ISSN 10681620, Russian Journal of Bioorganic Chemistry, 2013, Vol. 39, No. 6, pp. 629–638. © Pleiades Publishing, Ltd., 2013. Original Russian Text © R.N. Amirkhanov, V.F. Zarytova, N.V. Amirkhanov, 2013, published in Bioorganicheskaya Khimiya, 2013, Vol. 39, No. 6, pp. 705–717.
Composites of Peptide Nucleic Acids with Titanium Dioxide Nanoparticles. II. Dissociation of DNA/PNA Duplexes within TiO2 ⋅ Polylysine ⋅ DNA/PNA Nanocomposites and in Solution. Effect of Polylysine1 R. N. Amirkhanova, b, V. F. Zarytovaa, and N. V. Amirkhanova, 2 a
Institute of Chemical Biology and Fundamental Medicine, Siberian Branch of Russian Academy of Sciences, pr. Lavrent’eva 8, Novosibirsk 630090 Russia b Novosibirsk State University, ul. Pirogova 2, Novosibirsk 630090 Russia Received April 4, 2013; in final form, May 21, 2013
Abstract—When creating effective drugs, it is important not only to transport them into cells, but also allow them to be released from the “transporter” after the delivery. It was shown that the dissociation of peptide nucleic acids (PNA) from TiO2 ⋅ PL ⋅ DNA/PNA nanocomposites occurred according to a typical thermal denaturation, and polylysine (PL) in the nanocomposite has almost no effect on the dissociation. These data suggest that the immobilization of PNA in the TiO2 ⋅ PL ⋅ DNA/PNA nanocomposite is reversible and PNA can be easily released from TiO2 carrier into solution. In contrast to that, the dissociation of DNA/DNA and DNA/PNA duplexes in physiological solution in the presence of PL was not observed. PL in solution dra matically influences the dependence of the optical density on temperature and time for DNA/DNA duplexes and to a lesser degree for DNA/PNA duplexes. It has been assumed that PL and DNA/DNA duplexes in physiological solutions form triple polycomplexes (DNA/DNA ⋅ PL)m, which can aggregate and precipitate. PL in solution can also interact with DNA/PNA duplexes to form monocomplexes PL ⋅ (DNA/PNA)n con sisting of one PL chain and one or more (n) DNA/PNA duplexes. Although these monocomplexes do not precipitate, the dissociation of DNA/PNA duplexes from them is complicated. Keywords: dissociation, DNA/DNA and DNA/PNA duplexes, polylysine, nanocomposites, peptide nucleic acids, nanoparticles, titanium dioxide DOI: 10.1134/S1068162013060022 21
INTRODUCTION The design of composites consisting of gene directed drugs and nanoparticles for their delivery into cells is an urgent task of modern bioorganic chemistry, medicine, molecular biology, and pharmacology [2]. The use of nanomaterials is known to provide more efficient transport of drugs as compared with the exist ing methods [2–5]. When creating efficient nucleic acidsbased drugs, it is important not only to transport them into cells, but also allow them to be released from the nanocomposite after the delivery because prepara tions being strongly bound to the carrier, may be not accessible to interact with NA targets in cells due to steric hindrances posed by the carrier. Abbreviations: D, DNA/DNA duplex; P, DNA/PNA duplex; PL, polylysine; PBS, Kphosphate buffer containing 0.01 М KH2PO4 and 0.14 M NaCl, pH 7.5; TBS, TrisHCl buffer con taining 0.01 M TrisHCl and 0.14 M NaCl, pH 7.5; NA, nucleic acids; PNA, peptide nucleic acid; FluPNA, fluoresceinlabeled PNA. 1 Part I [1]. 2 Corresponding author: phone: +7 (383)3635123; fax: +7 (383)3635153; email:
[email protected].
In the previous paper [1], we described the prepa ration of TiO2 ⋅ PL ⋅ DNA/PNA by means of the non covalent immobilization of hybrid DNA/PNA duplexes (P duplexes) on TiO2 nanoparticles covered with polylysine (PL). It was shown that the proposed nanocomposites can efficiently deliver PNA into cells. PNA oligomers are considered as promising antisense drugs [6–8]. We hypothesized [1] that the immobiliza tion of PNA in the hybrid P duplex on the TiO2 ⋅ PL carrier is reversible due to possible dissociation of the duplex. It is known that polylysine may substantially influence the dissociation of DNA/DNA duplexes in solution [9–11]; the D duplexes formed in the pres ence of PL in physiological solution cannot dissociate but can form precipitated coagulates or micelles slightly soluble in water [10, 11]. The interaction of polylysine with the P duplexes in solution and its influence on dissociation of these duplexes immobilized on solid particles are not described in the literature. The goal of this work is to study both the dissocia tion of DNA/PNA duplexes in the TiO2 ⋅ PL ⋅
629
630
AMIRKHANOV et al.
Structures of model DNA/PNA and DNA/DNA duplexes and their characteristics Oligomer
Duplex structure N
C. AAC . . . TCCA . . . . T. ATGCCAT .
PNA1 DNA1
N
C. AAC . . . TCCA . . . . TA . . T. GCCAT .
PNA1 DNA5
51.0
D1
10
34.3
P2
12
60.5
D2
12
42.8
P3
14
72.2
D3
14
55.4
P4
16
73.8
D4
16
57.9
C
5'CAACTCCAT . . . . . . . . . . A. T. GCCAT3' 3'TTTTTCTAGTTGAGGTATAC5' N
C. AAC . . . TCCA . . . . T. A. .T. GCCAT ...
C
3'TTTTTCTAGTTGAGGTATACGG5' 5'C. A. A. CTCCATATGCCAT3 . . . .. . . . . . .
DNA2 DNA4
10
3'TTTTTCTAGTTGAGGTATAC5'
PNA1 DNA4
P1
3'TTTTTCTAGTTGAGGTAT5'
DNA2 DNA3
Tm, °C
C
5'CAACT . . . . . CCAT . . . . ATGCCAT3' .
PNA1 DNA3
Overlapping length, bp
3'TTTTTCTAGTTGAGGTAT5'
DNA2 DNA1
Duplex
3'TTTTTCTAGTTGAGGTATACGG5' N
CA . . ACTC . . . . CATAT . . . . . G. C. C. A. T.
C
3'CTAGTTGAGGTATACGGTACAT5'
DNA2
5'CAACTCCATATG . . . . . . . . . . . . . . C. C. AT3'
DNA5
3'CTAGTTGAGGTATACGGTACAT5'
The Tm values were obtained at duplex concentration of 2 µM in PBS. The measurement error was ±0.5°C. The PNA structure is desig nated in italic. N and Cends of PNA chains correspond to 5' and 3' ends in DNA, respectively [6].
DNA/PNA nanocomposites and the effect of PL on this process either in hetero phase or in solution. RESULTS AND DISCUSSION Effect of Polylysine on the Formation and Dissociation of DNA/DNA and DNA/PNA duplexes in Physiological Solution It is known that the influence of polylysine on the formation and dissociation of duplexes in solution can be reduced by increasing the ionic strength, for exam ple, increasing the concentration of NaCl to 1 M and above [9–12]. However, in our case these conditions are unacceptable because the proposed nanocompos ites must be suitable for the use in cells under physio logical conditions. In this work we used PBS or TBS as physiological buffers. The effect of polylysine on the dissociation of DNA/PNA and, for comparison, DNA/DNA duplexes in physiological solutions has been studied with an example of the model P (P1, P2, P3, and P4)
and D (D1, D2, D3, and D4) duplexes, which have the different number of overlapping complementary base pairs (table). As expected, the Tm values for the studied duplexes uniformly increase with the number of overlapping complementary base pairs for both the D, and P duplexes (Table). The melting temperatures of all P duplexes were significantly (by 15–18°C) higher than those of the corresponding D duplexes that in a good agreement with literature data [13, 14]. The thermal denaturation of the D and P duplexes was further studied in the presence of PL. The process was monitored by the change in the optical density of the systems, which is caused by the hypochromic effect due to stacking of heterocyclic bases in comple mentary complexes. The increase or the decrease of the optical absorption depends on the decrease or the increase of the hypochromic effect caused by the dis sociation (melting) or association of the duplex, respectively. This method allows one to evaluate the extent of the complex formation in real time without
RUSSIAN JOURNAL OF BIOORGANIC CHEMISTRY
Vol. 39
No. 6
2013
COMPOSITES OF PEPTIDE NUCLEIC ACIDS A260
(a)
A260
0.85
631 (b)
1 0.95 2
0.75 0.85
0.65
1
2 0.55
3 0.75
3
0.45 0
20
40
60
80
100 T, °C
0.65 0
20
40
60
80
100 T, °C
Fig. 1. Temperature dependence of optical absorption of complementary DNA/DNA (a) and DNA/PNA (b) oligomers in the absence (curves 1) and in the presence (curves 2 and 3) of polylysine. Curves 1 correspond to the melting of D2 duplex (a) or P2 duplex (b) in the absence of polylysine. Curves 2 are obtained after the addition of complementary DNA3 (a) or PNA1 (b) to the preformed mixture of DNA2+PL. Curves 3 are obtained after the addition of PL to the preformed duplexes D2 (a) or P2 (b).
any procedures of separation of the single and dou blestranded forms of DNA. The use of a more sensi tive fluorescent label for this purpose is not suitable because such a label attached to the terminal part of DNA or PNA causes no hypochromic effect. Figure 1 demonstrates the dependence of the opti cal absorption in solutions of the D2 and P2 duplexes in PBS on temperature in the presence of polylysine. PL was added either before or after the duplex formation. In the first case, DNA strands were mixed with polyl ysine followed by the addition of the second comple mentary strand of DNA (Fig. 1a, curve 2) or PNA (Fig. 1b, curve 2). In the second case, polylysine was added to the preformed D or P duplexes. Thus, we planned to observe the formation and the dissociation of duplexes, respectively, in the presence of polylysine (Figs. 1a, 1b, curves 3). For comparison, the figure shows the thermal denaturation curves of the same duplexes in the absence of PL (Figs. 1a and 1b, curves 1). It is seen that polylysine significantly influences the character of the thermal denaturation curves of both the D (Fig. 1a) and the hybrid P duplexes (Fig. 1b). Under normal conditions, heating of the D and P duplexes in the absence of PL leads to the increase in the optical absorption of the solution with increasing temperature with the typical temperature transition in the melting region of the duplex (Figs. 1a and 1b, curves 1). In this case, the increase in the optical absorption is due to the decrease in the hypochromic effect caused by the melting (dissociation) of the duplex. However, in the case of the heating of the D duplex in the presence of PL, the optical absorption does not increase and even decreases with increasing the temperature, i.e., has linear negative slope (Fig. 1a, curves 2 and 3). This dependence is observed when PL was added either before (curve 2) or after (curve 3) the duplex forma tion. RUSSIAN JOURNAL OF BIOORGANIC CHEMISTRY
A significant difference in the optical absorption in the initial regions of curves 2 and 3 (Figs. 1a and 1b) indicates the inability of the D or P duplex formation in the presence of polylysine. Otherwise, the absorp tion of mixtures formed with the addition of PL before and after the duplex formation would be identical due to the hypochromic effect. Polylysine in the solution can probably wind around the singlestranded DNA and, thereby, prevent or even block the formation of advantageous doublestranded conformation corre sponding to the normal duplex with classic Watson Crick complementary bonds. These data show that the presence of polylysine in physiological solution signif icantly influences not only the dissociation but also the formation of the DNA/DNA and DNA/PNA duplexes. Nevertheless, it should be noted that polylysine has a different effect on the formation and dissociation of the D and P duplexes. The addition of PL to the solu tion of the P duplex before (Fig. 1b, curve 2) or after (Fig. 1b, curve 3) its formation does not lead to the decrease in the absorption of the solution as is observed in the case of the D duplex (Fig. 1a, curves 2 and 3). The values of the optical absorption on curves 2 and 3 (Fig. 1b) even slightly increase with increasing temperature, which is probably due to the partial melt ing of the P duplex even in the presence of polylysine. The dissociation of a duplex is usually a reversible process, which is proved by the coincidence in the form of the melting curves of a duplex registered when heating and then cooling the system. Figure 2 shows the dependence of the optical absorption of the D (Figs. 2a and 2b) and P (Figs. 2c and 2d) duplexes on the temperature in the presence (Figs. 2b and 2d) and in the absence (Figs. 2a and 2c) of polylysine at both heating (Fig. 2, curve 1) and cooling (Fig. 2, curve 2). Vol. 39
No. 6
2013
632
AMIRKHANOV et al. A260
A260
(а)
(b)
0.55
0.79
1 0.45
2 0.74
0.35
1 0.69
0.25
0.64
2
0.15 0
20
40
A260
60
80
(c)
100 T, °C
0
20
40
A260 0.70
60
80
100 T, °C
80
100 T, °C
(d)
0.825 0.65
2 0.775
1
0.60
0.725
1 2
0.55
0.675
0.50 0
20
40
60
80
100 T, °C
0
20
40
60
Fig. 2. Temperature dependence of optical absorption of duplex D2 (a, b) or hybrid P2 duplex (c, d) in the absence (a, c) and in the presence (b, d) of polylysine. Curves 1 and 2 are obtained when heating and cooling the complexes, respectively.
In the absence of PL, the melting of the D and P duplexes is a reversible process with the same tempera ture transition on the curves of both dissociation (Fig. 2a and 2c, curve 1) and association (Fig. 2a and 2c, curve 2) of the duplexes. Some shift of curves 1 and 2 relative to each other when melting the D and P duplexes on Figs. 2a and 2c is due to an insignificant increase in the concentration of the solution in the cuvette because of the evaporation of the solution during the heating pro cess. This melting curve shift is not related to the phe nomenon of hysteresis as it is characterized by a com plete coincidence of the extreme points of the curves and by the fact that the second curve is always, with a certain delay, relative to the first. In our case, the sec ond curve is not in a delay and, on the contrary, ahead of the first curve, which is explained by the slight increase in the concentration of a duplex system. This is also proved by the coincidence of the temperature transitions on both curves because the Tm values are almost unchanged with an insignificant change (10– 20%) in the concentration of the solution. In contrast to that, the inflection point on the second curve at hys teresis is always shifted to higher temperatures. Another pattern is observed when polylysine is added to the solutions of the preformed D or P
duplexes. In the case of the D duplexes, the presence of PL leads to a permanent decrease in the optical absorption, regardless of raising (Fig. 2b, curve 1) or lowering the temperature (Fig. 2b, curve 2). In the case of the P duplexes, the addition of PL does not lead to a decrease in the absorption with an increase in tempera ture; the absorption even slightly increases (Fig. 2d, curve 1). As the temperature decreases, the optical absorption of the duplexes decreases and returns to its original value before heating (Fig. 2d, curve 2). In the presence of PL, however, the curves of the dependence of the optical absorption of the P duplexes on temper ature with its raising or lowering do not have a well defined temperature transition typical for the melting of a duplex. The curves do not coincide with each other and with the melting curves of the P duplexes in the absence of polylysine (Fig. 2c, curves, 1 and 2). One can thus conclude that in the case of both the D and P duplexes, the change in the optical absorption in the presence of polylysine in saline is the irreversible process. The anomalous change of the optical absorption for the D duplexes in the presence of polylysine is observed not only as a function of temperature but also of the time (Fig. 3). In the case of the D duplex, the
RUSSIAN JOURNAL OF BIOORGANIC CHEMISTRY
Vol. 39
No. 6
2013
COMPOSITES OF PEPTIDE NUCLEIC ACIDS A260
A260 0.80
(а) 1
0.68
633 (b) 1
0.75 0.63 2 0.70
2
0.58
0.65
0.53 0.48
0
100
200
300 t, min
0.60
0
100
200
300 t, min
Fig. 3. Time dependence of optical absorption of D2 duplex (a) and hybrid P2 duplex (b) in the absence (curves 1) and in the pres ence (curves 2) of PL at constant temperature (37°C).
presence of polylysine leads to a significant decrease in the optical absorption in time (Fig. 3a, curve 2), and the absorption in the absence of PL, as expected, does not change in time (Fig. 3a, curve 1). The calculated rate of the decrease in the absorp tion of the studied D2 duplex system in the presence of polylysine was 0.03 OU260/h, while in the absence of polylysine, this value was 0.002 OU260/h. This means that the change in the optical absorption of the three component DNA/DNA/PL system based on the D2 duplex is faster by a factor of 15 than that in the system in the absence of polylysine. The addition of poly lysine to the P duplexes at the constant temperature leads to the insignificant decrease in the optical absorption in time (Fig. 3b). The special character of the dependence of the optical absorption of DNA/DNA and DNA/PNA duplexes on temperature and time was determined not only for D2 and P2 duplexes but also for all other DNA/DNA (D1, D3, and D4) and DNA/PNA duplexes studied (P1, P3, and P4) (data not shown). Thus, it was found that PL in solution dramatically influences the character of the dependence of the opti cal absorption on temperature and time for DNA/DNA duplexes and, to a lesser extent, for DNA/PNA duplexes. The continuous decrease in optical absorption in solution of the D duplexes in the presence of PL is most likely due to aggregation of the formed complex DNA/DNA/PL and its precipitation. The aggregation of this complex is likely caused by electrostatic inter action between the negatively charged internucleotide phosphate groups in DNA/DNA duplex and the posi tively charged primary side amino groups in PL. This assumption is consistent with the literature [10, 11], which suggest that the ability of DNA/DNA duplexes to dissociation and their ability to form coagulates or RUSSIAN JOURNAL OF BIOORGANIC CHEMISTRY
micelles poorly soluble in water in the presence of PL depend on the ionic strength of the solution [10–12]. Polylysine in the relatively stable threecomponent PL ⋅ DNA/DNA or PL ⋅ DNA/PNA complexes formed can prevent the dissociation of DNA/DNA and DNA/PNA duplexes. It is possible that in the presence of PL, threecomponent complexes of the 1 type are formed, which consist of one PL chain and one or several (n) duplexes, i.e. PL ⋅ (DNA/DNA)n or PL ⋅ (DNA/PNA)n (Fig. 4, structure 1) or polycom plexes of the 2 type consisting of m PL molecules and m molecules of duplexes, i.e. (PL ⋅ DNA/DNA)m or (PL ⋅ DNA/PNA)m (Fig. 4, structure 2). In the case of the D duplexes, the most probable structure of the ternary PL · DNA/DNA complex under physiological conditions is, most likely, a poly complex 2 (Fig. 4, structure 2). Namely this structure provides aggregation and precipitation of the complex, which is accompanied by the decrease in the optical absorption observed in the experiment (Fig. 3a, curve 2). In the absence of polylysine, as it should be, the opti cal absorption of the duplex almost does not change in time within the error (Fig. 3a, curve 1), and reduced only after the addition of polylysine to the duplex (Fig. 3a, curve 2). Consequently, the most probable structure for the complex of DNA/DNA with PL is structure 2 (PL ⋅ (DNA/DNA)m), which can aggregate forming micelles or nanoparticles and precipitate. The addition of polylysine to the P duplexes, however, excludes the normal thermal denaturation (Fig. 2d) apparent as the Slike melting curve (Fig. 2c), but, unlike the D duplexes, does not result in a significant reduction in the absorption of the solution in time at a constant temperature (Fig. 3b). This behavior of the ternary complex PL ⋅ DNA/PNA may be associated with the formation of monocomplex 1 (Fig. 4, struc ture 1). The most likely structure for the complexes of DNA/PNA with PL can be assumed to be ternary Vol. 39
No. 6
2013
634
AMIRKHANOV et al. triple monocomplex PL ⋅ (DNA/DNA)n or PL ⋅ (DNA/PNA)n PL 1.
triple polycomplex (PL ⋅ DNA/DNA)m or (PL ⋅ DNA/PNA)m PL
PL
PL
2.
polylysine (PL)
DNA/DNA or DNA/PNAduplex
triple complex PL ⋅ DNA/DNA or PL ⋅ DNA/PNA Fig. 4. Possible structures of triple complexes formed by polylysine and DNA/DNA or DNA/PNA duplexes in physiological solution. 1 is triple monocomplex PL ⋅ (DNA/DNA)n or PL ⋅ (DNA/PNA)n; 2 is triple polycomplex (PL ⋅ (DNA/DNA)m or (PL ⋅ (DNA/PNA)m.
complex PL ⋅ (DNA/PNA)n (1). The structure of the ternary polycomplex (PL ⋅ DNA/PNA)m (2) is hardly probable because the PNA strand in the DNA/PNA duplex has no negatively charged groups. In this regard, in contrast with DNA/DNA duplex the electrostatic interaction of hybrid DNA/PNA duplex with the terminal regions of PL in the triple polycom plex (PL ⋅ (DNA/PNA)m (2) is too weak to form such polycomplex 2. On the other hand, the ternary complex formed with DNA/PNA duplex and PL as a triple monocomplex PL ⋅ (DNA/PNA)n (1) is strong enough not to melt under heating (see, e.g., Fig. 2b) and not precipitate, however not enough strong to bind several PL molecules to form the precipitated ter nary complex 2 (see, e.g., Fig. 3b). Thus, the hybrid DNA/PNA duplex in saline in the presence of polyl ysine may be unable to sufficiently dissociate due to the formation of the stable ternary complex PL ⋅ DNA/PNA, where polylysine prevents the normal duplex dissociation. Since the optical absorption of the PL ⋅ DNA/PNA system (Fig. 3b, curve 2) does not change in time, one can conclude that, unlike the D
duplexes, the P duplexes in the presence of PL do not aggregate and precipitate. Thus we assume that in the case of the D duplexes, the presence of polylysine leads to the formation of ternary polycomplex 2, which aggregate and precipi tate [10, 11], and in the case of the P duplexes, in all likelihood, this polycomplex is not formed, and only monocomplex 1 is formed (Fig. 4), which prevents the normal dissociation of the duplex but does not precip itate. This difference between the P and D duplexes in the presence of polylysine is, probably, due to the fact that the D duplex has as twice as many negative charges as the P duplexes. The lower number of the negative charges in the P duplexes cannot provide the strong binding of two and more polylysine chains and, consequently, is not enough to form aggregated three component particles of the 2 type (Fig. 4). Thus, although PL differently affects the P and D complexes, both types of duplexes cannot dissociate in the presence of PL.
RUSSIAN JOURNAL OF BIOORGANIC CHEMISTRY
Vol. 39
No. 6
2013
COMPOSITES OF PEPTIDE NUCLEIC ACIDS
Dissociation of DNA/PNA Duplexes Immobilized on TiO2 Nanoparticles Covered with Polylysine To study the influence of PL in the nanocomposites on the dissociation of duplexes, we designed the model TiO2 ⋅ PL ⋅ DNA/PNA nanocomposites, i.e. TiO2 ⋅ PL ⋅ P1, TiO2 ⋅ PL ⋅ P2, TiO2 ⋅ PL ⋅ P3, and TiO2 ⋅ PL ⋅ P4 con taining duplexes P1, P2, P3, and P4 with different num bers of overlapping complementary base pairs (table). Dissociation of DNA/PNA duplexes was moni tored by desorption of PNA from the TiO2 ⋅ PL ⋅ DNA/PNA nanocomposite. For this purpose, we used fluoresceinlabeled PNA (FluPNA) [1], which was used at first to form the DNA/FluPNA duplex followed by its immobilization on TiO2 ⋅ PL nanoparticles at low temperature to form TiO2 ⋅ PL ⋅ DNA/FluPNA nano composite. It should be noted that the direct method of UV spectroscopy by using hypochromic effect is not suitable to study the duplex dissociation, when duplex is immobilized on TiO2 nanoparticles, because TiO2 particles do not transmit UV rays and have a high opti cal absorption. It is convenient to use the fluorescent label in the solidphase variant because fluorescein labeled singlestranded PNA can be easily separated from the duplexbound PNA immobilized to the car rier by centrifugation of the mixture in the chosen temperature interval. So, it is possible to evaluate the dissociation extent of the duplex on the solid support at a given temperature. An aliquot of the nanocomposite was then heated for a certain period of time at different temperatures in the range of 20–90°C. The amount of desorbed FluPNA was evaluated after centrifugation of the sus pension of the nanocomposite by measuring the inten sity of fluorescence in the supernatant. The extent of the desorption of PNA was calculated by the ratio of the amount of FluPNA in the supernatant to the total amount of FluPNA used initially for the immobiliza tion. The results were used to evaluate the dependence of desorption of FluPNA from the TiO2 ⋅ PL ⋅ DNA/PNA nanocomposite on temperature. Figure 5 shows the curve 1 of the thermal desorption of FluPNA1 from complementary duplex DNA1/FluPNA1 in the corresponding nanocomposite. This curve has an S like shape typical for the melting curves of duplexes in solution (see, e.g. Fig. 2c, curve 1) with a characteris tic temperature inflection corresponding to the Tm value of the duplex. The shape of the desorption curve of FluPNA1 indicates that desorption from the nano composite occurs due to denaturation of the immobi lized duplex DNA1/FluPNA1. To further confirm the nature of desorption (which is due to dissociation of the duplex), a similar experi ment was performed using fluoresceinlabeled non RUSSIAN JOURNAL OF BIOORGANIC CHEMISTRY
80 2 Fluorescence in solution, %
Next, it was important to find out whether PL effects the dissociation of the DNA/PNA duplex in the TiO2 ⋅ PL ⋅ DNA/PNA nanocomposite.
635
70
60 1
50
40 20
40
60
80 T, °C
Fig. 5. Temperature dependence of desorption of FluPNA1 from TiO2 ⋅ PL ⋅ DNA1/ FluPNA1 nanocomposite (1) and desorption of noncomplementary FluPNA2 from the mix ture of TiO2 ⋅ PL with DNA1 and FluPNA2 in PBS (2).
complementary FluPNA2 with a sequence of NGCAAAAGCAGGGTAGAC. In this case, no dependence of fluorescence on the temperature was observed (Fig. 5, curve 2). The temperature dependence of fluorescence in the case of the complementary PNA indicates that desorption of PNA from nanocomposite TiO2 ⋅ PL ⋅ DNA1/FluPNA1 occurs due to the dissociation of the complementary DNA/PNA duplex. Thus, unlike the effect of PL on the dissociation of DNA/PNA in solution, the presence of polylysine in the solidphase system TiO2 ⋅ PL ⋅ DNA/PNA does not prevent the dissociation of the DNA/PNA duplex, which is noncovalently immobilized on the surface of TiO2 nanoparticles. The curves in Fig. 6 demonstrate the dependence of the desorption of FluPNA from the TiO2 ⋅ PL ⋅ DNA/FluPNA nanocomposites for all studied duplexes P1, P2, P3, and P4 with 10, 12, 14, and 16 overlapping complementary base pairs, respectively. All curves independently on the number of overlap ping base pairs are typical melting curves with the tem perature transition at the inflection point correspond ing to Tm of a duplex. As in the solution (table), the Tm value of the studied duplexes in the nanocomposites naturally increases with the number of overlapping complementary base pairs. The summed data of the Tm values for all studied duplexes in solution and on the solid phase (in the nanocomposites) presented in Fig. 7 as a dependence of the number of overlapping complementary base pairs in duplexes show that the thermostability of DNA/PNA duplexes immobilized on the nanoparti cles slightly higher (on average by 5–6°С) than that of the same duplexes in the solution. This is probably due not only to additional PNA binding affinity to com plementary DNA immobilized on nanoparticles, but also to additional PNA affinity to the nanoparticles, Vol. 39
No. 6
2013
AMIRKHANOV et al. Fluorescence intensity, a.u.
(а) 1.0
0.5
0 10
TiO2 ⋅ PL ⋅ P1 Tm = 63°C
30
50 Т, °С (c)
70
90 Fluorescence intensity, a.u.
Fluorescence intensity, a.u.
Fluorescence intensity, a.u.
636
1.0
0.5
0 10
TiO2 ⋅ PL ⋅ P3 Tm = 74°C
30
50 Т, °С
70
90
(b) 1.0
0.5
0 10
TiO2 ⋅ PL ⋅ P2 Tm = 63°C
30
50 Т, °С (d)
70
90
70
90
1.0
0.5
0 10
TiO2 ⋅ PL ⋅ P4 Tm = 80°C
30
50 Т, °С
Fig. 6. Thermal curves of desorption of FluPNA from TiO2 ⋅ PL ⋅ DNA/FluPNA nanocomposites and the Tm values for DNA/PNA duplexes P1, P2, P3, and P4 (a, b, c, and d, respectively) in PBS.
which leads to some decrease in the desorption rate of PNA from the nanocomposite. According to the data in table and in Figs. 6 and 7, the thermostability of all duplexes studied in the solu tion and in the nanocomposites increases in the fol lowing order: DNA/DNA (solution) < DNA/PNA (solution) < DNA/PNA (solid phase). The depen dence of the stability of the DNA/PNA duplexes on the number of overlapping complementary base pairs is the same in solution and on the solid phase in the nanocomposites. In other words, the more stable the duplex in the solution, the more stable it is in the TiO2 ⋅ PL ⋅ DNA/PNA nanocomposite. Thus, polylysine noticeably inhibits the DNA/PNA dissociation in solution. However, being noncovalently immobilized on the solid support, it has very little effect on the dissociation of DNA/PNA duplex in TiO2 ⋅ PL ⋅ DNA/PNA nanocomposite. This provides the transition of PNA from nanocomposite in solution depending on the strength of the original DNA/PNA duplex. The results show that the noncovalent immobiliza tion of PNA as the hybrid DNA/PNA duplexes on the titanium dioxide nanoparticles covered with polyl ysine is a reversible process. The different effect of polylysine on dissociation of the DNA/PNA duplexes in solution and in the TiO2 ⋅ PL ⋅ DNA/PNA composites is probably caused by the different structural interaction of polylysine with a double helix in solution and on the solid phase. More
flexible in solution, polylysine can probably wind around a double helix of the DNA/PNA duplex and, thereby, prevent or inhibit the duplex dissociation due to not only electrostatic interactions but also the decrease in the entropy of such a system because of “mechanical arrest” of the system. On the other hand, the polylysine molecules on the solid phase, being strongly fixed on the surface of TiO2 particles due to their positive charges, cannot easily wind the duplex and only electrostatically interact with the DNA chain. The other reason for a weak effect of immobi lized polylysine on the stability of the DNA/PNA duplexes can be that the efficient positive charge of polylysine immobilized on the nanoparticles is much smaller than that in the solution because a part of the positive charges of polylysine is spent on the electro static binding with the surface of TiO2 nanoparticle [1]. It is known that the additional stability of duplexes in the presence of polylysine significantly depends on the ratio of the positively charged amino groups in polylysine and the negatively charged internucleotide phosphate residues in DNA [10, 11]. Therefore, polyl ysine on the solid phase can influence the stabilization of duplexes to a lesser extent than in solution. Thus, we showed that PL in physiological solution significantly inhibited the association and dissociation of DNA/PNA and especially DNA/DNA duplexes and had a weak effect on the dissociation of DNA/PNA duplexes in nanocomposites. It means that the immobilization of PNA as hybrid DNA/PNA
RUSSIAN JOURNAL OF BIOORGANIC CHEMISTRY
Vol. 39
No. 6
2013
COMPOSITES OF PEPTIDE NUCLEIC ACIDS
637
DNA/DNA in solution DNA/PNA in solution
100
TiO2 ⋅ PL ⋅ DNA/PNA
Tm, °C
80
60
40
20
0
10
12 14 Number of complementary base pairs
16
Fig. 7. Comparison of the Tm values for DNA/DNA and DNA/PNA duplexes in solution and on solid phase in TiO2 ⋅ PL ⋅ DNA/PNA nanocomposites depending on the number of overlapping complementary base pairs in the duplex.
duplexes on TiO2 particles covered with polylysine is a reversible process due to the dissociation of these duplexes in the resulting TiO2 ⋅ PL ⋅ DNA/PNA nano composites. The results demonstrate a possibility of using the pro posed TiO2 ⋅ PL ⋅ DNA/PNA nanocomposites as carriers with the reversible attachment of therapeutically valu able PNA. EXPERIMENTAL We used: PolyLlysine hydrobromide (Sigma Ald rich, United States, MW 15000–30000) dried over P2O5 in vacuum; PNA oligomers, fluoresceinlabeled PNA (FluPNA), 5'32Plabeled DNA oligomers; TiO2 nanoparticles (4–6 nm) [1]; Phosphate buffered saline (PBS) containing 0.01 M KH2PO4 and 0.14 M NaCl, pH 7.5 and TrisHCl buffered saline (TBS), contain ing 0.01 TrisHCl and 0.14 NaCl, pH 7.5. Preparation of 200 μM solution of polylysine in water was carried out according to [1]. DNA oligomers were synthesized in the Institute of Chemical Biology and Fundamental Medicine (Sibe rian Branch of Russian Academy of Sciences) on a ASM 800 synthesizer (Biosset, Russia) by the standard phosphoroamidite method and purified by reverse phase HPLC. The purity of the oligonucleotides was examines by electrophoresis in 15% PAAG in denatur ing conditions. Oligonucleotides in gel were visualized by staining with StainsAll. UV spectra of aqueous solutions of PNA and DNA oli gomers and their duplexes were registered on a UV1800 spectrophotometer (Shimadzu, Japan). Concentra RUSSIAN JOURNAL OF BIOORGANIC CHEMISTRY
tion of DNA and PNA oligomers was evaluated spec trophotometrically using sum values of molar absorp tion coefficients for mono and dinucleotides at 260 nm [15]. Fluorescence was registered on a Varian Cary Eclipse Fluorescence spectrophotometer (Varian, United States) (excitation at 495 nm, absorp tion at 521 nm). DNA/DNA and hybrid DNA/PNA duplexes were prepared by mixing equimolar amounts of the starting oligomers in a buffer (PBS or TBS). Concentrations of the duplexes were in a range of 2–20 μM. The mix tures were incubated at 90°C for 5 min, followed by cooling to 25°C for 30 min and stored on ice until their use. The structures of the duplexes used and the exper imental values of their melting temperatures in solu tion are presented in the Table. For experiments with TiO2 particles, we used hybrid DNA/PNA duplexes obtained with PNA or its fluoresceinlabeled deriva tive FluPNA and complementary nonlabeled or 5'32P labeled DNA. The latter was prepared using [γ32P]ATP and T4 polynucleotide kinase [16]. PL ⋅ DNA/DNA and PL ⋅ DNA/PNA ternary com plexes. Method 1. Addition of polylysine before the duplex formation. Aqueous PL (1 μL of 200 μM solu tion) was added to the DNA oligomer (60 μL of 4 μM solution) in PBS at room temperature followed by the addition of the complementary DNA or PNA strand (Fig. 1a, 1b, curves 2). Method 2. Addition of polylysine to the preformed duplex. Aqueous PL (1 μL of 200 μM solution) was added to the preformed DNA/DNA or DNA/PNA duplex (120 μL of 2 μM solution) in PBS at room temperature. The prepared ternary complexes were then used to examine the influence of polylysine on association (Fig. 1, curves 2) or dissociation (Fig. 1, Vol. 39
No. 6
2013
638
AMIRKHANOV et al.
curves 2 and Fig. 2) of the duplexes in physiological solution and to study the effect of polylysine on the formation of associates with DNA/DNA or DNA/PNA duplexes in time (Fig. 3). Thermal denaturation of oligomer duplexes (2 μM) in solution in the absence or in the presence of polyl ysine was carried out using a UV1800 spectropho tometer and a TMSPC8 attachment for analyzing the melting temperature of nucleic acid complexes (Shi madzu, Japan) equipped by temperaturecontrolled eightsection holder. The optical absorption in each microcuvette (100 μL) was measured in PBS at 260 nm under heating from 5 to 95°C and cooling from 95 to 5°C. The rate of the temperature change was 0.5°C/min. Each experiment was repeated three or more times. The average Tm values of the duplexes studied in the absence of polylysine were presented in Table. Kinetics of changing the optical absorption in the mixture of DNA/DNA or DNA/PNA duplexes in the absence or in the presence of polylysine was carried out using the TMSPC8 device mentioned above. The opti cal absorption values of the solutions were measured every 10 min at 260 nm on a UV1800 spectrophotom eter (Shimadzu, Japan) during 5–6 h at 37°C in PBS. Nanoparticles of titanium dioxide were synthesized by hydrolysis of TiCl4 in water by the standard method [17] as described in [1]. TiO2 ⋅ PL nanocomposites were prepared as described in [1] by mixing the TiO2 suspension in water buffer (PBS or TBS) with aqueous solution of PL. The molar ratio of TiO2 particles to PL was 1 : 1 (one TiO2 particle contains 1500 TiO2 molecules [17]). TiO2 ⋅ PL ⋅ DNA/FluPNA nanocomposites were pre pared by the immobilization of the DNA/FluPNA duplex on the TiO2 ⋅ PL composite. The preformed cooled DNA/FluPNA duplex (10 μL, 20 μM) (or the mixture of DNA1 (5 μL, 40 μM) with noncomplemen tary FluPNA (5 μL, 40 μM)) was added to TiO2 ⋅ PL cooled to 0°C (20 μL, 1 mg/mL for TiO2; 8.3 nmol/μL, 20 μg, 0.167 nmol for PL). The concen tration of the prepared nanocomposites was 2 μM for DNA/PNA duplex and 0.1 mg/mL for TiO2. The pre pared suspensions were sonicated for 10–20 s, kept on ice under stirring for 5 min, and used immediately after the preparation. Dissociation of DNA/PNA duplexes in TiO2 ⋅ PL ⋅ DNA/PNA nanocomposites. Aliquots (50 μL) of TiO2 ⋅ PL ⋅ DNA/FluPNA nanocomposite (2 μM for DNA/PNA duplex and 0.1 mg/mL for TiO2) were kept separately at the certain fixed temperature (with 5°C interval from 20° to 90°C) for 10 minutes under constant stirring. Each sample was then quickly diluted to 500 μL with PBS cooled to 0°С and centri fuged for 10 min at 14 000 rpm. The fluorescence was measured in the supernatant and compared with the fluorescence value of the control sample taken as 100%, which was obtained similarly to the above nanocomposite but without TiO2 ⋅ PL. The proportion of FluPNA washed out from TiO2 ⋅ PL ⋅DNA/FluPNA
nanocomposite and remained in the nanocomposite was calculated by the ratio of fluorescence in the supernatant and in the control sample. The data were used to obtain the curves of the temperature depen dence of desorption of PNA from the studied nano composites. The inflection points on the curves were taken as the melting temperature values. AKNOWLEDGMENTS The work was supported by the Project of Siberian Branch of the Russian Academy of Sciences no. 61, RFBR projects nos. 080401045a and 110401408 a, and the State contract no. 16.512.11.2267. REFERENCES 1. Amirkhanov, N.V., Amirkhanov, R.N., and Zarytova, V.F. Russ. J. Bioorg. Chem., 2012, vol. 38, pp. 613–624. 2. Scholz, C. and Wagner, E., J. Control. Release, 2012, vol. 161, pp. 554–565. 3. Kuznetsova, S.A. and Oretskaya, T.S., Ross. Nanotekh nol., 2010, vol. 5, no. 9–10, pp. 40–52. 4. Liua, G., Swierczewskaa, M., Leea, S., and Chena, C., Nano Today, 2010, vol. 5, pp. 524–539. 5. Torchilin, V.P., Multifunctional Pharmaceutical Nano carriers, Series: Fundamental Biomedical Technologies, 2008, vol. 4, no. 14. 6. Nielsen, P.E., Peptide Nucleic Acids: Protocols and Applications, Wymondam, United Kingdom: Horizon Bioscience, 2004. 7. Shiraishi, T. and Nielsen, P.E., Methods Mol. Biol., 2011, vol. 751, pp. 209–221. 8. Antsypovich, S.I., Usp. Khim., 2002, vol. 71, no. 1, pp. 81–96. 9. Matsuo, K. and Tsuboi, M., Biopolymers, 1969, vol. 8, pp. 153–155. 10. Shapiro, J.T., Leng, M., and Felsenfeld, G., Biochemis try, 1969, vol. 8, pp. 3219–32. 11. Liu, G., Molas, M., Grossmann, G.A., Pasumarthy, M., Perales, J.C., Cooper, M.J., and Hanson, R.W., J. Biol. Chem., 2001, vol. 276, pp. 34379–34387. 12. Levina, A.S., Ismagilov, Z.R., Repkova, M.N., Shikina, N. V., Baiborodin, S.I., Shatskaya, N.V., Zagrebelnyi, S.N., and Zarytova, V.F., Russ. J. Bioorg. Chem., 2013, vol. 39, pp. 77–86. 13. Egholm, M., Buchardt, O., Christensen, L., Behrens, C., Freier, S.M., Driver, D.A., Berg, R.H., Kim, S.K., Norden, B., and Nielsen, P.E., Nature, 1993, vol. 365, pp. 556–568. 14. Giesen, U., Kleider, W., Berding, C., Geiger, A., Orum, H., and Nielsen, P.E., Nucleic Acids Res., 1998, vol. 26, pp. 5004–5006. 15. Richards, E., Handbook of Biochemistry and Molecular Biology: Nucleic Acids, Fasman, G.D., Ed., Cleavland: CRC Press, 1975, vol. 1, p. 589. 16. Perbal, B., A Practical Guide to Molecular Cloning, New York: Acad. Press, 1984. 17. Rajh, T., Saponjic, Z., Liu, J., Dimitrijevic, N.M., Scherer, N.F., VegaArroyo, M., Zapol, P., Curtiss, L.A., and Thurnauer, M.C., Nano Lett., 2004, vol. 4, pp. 1017–1023.
RUSSIAN JOURNAL OF BIOORGANIC CHEMISTRY
Translated by A. Levina Vol. 39
No. 6
2013
