Complete Nucleotide Sequence of cDNA and Deduced Amino Acid ...

THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1987 by The American Society of Biological Chemists, Inc.

Val. 262, No. 13, Issue of May 5, pp. 6280-6283,1987 Printed in U.S.A .

Complete Nucleotide Sequence of cDNA and Deduced Amino Acid Sequence of Rat Liver Arginase* (Received for publication, December 29,1986)

Susumu Kawarnotoztll,Yoshihiro Amayaz, Kaoru Murakamiz, Fuminori Tokunagall , Sadaaki Iwanagall , Keiko Kobayashi**,Takeyori Saheki**, Sadao KimuraB, and Masataka Moriz From the $Institute for Medical Genetics, Kumamoto University Medical School, Kumamoto 862, Japan, the §Departmentof Bacteriology, Teikyo UniversitySchool of Medicine, Itabashi-ku, Tokyo 173, Japan, the 11 Department of Biology, Faculty of Science, Kywhu University, Fukwka 812, Japan, and the **Department of Biochemistry, School of Medicine, Kagoshima University, Kagoshima 890, Japan

Arginase (EC 3.5.3.1) catalyzes the last step of urea synthesis in the liver of ureotelic animals. The nucleotide sequence of rat liver arginase cDNA, which was isolated previously (Kawamoto, S., Amaya, Y., Oda, T., Kuzumi, T., Saheki, T., Kimura, S., and Mori, M. (1986) Biochem. Biophys. Res. Commun. 136, 955961) was determined. An open reading frame was identified and was found to encode a polypeptide of 323 amino acid residues with a predicted molecular weight of 34,925. The cDNA included 26 base pairs of 5‘untranslated sequence and 403 base pairs of 3’-untranslated sequence, including 12 base pairs of poly(A) tract. The NH,-terminal amino acid sequence, and the sequences of two internal peptide fragments, determined by aminoacid sequencing, were identical to the sequences predicted from the cDNA. Comparisonof the deduced amino acid sequence of the rat liver arginase with that of the yeast enzyme revealed a 40%homology.

Arginase(L-arginine amidinohydrolase, EC 3.5.3.1) is an enzyme present in theliver of ureotelic animals andcatalyzes thefinalstep of ureasynthesis. Almost allthearginase activity in the ratliver is attributed to the peptide of trimer (1) or tetramer (2) of subunits of M , = 30,000-40,000. The heterogeneity of the enzyme has been noted in the liver (3,4) and other tissues (4). Coordinated synthesis of urea cycle enzymes, including arginase, as stimulated by high protein diets (5) or hormones (6), andthecoordinatedinduction profile of urea cycle enzymes during the postpartum period have been reported (7). We isolated cDNA clones for rat liver arginase (8). Dizikes et al. (9) also isolated a rat liver arginase cDNA, the length of which is less than half that of our clone. Molecular cloning of thecDNA sequence forarginaseshouldfacilitatefurther studies on dietary, hormonal, and developmental regulation of arginase gene expression, genetic analysis of the isozymes, * This work was supported inpart by Grants-in-Aid 61228014 and 60127010 (to M. M.) from the Ministry of Education, Science and Culture in Japan. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. The nucleotide sequence(s) reported in thispaper has been submitted to the GenBankTM/EMBL Data Bank with accession numberfs) 02720. (I To whom correspondence should be addressed Dept. of Bacteriology, Yokohama City University School of Medicine, 3-9 Fukuura, Kanazawa-ku, Yokohama 236, Japan.

and argininemia, a deficiency of the enzyme in the human liver. Inthepresentreport, we presenttheentire nucleotide sequence of cDNA for rat liver arginase and the complete amino acidsequence, as predicted from the nucleotidesequence. The amino acid sequence of the rat arginase is 40% homologous with that of the yeastenzyme (10). EXPERIMENTAL PROCEDURES’ RESULTSANDDISCUSSION

Nucleotide Sequence and Deduced Amino Acid Sequenceof Rat Liver Arginase cDNA-Fig. 1 (see Miniprint) showsa partial restriction map and the sequence analysis strategy of the plasmid pARGr-2 encoding rat liver arginase (8). The cDNA was cloned using an expression vector pUC8 ( l l ) , a n d the bacterial clone possessing the plasmid had a high level of arginase activity (8). The cDNA insert of pARGr-2 was sequenced accordingto the strategy involving useof the dideoxy technique (12). The sequence was determined on both strands of the cDNA,crossing restriction fragment junctures. Thedetermined nucleotidesequence andthepredicted amino acid sequence are shown in Fig. 2. The cDNA clone pARGr-2 contained 1398 nucleotides, including 12 bases of poly(A). The 5”noncoding region of 26 nucleotides was present. The translation initiation site was assigned to the methionine codon ATG at nucleotide positions 1-3. The possibility that the methionine codon ATG at nucleotide positions -6-3 isthetranslationinitiationsite was excluded by the following lines of evidence. First, the predicted NH2-terminal sequence starting from nucleotide position 1 is identical to the sequence (19 amino acid residues) determined by peptide sequencing of purified rat liver arginase (see below). Second, the nucleotide sequence of rat liver arginase cDNA at the NH’-terminal portion has a high homology with that of human liver arginase cDNA, which was cloned and sequenced,’ and the predicted NH2-terminal aminoacid sequence of human liver arginase is highly homologous to that of the rat Portions of this paper (including “ExperimentalProcedures,” Figs. 1, 3, and 5, and Tables I and 11) are presented in miniprint at the end of this paper. The abbreviation used is: HPLC, high performance liquid chromatography. Miniprint is easily read with the aid of a standard magnifying glass. Full size photocopies are available from the Journal of Biological Chemistry, 9650 Rockville Pike, Bethesda, MD20814. Request Document No. 86M 4446, cite author(s), and include a check or money order for $4.00 per set of photocopies. Full size photocopies are also included in the microfilm edition of the Journal that is available from Waverly Press. ’Y. Haraguchi,M. Takiguchi,Y. Amaya, S. Kawamoto, I. Matsuda, and M. Mori, unpublished results.

6280

Sequence of Rat Liver Arginase cDNA

enzyme. Human cDNA has no initiation methionine codon ATG upstreamof the position. Third, thenucleotide sequence IO 20 30 40 50 60 (-9 T G G a G A G C m A 4)surroundingtheATG codon ATCACCTCCAACCCAAAGCCCATAGACATTATCGCAGCCCCTTTCTCTAACGCACAGCCT M a I S a r S s r L y r P r o L y r P r o l l ~ G l u l l a l l . C L ~ A l a P r ~ P h a S a r L y s C l y C ~ n P r o a t nucleotide positions 1-3 (here underlined)agrees well with theconsensusinitiation sequence sinceanadenine(here 70 80 90 IO0 I LO I20 CCAGCACGCGTACAGAAAGGTCCCGCAGCATTAAGCAAAGCTCCCCTCCTCCACAAGCTT doubly underlined) is found in position -3 (13),butthe Ar~GlyCIyV~LCluLysCI~Pr~AI~AI~L~uA~gLyrAIaCIyLauVaICIuLysL~u sequence surrounding the ATGcodon a t nucleotide positions 170 160 I 80 130 150 140 -6--3 (here wavy underlined) does not. From the initiation AAACAAACACACTACAATGTCAGACACCACGCGGATCTCCCCTTTGTCGATCTCCCCAAT L y s G l u T h r C l u T y r A r n V ~ l A r ~ A ~ p H l r C L y A s ~ L a u A l a P h a V a l A s p V a l P r o A ~ n methionine ATG codon to the TAA termination codon (nucleotide l-969), 969 base pairs of anopen reading frame 190 200220 210 230 240 CACACCCCCTTTCAAATTGTCAACAACCCACGCTCTGTCCGAAAAGCCAATCAACAGCTG coding for 323 amino acidswere determined. The 3’-noncod~~p~~rProPhaGlnIlaValLysArnPrDArlSarVaICIyLy~AI~ASnCIuGI~L~u ing region contained 403 base pairs. A consensus polyade250 290 260280 270 300 nylylation signal AATAAA (14) (nucleotides 1344-1349), is CCTCCTGTCCTACCACAGACCCACAACAATCGAACAATCAGTCTCCTCCTCGCTCCACAC A 1 a A 1 a V ~ I V a l A 1 a G L u T h r G l n L y s A s n G l y T h r I ~ e S a r V ~ l V a l L ~ u G l y G l y A s p located12nucleotides upstream of the poly(A) tract. The sequence AATAAA isalsopresent a t nucleotide positions 310 320 330 340 350 360 CACACTATGCCAATTCCAAGCATCTCTGGCCACGCCAGGGTCCACCCTGACCTATCCCTC 968-973, which is the translation termination site.However, HlrSarM~lALaIlsGlySsrllaS~rGlyHlsAl~Ar~Va~HlsProAspLauCysVal this sequence does not appear to function as the polyadenyl370 380 390 400 410 420 ylation signal,becauseonlyasingle mRNA species of 1.6 ATTTGGCTGGATCCTCACACTCACATCAACACTCCCCTGACAACCACCTCTCCGAATCTC IIeTrpVaIArpAI~HlsThrArpIIsAsnThrProLauThrThrSarSarCLyArnLeu kilobases was detected in ratliver by Northern blot analysis (8). This 3’-noncodingregion is A+T-rich (62%), resembling 430 440 450 460 470 480 CACCCGCAACCCGTGGCCTTTCTCCTCAACTGAACTGAAAGCAAAGTTCCCACATGTACCA many othereucaryotic mRNAs with tracts of 4 or more AS or HlrGLyGlnPr~V~IA1~PhaLauLsuLyrCluLauLYrCIyLysPh~Pr~A~pVaIPro Ts scattered throughout. As the size of the mRNA for rat 500 540 5 1 0530 520 490 liver arginase was estimated by Northern analysis tobe 1600 CCATTCTCCTCGCTCACCCCCTGCATATCTGCCAACGACATCCTCTACATCCCCTTCCCA C l y P h a S e r T r p V ~ L T h r P r o C y s I l ~ S ~ r A ~ ~ L ~ ~ A ~ p I ~ ~ V ~ ~ T ~ bases r l l ~ G(8), l y Lthe ~ u AcDNA r~ insert of 1398 base pairs is expected to 580 550570 560 600 cover about 90% of the complete mRNA. CATGTCGACCCTCCCCAACACTATATAATAAAAACTCTGCCCATTAACTATTTCTCAATG A r p V a L A r p P r ~ G l y C L u H I s T y r I I ~ l l e L y r T h ~ L ~ u G I y I I a L y s T y r P h a S o ~ M n I Based on the nucleotide sequence of the cDNA, the 323 amino acid sequence of rat liver arginase was deduced (Fig. 610 620 630 640 650 660 2). The molecular weight of the enzyme was calculated to be ACTGAAGTGCACAAGCTGGCAATTGCCAAAGTGATCCAAGAGACCTTCACCTACCTGCTG T h r G L u V a L A s p L y r L a u G l y I l ~ G ~ y L y s V ~ ~ M e l G l u G ~ u T h r P h e S ~ r T y r L ~ u34,925, L~u including the initiation methionine. This value is in 610 680 690 100 110 120 agreement with the values (Mr= 30,000-40,000) determined CCAAGCAAGAAAACCCCCATTCACCTCAGTTTTGATGTTCATCCACTCCACCCACTATTC by physical methods (1, 2). ClyAr~LyrLyrArgProIleHlsLauSsrPheArpVaIA~pGIyLauAcpProVaIPhe Amino Acid Composition and Partial Amino Acid Sequence 780 130 140 150 760 170 ACCCCGCCTACGGGCACACCCCTTGTCGGAGGCCTATCTTACACACAACGTCTCTACATC of Rat Liver Arginase-Rat liver arginase was purified accord~ ~ ~ p ~ o ~ ~ ~ T h r G l y T h r P r ~ V ~ ~ V ~ ~ G ~ y G ~ Y L s u S e r T y r A r ~ C ~ u C ~ y L ~ u T ~ r 1 ~ ~ ing to Schimke(15). On polyacrylamide gel electrophoresis in 190 800 810 820 830 840 sodium dodecyl sulfate it migrated as a single protein band ACACAAGAAATTTACAAGACACGGCTACTTTCACGACTAGATATCATGCAAGTGAACCCA ~ h r G l u C l u l l s T y r L y s T h r G l ~ L ~ u L ~ ~ S ~ ~ ~ l Y L e u A s ~ l l ~ M ~ l C ~ uwith V a l AM sn , P=r ~37,000. The amino acid composition of rat liver 900 arginase is in close agreement with that predicted from the 850 860 810 880 890 ACTCTTGGCAACACACCAGAGGAGGTGACTCGTACTCTCAACACCCCACTCCCGTTCACC nucleotide sequence (Table I (see Miniprint)). The numberof ThrLsuGlyLyrThrPr~GLuCluVnlThrArgThrV~lA~nThrAlaValProLnuThr proline residues, determined from the purified enzyme, was 910 920 930 940 950 960 slightly less than those predicted from the cDNA sequence. TTCTCTTGTTTTCGAACGAAACGGGAAGCTAATCATAAGCCACACACTCACTACCTTAAA L ~ u S e r C y r P h s G 1 y T h r L y r A r s C l u G 1 y A s n l l l r L y r P r o G l u T h r A r p T y r L ~ u L Y s The COOH-terminal end, which is proline-rich, of the arginase mighthave been cleavedby carboxypeptidase during the 910 CCACCCAAATAAATGTGAATACATCGCATAAAACTCATCTGCGGCATCACACCAAACCCA purification procedures. The number of charged amino acid ProProLys*** residues predicted from the cDNA (Asp + Glu = 37 uersus Lys + Arg = 37, and His = 8 ) is consistent with the basic ACAGAACCACGCCAACCCTGCTCCTCCCAAGGGCTTCTTCTTTTACAAAAAACAATCTTT nature of the enzyme, as suggested by physical analyses (15). To confirm the position of the translation initiation site TTTCCCAATATCTATCTATTCTAGCACTTCCTTTCTGGAATCAAATTCACCCTGTCCCAA and the reading frameof the cDNA sequence, we determined the amino acid sequence of the NH, terminus of rat liver arginase (TableI1 (see Miniprint)). A major and a minor peak TTAAAACAGCTATGAAATTACGAGACACGTACTTCCCATTTTACCACAACTTATCCTTAA of the amino acid derivatives were observed in each cycle of theEdmandegradation.The sequencededucedfrom the CAAGTACTATAAATTAATATCTAATTAAAAAATGCACCACCAGTTAAAATACACACTCAT majorpeak in each cycle coincidedwith that predicted at nucleotide positions 4-57 (Fig. 2), whereas the sequence from the minor peak coincided with that predicted at nucleotide CTCAAGTCTCAACTCACCCTTGGAACCAAAGGCATCTCGAGACCACCCCTCCATCCACCT positions 1-45. These results indicate that the cDNA clone pARGr-2 is that for rat liver arginase and that the translation CCTTCAAAACATCTCATTTTTCT=CTCTTTATAATAAAAAAAAAAAA 1312 initiates from the methionine a t nucleotide positions at 1-3, FIG. 2. Nucleotide sequence of rat liver arginase cDNA although a large portion of the initiation methionine might (pARGr-2) and its deduced amino acid sequence. Nucleotides be cleaved, either in vivo or during isolation. Moreover, to are numbered in the 5’ to 3’ direction, beginning with the 1stresidue confirm the internalsequence of rat liver arginase, theenzyme of the ATG triplet encoding the initiation methionine, andthe was digestedwith lysyl endopeptidase and the digest was nucleotides on the 5’ side of residue 1 are indicated by negative numbers. The putative polyadenylylation signal, AATAAA, is doubly purified using high performance liquid chromatography. (Fig. underlined. The stop codon is represented by *::. The deduced amino 3 (see Miniprint)). The NH,-terminal sequences of the two acid sequence is indicated below the nucleotide triplet. The three lysyl peptides, K-23 and K-24, which are shown in Table 11, peptide sequences determined by Edman degradation are underlined. agreed completely with those predicted from the cDNA se-26

590

6281

CTCACCTCCACCAACCCTGCATGACC

6282


Yeast Rat Yeast Rat Yeast Rat

101-150: 79-128:

L V Y N S V S K V V Q A N R F P L T L G G D H S I A I G T V S A V L D K Y P D A G L L W I D A H A D Q L A A V U A E T Q K N G T I S V V \ G l M H ] S I i G H A R V H U L C V I ~ V ~

Yeast Rat Yeast Rat Yeast Rat

251-300: 227-276:

no n

D M C [ Y ( O l V m L Y I m R v l T L V I F L VIYR L A E S G N L I A L D V V 1 H L S F D V D G L D P V F T P A T G T P V V . G G L S Y R E G L Y I T E E I Y K T G L L S G L D I M

Yeast Rat

FIG. 4. Comparison of amino acid sequence of rat liver arginase with that of yeast arginase. Amino acid sequence of rat liver arginase is from Fig. 2,and thatof yeast enzyme is from Sumrada and Cooper (10).Gaps (-) were introduced to increase the similarity, and matching amino acids are boxed.

quences at nucleotide positions 517-573 and 124-171, respectively (Fig. 2). Sequence Comparison with Yeast Arginase-The nucleotide sequence of Saccharomyces cerevisiae arginase gene CAR1 has been determined, and the amino acid sequenceof the arginase protein was predicted (10). The amino acid sequence of rat liver arginase, which contains 323 amino acids, was compared with that of the yeast enzyme,which contains 333 amino acids (Fig. 4).Four gaps were introduced in the ratenzyme to increase the similarity. There was a 40% identity between the amino acid sequences of the rat liver and yeast enzymes, without counting the gaps. Homology is 44% at thenucleotide level. Arginase is involved in the urea cycle in the liver of ureotelic animals, whereas it catalyzes the first step of arginine degradation inyeast. Thus, it islikely that rat and yeast arginases have evolved from acommon ancestralgene, despite differences in metabolic functions. Hydropathy profiles for rat and yeast arginases areshown in Fig. 5 (see Miniprint)). The profiles are similar along the entire sequences, when the gaps and noncorresponding portions (Fig. 4) are taken into consideration. Of the five enzymes of the urea cycle, cDNA clones for carbamoyl-phosphate synthase (ammonia) (EC 6.3.4.16) (18, (EC 2.1.3.3) (20, 21), 19),ornithinecarbamoyltransferase argininosuccinate synthetase (EC 6.3.4.5) (22), argininosuccinate lyase (EC 4.3.2.1) (23-25), and arginase (this paper, Ref. 9,andunpublished results’) have been isolatedand sequenced. Thus, cDNAclones are available forall of the urea cycle enzymes and will bepertinenttools for studieson regulation of gene expression and on the ureacycle enzymopathies. Acknowledgments-We thank Drs. K. Okuda and T. Takahashi (Yokohama City University) and M. Ohara (Kyushu University) for critical comments on the manuscript. REFERENCES 1. Penninckx, M., Simon, J.-P., and Wiame, J.-M. (1974)Eur. J. Biochem. 49,429-442

2. Hirsch-Kolb, H., and Greenberg, D.M. (1968)J . Biol. Chem. 243,6123-6129 3. Tarrab, R., Rodriguez, J., Huitrbn, C., Palacios, R., and Soberbn, G. (1974)Eur. J. Bwchem. 49,457-468 4. Herzfeld, A., and Raper, S. M. (1976)Biochem. J. 153,469-478 5. Schimke, R. T. (1962)J. BioL Chem. 237,459-468 6. Lin, R. C., Snodgrass, P. J., and Rabier, D. (1982)J. Bid. Chem. 267,5061-5067 7. Lamers, W.H., Mooren, P. G.,De Graaf, A., and Charles, R. (1985)Eur. J. Biochem. 146,475-480 8. Kawamoto, S., Amaya, Y., Oda, T., Kuzumi, T., Saheki, T., Kimura, S., and Mori, M. (1986)Biochem. Biophys. Res. Commun. 136,955-961 9. Dizikes,G. J., Spector, E. B., and Cederbaum, S. D. (1986) Somatic Cell Mol. Genet. 12, 375-384 10. Sumrada, R. A., and Cooper, T. G. (1984)J . Bacteriol. 160,10781087 11. Vieira, J., and Messing, J. (1982)Gene (Amst.) 19, 259-268 12. Sanger, F., Nicklen, S., and Coulson, A.R. (1977)Proc. Natl. Acad. Sci. U. S. A. 74,5463-5467 13. Kozak, M. (1984)Nucleic Acids Res. 12,857-872 14. Proudfoot, N. J., and Brownlee, G. G. (1976)Nature 263, 211214 15. Schimke, R. T. (1964)J. Biol. Chem. 239,3808-3817 16. Messing, J., and Vieira, J. (1982)Gene (Amst.) 19, 269-276 17. Aketagawa, J., Miyata, T., Ohtsubo, S., Nakamura, T., Morita, T., Hayashida, H., Miyata, T., and Iwanaga, S. (1986)J. Biol. Chem. 261, 7357-7365 18. Adcock, M. W., and O’Brien, W. E. (1984)J. Biol. Chem. 259, 13471-13476 19. Nyunoya, H., Broglie, K. E., Widgren, E. E., and Lusty, C. J. (1985)J. Biol. Chem. 260,9346-9356 20. Takiguchi, M., Miura, S., Mori, M., Tatibana, M., Nagata, S., and Kaziro, Y. (1984)Proc. Natl. Acad. Sci. U. S. A. 81,74127416 21. Horwich, A.L., Fenton, W.A., Williams, K.R., Kalousek, F., Kraus. J. P.. Doolittle. R. F.. Koniasbere. W.. and Rosenbere. L.E. (1984)’Science224, 1068-1074 22. Bock, H.-G. 0..Su, T.-S., O’Brien,W.E., and Beaudet. A.L. (1983)Nucleic Acids Res.. 11,6505-6512 23. Amaya, Y., Kawamoto, S., Oda, T., Kuzumi, T., Saheki, T., Kimura, S., and Mori, M. (1986)Biochem. Int. 13,433-438 24. Lambert. M.A.. Simard. L.R.. Rav. P. N.. and McInnes. R. (1986)’kol.Cell. Biol. 6, 1722-1728’ 25. O’Brien. W. E., McInnes. R.. Kalumuck, K., Adock.M. (1986) Proc. ivatl. A& Sci. U: S. A. 83,721117215 26. Kyte, J., and Doolittle, R. F. (1982)J. Mol. Bwl. 157, 105-132 27. Hirs, C. H. W. (1956)J . Bwl. Chem. 219,611-621 I .

I

I

I

l

T


6283

SUPPLEMENTAL MATERIAL TO Complete Nucleotide Sequence of c D N A and Deduced Aminu Acld Sequence a f Rat Liver A i g i n a ~ e

by SuSumu Kawamoto, Yoshlhlra Amaya. Kaoru Murakaml. F u m l n o n

Tokunaga. Sadaakl Iwanagn, Kelko Kobayashl. Takeyorl Sahekl, Sadao K l m u r a . and Masataka Mor1

EXPERIMENTAL P R ' X E U V R E S

80 I

Clr

60

x Y

0 k L

40 0 + 0)

0

20 27.9'

1%

:;:$ 24.ge

10 24 19 19

71.9

25

32.9

34

0

5

16.6

: f i

3.8f 28.08 3.5

1s

0

3 5

18.5% 28.0 8.7

20 28 9 11 26 9

10.9 25.2 8.5

1.7h

2

10.9

11

"The amino a c i d c o m p o s ~ ~ ~of o nthe purlfled arginase was determined as described under EXPERIMENTAL PROCEDURES. Except where indicated. the values ajlr averages of those obtained from 2 4 , 4 8 . alld 7 2 h hydrolyses w I t h 5.7 M H C I

Approximate y i e l d s of phenylthiohydantoln derivatives were calculated f r o m peak heights on HPLC. The sample used was 4 . 2 nmol (whole enzyme), and the repetitive yleld was 98% lvhale enzyme). 95% (peptide X - 2 3 ) . and 94% (peptide K - 2 4 1 respectively. Amlno a c i d s and values In Darentheses are

PepfIde K-23 "mol

Amino aCld

"mol

Asp Ile Val Tyr

0.13 0.2% 0.29

Glu Thr

0.31 n.d.=

GI"

0.19

Tyr

0.37 0.29

Iie Gly Le" Arg

0.22

AS"

0.21

Val

0.21

Arg

0.21

ASP

0.14 0.19 0.14

ASP 0.05 His

Val Asp 0.15 Pro Gly

Cl" His Tyr Ileb

LYS

19

'n.d.,

'-.

not determined. not identified.

Peptide K-24

Amino acid

0.2, 0.29 0.52 0.30

0.15

Ala

0.14 0.25 0.13 0.14

0.10

0.10Phe Val ASP

0.10 0.15

0.03 0.09

0.06 0.04

G1Y

ASP Leu

30

60

90 Retention Time (rninl

a