Cloning of the canine gene encoding transcription ... - Springer Link

Mammalian Genome 11, 31–36 (2000).

Incorporating Mouse Genome

© Springer-Verlag New York Inc. 2000

Cloning of the canine gene encoding transcription factor Pit-1 and its exclusion as candidate gene in a canine model of pituitary dwarfism Irma S. Lantinga-van Leeuwen,1 Jan A. Mol,1 Hans S. Kooistra,1 Ad Rijnberk,1 Matthew Breen,2 Corinne Renier,3 Bernard A. van Oost1 1 Department of Clinical Sciences of Companion Animals, Faculty of Veterinary Medicine, University of Utrecht, P.O. Box. 80.154, 3508 TD Utrecht, The Netherlands 2 Centre for Preventive Medicine, Animal Health Trust, Lanwades Park, Newmarket, Suffolk, CB8 7UU, UK 3 UPR 41 CNRS Recombinaisons Ge´ne´tiques, Faculte´ de Me´decine, 2 avenue du Professeur Le´on Bernard, 35043 Rennes Cedex, France

Received: 16 April 1999 / Accepted: 31 August 1999

Abstract. Combined pituitary hormone deficiency (CPHD) is an autosomal recessive inherited disease of German shepherd dogs characterized primarily by dwarfism. In mice and humans a similar genetic disorder has been described that results from an alteration in the gene encoding the transcription factor Pit-1. In this study we characterized the canine Pit-1 gene, determined the chromosomal localization of the Pit-1 gene, and screened dwarf German shepherd dogs for the presence of mutations in this gene. The fulllength canine Pit-1 cDNA contained an open reading frame encoding 291 amino acids, 92 bp of 5⬘-untranslated region, and 1959 bp of 3⬘-untranslated region. The deduced amino acid sequence was highly homologous with Pit-1 of other mammalian species. Using a Pit-1 BAC clone as probe, the Pit-1 gene was mapped by FISH to canine Chromosome (Chr) 31. In dwarf German shepherd dogs a C to A transversion was detected, causing a Phe (TTC) to Leu (TTA) substitution at codon 81. This alteration was present neither in other canine breeds analyzed nor in other mammalian species. However, healthy German shepherd dogs were also homozygous for the mutant allele, indicating that it is not the primary disease-causing mutation. In addition, linkage analysis of polymorphic DNA markers flanking the Pit-1 gene, 41K19 and 52L05, revealed no co-segregation between the Pit-1 locus and the CPHD phenotype. These findings suggest that a gene other than Pit-1 is responsible for the pituitary anomaly in dwarf German shepherd dogs.

Introduction Congenital growth hormone deficiency (GHD) can result from insufficient stimulation by the hypothalamic growth hormonereleasing hormone (GHRH), from maldevelopment of the pituitary somatotrophs, from disorders of growth hormone synthesis, or from defective GH receptor function. In some of these abnormalities an underlying genomic defect has been identified (Wainrajch et al. 1996; Pernasetti et al. 1998). In addition, GH deficiency dwarfism has been ascribed to pressure atrophy of the anterior lobe by cysts of Rathke’s pouch. The associated endocrine deficiencies are highly variable (Mukherjee et al. 1997). In the dog, pituitary dwarfism is known to be an autosomal inherited abnormality, primarily occurring in German shepherd dogs (Andresen and Willeberg 1976). The condition is characterized by profound dwarfism with retention of lanugo or secondary Correspondence to: B.A. van Oost The nucleotide sequence data reported in this paper have been submitted to GenBank and have been assigned the accession number AF035585.

hairs and lack of primary or guard hairs. In most cases already at a young age, an intrapituitary cyst can be identified that gradually enlarges with age (Kooistra et al. 1998). Functionally the plasma concentrations of GH, prolactin (PRL), and thyroid-stimulating hormone (TSH) do not increase in response to supra-pituitary stimulation, whereas the response of luteinizing hormone (LH) is subnormal (Kooistra et al. 1998; Hamann et al. 1999). The combined pituitary hormone deficiency marks the Pit-1 homeodomain gene as a candidate for the genetic disorder. Pit-1 is a pituitary-specific transcription factor required for the expression of the GH, PRL, and TSH genes. In addition to its role in cellspecific expression, Pit-1 plays an essential role in the development of somatotrophic, lactotrophic, and thyrotrophic cells in the anterior pituitary. As a member of the POU family, Pit-1 contains a highly conserved DNA-binding domain consisting of the POUhomeo domain, a low-affinity DNA binding domain, and of the POU-specific domain, responsible for the specificity of DNA binding (Tuggle and Trenkle 1996). Abnormalities in the Pit-1 gene were first observed in Snell and Jackson dwarf mice, and later in human families with combined pituitary hormone deficiency (Parks et al. 1993). Recently, dwarfism caused by mutations in an embryonically expressed homeobox gene, the Prophet of Pit-1 (Propl), was described (Sornson et al. 1996; Wu et al. 1998). In addition, several other homeobox genes have been identified and implicated in pituitary organogenesis (Watkins-Chow and Camper 1998). The emerging knowledge about pituitary development enables a candidate gene approach to identify the genetic defects responsible for growth hormone deficiency syndromes in dogs. This will allow early detection of the condition and consequently improve the results of treatment (Kooistra et al. 1998). In addition, it will eventually allow eradication of the disease by detection and subsequent exclusion of heterozygous carriers from breeding. In this study, we determined the nucleotide sequence of the coding region of the canine Pit-1 gene, parts of the intron sequences, and the chromosomal location of the Pit-1 gene. We analyzed the Pit-1 sequence in healthy dogs and in dwarf German shepherd dogs with deficiencies in GH, PRL, and TSH.

Materials and methods Tissues and isolation of RNA and DNA. Pituitary glands were obtained from Great Danes that were euthanized for non-GH-gene-related reasons. Upon excision, the pituitary glands were quickly frozen in liquid nitrogen and stored at −70°C until analysis. Poly(A)+-enriched RNA was isolated directly from pituitary cells with the Micro-Fast Track Kit (Invitrogen, Leek, The Netherlands).

32

I. S. Lantinga-van Leeuwen et al.: Isolation and characterization of the canine Pit-1 gene

Table 1. Primers used for cloning and mutation analysis of the canine Pit-1 gene. Amplified fragment

Primer

Fragment

Template

Length

Name

Positiona

Sequence (5⬘–3⬘)

F1

cDNA

219 bp

F2

cDNA

647 bp

5⬘-RACE 3⬘-RACE A

cDNA cDNA DNA

335 bpc 2.3 kbc ~3.0 kb

B

DNA

254 bp

C

DNA

403 bp

D

DNA

221 bp

E

DNA

899 bp

F

DNA

1.15 kb

E1aF E2aR E1bF E6R E2aR E6F 5UF E2bR I1F I2R I2F I3R I3F E4R E4F E5R E5F 3UR

81–102 279–299 155–174 779-801 279–299 751–776 15–34 286–307 Intron 1 Intron 2 Intron 2 Intron 3 Intron 3 671–693 585–608 740–759 711–730 1036–1060

TCTTGTGGGAATGAGTTGCCb CACTCCATAGGTTGATGGCTGb TGCCCTGCCTCTGAGAATGCb TCTGTTCTCCAAAGTGTCTCTCCb CACTCCATAGGTTGATGGCTGb CTATAAGTATTGCTGCTAAGGATGC CGTGGACCGGCCCTTTGAAG CCTGCCATAACTCCATAGGTAG TCTTGGTGACAATGGGAAACACAGCA GGCACTCCGTATCAGGGAACACAGG CGACGGTGACCACGACAGCCTTG AAAGGACGAGCGCGCTGACGCAG GCCACAATGAATGCTTCTTGAAT CCACTTGCTCAGCTTCCTCCAGC TTCAGTCAAACGACTATCTGCCGA TACTTATAGTTGTTCTTCGC AAAGTGGGAGCAAATGAAAG GCCAGCCAAATAACTCCTTTCTGGG

a

According to the canine Pit-1 cDNA sequence given in Figure 1. Based on human and/or rat Pit-1 cDNA sequences. c In combination with the adapter primer used in the RACE reaction. b

Blood samples were collected from dwarf German shepherd dogs and their available littermates and parents, as well as from dogs of other breeds. Genomic DNA was isolated from blood lymphocytes according to standard procedures (Miller et al. 1988).

Cloning and sequence analysis of the canine Pit-1 cDNA. Two overlapping fragments of the canine Pit-1 gene transcript (F1, F2) were amplified by RT-PCR, with primers complementary to human and/or rat Pit-1 cDNA sequences. The names and nucleotide sequences of the primers are listed in Table 1. RT-PCR, with 1 ␮g pituitary total RNA as template, was performed as previously described (Mol et al. 1995). The 5⬘ and 3⬘ ends of canine Pit-1 cDNA were amplified by RACE (rapid amplification of cDNA ends) PCR, according to the manufacturer’s protocol (Marathon cDNA Amplification Kit, Clontech Laboratories, Palo Alto, Calif.). One microgram pituitary poly(A)+ RNA was used as template for cDNA synthesis. The 5⬘-RACE was done with reverse primer E2R, Taq DNA polymerase (Promega Corp., Madison, Wis.), and an antibodymediated hot start (TaqStart Antibody, Clontech). The cycle conditions were initial denaturation at 94°C for 2 min, followed by 35 cycles at 94°C for 30 s, 55°C for 30 s, and 72°C for 1 min. The 3⬘-RACE was performed with primer E6F, KlenTaq polymerase (Advantage cDNA PCR kit, Clontech) and 34 cycles of denaturation (94°C, 30 s), annealing (60°C, 30 s), and extension (68°C, 4 min), after an initial denaturation at 94°C for 2 min. The RT-PCR and RACE PCR products were gel purified and cloned in pUC18. Double-stranded DNA was sequenced with the T7 Sequencing Kit (Pharmacia, Uppsala, Sweden) and vector-specific primers. In addition, several canine-specific Pit-1 primers were designed. The sequence analysis was performed at least twice with independently amplified and subcloned PCR products to exclude PCR artefacts.

volume of 50 ␮l. The PCR reactions consisted of 2 min at 94°C, followed by 35 cycles of 30 s at 94°C, 30 s at 55°C, and 4 min or 1 min at 68°C. The PCR products were gel purified and directly sequenced with an ABI 310 Genetic Analyzer with BigDye Termination mix. Restriction Fragment Length Polymorphism (RFLP) PCR was performed to determine whether healthy littermates of the dwarf German shepherd dogs contain the C to A transversion in exon 3. Gel-purified Pit-1 fragment C was digested by the restriction enzyme MaeIII (BoehringerMannheim, Mannheim, Germany) according to the supplier’s instructions. The digested PCR fragments were electrophoresed through a 1.5% agarose gel and stained with ethidium bromide. The DNA marker VI (Boehringer Mannheim) was used as size marker.

Chromosomal localization of the canine Pit-1 gene by FISH analysis. Fluorescence in situ hybridization (FISH) was performed as previously described (Breen et al. 1999a), with digoxygenin-labeled canine Pit-1 BAC DNA as probe. The chromosomal assignment was confirmed by co-hybridization with biotinylated chromosome-specific cosmid clones (Breen et al. 1999b) to allow dual color detection. Detection was with FITC and Texas Red, respectively.

Radiation hybrid mapping of the canine Pit-1 gene. The Pit-1 gene was mapped by PCR on a dog whole genome radiation hybrid panel (Vignaux et al. 1999a, 1999b) as described in Priat et al. (1998). The Pit-1 PCR primers used were 5⬘-TTCAGTCAAACGACTATCTGCCGA-3⬘ (exon 4) and 5⬘-AGCCTAAATCCTACCAGTGGAAGTCAC-3⬘ (intron 4), resulting in a 188-bp PCR fragment.

Linkage analysis of Pit-1 flanking markers. The microsatellites Determination of the exon/intron boundaries. Three introns of the Pit-1 gene were completely amplified by PCR (Fragments A, E, F; Table 1), with Klentaq and 35 cycles of denaturation (94°C, 30 s), annealing (60°C, 30 s), and extension (68°C, 4 min). Attempts to amplify introns 2 and 3 by long-distance PCR were unsuccessful. To circumvent this problem, we screened a Doberman Pinscher BAC library (Li et al. 1999) with a 32P-labeled Pit-1 probe (fragment E) as previously described (van de Sluis et al. 1999). A positive clone was partially sequenced with an ABI 310 Genetic Analyzer (Perkin Elmer Applied Biosystems, Foster City, Calif.) with BigDye Termination mix (Perkin Elmer).

Genomic DNA sequencing for Pit-1 mutations. With six pairs of oligonucleotides (A–F, Table 1), the entire coding region of the Pit-1 gene was amplified by PCR. PCR was carried out with 50–200 ng genomic DNA and the Advantage cDNA PCR kit (fragments A, B, D, E, F) (Clontech) or Advantage-GC cDNA PCR kit (fragment C; Clontech) in a final

177K14, 41K19, and 52L05 were typed by use of the primers recently developed by Jouquand et al. (personal communication): 177K14 forward 5⬘-ACATGCTTTCATGTTGCTGC-3⬘ and reverse 5⬘-GATGCTAGACAAAGCAGCCC-3⬘, 41K19 forward 5⬘-GAGGAGGATGGGGTGAT-3⬘ and reverse 5⬘-AACTGGCATTTCCTTATTTT-3⬘, and 52L05 forward 5⬘-ACCTGGTCATTTGAGATTAGA-3⬘ and reverse 5⬘TGGCTTTTGTGTATGTATTTT-3⬘. PCR was performed on 50–100 ng genomic DNA in a final volume of 10 ␮l containing 5 pmol of each primer, 200 ␮M dNTPs, 2 mM MgCl2, 50 mM KCl, 10 mM Tris-HCl (pH 8.3), and 0.35 U AmpliTaq Gold polymerase (Perkin Elmer). The forward primer was fluorescently labeled at the 5⬘ end. The PCR consisted of an initial Taq polymerase activation at 94°C for 10 min, followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s, with a final extension at 72°C for 15 min. The PCR products were combined with an aliquot of an internal lane size standard (GeneScan 500-TAMRA, Perkin Elmer) and resolved with an ABI 310 Genetic Analyzer. The data were analyzed with GENESCAN software (Perkin Elmer).


Fig. 1. Nucleotide sequence and deduced amino acid sequence of Great Dane Pit-1 cDNA. The sequence has been deposited in the GenBank database under accession no. AF035585. A minor part of the sequence has

33

been reported previously by us (accession no. AF102266). The C to A transversion (codon 81) found in German shepherd dogs is shown in bold.

Results Cloning and sequencing of the canine Pit-1 gene. Two overlapping parts of canine Pit-1 cDNA, covering codons 5–228, were amplified by RT-PCR with primers complementary to human and/ or rat Pit-1 cDNA sequences. RACE PCR was performed to determine the 5⬘- and 3⬘- flanking regions. The 5⬘-RACE yielded a 335-bp PCR fragment, corresponding to a 5⬘-UTR of 92 bp. The 3⬘-RACE product was 2.3 kb, corresponding to a 3⬘-UTR of 1959 bp. The full-length cDNA contains an open reading frame encoding for 291 amino acids. The complete nucleotide sequence and deduced amino acid sequence of the canine Pit-1 cDNA are given in Fig. 1. The putative mature protein was highly homologous with Pit-1 of other mammalian species (Fig. 2). Comparison with the rat (Theill et al. 1992), mouse (Li et al. 1990), swine (Yu et al. 1994), and human (Tatsumi et al. 1992) Pit-1 amino acid sequences revealed 89.7%, 89.3%, 89.7%, and 91.4% identities, respectively. The well-conserved POU and HOMEO domains were 98.5–100% and 92–98% homologous, respectively, with the cognate regions in other mammalian species. To facilitate Pit-1 mutation analysis of genomic DNA, the intron sequences of the canine Pit-1 gene were completely (introns 1, 4 and 5) or partly (introns 2 and 3) determined by long-distance PCR and BAC DNA sequencing. The sequence of the exon-intron boundaries conforms to the consensus splicing signal (Shapiro and Senapathy 1987; Fig. 3). Mutation analysis of the canine Pit-1 gene. Genomic DNA isolated from three dwarf German shepherd dogs was screened ini-

Fig. 2. Comparison of the putative canine Pit-1 amino acid sequence with Pit-1 sequences of other mammalian species. Conserved amino acids across all species are indicated by asterisks(*).

34


Fig. 3. Sequences of the exon/intron boundaries of the canine Pit-1 gene. The deduced amino acid sequence is given below the sequence. The amino acid position at the splice site is indicated, and the sizes of the introns are given whenever possible.

tially for the presence of mutations in the Pit-1 gene. The entire coding region and the exon/intron boundaries (at least 26 bp intron-sequence) were amplified by PCR and directly sequenced. In all three dogs a homozygous C to A transversion was detected in exon 3 (fragment C), leading to the substitution of a phenylalanine (TTC) by a leucine residue (TTA) at codon 81. The C to A transversion alteration creates a MaeIII recognition site (GTNAC), offering a rapid detection method for this particular mutation. As a result of the MaeIII site, the 403-bp PCR fragment C will be cut by MaeIII into a 329-bp, a 69-bp, and a 5-bp fragment instead of a 398-bp and a 5-bp fragment. To determine whether the detected base substitution is associated with dwarfism, we screened genomic DNA from healthy littermates of the German shepherd dogs for the presence of the mutation. For two of the three analyzed dwarf German shepherd dogs, no DNA from relatives was available for analysis. Therefore, a fourth dwarf and her healthy sister and mother were included in the study. In addition, genomic DNA from Beagle and Golden Retriever dogs was analyzed. Pit-1 fragment C was amplified by PCR and digested with MaeIII. Both dwarf and healthy German shepherd dogs appeared to be homozygous for the mutant, Leu81encoding, allele (Fig. 4). MaeIII did not cut the Pit-1 PCR fragments derived from Beagle and Golden Retriever dogs (Fig. 4). The TTC triplet was also found in Pit-1 cDNA from a Great Dane (Fig. 1) and in genomic DNA from a Doberman Pinscher (Pit-1 BAC clone). Chromosomal mapping of Pit-1. The chromosomal localization of the canine Pit-1 gene was determined by FISH, with Pit-1 BAC DNA as probe. The BAC clone hybridized specifically to the proximal end of CFA31. Co-hybridization with a CFA31-specific cosmid clone [which itself has been verified to be on CFA31 by co-hybridization with a Chr 31-specific paint probe (Breen et al. 1999b)] confirmed our initial identification of the localization of Pit-1 onto CFA31 (Fig. 5). Radiation hybrid mapping of the Pit-1 gene. The Pit-1 gene was also localized on the canine radiation hybrid map consisting of 400 polymorphic markers and genes (Priat et al. 1998). The gene was assigned to the RH.01-a group, where the microsatellite markers 177K14, 41K19, and 52L05 were recently mapped (Jouquand et al., personal communication). The mapping order was: 52L05, Pit-1, 177K14, and 41K19. Linkage analysis of these markers was performed to study the possibility that the pituitary disorder is caused by a mutation in the Pit-1 gene outside the coding region. Marker 177K14 (LOD score 29, 5 cR) was not polymorphic in German shepherd dogs, showing only a 222-bp PCR fragment in this dog breed. The Pit-1 flanking markers 41K19 (LOD score 14, 38 cR) and 52L05 (LOD score 9.9, 53 cR) both revealed two alleles in German shepherd dogs (Fig. 6). Additional alleles were detected in the Beagle and Golden Retriever (not shown). Four of the seven analyzed dwarf German shepherd dogs showed heterozygosity for the 41K19 and/or 52L05 marker. No consistent co-

Fig. 4. Restriction enzyme digestion of Pit-1 fragment C (exon 3). Electrophoretic profiles of PCR-amplified DNA digested with MaeIII. Lane 1: molecular weight marker. Lanes 2 and 3: digested genomic DNA from Beagle and Golden Retriever dogs, showing a 398-bp band. Lanes 4–11: digested genomic DNA from dwarf German shepherd dogs (䊉, 䊏), and healthy relatives (䊐, 䊊), showing a 329-bp band. The mother is carrier (•); the littermates may be carrier or non-carrier.

Fig. 5. Chromosomal localization of the canine Pit-1 gene. Fluorescence in situ hybridization (FISH) of the BAC clone containing the Pit-1 gene (top arrow on right and left sides) and a Chr 31-specific cosmid clone (bottom arrow on right and left sides) maps Pit-1 to CFA31.

segregation between one of the Pit-1-linked marker alleles and the combined pituitary hormone deficiency phenotype was observed. Discussion As part of our efforts to identify genes responsible for combined pituitary hormone deficiencies in German shepherd dogs, we have characterized the gene encoding transcription factor Pit-1. The gene structure of the canine Pit-1 gene is very similar to the structural organization of the human, mouse, and rat Pit-1 genes, each comprising six exons interspersed by five introns with conserved splicing boundaries. The 2.9-kb gene transcript contains an open reading frame encoding for 291 amino acids, 92 bp of 5⬘-UTR, and 1959 bp of 3⬘-UTR. A long 3⬘-UTR has also been reported in rat and chum salmon Pit-1 cDNA (Konzak and Moore 1992; Ono and Takayama 1992). The deduced amino acid sequence of the canine Pit-1


35

Fig. 6. Segregation of the Pit-1 flanking microsatellite markers 41K19 and 52L05 in affected pedigrees of German shepherd dogs. The size of the observed PCR products is indicated in base pairs (N.D.⳱ not done). The

dwarf dogs (䊏, 䊉) and unaffected, related German shepherd dogs (䊐, 䊊) both show heterozygosity or homozygosity for the Pit-1 linked marker alleles.

cDNA is highly homologous with that of Pit-1 of other mammalian species, in particular in the POU-specific and POU-homeo domains. Analysis of the Pit-1 gene in dwarf German shepherd dogs revealed a homozygous C to A transversion in exon 3, leading to an amino acid substitution at position 81 (Leu for Phe). The alteration was found in both dwarf and healthy German shepherd dogs, indicating that it is not the disease-causing mutation. The substituted residue is located outside the POU-specific, POU-homeo, and transactivation domains of Pit-1, the functional domains in which the majority of the Pit-1 mutations causing dwarfism are found (Tuggle and Trenkle 1996). Both Phe and Leu amino acids contain nonpolar side chains, suggesting that the C to A transversion can be predicted to cause a conservative amino acid change. However, this substitution is present neither in the other four dog breeds analyzed in this study nor in all previously reported Pit-1 sequences, including fish and avian Pit-1 sequences (Ono and Takayama 1992; Yamada et al. 1993; Wong et al. 1992). As combined pituitary hormone deficiency occurs primarily in German shepherd dogs, the presence of this rare Pit-1 sequence variation may be a predisposition for congenital dwarfism. In the dog, differences in body size between several breeds are attributed to differences in the period of postnatal GH excess (Favier et al., personal communication). For example, in a giant breed dog such as the Great Dane, excessively high circulating GH levels have been found during the first 4–5 months of life. Pit-1 sequence analysis in the Great Dane, Doberman Pinscher, Beagle, and Golden Retriever did not reveal nucleotide differences among these breeds, indicating that this transient GH excess is not caused by an activating mutation in the coding region of Pit-1. We mapped the Pit-1 gene to canine Chr CFA31, using dualcolor FISH. In humans, Pit-1 has been mapped to Chr 3p11 (Ohta et al. 1992), suggesting that this region is syntenic to CFA31. However, reciprocal hybridization between HSA3 and CFA31 with whole chromosome paint probes (Zoo-FISH) has revealed no shared synteny between these two chromosomes (M. Breen, unpublished data). Since the level of resolution of Zoo-FISH has been estimated to be in the region of 7 Mb (Scherthan et al. 1994), it is possible that regions of shared synteny smaller than this limit will not be detected. The Pit-1 gene was also mapped to a dog whole genome radiation hybrid panel where 400 polymorphic markers and genes have been placed (Priat et al. 1998). The Pit-1 gene was assigned to the RH.01-a group, close to the recently developed polymorphic markers 41K19 and 52L05 (Jouquand et al., personal communication). Linkage analysis of these Pit-1 flanking markers in affected pedigrees of German shepherd dogs was performed to address the possibility that the disease is caused

by a Pit-1 mutation outside the coding region. However, no consistent co-segregation between one of the Pit-1-linked marker alleles and the disease was observed, indicating that Pit-1 is not responsible for combined pituitary hormone deficiency in German shepherd dogs. Now that an increasing number of canine polymorphic markers are becoming available, genetic linkage analysis will facilitate the evaluation and localization of new candidate genes for the disease. The recently described Prop1 gene, defective in Ames dwarf mice (Sornson et al. 1996), is a strong candidate for the canine pituitary disorder. In addition to deficiencies in GH, PRL, and TSH, Ames mice show a reduced LH response upon stimulation by LH-releasing hormone, resembling the phenotypic characteristics of dwarf German shepherd dogs. The molecular steps in pituitary organogenesis have been investigated recently by analyzing knock-out and transgenic mice. The hormone-producing pituitary cell types—gonadotropes, thyrotropes, somatotropes, lactotropes, corticotropes, and melanotropes—appear to emerge in a spatially and temporally specific fashion from a common precursor (Treier et al. 1998). The terminal differentiation of the pituitary cell types involves sequential dorsal–ventral gradients of several transcription factors. Interestingly, transgenic mice expressing a dominant-negative BMP1A receptor exhibited a dwarf phenotype similar to the Ames mice, indicating that this receptor and its ligands are also potential candidate genes for the combined pituitary hormone deficiency in dwarf German shepherd dogs. Acknowledgments. This work was supported by the Dutch Cancer Society (RUU-95-1092). Matthew Breen (Animal Health Trust) is supported by funds from the Guide Dogs for the Blind Association. Corinne Renier is supported by funds from the CNRS and by Conseil Re´gional de Bretagne. The authors wish to thank Sophie Jouquand for communication of results before publication, Harry G.H. van Engelen for his help by obtaining pituitary glands, Desiree Bresser for collecting blood samples from German shepherd dogs, and Marijke Kwant and Monique E. van Wolferen for technical assistance. The critical reading of the manuscript by Dr. B.E. Belshaw is highly appreciated.

References Andresen E, Willeberg P (1976) Pituitary dwarfism in German shepherd dogs: additional evidence of simple, autosomal recessive inheritance. Nord Vet Med 28, 481–486 Breen M, Langford CF, Carter NP, Holmes NG, Dickens HF et al. (1999a) FISH mapping and identification of canine chromosomes. Am Genet Assoc 90, 27–30 Breen M, Bullerdiek J, Langford CF (1999b) The DAPI banded karyotype of the domestic dog (Canis familiaris) generated using chromosome specific paint probes. Chromosome Res, in press

36


Hamann F, Kooistra HS, Mol JA, Gottschalk S, Bartels T, Rijnberk A (1999) Pituitary function and morphology in two German shepherd dogs with congenital dwarfism. Vet Rec 144, 644–646 Konzak KE, Moore DD (1992) Functional isoforms of Pit-1 generated by alternative messenger RNA splicing. Mol Endocrinol 6, 241–247 Kooistra HS, Voorhout G, Selman PJ, Rijnberk A (1998) Progestininduced growth hormone (GH) production in the treatment of dogs with congenital GH deficiency. Domest Anim Endocrinol 15, 93–102 Li R, Mignot E, Faraco J, Kodatani H, Cantanese JJ et al. (1999) Construction and characterization of an eightfold redundant dog genomic bacterial artificial chromosome library. Genomics 58, 9–17 Li S, Crenshaw III EB, Rawson EJ, Simmons DM, Swanson LW et al. (1990) Dwarf locus mutants lacking three pituitary cell types result from mutations in the POU-domain gene Pit-1. Nature 347, 528–533 Miller SA, Dykes DD, Polesky HF (1988). A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 16, 1215 Mol JA, van Garderen E, Selman PJ, Wolfswinkel J, Rijnberk A et al. (1995) Growth hormone mRNA in mammary gland tumors of dogs and cats. J Clin Invest 95, 2028–2034 Mukherjee JJ, Islam N, Kaltsas G, Lowe DG, Charlesworth M et al. (1997) Clinical, radiological and pathological features of patients with Rathke’s cleft cysts: tumor that may recur. J Clin Endocrinol Metab 82, 2357– 2362 Ohta K, Nobukuni Y, Mitsubuchi H, Ohta T, Tohma T et al. (1992) Characterization of the gene encoding human pituitary-specific transcription factor, Pit-1. Gene 122, 387–388 Ono M, Takayama Y (1992) Structures of cDNAs encoding chum salmon pituitary-specific transcription factor Pit-1/GHF-1. Gene 226, 275–279 Parks JS, Kinoshita E-I, Pfa¨ffle RW (1993) Pit-1 and hypopituitarism. Trends Endocrinol Metab 4, 81–85 Pernasetti F, Milner RDG, Ashwal AAZA, de Zegher F, Chavez VM et al. (1998) Pro239Ser: a novel recessive mutation of the Pit-1 gene in seven Middle Eastern children with growth hormone, prolactin and thyrotropin deficiency. J Clin Endocrinol Metab 83, 2079–2083 Priat C, Hitte C, Vignaux F, Renier C, Jiang Z et al. (1998) A wholegenome radiation hybrid map of the dog genome. Genomics 54, 361– 378 Scherthan H, Cremer T, Arnason U, Weier H-U, Lima-de-Faria A et al. (1994) Comparative chromosome painting discloses homologous segments in distantly related mammals. Nat Genet 6, 342–347 Shapiro MB, Senapathy P (1987) RNA splice junctions of different classes of eukaryotes: sequence statistics and functional implications in gene expression. Nucleic Acids Res 15, 7155–7174

Sornson MW, Wu W, Dasen JS, Flynn SE, Norman DJ et al. (1996) Pituitary lineage determination by the Prophet of Pit-1 homeodomain factor defective in Ames dwarfism. Nature 384, 327–333 Tatsumi K, Notomi T, Amino N, Miyai K (1992) Nucleotide sequence of the complementary DNA for human Pit-1/GHF-1. Biochim Biophys Acta 1129, 231–234 Theill LE, Hattori K, Lazzaro D, Castrillo JL, Karin M (1992) Differential splicing of the GHF1 primary transcript gives rise to two functionally distinct homeodomain proteins. EMBO J 11, 2261–2269 Treier M, Gleiberman AS, O’Connell SM, Szeto DP, McMahon JA et al. (1998) Multistep signaling requirements for pituitary organogenesis in vivo. Genes Dev 12, 1691–1704 Tuggle CK, Trenkle A (1996) Control of growth hormone synthesis. Domest Anim Endocrinol 13, 1–33 van de Sluis BJA, Breen M, Nanji M, van Wolferen M, de Jong P et al. (1999) Genetic mapping of the copper toxicosis locus in Bedlington terriers to dog chromosome 10, in a region syntenic to human chromosome region 2p13-16. Hum Mol Genet 8, 501–507 Vignaux F, Priat C, Jouquand S, Hitte C, Jiang Z et al. (1999a) Toward a dog radiation hybrid map. J Hered 90, 62–67 Vignaux F, Hitte C, Priat C, Chuat JC, Galibert F (1999b) Construction and optimization of a dog whole genome radiation hybrid panel. Mamm Genome 9, 888–894 Wainrajch MP, Gertner JM, Harbison MD, Chua SC Jr, Leibel RL (1996) Nonsense mutation in the human growth-hormone releasing hormone receptor causes growth failure analogous to the little (lit) mouse. Nat Genet 12, 88–90 Watkins-Chow DE, Camper SA (1998) How many homeobox genes does it take to make a pituitary gland? Trends Genet 14, 284–290 Wong EA, Silsby JL, el Halawani ME (1992) Complementary DNA cloning and expression of Pit-1/GHF-1 from the domestic turkey. DNA Cell Biol 11, 651–660 Wu W, Cogan JD, Pfa¨ffle RW, Dasen JS, Frisch H et al. (1998) Mutations in PROP1 cause familial combined pituitary hormone deficiency. Nat Genet 18, 147–149 Yamada S, Hata J-I, Yamashita S (1993) Molecular cloning of fish Pit-1 cDNA and its functional binding to promoter of gene expressed in the pituitary. J Biol Chem 268, 24361–24366 Yu T-P, Schmitz CB, Rothschild MF, Tuggle CK (1994) Expression pattern, genomic cloning and RFLP analyses of the swine PIT-1 gene. Anim Genet 25, 229–233