JOURNAL OF BACTERIOLOGY, Nov. 2001, p. 6558–6564 0021-9193/01/$04.00⫹0 DOI: 10.1128/JB.183.22.6558–6564.2001 Copyright © 2001, American Society for Microbiology. All Rights Reserved.
Vol. 183, No. 22
Complementation of a Nonmotile flaB Mutant of Borrelia burgdorferi by Chromosomal Integration of a Plasmid Containing a Wild-Type flaB Allele MARINA L. SARTAKOVA,1 ELENA Y. DOBRIKOVA,1 M. ABDUL MOTALEB,2 HENRY P. GODFREY,3 NYLES W. CHARON,2 AND FELIPE C. CABELLO1* Departments of Microbiology and Immunology1 and Pathology,3 New York Medical College, Valhalla, New York 10595, and Department of Microbiology and Immunology, West Virginia University, Health Sciences Center, Morgantown, West Virginia 265062 Received 30 May 2001/Accepted 17 August 2001
With the recent identification of antibiotic resistance phenotypes, the use of reporter genes, the isolation of null mutants by insertional inactivation, and the development of extrachromosomal cloning vectors, genetic analysis of Borrelia burgdorferi is becoming a reality. A previously described nonmotile, rod-shaped, kanamycinresistant B. burgdorferi flaB::Km null mutant was complemented by electroporation with the erythromycin resistance plasmid pED3 (a pGK12 derivative) containing the wild-type flaB sequence and 366 bp upstream from its initiation codon. The resulting MS17 clone possessed erythromycin and kanamycin resistance, flat-wave morphology, and microscopic and macroscopic motility. Several other electroporations with plasmids containing wild-type flaB and various lengths (198, 366, or 762 bp) of sequence upstream from the flaB gene starting codon did not lead to functional restoration of the nonmotile flaB null mutant. DNA hybridization, PCR analysis, and sequencing indicated that the wild-type flaB gene in nonmotile clones was present in the introduced extrachromosomal plasmids, while the motile MS17 clone was a merodiploid containing single tandem chromosomal copies of mutated flaB::Km and wild-type flaB with a 366-bp sequence upstream from its starting codon. Complementation was thus achieved only when wild-type flaB was inserted into the borrelial chromosome. Several possible mechanisms for the failure of complementation for extrachromosomally located flaB are discussed.
inactivated and specific functions of genes clearly defined (19, 20, 24). The periplasmic flagella of B. burgdorferi contain a major filamentous protein, FlaB, and a minor protein, FlaA (15). Isolation of flaB null mutants of B. burgdorferi by allelic exchange with a flaB gene inactivated with a kanamycin resistance cassette insertion clearly defined the role of FlaB in motility and cell shape, since the flaB null mutant was completely nonmotile and was rod shaped (21). We have now extended this work by complementing the mutant flaB by using B. burgdorferi erythromycin resistance plasmid pGK12 derivatives. Integration of a wild-type flaB gene into the chromosome and expression of FlaB restored the motility and shape of the flaB null mutant and demonstrated that genetic complementation is possible in B. burgdorferi.
Genetic analysis of bacterial pathogens has been crucial for identifying and characterizing properties involved in their ability to produce disease and, when linked to in vivo and in vitro models of infection, has enabled the application of Koch’s molecular postulates to ascertain the role of specific gene products in disease production (11). This has opened the door for improved methods of prevention, diagnosis, and treatment of these infections (8, 22). Use of the fruitful combination of genomics and genetic methods to identify virulence genes in Borrelia burgdorferi has been delayed because this bacterium has not been amenable to genetic manipulation with methods widely used with other bacteria (6, 7, 30). There is therefore still a deficit of information regarding putative virulence genes in B. burgdorferi B31 even though several years have elapsed since the complete genomic DNA sequence of this bacterium was determined (12). The identification of kanamycin and erythromycin resistance as useful genetic markers in B. burgdorferi (4, 27), the isolation of null mutants of this bacterium (4), and the development of extrachromosomal cloning vectors (27, 29) suggest that the technical problems of analysis of putative virulence genes in this species may be nearing an end. Only recently have gene exchange systems in spirochetes progressed to the point where putative motility genes could be
MATERIALS AND METHODS Bacterial strains, growth conditions, and plasmids. B. burgdorferi B31 (ATCC 35210) and its flaB null mutant, flaB::Km, derived by insertion of a kanamycin resistance gene into the AgeI site of flaB (BB0147) (21), were grown at 32°C in Barbour-Stoenner-Kelly medium (Sigma Chemical Co., St. Louis, Mo.) supplemented with 7% rabbit sera (Sigma). Kanamycin (350 g/ml) was added to the medium when the flaB::Km mutant was grown. Although it was originally stated in a previous publication that the kanamycin cassette in this mutant was inserted in the direction opposite to transcription of flaB (21), further analysis has indicated that both genes have the same orientation. All PCR amplifications were performed in a rapid thermal cycler machine (Idaho Technology, Idaho Falls, Idaho) in the buffer supplied by the manufacturer with 2 mM MgCl2, 0.2 mM deoxynucleoside triphosphate, 0.5 M concentrations of each primer, and 0.25 U of Taq polymerase (Gibco-BRL, Gaithersburg, Md.) in a total volume of 10 l by using the primers and conditions presented in Table 1. Amplification products were purified by electrophoresis in 1% agarose (Seakem; FMC) and extraction
* Corresponding author. Mailing address: Department of Microbiology and Immunology, Basic Sciences Bldg., New York Medical College, Valhalla, NY 10595. Phone: (914) 594-4182. Fax: (914) 594-4176. E-mail:
[email protected]. 6558
COMPLEMENTATION OF A B. BURGDORFERI flaB MUTANT
VOL. 183, 2001
6559
TABLE 1. Primers and conditions used for PCR analysis Primer
Sequence 5⬘ to 3⬘
Paired with primer
Annealing temp (°C)a
Extension time(s)a
MCS1 MCS2 F1 F350 CM1 CM2 1 2 3 4 5 6 7 8 9 19 20 E3 E4
CCCCGGCTCGAGGTCGACGGb GCGGCCGGTCTAGAACTAGTGb CCATCGATTTTACCGTTAAGCGC ATCCCGGGAGATTGTCTGTCGCC GATAAAGATCTAGGAGGCATAT TAAAAAGCTTCTTGAACTAACG GCCTGCGCAATCATTGCCATTGC CTAGTGGGTACAGAATTAATCGAGC TGCAAAGGTTCTTGATGCTGAAAC TCATCGATAAGCCTGCATTATGC ACTAGCCTCAAAAGTTCTTCCTGC ATGAAGGAGAAAACTCACCGAGGC TAAAAAGCTTCTTGAACTAACG CTTCCCGGGATTAATATTGTAAGCTC GGATCGATTGTTAATACAATTTATACC CTGATGATGGCAAGTCGGAG ACGCCTATACCAGAAAGCCC TTGTCATTATTTTATCTATATTATG ACGTATATAGATTTCATAAAGCT
MCS2 MCS1 9 9 CM2 CM1 2 5 1 3 2 3 8 4 8 20 19 E4 E3
52 52 54 54 54 54 52 54 54 54 54 54 54 54 54 57 57 48 48
10 10 50 50 27 27 119 119 130 150 119 119 119 90 or 150 75 25 25 25 25
a PCR for a total of 37 cycles was done in a rapid thermal cycler (Idaho Technology) by using the following settings: denaturation at 95°C for 0 s, annealing at the indicated temperature for 0 s, and extension at 72°C for the indicated time. Primer pair F1 and 9 with a 50-s extension time, primer pair F350 and 9 with a 50-s extension time, and primer pair 8 and 4 with a 90-s extension time were used to generate the amplicons cloned into pED2, pED3, and pED4, respectively. b The HpaII restriction site is underlined.
with a QIAquick gel extraction kit (Qiagen, Santa Clara, Calif.) according to the manufacturer’s instructions. Plasmid pED1 was constructed by restriction of pGK12 with HpaII and insertion of a 97-bp PCR fragment from pBluescript II SK (5, 18). This fragment containing a multiple cloning site was amplified by using primers MCS1 and MCS2 (Table 1). Taking into account previous (13, 14, 15, 16, 28) and more recent (10) observations suggesting that the promoters of B. burgdorferi are similar to the 70 promoters of Escherichia coli and that DNA sequences upstream of the 70 promoters may play a role in gene expression in B. burgdorferi (28), we constructed three different recombinant plasmids from pED1 to ensure expression of wild-type flaB after electroporation. These plasmids contained the entire B. burgdorferi flaB gene (GenBank accession no. AE000783) and variable lengths of flaB upstream flanking region sequences cloned into the XcmI site of pED1. Plasmid pED2 had a 1,264-bp insertion containing a 198-bp sequence upstream from the flaB start codon and a 42-bp sequence downstream from the flaB stop codon, pED3 had a 1,429-bp insertion containing a 366-bp sequence upstream from the flaB starting codon and a 42-bp sequence downstream from the flaB stop codon, and pED4 had a 1,919-bp insertion containing a 762-bp sequence upstream from the flaB start codon and a 146-bp sequence downstream from the flaB stop codon. Amplicons for insertions were obtained by using the primers shown in Table 1. The correctness of the DNA sequence of 5⬘-flanking regions of flaB, including the promoter regions and flaB itself in pED2, pED3, and pED4, was confirmed by DNA sequencing (DNA Sequencing Facility, Columbia University Cancer Center, New York, N.Y.). Plasmids pED1, pED2, pED3, and pED4 were propagated in E. coli DH5␣, purified by using a Wizard Maxi-Purification kit in accordance with the manufacturer’s instructions (Promega, Madison, Wis.), resuspended in sterile TrisEDTA buffer, and used for electroporation. Electroporation of B. burgdorferi B31 and flaB::Km mutants with plasmid DNA. Wild-type B. burgdorferi flaB::Km and B31 were electroporated with 7 to 10 g of pED1, pED2, pED3, or pED4, and, after an 18 to 20 h recovery period, aliquots containing ca. 2 ⫻ 108 cells were plated onto 60-mm tissue culture dishes (27). Erythromycin (0.06 g/ml) and kanamycin (350 g/ml) were used for selection. Colonies of electroporant Borrelia organisms that appeared 2 to 4 weeks after plating were placed into liquid medium containing erythromycin (0.06 g/ml) and kanamycin (350 g/ml). Microscopic observation and motility assays. Cell morphology and motility were determined by using an Olympus Bx60 microscope equipped with a Plan phase-contrast objective (magnification, ⫻100; numerical aperture, 1.25), a DVC-1310C digital camera (Digital Video Camera Company, Inc., West Austin, Tex.), and XCAP-Lite software (EPIX, Inc., Buffalo Grove, Ill.). Motility of B. burgdorferi was also detected by spotting ca. 2.5 ⫻ 108, 5 ⫻ 108, and 10 ⫻ 108 cells on the center of 0.35% soft agar plates and observing the growing circle of opacity in the agar produced by the motile strains over the course of 5 days of culture. Southern hybridization and PCR analysis of electroporants. Plasmid DNA from nonmotile and motile B. burgdorferi electroporated with pED plasmids was
isolated by using a Plasmid Mini Kit (Qiagen) according to the manufacturer’s instructions. Total DNA from wild-type B. burgdorferi B31, flaB::Km mutant cells, and motile and nonmotile electroporants was isolated by phenol-chloroform extraction (17). Southern hybridization (26) was performed with a 720-bp DNA probe (27) generated by PCR by using primers CM1 and CM2 (Table 1) corresponding to the cm gene present in pED derivatives; it was labeled with digoxigenin (DIG DNA labeling and detection kit; Boehringer Mannheim, Indianapolis, Ind.). PCR analysis of clone MS17 was done by using the primers and PCR conditions shown in Table 1. The location of the primers used in this analysis are shown in Fig. 3. RT-PCR. Primers 1 and 2 (Table 1) were used to detect flaB mRNA in total RNA samples of wild-type B. burgdorferi B31, flaB::Km mutant cells, and motile and nonmotile electroporants by reverse transcription-PCR (RT-PCR) (Access RT-PCR system; Promega) according to the manufacturer’s instructions. Total RNA was isolated by extraction with guanidine thiocyanate-phenol-chloroform (9), treated with RQ1 RNase-free DNase (Promega) for 3 h at 37°C to eliminate any contaminating DNA, extracted with phenol-chloroform, and precipitated with ethanol. Control RT-PCRs in which reverse transcriptase was omitted were included to eliminate the possibility that residual DNA served as a template for the PCR. Immunoblotting. To detect FlaB, 108 cells of wild-type B. burgdorferi B31, flaB::Km mutants and motile and nonmotile electroporants were lysed and separated by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred electrolytically to Hybond ECL nitrocellulose membranes (Amersham Pharmacia) (26). Blots were incubated with monoclonal mouse antiFlaB H9724 antibody kindly provided by A. Barbour (3) and developed with horseradish peroxidase-conjugated goat anti-mouse immunoglobulin A (Sigma), ECL-Plus chemiluminescence technology, and Hyperfilm MP (Amersham Pharmacia). Competitive PCR. The copy number of pED3 in motile MS17 and nonmotile MS15 was estimated by using two competitors: a previously described pUC19 derivative containing bmpD with a 109-bp internal deletion (10) and a pGK12 derivative containing a 150-bp internal deletion in ermC. This latter competitor was constructed by digestion of pGK12 DNA with endonuclease BsiHKAI to cut at the two restriction sites in the ermC sequence. For bmpD quantitation, total DNA from MS17 (0.75 ng), twofold dilutions of bmpD competitor (highest dose, 2 pg), and primer pair 19 and 20 (Table 1) were used. For ermC quantitation, the total DNA from MS17 or MS15 (0.75 ng), twofold dilutions of ermC competitor, and primer pair E3 and E4 (Table 1) were used.
RESULTS AND DISCUSSION Phenotypic complementation of B. burgdorferi flaB::Km mutants. Electroporation of the flaB::Km null mutant with pED2, pED3, and pED4 generated 16 clones (6 clones containing
6560
SARTAKOVA ET AL.
J. BACTERIOL.
FIG. 1. Complementation of B. burgdorferi flaB::Km null mutant by electroporated pED plasmids containing wild-type flaB. (A) Wild-type B. burgdorferi B31 (motile) pleiomorphic spirochetes with flat-wave morphology. (B) B. burgdorferi flaB::Km null mutant (nonmotile) bacteria with rod-shaped morphology. (C) MS15 B. burgdorferi flaB::Km harboring extrachromosomal pED3(nonmotile) bacteria with rod-shaped morphology. (D) MS17 B. burgdorferi flaB::Km harboring chromosomal pED3 (motile) pleiomorphic spirochetes with flat-wave morphology.
pED2, 9 containing pED3, and 1 containing pED4) able to grow on plates with erythromycin and kanamycin. All of these clones were stable and resistant to both antibiotics in liquid medium. After two to three passages in selective medium, microscopic examination indicated that 15 of these clones con-
tained only nonmotile, rod-shaped organisms (Fig. 1C) similar to the rod-shaped, nonmotile flaB null mutants (Fig. 1B). Cells from a single clone electroporated with pED3, MS17, had a flat-wave morphology (Fig. 1D) similar to that of wild-type B. burgdorferi (Fig. 1A), and all were motile. Examination of the
VOL. 183, 2001
COMPLEMENTATION OF A B. BURGDORFERI flaB MUTANT
FIG. 2. Detection and localization of pED2, pED3, and pED4 in flaB::Km null mutant electroporants. (A) PCR amplification of flaB by using primers 1 and 2 (Table 1) from total DNA of wild-type B. burgdorferi B31 (Wt B31), B. burgdorferi flaB::Km (flaB), and motile MS17 and nonmotile MS15, MS34, and MS5 flaB::Km electroporants. B. burgdorferi flaB::Km electroporants contained pED3 (MS17, MS15), pED4 (MS34), and pED2 (MS5). The location of the primers is shown in Fig. 3B. (B) Southern hybridization with 720-bp cm DNA probe from plasmid pED1 of total DNA from wild-type B. burgdorferi B31 (Wt B31), B. burgdorferi fla::Km (flaB) and motile MS17 electroporant, and of plasmid DNA from motile MS17 and nonmotile MS15, MS34, and MS5 electroporants and pED3, pED4, and pED2. See Materials and Methods for details.
motility of different flaB::Km electroporants in 0.35% soft agar revealed that only MS17 demonstrated the same motility as wild-type B. burgdorferi B31 (ca. 10 mm in diameter after 5 days). Presence and location of pED2, pED3, and pED4 plasmid DNA sequences in motile and nonmotile flaB::Km electroporants. To determine why flaB::Km electroporants apparently harboring the flaB wild-type gene were not phenotypically complemented, total DNA of all electroporant clones was examined by PCR amplification with primers 1 and 2 designed to amplify flaB (Fig. 2A). All 16 clones yielded the expected two amplicons of 880 and 2,080 bp, with the smaller amplicon corresponding to the wild-type flaB in the plasmids and the larger amplicon corresponding to the flaB::Km mutant with its kanamycin resistance cassette insertion (Fig. 2A). These results were consistent with the presence of pED2, pED3, and pED4 within nonmotile, as well as motile, electroporants and indicated that the lack of motility was not due to the absence of the wild-type flaB allele because of a failure of electroporation. To determine the location of the electroporated plasmid
6561
DNA, plasmid DNA isolated from nonmotile and motile B. burgdorferi electroporants and total DNA isolated from wildtype B. burgdorferi B31, flaB::Km mutant cells and motile and nonmotile electroporants were analyzed by Southern hybridization by using the plasmid-specific cm probe. Hybridization signals obtained in nonmotile clones MS15, MS34, and MS5 corresponded to extrachromosomal plasmid DNA of the same size as the pED3, pED4, and pED2 plasmids used for electroporation (Fig. 2B). In contrast, in the motile electroporant that contained pED3 (MS17), the positive signal comigrated with large chromosomal DNA and not with plasmid DNA (Fig. 2B). These results suggested integration of pED3 into the borrelial chromosome in clone MS17. Genetic structure of the chromosome region containing the flaB null mutant and pED3 insertion. A diagram of the postulated pED3 integration into the borrelial chromosome in MS17 is shown in Fig. 3B. PCR amplification of total DNA from MS17 with primers 1 and 3 (Fig. 3A, lane 1), primers 3 and 4 (Fig. 3A, lane 2), or primers 3 and 6 (Fig. 3A, lane 4) generated amplicons of ca. 3,209, 3,442, and 2,496 bp, confirming that MS17 contained the unmodified inactivated flaB gene with a kanamycin insertion at the flaB AgeI site of the original flaB::Km mutant. Localization of this inactivated flaB was further confirmed by using primers 2 and 5 to generate a 2,727-bp amplicon from MS17 total DNA (Fig. 3A, lane 3), appreciably larger than the 1,557-bp amplicon generated by these primers from B. burgdorferi B31 total DNA (data not shown). Additional supporting evidence for chromosomal integration of pED3 in MS17 was obtained by amplification of MS17 total DNA by using primers 7 and 8 to generate an amplicon of 2,702 bp (Fig. 3A, lane 5) and by using primers 8 and 9 to generate an amplicon of 1,807 bp (Fig. 3A, lane 7). As expected, because of the length of the potential amplicon (ca. 9,150 kb), amplification of total DNA of MS17 by using primers 4 and 8 under conditions shown in Table 1 failed to generate any amplicons (Fig. 3A, lane 6), while amplification of total DNA from the original flaB::Km mutant by using primers 4 and 8 and primers 8 and 9 generated amplicons of the expected size (data not shown). These results are consistent with recombination of pED3 into the chromosome of flaB::Km mutant by a single crossover event into the mutated flaB to the right of the kanamycin insertion, creating a merodiploid that contained both inactivated and wild-type genes. This was directly confirmed by DNA sequencing (data not shown) of PCR amplicons generated by using primers 3 and 6 and primers 7 and 8 (Fig. 3B). Expression of the flaB gene in complemented and noncomplemented derivatives of flaB::Km mutant. Complementation of flaB in MS17 was associated with the production of flaB mRNA and the production of FlaB protein. RT-PCR of total RNA by using primers 1 and 2 (Table 1) indicated that flaB mRNA was not detected in the flaB::Km mutant (Fig. 4A, lane 2). In clones MS5, MS15, and MS34 harboring extrachromosomal flaB in pED2, pED3, and pED4, respectively, there was considerably less flaB mRNA expressed (Fig. 4A, lanes 3, 4, and 6) than in wild-type B. burgdorferi B31 or in MS17 (Fig. 4A, lanes 1 and 5). Control reactions, in which reverse transcriptase was omitted, produced no amplicons, eliminating the possibility that residual DNA served as a template for PCR in any of the reactions. Immunoblotting of borrelial cell proteins de-
6562
SARTAKOVA ET AL.
J. BACTERIOL.
FIG. 3. PCR amplification and proposed genetic structure of the chromosomal region of the motile merodiploid derivative of B. burgdorferi flaB::Km null mutant containing chromosomally inserted pED3. (A) PCR amplification of total DNA. Lane 1, primers 1 and 3; lane 2, primers 3 and 4; lane 3, primers 2 and 4; lane 4, primers 3 and 6; lane 5, primers 7 and 8; lane 6, primers 4 and 8; lane 7, primers 8 and 9. See Table 1 for primer sequences and panel B for primer locations. (B) Proposed mechanism and location of pED3 insertion into B. burgdorferi chromosome in MS17. (i) Chromosome of B. burgdorferi flaB::Km containing flaB interrupted by a kanamycin cassette. (ii) Chromosome of merodiploid MS17 containing flaB interrupted by a kanamycin cassette and wild-type flaB. Arrows and numbers in diagrams i and ii correspond to primers used for PCR. Primer 5 is located within proV (BB0146). Primer 4 is located in the intergenic region between proV and flaB (BB0147), 146 nucleotides downstream from the flaB stop codon. Primer 8 is located within fliD (BB0149).
tected a 41-kDa FlaB protein only in B. burgdorferi B31 (Fig. 4B, lane 1) and MS17 (Fig. 4B, lane 5). Thus, restoration of the flat-wave morphology and motility of the flaB::Km mutant and synthesis of flaB mRNA and FlaB protein occurred only in the MS17 merodiploid containing pED3 inserted in the B. burgdorferi chromosome. The relative lack of flaB mRNA expression and the absence of FlaB in MS15 compared to MS17 was associated with a loss of plasmid in B. burgdorferi MS15 compared to MS17. There were equivalent amounts of pED3 (0.33 pg of ermC/ng of total DNA) and the chromosomally located bmpD gene DNA (0.33 pg of bmpD/ng of total DNA) in B. burgdorferi MS17, a finding consistent with the presence of a similar number of copies of pED3 and bmpD per chromosome in this strain. In contrast, MS15 contained fourfold-less ermC DNA (0.083 pg of ermC/ng of total DNA) than was present in MS17, a finding consistent with a fourfold decrease of pED3 copies per chromosome equivalent. The complementation of the B. burgdorferi flaB null mutant described here indicates that genetic complementation can now be applied to study the putative function of any gene in B. burgdorferi and opens the way to analyze gene function in this
FIG. 4. Analysis of flaB gene expression in wild-type B. burgdorferi B31 (Wt B31), the B. burgdorferi flaB::Km null mutant (flaB), and nonmotile MS5, MS15, MS34, and motile MS17 electroporants. (A) RT-PCR with primers 1 and 2. (B) Immunoblot with mouse monoclonal anti-flaB.
VOL. 183, 2001
COMPLEMENTATION OF A B. BURGDORFERI flaB MUTANT
pathogen in fulfillment of Koch’s molecular postulates (11). The success of these studies rests on the use of kanamycin and erythromycin antibiotic resistance as selective markers in B. burgdorferi, the development of methods to introduce insertionally inactivated genes into the B. burgdorferi chromosome, and the design of compatible extrachromosomal vectors for this pathogen (4, 27, 29). Interestingly, we obtained complementation of the flaB defect only in cis when the pED3 plasmid was integrated into the chromosome of the mutant generating a merodiploid. Derivatives harboring unintegrated plasmids with extrachromosomal flaB were not complemented by the wild-type flaB gene. The genetic structure of the MS17 flaB merodiploid suggests that null mutants could be introduced into the chromosome of B. burgdorferi by merodiploid generation, followed by counterselection to detect derivatives that have lost the plasmid, leaving behind the inactivated gene (25). Analysis of the genetic structure of the MS17 merodiploid strongly suggests that it was generated by a single crossover facilitated by the DNA homology provided by the mutated flaB in the chromosome and the wild-type flaB in the plasmid. It is not clear whether the insertion of pED3 is influenced in some manner by the length of its 5⬘ upstream promoter region, but the single crossover between the wild-type flaB and its mutated counterpart took place in the DNA region corresponding to the start of the gene. The fact that the total length of the cloned flaB insertion present in pED3 is intermediate in length to the insertions present in the plasmids that did not recombine into the chromosome (pED2 and pED4) could suggest that the length of the insertion in pED3 could positively influence the frequency of recombination. Analysis of flaB expression by RT-PCR and immunoblotting in different derivatives of the B. burgdorferi flaB null mutant indicated that the only derivative capable of synthesis of large amounts of flaB mRNA and FlaB protein (comparable to wild-type B31) was the MS17 merodiploid containing pED3 with flaB inserted into the chromosome. The decreased expression of wild-type flaB in the MS15 derivative containing extrachromosomal pED3 compared to its expression in the MS17 derivative with chromosomal pED3 strongly suggests that flaB expression is linked to its chromosomal location rather than to the length of the 5⬘ upstream promoter region in the construct. This hypothesis is supported by the fact that the MS34 derivative harboring extrachromosomal pED4 with a larger upstream promoter region was not complemented and lacked flaB expression. The decreased levels of flaB mRNA and FlaB in pED derivatives harboring extrachromosomal flaB compared to the derivative in which the gene was chromosomally inserted is consistent with the observed decreased copy number of pED3 in MS15 compared with MS17. Reports consistent with our current observations suggest that plasmids such as pGK12 and its pED derivatives which replicate by the rolling circle model become unstable as the size of the cloned insert increases (2). These findings could also be explained by hypothesizing that the expression of flaB from the extrachromosomal location produces amounts of FlaB that are deleterious to B. burgdorferi, and subsequent passages in medium with antibiotic select for pED3 mutants with a lower copy number expressing decreased amounts of FlaB (23). FlaB is likely to complex with a
6563
chaperone protein (FlaJ) before it is transported to the periplasmic space and assembled on the growing filament (1); an excess of FlaB could result in its polymerization in the cytoplasm. In addition, because the fourfold decrease in pED3 copy number in B. burgdorferi MS15 compared to MS17 would not appear to be sufficient to explain the drastic decrease in flaB mRNA and the lack of FlaB expression in MS15, it could also be hypothesized that transcriptional and posttranscriptional regulatory mechanisms triggered by the expression of flaB from the extrachromosomal location might also down regulate its expression (16). Our own unpublished results (M. A. Motaleb and N. W. Charon, unpublished observations) indicate that complementation of other null mutants of B. burgdorferi can be achieved by using wild-type alleles presented in extrachromosomal pGK12 derivatives and suggest that the present findings are not relevant to the complementation of every gene in B. burgdorferi. In summary, we have complemented a B. burgdorferi flaB null mutant by insertion of a plasmid containing the wild-type flaB and a 366-bp segment of DNA upstream from its starting codon into the B. burgdorferi chromosome to create a merodiploid. Our experiments also indicate that these merodiploids could be used to study regulation of gene expression in this pathogen, as well as for further genetic manipulation. ACKNOWLEDGMENTS We thank A. G. Barbour for kindly providing us with mouse monoclonal anti-FlaB H9724 antibody, I. Schwartz and S. A. Newman for their assistance and encouragement, Harriett V. Harrison for assistance in manuscript preparation, and D. Ketton for critical comments. This work was supported by Public Health Service grants AI43063 to F.C.C. and AI29743 to N.W.C. REFERENCES 1. Auvray, F., J. Thomas, G. M. Fraser, and C. Hughes. 2001. Flagellin polymerization control by a cytosolic export chaperone. J. Mol. Biol. 308:221– 229. 2. Ballester, S., P. Lopez, M. Espinosa, C. Alonso, and S. A. Lacks. 1989. Plasmid structural instability associated with pC194 replication functions. J. Bacteriol. 171:2271–2277. 3. Barbour, A. G., S. F. Hayes, R. A. Heiland, M. E. Schrumpf, and S. L. Tessier. 1986. A Borrelia-specific monoclonal antibody binds to a flagellar epitope. Infect. Immun. 52:549–554. 4. Bono, J. L., A. F. Elias, J. J. Kupko, III, B. Stevenson, K. Tilly, and P. Rosa. 2000. Efficient targeted mutagenesis in Borrelia burgdorferi. J. Bacteriol. 182: 2445–2452. 5. Borovkov, A. Y., and M. L. Rivkin. 1997. XcmI-containing vector for direct cloning of PCR products. BioTechniques 22:812–814. 6. Cabello, F. C., M. L. Sartakova, and E. Y. Dobrikova. 2001. Genetic manipulation of spirochetes—light at the end of the tunnel. Trends Microbiol. 9:245–248. 7. Casjens, S. 2000. Borrelia genomes in the year 2000. J. Mol. Microbiol. Biotechnol. 2:401–410. 8. Chiang, S. L., J. J. Mekalanos, and D. W. Holden. 1999. In vivo genetic analysis of bacterial virulence. Annu. Rev. Microbiol. 53:129–154. 9. Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156–159. 10. Dobrikova, E. Y., J. Bugrysheva, and F. C. Cabello. 2001. Two independent transcriptional units control the complex and simultaneous expression of the bmp paralogous chromosomal gene family in Borrelia burgdorferi. Mol. Microbiol. 39:370–378. 11. Falkow, S. 1988. Molecular Koch’s postulates applied to microbial pathogenicity. Rev. Infect. Dis. 10(Suppl. 2):S274–S276. 12. Fraser, C. M., S. Casjens, W. M. Huang, G. G. Sutton, R. Clayton, R. Lathigra, O. White, K. A. Ketchum, R. Dodson, E. K. Hickey, M. Gwinn, B. Dougherty, J.-F. Tomb, R. D. Fleischmann, D. Richardson, J. Peterson, A. R. Kerlavage, J. Quackenbush, S. Salzberg, M. Hanson, R. van Vugt, N. Palmer, M. D. Adams, J. Gocayne, J. Weidman, T. Utterback, L. Watthey, L. McDonald, P. Artiach, C. Bowman, S. Garland, C. Fujii, M. D. Cotton, K. Horst, K. Roberts, B. Hatch, H. O. Smith, and J. C. Venter. 1997. Genomic
6564
13. 14. 15. 16.
17. 18. 19. 20. 21.
SARTAKOVA ET AL.
sequence of a Lyme disease spirochaete, Borrelia burgdorferi. Nature 390: 580–586. Ge, Y., I. G. Old, I. Saint Girons, and N. W. Charon. 1997. Molecular characterization of a large Borrelia burgdorferi motility operon which is initiated by a consensus 70 promoter. J. Bacteriol. 179:2289–2299. Ge, Y., I. G. Old, I. Saint Girons, and N. W. Charon. 1997. The flgK motility operon of Borrelia burgdorferi is initiated by a 70-like promoter. Microbiology 143:1681–1690. Ge, Y., C. Li, L. Corum, C. A. Slaughter, and N. W. Charon. 1998. Structure and expression of the FlaA periplasmic flagellar protein of Borrelia burgdorferi. J. Bacteriol. 180:2418–2425. Heinzerling, H. F., M. Olivares, and R. A. Burne. 1998. Genetic and transcriptional analysis of flgB flagellar operon constituents in the oral spirochete Treponema denticola and their heterologous expression in enteric bacteria. Infect. Immun. 65:2041–2051. Hinnebusch, J., and A. G. Barbour. 1992. Linear- and circular-plasmid copy numbers in Borrelia burgdorferi. J. Bacteriol. 174:5251–5257. Kok, J., J. M. B. M. van der Vossen, and G. Venema. 1984. Construction of plasmid cloning vectors for lactic streptococci which also replicate in Bacillus subtilis and Escherichia coli. Appl. Environ. Microbiol. 48:726–731. Li, C., L. Corum, D. Morgan, E. L. Rosey, T. Stanton, and N. W. Charon. 2000. The spirochete FlaA periplasmic flagellar sheath protein impacts flagellar helicity. J. Bacteriol. 182:698–6706. Li, C., M. A. Motaleb, M. Sal, S. F. Goldstein, and N. W. Charon. 2000. Spirochete periplasmic flagella and motility. J. Mol. Microbiol. Biotechnol. 2:345–354. Motaleb, M. A., L. Corum, J. L. Bono, A. F. Elias, P. Rosa, D. S. Samuels, and N. W. Charon. 2000. Borrelia burgdorferi periplasmic flagella have both
J. BACTERIOL. skeletal and motility functions. Proc. Natl. Acad. Sci. USA 97:10899–10904. 22. Nordstrand, A., A. G. Barbour, and S. Bergstro ¨m. 2000. Borrelia pathogenesis research in the post-genomic and post-vaccine era. Curr. Opin. Microbiol. 3:86–92. 23. Paulsson, J., and M. Ehrenberg. 1998. Trade-off between segregational stability and metabolic burden: a mathematical model of plasmid ColE1 replication control. J. Mol. Biol. 279:73–88. 24. Picardeau, M., A. Brenot, and I. Saint Girons. 2001. First evidence for gene replacement in Leptospira spp. Inactivation of L. biflexa flaB results in nonmotile mutants deficient in endoflagella. Mol. Microbiol. 40:189–199. 25. Reyrat, J.-M., V. Pelicic, B. Gicquel, and R. Rappuoli. 1998. Counterselectable markers: untapped tools for bacterial genetics and pathogenesis. Infect. Immun. 66:4011–4017. 26. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Plainview, N.Y. 27. Sartakova, M., E. Dobrikova, and F. C. Cabello. 2000. Development of an extrachromosomal cloning vector system for use in Borrelia burgdorferi. Proc. Natl. Acad. Sci. USA 97:4850–4855. 28. Sohaskey, C. D., W. R. Zu ¨ckert, and A. G. Barbour. 1999. The extended promoters for two outer membrane lipoprotein genes of Borrelia spp. uniquely include a T-rich region. Mol. Microbiol. 33:41–51. 29. Stewart, P., R. Thalken, J. Bono, and P. Rosa. 2001. Isolation of a circular plasmid region sufficient for autonomous replication and transformation of infectious Borrelia burgdorferi. Mol. Microbiol. 39:714–721. 30. Tilly, K., A. F. Elias, J. L. Bono, P. Stewart, and P. Rosa. 2000. DNA exchange and insertional inactivation in spirochetes. J. Mol. Microbiol. Biotechnol. 2:433–442.
