Circulating Tumor Cells and Circulating Tumor DNA

ME63CH13-Pantel

ARI

ANNUAL REVIEWS

12 December 2011

12:31

Further

Annu. Rev. Med. 2012.63:199-215. Downloaded from www.annualreviews.org by INSERM-multi-site account on 07/02/14. For personal use only.

Click here for quick links to Annual Reviews content online, including: • Other articles in this volume • Top cited articles • Top downloaded articles • Our comprehensive search

Circulating Tumor Cells and Circulating Tumor DNA Catherine Alix-Panabières,1,2,3 Heidi Schwarzenbach,4 and Klaus Pantel4 1 University Medical Center, Saint-Eloi Hospital, Institute of Research in Biotherapy, Laboratory of Rare Human Circulating Cells, Montpellier, France; 2 University Medical Center, Laboratory of Cell and Hormonal Biology, Arnaud de Villeneuve Hospital, Montpellier, France; 3 University Institute of Clinical Research UM1 – EA2415 – Epidemiology, Biostatistics & Public Health; email: [email protected] 4 Institute of Tumor Biology, University Medical Center, Hamburg-Eppendorf, 20246 Hamburg, Germany; email: [email protected]

Annu. Rev. Med. 2012. 63:199–215

Keywords

First published online as a Review in Advance on November 2, 2011

tumor cell dissemination, cell-free tumor DNA, allelic imbalance, genetic alterations, epigenetic alterations

The Annual Review of Medicine is online at med.annualreviews.org This article’s doi: 10.1146/annurev-med-062310-094219 c 2012 by Annual Reviews. Copyright All rights reserved 0066-4219/12/0218-0199$20.00

Abstract Solid tumors derived from epithelial tissues (carcinomas) are responsible for 90% of all new cancers in Europe, and the main four tumor entities are breast, prostate, lung, and colon cancer. Present tumor staging is mainly based on local tumor extension, metastatic lymph node involvement, and evidence of overt distant metastasis obtained by imaging technologies. However, these staging procedures are not sensitive enough to detect early tumor cell dissemination as a key event in tumor progression. Many teams have therefore focused on the development of sensitive assays that allow the specific detection of single tumor cells or small amounts of cell-free tumor DNA in the peripheral blood of cancer patients. These methods allow the detection and characterization of early metastatic spread and will provide unique insights into the biology of metastatic progression of human tumors, including the effects of therapeutic interventions.

199

ME63CH13-Pantel

ARI

12 December 2011

12:31

INTRODUCTION Circulating tumor cells (CTCs): cells shed by the primary tumor into the bloodstream very early in tumor development


Disseminated tumor cells (DTCs): CTCs that have left the blood circulation and homed into secondary organs MRD: minimal residual disease BM: bone marrow Circulating cell-free tumor DNA: DNA released by apoptotic and necrotic cells of the primary tumor into the blood circulation early in tumor development

200

Early during the formation and growth of a primary tumor (e.g., breast, colon, or prostate cancer), cells are shed from the primary tumor and circulate through the bloodstream. These circulating tumor cells (CTCs) are very heterogeneous and can be enriched and detected via different technologies based on their physical and biological properties. CTC analyses are considered a real-time “liquid biopsy” in cancer patients. The prognosis of carcinoma patients, even with small primary tumors, is mainly determined by the blood-borne dissemination of tumor cells from the primary site to distant organs such as bone marrow, liver, lungs, or brain, and the subsequent outgrowth of these cells in their new microenvironment (1, 2). Disseminated tumor cells (DTCs) are considered micrometastases. They can remain in a dormant state for many years after complete resection of the primary tumor before giving rise to macrometastasis (3, 4). DTCs recirculating through the bloodstream may colonize other distant organs, giving rise to secondary metastases. Interestingly, DTCs can even return to the primary tumor, a process termed tumor self-seeding or cross-seeding, giving rise to aggressive metastatic variants. These DTCs could thereby potentially contribute to the development of local relapses (5, 6), although this provocative hypothesis requires support from studies in cancer patients. Minimal residual disease (MRD), i.e., the presence of DTCs, is undetectable by highresolution imaging technologies. However, DTCs can now be identified in the bone marrow (BM), lymph nodes, or circulating blood, using sensitive and specific assays (1, 4). BM is easily accessible by needle aspiration through the iliac crest, and it plays the most prominent role among the distant organs as indicator organ for MRD thus far. BM appears to be a common homing organ for DTCs derived from carcinomas of different organs (7) and also might be a reservoir for DTCs with the capacity to reenter other distant organs. Alix-Panabières

·

Schwarzenbach

·

Pantel

For the follow-up of cancer patients, sequential analyses are pivotal. Because BM needle aspiration is far more invasive than sampling of peripheral blood, research groups are currently evaluating the clinical utility of tumor cells in the blood rather than BM to assess prognosis and monitor systemic therapy (4). A number of innovative technologies to improve methods for CTC detection with extraordinarily high sensitivity have recently been developed, including CTC microchips, filtration devices, quantitative RT-PCR assays, and automated microscopic systems (1, 4). However, the specificity and clinical utility of these methods still have to be demonstrated in large prospective multicenter studies to reach the high level of evidence required for introduction into clinical practice. Concentrations of circulating cell-free tumor DNA are high in cancer patients compared to healthy individuals. Early in tumor development, apoptotic and necrotic cells of the primary tumor release DNA into the bloodstream (Figure 1). In the peripheral blood, this cell-free DNA circulates predominantly in the form of nucleosomes, indicating that it retains at least some features of the nuclear chromatin. This DNA can be extracted from blood, and its genetic and epigenetic alterations can be determined (8). Epigenetic modifications include DNA methylation and configuration changes in chromatin histone proteins (9). In chromosomal regions of tumorassociated genes, epigenetic modifications may affect important regulatory mechanisms for the pathogenesis of malignant transformation. DNA methylation of the cytosine base in CpG dinucleotides, which are found as isolated or clustered CpG islands, induces gene repression by inhibiting the access of transcription factors to their binding sites. Inactivation of tumor suppressor genes by promoter hypermethylation is thought to play a crucial role in tumorigenesis. However, the aberrations of the cell-free DNA in blood do not always match those of the primary tumor (8). This discrepancy may be ascribed at least partly to CTCs or DTCs,

ME63CH13-Pantel

ARI

12 December 2011

12:31

CTC

+ DNA

a

2

el

ess dv

o Blo

1

Microsatellite PCR using cell-free DNA for detection of LOH

b Fluorescence intensity


Primary tumor or metastasis

1,200

Extraction of cell-free ffrree DNA

Capillary gel electrophoresis

Methylation-sensitive PCR using bisulfiteconverted cell-free DNA for detection of methylated DNA

Wild type DNA

600

c

0 1,200

DNA sequencing

T T A T T T C G G G T C G A T T T A G AG

Cell-free blood DNA

120

LOH

130

600 0

150

Length of the PCR product (bp)

TGAGGGATGATTAAAGGTTTTTT 220

230

Figure 1 Detection of genetically and epigenetically altered DNA in blood. High levels of cell-free tumor DNA circulate in the blood of cancer patients. (a) This tumor DNA found in blood can be released from either the primary tumor or (micro)metastasis, or apoptotic circulating tumor cells (CTCs). This DNA can be extracted from blood, and the genetic and epigenetic alterations can be determined. To detect loss of heterozygosity (LOH) on cell-free DNA, extracted DNA is amplified in a polymerase chain reaction (PCR)-based fluorescence microsatellite analysis using a gene-specific primer set binding to tumor suppressor genes. The fluorescence-labeled PCR products can be separated by capillary gel electrophoresis and detected by a fluorescence laser. In the diagram (b), the abscissa indicates the length of the PCR product; the ordinate gives information on the fluorescence intensity represented as peaks. The upper and lower parts of the diagram show the PCR products derived from wild-type DNA (from leukocytes) and plasma DNA, respectively. As depicted by the two peaks of the amplified wild-type DNA, both alleles are intact, whereas the lower peak of the PCR product derived from the plasma DNA shows LOH (arrow). (c) To detect cell-free methylated DNA, extracted DNA is denatured and treated with sodium bisulfite. In a methylation-sensitive PCR, the modified DNA is amplified with gene-specific primers. Because sodium bisulfite converts unmethylated cytosine residues into uracil, in contrast to methylated cytosine, the methylation pattern can be determined by DNA sequencing. www.annualreviews.org • Circulating Tumor Cells and Tumor DNA

201

ME63CH13-Pantel

ARI

12 December 2011

12:31

which can also release their DNA into the blood circulation (Figure 1). This review focuses on the detection and further characterization of individual CTCs and circulating cell-free DNA as real-time liquid biopsies that can help identify therapeutic targets and potential mechanisms of resistance to therapy. This strategy might contribute to the development of improved individualized targeted treatment of cancer patients.

CIRCULATING TUMOR CELLS Annu. Rev. Med. 2012.63:199-215. Downloaded from www.annualreviews.org by INSERM-multi-site account on 07/02/14. For personal use only.

Technologies Used for CTC Detection The detection of CTCs in peripheral blood of cancer patients holds great promise, and many exciting technologies have been developed over the past few years. However, detecting CTCs remains technically challenging. CTCs occur at very low concentrations of one tumor cell in the background of millions of blood cells. Their identification and characterization require extremely sensitive and specific analytical methods, which are usually a combination of enrichment and detection procedures. Below, we briefly introduce some of the key technologies of CTC detection, although a comprehensive overview of all existing assays and publications would be beyond the scope of this article. CTC enrichment. CTC enrichment includes a large panel of technologies based on the different properties of CTCs that distinguish them from the surrounding normal hematopoietic cells (Figure 2), including physical properties (size, density, electric charges, deformability) and biological properties (surface protein expression, viability, and invasion capacity). Physical properties have the advantage that they allow CTC separation without labeling. Methods based on physical properties include density gradient centrifugation (Ficoll, OncoQuick); filtration through special filters, e.g., the ISET (Isolation by Size of Epithelial Tumor Cells) (10, 11) or a novel three-dimensional 202

Alix-Panabières

·

Schwarzenbach

·

Pantel

microfilter (12); a new versatile label–free biochip using the unique differences in size and deformability of cancer cells (larger and stiffer than blood cells) (13, 14); a microfluidic device combining multi-orifice flow fractionation (MOFF) and the dielectrophoretic (DEP) cell separation technique (15); and a dielectrophoretic field–flow fractionation (DEPFFF) device that allows isolation of viable CTCs by different response to DEP due to difference in size and membrane properties (16). Biological properties are mainly used in immunological procedures with antibodies against either tumor-associated antigens (positive selection) or the common leukocyte antigen CD45 (negative selection). Immunomagnetic systems target an antigen with an antibody that is coupled to a magnetic bead, and the antigenantibody complex is subsequently isolated via exposure to a magnetic field. Positive selection is usually carried out with antibodies against the epithelial cell adhesion molecule (EpCAM), and subsequent immunocytological detection of CTCs is performed with antibodies to cytokeratins, the intermediate filaments of epithelial cells (1). Among the current EpCAM-based R technologies, the FDA-approved CellSearch system has gained considerable attention over the past seven years (4) and is the “gold standard” for all new CTC detection methods (17, 18). At present, there is a focus on the development of microfluidic devices (“chips”), which can handle very small blood volumes. A microfluidic platform called a CTC-chip consists of an array of anti-EpCAM antibody-coated microposts (19–22). The high CTC counts in nonmetastatic cancer patients and the frequent detection of positive events in healthy controls warrant further investigations on the specificity of this assay. Recently, a new CTC-chip called Ephesia, which uses columns of biofunctionalized superparamagnetic beads self-assembled in a microfluidic channel onto an array of magnetic traps (23), and another microfluidic system using high-throughput selection, enumeration, and electrokinetic manipulation of low-abundance CTCs have been introduced

ME63CH13-Pantel

ARI

12 December 2011

12:31

RBC

Blood vessel

Leukocytes CTC

a

b

Physical properties

Size/deformability

Density

Electric charges


++ + – + – + –– + – + – ++

CD45+

– – + – + – + + – + – + – – –

Biological properties Marker proteins EpCAM

EpCAM+

EpCAM+

Positive

Positive

Positive

Glyco A

Micropost

EpCAM+

Positive

Ephesia

EpCAM+

CD45 CD45+

MagSweeper

Negative

Invasive capacity CAM

Fluo-CAM

Figure 2 Enrichment of circulating tumor cells (CTCs) from the peripheral blood of cancer patients is based on physical or biological properties of CTCs. (a) Physical properties include size (membrane filter devices), deformability (microfluidic system in a chip), density (Ficoll centrifugation), and electric charge (dielectrophoresis). (b) Biological properties include expression of cell surface markers and invasive capacity. Cell surface markers include an epithelial cell adhesion molecule (EpCAM) for positive selection and CD45 for negative selection; anti-EpCAM or anti-CD45 antibodies conjugated with magnetic beads, used to enrich CTCs in a magnetic field; and anti-EpCAM antibodies on microposts or columns of nanobeads. Invasive capacity refers to adherence and invasion of fluorescent matrix. Abbreviations: glyco A, glycophorin A (a 131-amino-acid protein present at the extracellular surface of the human red blood cell); CAM, cell adhesion matrix; fluo-CAM, fluorescent cell adhesion matrix; RBC, red blood cells.

(24); validation of these assays is still ongoing. Microdevices can handle cell numbers and sample volumes at least 10 times smaller (