adachi N, Kawasaki K (2003) Effects of cell density on proliferation and matrix synthesis of chondrocytes embedded in atelocollagen gel. Artif Organs 27:249–255 Lim SM, Choi YS, Shin HC, Lee CW, Kim DI (2005) Isolation of human periosteum-derived progenitor cells using immunophenotypes for chondrogenesis. Biotechnol Lett 27:607–611 Lynn AK, Yannas IV, Bonfield W (2004) Antigenicity and immunogenicity of collagen. J Biomed Mater Res B Appl Biomater 71:343–354 Majumdar MK, Banks V, Peluso DP, Morris EA (2000) Isolation, characterization, and chondrogenic potential

Biotechnol Lett (2007) 29:323–329 of human bone marrow-derived multipotential stromal cells. J Cell Physiol 185:98–106 Murata M, Maki F, Sato D, Shibata T, Arisue M (2000) Bone augmentation by onlay implant using recombinant human BMP-2 and collagen on adult rat skull without periosteum. Clin Oral Implants Res 11:289–295 Ochi M, Uchio Y, Kawasaki K, Wakitani S, Iwasa J (2002) Transplantation of cartilage-like tissue made by tissue engineering in the treatment of cartilage defects of the knee. J Bone Joint Surg Br 84:571–578 Ochi M, Uchio Y, Tobita M, Kuriwaka M (2001) Current concepts in tissue engineering technique for repair of cartilage defect. Artif Organs 25:172–179 Pontz B, Meigel W, Rauterberg J, Kuhn K (1970) Localization of two species specific antigenic determinants on

329 the peptide chains of calf skin collagen. Eur J Biochem 16:50–54 Schaefer D, Martin I, Jundt G, Seidel J, Heberer M, Grodzinsky AJ, Bergin I, Vunjak-Novakovic G, Freed LE (2002) Tissue engineered composites for the repair of large osteochondral defects. Arthritis Rheum 46:2524–2534 Uchio Y, Ochi M, Matsusaki M, Kurioka H, Katsube K (2000) Human chondrocyte proliferation and matrix synthesis cultured in Atelocollagen gel. J Biomed Mater Res 50:138–143 Yang EK, Seo YK, Youn HH, Lee DH, Park SN, Park JK (2000) Tissue engineered artificial skin composed of dermis and epidermis. Artif Organs 24:7–17

123