Construction of a Bacillus thuringiensis engineered strain with high

See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/41467481

Construction of a Bacillus thuringiensis engineered strain with high toxicity and broad pesticidal spectrum against... Article in Applied Microbiology and Biotechnology · February 2010 DOI: 10.1007/s00253-010-2479-5 · Source: PubMed

CITATIONS

READS

12

68

10 authors, including: Jingjing Liu

Changlong Shu

Jilin University

Institute of Plant Protection, Chinese Acade…

6 PUBLICATIONS 27 CITATIONS


SEE PROFILE

SEE PROFILE

Fuping Song

Jie Zhang

Chinese Academy of Agricultural Sciences

University of Science and Technology of China


500 PUBLICATIONS 6,415 CITATIONS

SEE PROFILE

SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Mother cell lysis in Bacillus thuringiensis View project

All content following this page was uploaded by Fuping Song on 28 August 2015.

The user has requested enhancement of the downloaded file. All in-text references underlined in blue are added to the original document and are linked to publications on ResearchGate, letting you access and read them immediately.

Appl Microbiol Biotechnol (2010) 87:243–249 DOI 10.1007/s00253-010-2479-5

BIOTECHNOLOGICALLY RELEVANT ENZYMES AND PROTEINS

Construction of a Bacillus thuringiensis engineered strain with high toxicity and broad pesticidal spectrum against coleopteran insects Jingjing Liu & Guixin Yan & Changlong Shu & Can Zhao & Chunqin Liu & Fuping Song & Lin Zhou & Junlan Ma & Jie Zhang & Dafang Huang

Received: 22 September 2009 / Revised: 26 January 2010 / Accepted: 28 January 2010 / Published online: 18 February 2010 # Springer-Verlag 2010

Abstract A newly engineered strain, denominated BIOT185, was constructed through integrating the cry8Ca2 gene into the endogenous plasmid of BT185 (contains cry8Ea1) by homologous recombination. The thermosensitive plasmid vector was eliminated by the rising temperature of recombinant cultures. No antibiotic gene or other unnecessary genes were introduced to the new strain. Sodium dodecyl sulfate– polyacrylamide gel electrophoresis and Western blot analysis demonstrated that the cry8Ca2 gene was expressed normally and produced a 130-kDa protein in the BIOT185 strain. Bioassay results showed that the new strain had high toxicity to the pests Anomala corpulenta and Holotrichia parallela, which often damage the same fields. Keywords Bacillus thuringiensis . Engineered strain . Homologous recombination . Anomala corpulenta . Holotrichia parallela

J. Liu : G. Yan : C. Shu : C. Zhao : F. Song : L. Zhou : J. Ma : J. Zhang (*) State Key Laboratory for Biology of Plant Diseases and Insect Pests, Institute of Plant Protection, Chinese Academy of Agricultural Sciences, Beijing 100193, People’s Republic of China e-mail: [email protected] C. Liu Cangzhou Academy of Agricultural and Forestry Sciences, Cangzhou 061001, People’s Republic of China D. Huang (*) Biotechnology Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, People’s Republic of China e-mail: [email protected]

Introduction Insects of the scarab family are some of the most destructive pests in agriculture, horticulture, and forestry in both Europe and Asia, and the larvae destroy the underground parts of the plants and reduce output yield significantly (Schnetter et al. 1996; Wei & Deloach 1995). Thus, both biological and chemical pest control approaches are under investigation (Keller et al. 2000; Peters 2000; Schnetter et al. 1996). With the increasing environmental burden exerted by chemical pesticides, the biological pesticide is becoming an alternative choice. Bacillus thuringiensis, which has been used worldwide for more than 60 years, has been under examination as an alternative to chemical scarab control. Cry8-type toxins that accumulate in B. thuringiensis strains have been reported to kill scarab larvae specifically (see also the B. thuringiensis toxin specificity database at http://www.glfc.cfs.nrcan.gc. ca/bacillus). The B. thuringiensis strain HBF-1 contains the cry8Ca2 gene, which has insecticidal activity against Anomala corpulenta (Shu et al. 2007), and strain BT185 contains the cry8Ea1 gene, which is toxic to Holotrichia parallela (Shu et al. 2009; Yu et al. 2006). Both strains have been isolated and characterized, and their high toxicity makes the two B. thuringiensis strains potential candidates for A. corpulenta and H. parallela management. In China, A. corpulenta and H. parallela are two of the severe species of the scarab family. These species damage the same fields and are severely endangering the production of peanut, soybean, potato crops, and turf grass, with an average of 15–20% loss annually (Luo et al. 2008; Wei & Deloach 1995). Because the scarab larvae live in soil, the use of chemical pesticides to control the pest is not often efficient and always causes environmental problems.

244

Appl Microbiol Biotechnol (2010) 87:243–249

However, so far, there is no literature showing that the B. thuringiensis strains or cry genes could control both A. corpulenta and H. parallela synchronously, owing to the very narrow pesticidal spectrum of Cry proteins. In this report, we investigated on constructing an engineered strain by introducing the cry8Ca2 gene to strain BT185 for the future development of biopesticides against A. corpulenta and H. parallela.

Materials and methods Strains, plasmids, and cultivation condition Escherichia coli JM110 was used for transformations, whereas E. coli SCS110 was used to produce unmethylated plasmid DNA for B. thuringiensis transformations. B. thuringiensis isolate BT185 was used as the recipient strain. Wild B. thuringiensis isolate HBF-1, which contains the cry8Ca2 gene, was used as a positive control for a bioassay against A. corpulenta. E. coli was grown at 37 °C in Luria–Bertani (LB) medium (1% NaCl, 1% tryptone, and 0.5% yeast extract). B. thuringiensis strains were plated on Peptone–Beef (PB) medium (0.3% beef extract and 0.5% peptone, pH 7.2) at 30 °C. Antibiotic-resistant Bt strains were selected on erythromycin (5 µg/ml). Plasmid pMAD was used for homologous recombination in B. thuringiensis (Arnaud et al. 2004). The pSTK-8C plasmid provided the cry8Ca2 gene and cry3Aa7 promoter. DNA manipulation and transformation All of the nucleotide sequences of oligonucleotide primers are shown in Table 1. DNA manipulation and E. coli transformation were carried out as described by Sambrook et al. (2000). Transformation of B. thuringiensis was performed as described by (Lereclus et al. 1989). Taq DNA polymerase, high-fidelity KOD polymerase, and restriction enzymes were purchased from TaKaRa, ToYoBo, and New England Biolabs, respectively. T4 DNA ligase was purTable 1 Nucleotide sequences of oligonucleotide primers Primers

Sequences

8E (270) cry8 (1) pFe5 pRe3 pEX5 pEX3 Eblot5 Eblot3

TGTACTATATAGGCTCACAATCGG ATGAGTCCAAATAATCAAAATG CGACGCGTTTCACATAAATGCTGAAAT CATGCCATGGAAACGTCCAGATAAATATAAGAA TGTATCTGGTAGGGGAGCTTAATTAAAG ACAATTCTTTCGGGCAAAAAACCCCTCAA GGTAGGAAAGAATTGTCGCATG GTAACAGATGTGACGGAGTT

chased from TaKaRa. A polymerase chain reaction (PCR) product purification kit was purchased from Axygen. Location of cry8Ea1 gene Plasmid DNA of BT185 was isolated according to the method of (Song et al. 2003). The pattern of the plasmid DNA was identified to be the same as in (Yu et al. 2006). Then, the DNA bands with different molecular weights were recovered from an agarose gel. The pair of primers 8E (270) and cry8 (1), based on specific nucleic acid sequences of the variable region, was used to amplify the cry8Ea1 gene fragment, and the PCR product was subsequently sequenced to identify cry8Ea1 gene. Construction of integrated vector The tnp167B gene located upstream of the cry8Ea1 gene was found by the analysis of a 7.2-kb fragment digested by restriction enzyme SmaI. The 7.2-kb fragment was obtained in the experiment of cloning cry8Ea1 gene (Yu et al. 2006). The 1.6-kb tnp167B gene was amplified with primers pFe5 and pRe3. Plasmid DNA from B. thuringiensis strain BT185 was used as a template for the PCR reaction. The full-length 4.3-kb cry8Ca2 gene with cry3Aa7 promoter was amplified with primers pEX5 and pEX3 and was inserted into the HpaI restriction enzyme site in the tnp167B gene. Then, the 5.9-kb fusion gene fragment was treated with restriction enzymes MluI and NcoI and subsequently purified on an agarose electrophoresis gel. The purified fragments were cloned in the corresponding restriction site of vector pMAD (“Thermosensitive recombination system” in (Arnaud et al. 2004)). From this procedure, a novel plasmid-designated pMEC was created (Fig. 1). Homologous recombination A two-step procedure was then used for allele replacement in B. thuringiensis. In the first step, pMEC was transformed into B. thuringiensis strain BT185 by electroporation, as described by (Lereclus et al. 1989). Transformants were selected after 2-day incubation on an LB medium plate containing erythromycin (5 µg/ml) at 30 °C. In the second step, one positive colony was inoculated into the liquid LB medium and incubated at 30 °C for 12 h, with shaking at 230 rpm. A 1% aliquot of the overnight cultivation was inoculated into fresh LB medium without antibiotic and incubated with shaking for 2.5 h at 38 °C, followed by two more repetitions of this manipulation. The thermosensitive plasmid pMEC could be eliminated in this temperature. Serial dilutions of this culture were plated on LB medium. The colony was transferred onto LB medium with erythromycin (5 µg/ml) and without antibiotic at the corresponding position,


245

Fig. 1 Simplified maps of the plasmid constructed in this study. The plasmid pMAD contained a temperature-sensitive replication region named ori pE194ts, the ermC gene (erythromycin resistance gene), the bgaB gene (β-galactosidase gene) with a plcpB promoter (from S. aureus), and the bla gene (β-lactamases gene). Plasmid pMEC was

constructed by inserting a 5.9-kb fragment gene into the MCS of pMAD digested by restricted enzymes MluI and NcoI. In the inserted fragment, the 4.3-kb core of the cry8Ca2 encoding region with the cry3Aa7 promoter region was flanked by the1.6-kb tnp167B gene

respectively. After incubation at 30 °C for 2 days, one colony was sensitive to erythromycin, and PCR amplifications with primers pFe5 and pRe3 were performed to confirm the 4.3-kb gene insertion.

conjugated with AP and detected by NBT/BCIP chromogenic system. The following procedure was the same as that of (Wang et al. 2006). Scanning electron microscopy examination

Southern blotting assay The plasmid DNA of the positive colony and B. thuringiensis strain BT185 were extracted and digested by restriction enzyme XcmI, and both of the products were used for Southern blotting. The primer pairs Eblot5 and Eblot3 were designed according to the XcmI-digested fragment and were used to amplify the 665-bp probe sequence contained in tnp167B gene. The probe was labeled using digoxigenin and immunodetected with anti-digoxigenin conjugated to alkaline phosphatase (AP), and then it was visualized with the colorimetric substrates nitroblue tetrazolium chloride (NBT) and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP). The method of hybridization was the same as in (Sambrook & Russell 2000). The hybridization kit was purchased from Roche Group. Preparation of Cry protein and analysis of Western blotting At appropriate intervals (approximately every 2–4 h), the BT185 strain culture was collected by centrifugation and SDS-PAGE was performed on an 8% gel, according to the method of (Sambrook & Russell 2000). Western blotting experiments were performed on spore– crystal extracts from B. thuringiensis. After lysis, spore– crystal mixtures from 1.0-ml cultures were harvested by centrifugation at 12,000×g, washed once in 1.0 M NaCl and once in distilled water, and then resuspended in distilled water. After the samples were separated by SDS-PAGE, proteins were electro-transferred to a PVDF membrane. Antibody protein raised in rabbits of Cry8Ca2 extracted from Bt strain HBF-1 was used in Western blotting with 1:30,000 dilution. The secondary antibody was produced in sheep

All B. thuringiensis strains were incubated in PB medium at 30°C and harvested by centrifugation for 10 min at 10,000×g after sporulation. The pellets were resuspended three times in sterile distilled water, and the spore–crystal mixture was fixed in dehydrated inethanol–propylene oxide and 1% OsO4. The strains were sputter-coated with gold in an IB-5 ion coater (Hitachi) for 5 min and then examined and photographed in a Zeiss 950 digital scanning microscope at a voltage of 12 kV. Stability assay of foreign cry gene The segregation stability of the cry8Ca2 gene in the recombinant strain was monitored. The strain was incubated in LB broth at 30 °C with shaking at 230 rpm, and the samplings of every 12 h were used to determine segregation stability. The samples were serially diluted and plated on LB plates and grown at 30 °C for 12 h, and the genomic DNA of 300 randomly selected colonies was extracted and used for detecting the presence of the cry8Ca2 gene by PCR. We sampled until 96 h (90% of the cells lysed and release spores and crystals). Each stability test was repeated twice, and the average values were presented. Insect bioassays Methods for the H. parallela and A. corpulenta insect bioassays were adapted from (Yu et al. 2006), with some modification. Spores and crystals of the B. thuringiensis strain were harvested and resuspended in sterilized water. The number of spores in suspensions was calculated, and 18-ml suspensions with 1.5-fold serial dilutions were added

246

to 100 g of soil containing potato pieces sterilized under ultraviolet light in a six-well plate. Each well of the plate contained one 7-day-old scarab larva for each species (H. parallela and A. corpulenta). Bioassays were conducted at 25 °C with soil humidity of 18–20%. Distilled water was used as a negative control when mixed with the soil containing potato pieces. Larval mortality was scored after incubation for 7 and 14 days, respectively, and each treatment was repeated in triplicate. The LC50 values were determined using the 14-day data and probit analysis (Finney 1971).

Results Location of cry8Ea1 gene B. thuringiensis strain BT185 contained six large endogenous plasmids with molecular masses of 191, 161, 104, 84, 56, and 37 kb, respectively (Yu et al. 2006). PCR amplification results indicated that the cry8Ea1 gene was located on the largest inner plasmid (191 kb) of the BT185 strain (data not shown). Sequence analysis of PCR products also certified this result. Construction of recombinant plasmid pMEC and homologous recombination The 5.9-kb fragment containing the cry3Aa7 promoter and cry8Ca2 gene flanked by the upstream and downstream sequences of tnp167B was inserted into the multiple cloning site of the pMAD vector, and the recombinant plasmid pMEC was obtained. By using homologous recombination in vivo, the expression cassette located on pMEC plasmid was inserted to tnp167B gene, which is located on the resident plasmid of the BT185 strain. The Southern blot is shown in Fig. 2. In lane 1, the 1.0-kb wild tnp167B segment was detected. In

Fig. 2 Results of Southern blotting analysis of the recombination engineered strain BIOT185. Lane M, marker (6.0, 4.0, 3.0, 2.5, 2.0, 1.5, 1.0, 0.75, and 0.5 kb); lane 1, plasmid of recombinant strain BIOT185 treated with XcmI restriction enzyme and hybridized to the approximately 5.3-kb band; lane 2, endogenous plasmid of wild-strain BT185 digested by XcmI restriction enzyme and hybridized to the approximately 1.0-kb band


lane 2, the 5.3-kb fused gene was hybridized without the 1.0-kb band, suggesting that in the recombinant strain the 4.2-kb expression region of the cry8Ca2 gene was integrated into the endogenous plasmid of the BT185 strain and that the recombinant plasmid pMEC was eliminated. The novel recombinant B. thuringiensis strain was designated BIOT185. Scanning electron microscopy examination Spore–crystal mixtures from the BT185 strain, HBF-1 strain, and the recombinant strain BIOT185 were examined under a scanning electron microscope (Fig. 3). Crystal observation indicated that BIOT185, B. thuringiensis strain BT185, and HBF-1 could produce orbicular crystals (Fig. 3a–c, respectively), and there was no visible difference between strains. Cry protein analysis Crystal protein produced by BT185, HBF-1 (a wild-type strain containing the cry8Ca2 gene only), and recombinant strain BIOT185 were analyzed. SDS-PAGE analysis showed that the parent BT185 strain and the recombinant strain BIOT185 had 130-kDa components (Fig. 4a). The presence of Cry8Ca2 polypeptide in spore–crystal mixtures from recombinant strain BIOT185 was confirmed by Western blotting analysis (Fig. 4b) using antiserum against Cry8Ca2 polypeptide from B. thuringiensis strain HBF-1. Stability assay of foreign cry gene The results of the stability test indicated that the cry8Ca2 gene contained in recombinant strain BIOT185 was very stable. Until continuous cultivation of 96 h, all the selected colonies contained the cry8Ca2 gene. Bioassay against coleopteran insect larvae The BT185 strain, HBF-1, and recombinant strain BIOT185 were tested in bioassays against H. parallela and A. corpulenta larvae, respectively (Table 2). The results showed that, in addition to the activity against H. parallela larvae that is shared with host strain BT185, the recombinant strain BIOT185 gained high insecticidal activities against A. corpulenta larvae.

Discussion Construction of engineered strains is one of the traditional ways to improve B. thuringiensis. The engineered strains, with broadened insecticidal spectrum or higher toxicity, are mainly constructed by introducing an interrelated gene to


247

Fig. 3 Photos of engineered strain BIOT185 taken with a scanning electron microscope. a BIOT185 (×8,000), b BT185 (×8,000), c HBF-1 (×8,000). All of the three strains produced orbicular crystals

the parental strains. An engineered strain with broadened insecticidal spectrum was constructed by introducing the cry3Aa7 gene into wild-strain G03 (B. thuringiensis subsp. aizawai), which contained the cry1Aa, cry1Ac, cry1Ca, and cry2Ab genes. The new recombinant strain not only showed high insecticidal activity against the lepidopteran pests (Spodoptera exigua, Plutella xylostella, and Helicoverpa amigera) but also conferred new toxicity against the coleopteran elm leaf beetle (Pyrrhalta aenescens) (Wang et al. 2006). The B. thuringiensis subsp. aizawai recombinant strain was conferred to have significantly higher toxicity than that of the parental strain by introducing the expression of high levels of chitinase (Thamthiankul et al. 2004). In China, A. corpulenta and H. parallela are two of

the severe species of the scarab family and cause damage to fields synchronously. Strain HBF-1 and BT185 were not easy to be applied in A. corpulenta and H. parallela control directly because HBF-1 was only toxic to A. corpulenta while BT185 was only toxic to H. parallela. In the present work, we constructed a new strain, BIOT185, from the two origin strains HBF-1 and BT185. BIOT185 had a broadened insecticidal spectrum compared to the origin strains and was toxic to both H. parallela and A. corpulenta. Cry8Ea1 and Cry8Ca2 proteins coexpressed in one B. thuringiensis strain could simplify the fermentation process and reduce the cost. The broadened insecticidal spectrum of BIOT185 makes it a potential candidate for developing a new B. thuringiensis pesticide for A. corpulenta and H. parallela management. Furthermore, in this report, BIOT185 gained higher insecticidal activities against A. corpulenta larvae. Similar to this report, Yan et al. have reported that an engineered B. thuringiensis strain 3A-HBF corporate expressed Cry3Aa and Cry8Ca with higher toxicity (C. bowringi and A. corpulenta) than the original BT22 (contained cry3Aa) and HBF-1 (contained cry8Ca) (Yan et al. 2009). It seems that these coleopteran larva specific toxins have a synergistic activity when applied together. These results do suggest that the following work

Table 2 Insecticidal bioassay results of the engineered strain BIOT185 Fig. 4 SDS-PAGE and Western blotting analysis results of engineered strain BIOT185. a SDS-PAGE. Lane M, marker (212, 116, 97, and 66 kDa); lane 1, recombinant strain BIOT185; lane 2, wild-strain BT185; lane 3, complement strain HBF-1. b Western blotting with Cry8Ca2 antibody. Lane M, marker (212, 116, 97, 66, and 45 kDa); lane 1, recombinant strain BIOT185 expressing both Cry8Ca2 and Cry8Ea1 protein with a 130.5-kDa molecular mass; Lane 2, wildstrain BT185 expressing Cry8Ea1 and Cry8Fa1 protein (130.5 kDa); lane 3, complement strain HBF-1 expressing Cry8Ca2 protein (130.5 kDa) only

Strain

Insecticidal activity (LC50) (95% confidence interval) A. corpulenta (×108CFU/g)

H. parallela (×108CFU/g)

BIOT185 HBF-1

1.622 (0.949–2.425) 1.388 (0.758–2.028)

0.842 (0.298–1.346) NA

BT185

NA

10.450 (6.547–12.910)

NA no activity

248

should focus on the understanding and demonstrate the synergism. There are several methods for construction of engineered B. thuringiensis strains. Kaur used the conjugation method to broaden the insecticidal spectrum of Bt wild strains (Kaur 2000). This conventional approach suffers from limitations of accurate localization of cry genes on chromosomes or endogenous plasmids, plasmid incompatibility, and eventual segregation loss of plasmid in transconjugant strains. The electroporation method was developed with a series of shuttle vectors that are functional both in Gramnegative and Gram-positive bacteria and was also applied in broadening the insecticidal spectrum of Bt wild strains (Wang et al. 2006). This method has always suffered the instability of plasmids and introduced antibiotic genes and other unnecessary foreign genes, which could cause environmental threats. The homologous recombination and transposon methods have been advocated to insert foreign genes into resident plasmids as well as into the chromosome (Baum et al. 1996; Poncet et al. 1997). Lereclus et al. have delivered the cry3A gene into the 75-kb plasmid in strain HD73 and used temperature-sensitive shuttle vector pRN5101 by homologous recombination. The resulting strain displayed insecticidal activity against both Lepidoptera and Coleoptera (Lereclus et al. 1992). Kalman et al. combined transformation with transduction to integrate the cry1C gene into the chromosome of B. thuringiensis subsp. kustaki strain. In the recombinant strain, the expression and stability of the Cry1C protein had been improved remarkably (Kalman et al. 1995). In the present study, the new strain BIOT185 was constructed by integrating the cry8Ca2 gene into the endogenous plasmid of BT185 by allele recombination, using the temperature-sensitive plasmid pMAD (Arnaud et al. 2004). In strain BIOT185, the cry8Ca2 gene was located near the cry8Ea1 gene on the same endogenous plasmid. The results of the Western blot analysis, genetic stability assay, and bioassay suggest that the expression and stability of the cry8Ca2 gene were considerable. Additionally, in the process of allele replacement, only the expression cassette that contained the cry3Aa7 promoter and cry8Ca2 gene was introduced to the endogenous plasmid, which implies that no antibiotic gene or other unnecessary genes that could cause environmental damage were introduced to the new strain. In conclusion, the new engineered strain BIOT185, constructed in this work, was toxic to both H. parallela and A. corpulenta larvae. In the future, this strain could be used for developing an environment-friendly biopesticide. Acknowledgements We are very grateful to Dr. Qinglei Wang for the supply of test larvae and for the help with the bioassays. This work was supported by Project 973 (No. 2009CB118902, 2007CB109203), Plan 863 (No.2006AA10A212), and 2009ZX08009-030B, 2009ZX08009-031B.


References Arnaud M, Chastanet A, Débarbouillé M (2004) New vector for efficient allelic replacement in naturally nontransformable, lowGC-content, Gram-positive bacteria. Appl Environ Microbiol 70:6887–6891 Baum JA, Kakffuda AM, Gawron-Burke C (1996) Engineering Bacillus thuringiensis bioinsecticides with an indigenous sitespecific recombination system. Appl Environ Microbiol 62:4367–4373 Finney DJ (1971) Probit analysis. Cambridge University Press, Cambridge United Kingdom Kalman S, Kiehne KL, Cooper N, Reynoso MS, Yamamoto T (1995) Enhanced production of insecticidal proteins in Bacillus thuringiensis strains carrying an additional crystal protein gene in their chromosomes. Appl Environ Microbiol 61:3063–3068 Kaur S (2000) Molecular approaches towards development of novel Bacillus thuringiensis biopesticides. World J Microbiol Biotechnol 16:781–793 Keller S, David-Henriet AI, Schweizer C (2000) Insect pathogenic soil fungi from Melolontha melolontha control sites in the canton Thurgau. In: Keller S (ed) Integrate Control of Soil Pest Subgroup “Melolontha”. Conference Proceeding IOBC/WPRS, vol. 23, pp 73–78 Lereclus D, Arantes O, Chaufaux J, Lecadet MM (1989) Transformation and expression of a cloned δ-endotoxin gene in Bacillus thuringiensis. FEMS Microbiol Lett 60:211–218 Lereclus D, Vallade M, Chaufaux J, Arantes O, Rambaud S (1992) Expansion of insecticidal host range of Bacillus thuringiensis by in vivo genetic recombination. Biotechnology 10:418–421 Luo C, Guo XJ, Zang ZL (2008) Species identification of white grubs in lawns around Beijing and their damage characteristics. Acta Entomologica Sinica 51:108–112 Peters A (2000) Susceptibility of Melolontha mololontha to Heterorhabditis bacteriophora, H. megidis and Steinernema glaseri. In: Keller S (ed) Integrated control of soil pest subgroup “Melolontha”. Conference Proceeding IOBC/WPRS, vol. 23, pp 39–45 Poncet S, Bernard C, Dervyn E (1997) Improvement of Bacillus sphaericus toxicity against dipteran larvae by integration, via homologous recombination, of the Cry11A toxin gene from Bacillus thuringiensis subsp. israelensis. Appl Environ Microbiol 63:4413–4420 Sambrook J, Russell D (2000) Molecular cloning: a laboratory manual, 3rd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Schnetter W, Mitterüller R, Fröschle M (1996) Control of the cockchafer Melolontha in the Kraichgau with NeemAzal-T/S. In: Keller S (ed) Integrated control of soil pests. Conference Proceeding IOBC/WPRS, vol. 19, pp. 95–99 Shu CL, Liu RM, Wang RY, Zhang J, Feng SL, Huang DF, Song FP (2007) Improving toxicity of Bacillus thuringiensis strain contains the cry8Ca gene specific to Anomala corpulenta larvae. Curr Microbiol 55:492–496 Shu CL, Yan GX, Wang RY, Zhang J, Feng SL, Huang DF, Song FP (2009) Characterization of a novel cry8 gene specific to Melolonthidae pests: Holotrichia oblita and Holotrichia parallela. Appl Microbiol Biotechnol 84:701–707 Song FP, Zhang J, Gu AX, Wu YE, Han LL, He KL, Chen ZY, Yao J, Hu YQ, Li GX, Huang DF (2003) Identification of cry1I-type genes from Bacillus thuringiensis strains and characterization of a novel cry1I-type gene. Appl Environ Microbiol 69:5207– 5211 Thamthiankul S, Moar WJ, Miller ME, Panbangred W (2004) Improving the insecticidal activity of Bacillus thuringiensis subsp. aizawai against Spodoptera exigua by chromosomal

Appl Microbiol Biotechnol (2010) 87:243–249 expression of a chitinase gene. Appl Microbiol Biotechnol 65:183–192 Wang GJ, Zhang J, Song FP, Wu J, Feng SL, Huang DF (2006) Engineered Bacillus thuringiensis GO33A with broad insecticidal activity against lepidopteran and coleopteran pests. Appl Microbiol Biotechnol 72:924–930 Wei X, Deloach CJ (1995) Biological control of white grubs (Coleopera: Scarabaeidae) by larvae of Promachus yesonicus (Diptera: Asilidae) in China. Bio Control 5:290–296

View publication stats

249 Yan G, Song F, Shu C, Liu J, Liu C, Huang D, Feng S, Zhang J (2009) An engineered Bacillus thuringiensis strain with insecticidal activity against Scarabaeidae (Anomala corpulenta) and Chrysomelidae (Leptinotarsa decemlineata and Colaphellus bowringi). Biotechnol Lett. doi:10.1007/s10529009-9913-8 Yu H, Zhang J, Huang DF, Gao JG, Song FP (2006) Characterization of Bacillus thuringiensis strain Bt185 toxic to the Asian cockchafer: Holotrichia parallela. Curr Microbiol 53:13–17