Comparison of different diagnostic methods of

‫العدد الرابع‬-‫مجلة النيلين الطبية‬

NMJ March 2012

Comparison of different diagnostic methods of Helicobacter pylori infection in Sudanese patients 1

Nazar Abdalazeem Osman Abdalsadeg, 2Adam Ahmed Adam, 3Hassan Abdul-Aziz, 2 Waleed Hussein Omer, 4Hassan Abdalsalam Osman and 2Ahmed Kamal Bolad

1

Ahfad University for Women, Omdurman, Sudan, P.O.Box:167, Omdurman, Sudan of Microbiology 2 3 4

Tel 00249912476762. PH.D

Alneelain University, faculty of medicine and alneelain medical research center –Sudan Alribat University, Academic affairs West Nile College, Department of Medical Laboratory

ABSTRACT This study aimed at comparing a PCR method of direct detection from biopsy and two other methods: culture and (campylobacter like organism) CLO test for the diagnosis of H. pylori in Sudan. A total of 100 biopsies were taken from 100 patients presenting with various gastroduodenal symptoms after obtaining an informed consent. The biopsies were analyzed using the culture method, CLO test kit and the PCR test using the 23S rRNA gene (Jene bioscience kits). With culture 48% (48 out of 100) were positive, CLO test 53% (53 of 100) were positive, 58 out of 100(58%) were patients by using PCR. Sensitivity and specificity of culture technique was (78%) and (94%) respectively while PCR showed a sensitivity of 94% and a specificity of 75% and CLO test showed (96% & 86.5%) for sensitivity and specificity when culture was the golden method and (88%, 95%) when PCR was the golden method. The PCR test appears to be the most reliable test for diagnosis of H. pylori in Sudan especially where culture is difficult. Keywords: Helicobacter pylori, biopsies, PCR, CLO test, culture.

INTRODUCTION Helicobacter pylori (H. pylori) is the causative agent of gastritis, peptic ulcer, MALT lymphoma and is a risk factor in the development of gastric cancer (1). There are several methods for the diagnosis of Helicobacter pylori and can be classed into two broad categories, namely invasive methods that require endoscopy or the minimally or non-invasive methods that do not require endoscopy.  2012 Al Neelain Medical Journal

The endoscopy methods include culture, (campylobacter like organism) CLO test, PCR, fluorescence in situ hybridization (FISH), direct gram stain, histology, while the non-invasive methods include serology, urea breath test (UBT) and Helicobacter pylori stool antigen test (HbsAg). Culture is the gold standard for the diagnosis of any microorganism and so where culture cannot be possible histology vol.2 No.4

ISSN 1858-6279


NMJ March 2012

and CLO test have been used as the gold standard for the diagnosis of H. pylori. UBT is however the known gold standard for the non-invasive detection of H. pylori.(2) In Sudan , currently both gold standards for the non-invasive and invasive detection of H. pylori are fraught with several problems such methods are either difficult for isolation of H. pylori due to frequent power outages in case of culture or very expensive and not generally affordable or available in case of UBT. This, in addition to the fact that culture could take several days to obtain a result and in

developing countries, of which Sudan is one, it is even difficult to obtain a result. Several assays based on the use of PCR have been developed to detect the presence of H.pylori DNA by using several gene targets directly from the biopsies (2 – 3). The targets of these PCR methods include urease A (ureA) gene , cag A gene , phosphosamine mutase (glmM) gene and 16S rRNA gene 95).(3,4,5) The aim of the study was to compare the sensitivity and specificity of PCR methods in H. pylori diagnosis with the results with those of culture and CLO test.

MATERIALS AND METHODS This was a descriptive cross–sectional study carried out in Khartoum state (Sudan). One hundred biopsies were collected from patients attending Alribat teaching Hospital , Alneelain medical center and Asia hospital, with gastric symptoms. The specimens were analyzed using the following methods: culture method, CLO test and PCR. The total Gastric biopsies genomic DNA was extracted by using (Jena bioscience) Genomic DNA purification from tissue DNA Preparation Kit according to manufacturer's instructions. PCR amplification methods and oligonucleotide primers derived from a known sequence of the 23S rRNA gene were used: 5_-AGGTTAAGAGGATGCGTCAGTC3_and 5_- CGCATGATATTCCCATTAGC AGT-3 The ultraviolet

gel was visualized trans–illuminator,

over and

photographed using gel documentation system, fragments size (about 267 bp at second PCR reaction) were estimated from the distance of migration relative to the positive control. Culture was done by direct plating from biopsies samples. The media used include an agar base (brain heart infusion agar), selective supplement (Skirrow) and growth supplement (animal plasma). The inoculated plates were incubated in microaerophilic atmosphere using microaerophilic kits (campylobacter system CN0025A oxoid) at 37°C for 3 days. The isolated bacteria were identified by its colonial morphology, microscopy and biochemical test. The CLO test was done using the sample according to the kits manufacture’s instructions.

RESULTS  2012 Al Neelain Medical Journal

vol.2 No.4

ISSN 1858-6279

NMJ March 2012

A total number of one hundred patients attending Alrebat teaching hospital, alneelain medical center and Asia hospital suffering from GIT problem were enrolled in this study, Of these (54%) were males and (46%) were females. The age of the patients ranged between 10 to 80 years, the endoscopic result showed that 82% of the patients have gastritis, 13% with duodenitis and only (7%) have gastric ulcer. H. pylori were isolated from 48 patients (48%) by culture method and from 58 patients (58%) by using PCR method (Figure .2) and from 54 patients (54%) using CLO test. (Figure 1) A total number of 45 patients gave positive result in both culture and PCR while 3 patients' showed positive result in culture and negative in PCR and 13 patients were positive by PCR and negative by culture. (Table.1). Chi-square shows that there is difference between culture and PCR (P value: .000). Forty six patients showed positive results in both culture and CLO techniques, 2 patients gave positive result only by culture and negative to CLO test and 7 patients showed positive result by CLO test and negative by the culture technique. (Table.2). Chi-square showed that there is significant difference between culture and CLO test (P value: .000).

 2012 Al Neelain Medical Journal


The sensitivity and specificity of culture technique was (78%) and (94%) respectively while PCR showed a sensitivity of 94% and a specificity of 75% and CLO test showed (96% & 86.5%) for sensitivity and specificity when culture was the golden method and (88% & 95%) when PCR was considered as the golden method. Statistical analysis revealed that culture isolated H. pylori was not significantly associated with the gender of patients (P= 0.083). Also, there were no differences (P= 0.848) in culture isolated rates and patients symptoms (epigastric pain (P= 0.848), heartburn (P= 1.333) and reflux (P= 3.000). Statistical analysis also showed that no significant relation between culture isolate and endoscopic findings (gastritis, gastric ulcer and dudenitis) (P=0.645) Of the total number of 58 PCR positive cases 32 were males and 26 were females, of these 58 epigastric pain was found in all of them (100%), heartburn in 51.7% (30/58), reflux in 51.7% (30/58) and vomiting in 27.6% (16/58). Statistical analysis showed that PCR positivity to H. pylori was not significantly associated with the gender of patients (P= 0.621). Statistically there was no association between PCR positive and patients symptoms (P= 0.069).

vol.2 No.4

ISSN 1858-6279


NMJ March 2012

(Figure1) Shows % positivity of the 3 methods used for H. pylori diagnosis

50 bpredal

267 bp 250 bp 300 bp

(Figure 2) PCR gel documentation of helicobacter pylori

(Table1) Correlation between culture and PCR CULTURE

PCR

-ve

Count Row % Column % +ve Count


Total

+ve

-ve

3 7.1% 6.3% 45

39 92.9% 75.0% 13

42 (PCR -ve) 100.0% 42.0% 58 (PCR +ve) vol.2 No.4

ISSN 1858-6279


NMJ March 2012

Total

77.6% 22.4% 93.8% 25.0% 48 52 (CULTURE +ve) (CULTURE-ve) Row % 48.0% 52.0% Column % 100.0% 100.0% Row % Column % Count

100.0% 58.0% 100 100.0% 100.0%

(Table2): Correlation between culture and CLO test

CULTURE +ve -ve 2 Count 4.3% Row % Column % 4.2% 46 +ve Count 86.8% Row % Column % 95.8% Total Count 48 Row % 48.0% Column % 100.0%

CLO_Test

-ve

Total

45 95.7% 86.5% 7 13.2% 13.5% 52 52.0% 100.0%

47 100.0% 47.0% 53 100.0% 53.0% 100 100.0% 100.0%

DISCUSSION H. pylorus is a gram –negative bacterium that colonizes the human stomach resulting in chronic gastritis. The severity of the inflammation is likely to underlie H. pylorirelated diseases. The prevalence of H. pylori infection increases with age worldwide (6). In the present study, this increase pattern was exhibited partly among our Sudanese.  2012 Al Neelain Medical Journal

Accurate diagnosis is essential for the effective treatment and management of infections caused by this organism. There are several methods for the diagnosis of H. pylori and can be classed into two broad categories, namely invasive methods that require endoscopy or the minimally or noninvasive methods that do not require endoscopy.(7) The endoscopy methods include direct Gram’s stain, culture, CLO vol.2 No.4

ISSN 1858-6279


NMJ March 2012

test, PCR, fluorescence in situ hybridization (FISH) and histology; while the noninvasive methods include serology, urea breath test (UBT) and H. pylori stool antigen test. In the present study culture, PCR and CLO test were used as diagnostic tools. Of these cultures technique detected H. pylori in (48%) of patients, PCR in (58%) and CLO test in (54%). Culture is the gold standard for the diagnosis of any microorganism, but in the case of H. pylori many drawbacks were noticed including that it is time consuming and difficult to grow due to the usual none abundance of bacteria and the strict conditions required for its growth: like growth supplements and selective requirements. Out of 100 sample inoculated in brain heart agar 48 H. pylori were isolated. This finding is in accordance to the findings of Reza Khashei and his colleagues who found that 80 (34.8%) of the 230 patients studied were harboring H. pylori in the antrum of the stomach (8). Another study showed that the percentage of culture positive specimen was 31.94% (9) Several assays based on the use of PCR have been developed to detect the presence of H. pylori DNA by using several gene targets directly from the biopsies (10) (11). The targets of these PCR methods included urease A (ureA) gene cag A gene (12), phosphosamine mutase (glmM) gene (13) and 23S rRNA gene. The advantage of PCR over non molecular methods is that it affords a high degree of sensitivity and specificity, with a

detection rate of 10 to 100 H. pylori cells. (14)

The present study was conducted using PCR targeted at the specific 23S rRNA gene for H. pylori. The positive result of (58%) was close to the study done by Sonia Agudo and her colleagues in USA who found (64.1%) prevalence of H. pylori among Spanish patients(15).It is also similar to another study done in China by Zhuoqi and his colleagues who detected H. pylori in (59.5%) of the studied samples. (16). SI Smith and his colleagues detected H. pylori in 35% of their patients using a PCR method in Nigeria (17) The rapid urease CLO (Campylobacter-like organism test) is commonly used during endoscopy to diagnose the presence of H. pylori. The basis of the test is the ability of H. pylori to secrete the urease enzyme, which catalyzes the conversion of urea to ammonia and bicarbonate. CLO test results were observed in (54%) of the patients in this study. This finding is in accordance to the study done in Kuwait University, where (52%) of the patients had a positive CLO test when they also used a single biopsy as we did. (18) Our result was different from that of Stella I. Smith and his colleagues who found that the percentage of the CLO test was 15/42 (35.71%) (17) In conclusion the PCR test was found to be the most sensitive method to be used for the routine diagnosis for the presence of helicobacter pylori in patients suspected to be infected by the organism.

Acknowledgement: We would like to thank the family of Al Neelain Medical Research Center- Faculty of Medicine, University of Al Neelain, for their valuable help and expert support.

REFERENCES


vol.2 No.4

ISSN 1858-6279

NMJ March 2012

1- Blaser MJ, Perez-Perez GI, Kleanthous H, Cover TL, Peek RM, Chyou PH, Stemmermann GN, Nomura A. Infection with Helicobacter pylori strains possessing cagA is associated with an increased risk of developing adenocarcinoma of the stomach. Cancer Res 1995; 55:2111- 15. 2- Weiss J, Mecca J, da Silva E, Gassner D. Comparison of PCR and other diagnostic techniques for detection of Helicobacter pylori infection in dyspeptic patients. J Clin Microbiol 1994; 32: 1663-68. 3- Bickley J, Owen RJ, Fraser AG, Pounder RE. Evaluation of the polymerase chain reaction for detecting the urease C gene of Helicobacter pylori in gastric biopsy sample and dental plaque. J Med Microbiol 1993; 39: 338-344. 4- Clayton CL, Kleanthous H, Coates PJ, Morgan DD, Tabaqchali S. Sensitive detection of Helicobacter pylori by using polymerase chain reaction. J Clin Microbiol 1992; 30: 192-200. 5- Lu JJ, Perng CL, Shyu RY, Chen CH, Lou Q, Chong SKF, Lee CH. Comparison of five PCR methods for detection of Helicobacter pylori DNA in gastric tissues. J Clin Microbiol 1999; 37: 772-774. 6- Alberto Pilotto and Nathalie Salles. Helicobacter pylori infection in geriatrics. Volume 7.October 2002, Pages: 56–62 7- Shiotani A, Nurgalieva Z, Yamaoka Y, Graham D (2000). Helicobacter pylori. Med Clin North Am 84, 1125–1136. 8- Reza Khashei, Hasan Shojaei, Peyman Adibi, Ahmad Shavakhi, Mohammad Mehdi Aslani, Abass Daei Naser. Genetic Diversity and Drug Resistance of Helicobacter pylori Strains in Isfahan, Iran. Iranian Journal of Basic Medical Sciences Vol. 11, No. 3, Autumn 2008, 174-182 Received: Oct 7, 2008; Accepted: Dec 3, 2008



9Mohammad Kargar, Maryam Baghernejad, Abbas Doosti2 and Sadegh Ghorbani-Dalini. Clarithromycin resistance and 23S rRNA mutations in Helicobacter pylori isolates in Iran. African Journal of Microbiology Research Vol. 5(8) pp. 853856, 18 April, 2011 10- Gisbert, J. P., D. Olivares, I. Jimenez, and J. M. Pajares. 2006. Is there any correlation between 13C-urea breath test values and response to first-line and rescue Helicobacter pylori eradication therapies? Dig. Liver Dis. 38:254-259. 11-Kim, M. J., R. Michener, and G. Triadafilopoulos. 1997. Serum 13Cbicarbonate assay for the diagnosis of gastric Helicobacter pylori infection and response to treatment. Gastroenterology 113:31-37. 12Moulton-Barrett, R., G. Triadafilopoulos, R. Michener, and D. Gologorsky. 1993. Serum 13C-bicarbonate in the assessment of gastric Helicobacter pylori urease activity. Am. J. Gastroenterol. 88:369-374. 13- Tomatari FH, Mobarez AM, Amini M, Hosseini D, Talebi Bezmin Abadi A (2010). Helicobacter Pylori Resistance to Metronidazole and Clarithromycin in Dyspeptic Patients in Iran. IRCMJ, 12(4): 409-412. 14- Ho GY, Windsor HM (2000). Accurate diagnosis of Helicobacter pylori. Polymerase chain reaction tests. Gastroenterol Clin North Am 29,903–915. 15- Agudo, Guillermo Pérez-Pérez, Teresa Alarcón, Manuel López-Brea. Rapid detection of clarithromycin resistant Helicobacter pylori strains in Spanish patients by polymerase chain reactionrestriction fragment length polymorphism. 1Hospital de la Princesa, Madrid. Instituto de Investigación Sanitaria del Hospital La Princesa 2Departments of Medicine and vol.2 No.4

ISSN 1858-6279

NMJ March 2012


Microbiology, NYU School of Medicine, New York, USA 16- Liu, Jing Shen, Lian Zhang, Lin Shen, Qiang Li, Baozhen Zhang, Jing Zhou, Liankun Gu, Guoshuang Feng, Junling Ma, Wei-Cheng You and Dajun Deng.Prevalence of A2143G mutation of H. pylori-23S rRNA in Chinese subjects with and without clarithromycin use history. BMC Microbiology 2008, 8:81doi:10.1186/1471-2180-8-81 17- Stella. Smith, Muinah A. Fowora1, Jesse A. Otegbayo, Fatimah B. Abdulkareem, Emmanuel A. Omonigbehin1, Akere Adegboyega, Monica Contreras , Rainer Haas. Comparison of PCR with other diagnostic techniques for the detection of H. pylori infection in patients presenting with gastroduodenal symptons in Nigeria. Int J Mol Epidemiol Genet 2011;2(2):178-184 www.ijmeg.org /ISSN:19481756/IJMEG1011005 18- Siddique I, Al-Mekhaizeem K, Alateeqi N, Memon A, Hasan F. Diagnosis of Helicobacter pylori: improving the sensitivity of CLOtest by increasing the number of gastric antral biopsies. J Clin Gastroenterol. 2008 Apr;42(4):356-60.


vol.2 No.4

ISSN 1858-6279

NMJ March 2012


‫العدد الرابع‬- ‫مجلة النيلين الطبية‬

vol.2 No.4

ISSN 1858-6279