Construction of a YAC library1 from barley cultivar Franka and ...

Color profile: Generic CMYK printer profile Composite Default screen

1031

Construction of a YAC library1 from barley cultivar Franka and identification of YAC-derived markers linked to the Rh2 gene conferring resistance to scald (Rhynchosporium secalis) Dagmar Schmidt, Marion S. Röder, Harald Dargatz, Norbert Wolf, Günther F. Schweizer, Andy Tekauz, and Martin W. Ganal

Abstract: The Rh2 resistance gene of barley (Hordeum vulgare) confers resistance against the scald pathogen (Rhynchosporium secalis). A high-resolution genetic map of the Rh2 region on chromosome 1 (7H) was established by the use of molecular markers. Tightly linked markers from this region were used to screen existing and a newly constructed yeast artificial chromosome (YAC) library of barley cv. Franka composed of 45 000 clones representing approximately two genome equivalents. Corresponding YAC clones were identified for most markers, indicating that the combined YAC library has good representation of the barley genome. The contiguous sets of YAC clones with the most tightly linked molecular markers represent entry points for map-based cloning of this resistance gene. Key words: yeast artificial chromosomes, map-based cloning, disease resistance gene, library screening, Hordeum vulgare. Résumé : Le gène Rh2 chez l’orge (Hordeum vulgare) confère la résistance à l’agent causal de la rhynchosporiose, le Rhynchosporium secalis. Une carte génétique à haute résolution de la région du chromosome 1 (7H) où se trouve Rh2 a été produite à l’aide de marqueurs moléculaires. Des marqueurs fortement liés provenant de cette région ont été utilisés pour cribler une banque génomique du cultivar Franka comptant 45 000 clones YAC (chromosomes artificiels de levure), soit l’équivalent d’environ deux génomes. Des clones YAC ont été identifiés pour la plupart des marqueurs indiquant que la banque YAC offre une bonne représentativité du génome de l’orge. Les contigs de clones YAC portant les marqueurs les plus fortement liés constituent des points de départ en vue du clonage positionnel de ce gène de résistance. Mots clés : chromosomes artificiels de levure, clonage positionnel, gène de résistance, criglage de banques, Hordeum vulgare. [Traduit par la Rédaction]

Schmidt et al.

1040

Introduction Yeast artificial chromosome (YAC) clones with DNA inserts in the range of several hundred kilobases are important tools for genomic analysis and map-based cloning in higher eukaryotic organisms (Burke et al. 1987). YACs are eukaryotic chromosomes that can harbour large segments of a eukaryotic donor genome. YAC libraries have been constructed for a number of plants species such as rice (Oryza

sativa) (Umehara et al. 1995), sugar beet (Beta vulgaris) (Eyers et al. 1992; Kleine et al. 1995), tomato (Lycopersicon esculentum) (Martin et al. 1992; Bonnema et al. 1996), and maize (Zea mays) (Edwards et al. 1992). Many of these libraries have been successfully used for map-based cloning of agronomically interesting genes (Martin et al. 1993; Cai et al. 1997; Ling et al. 1999). Recently, large insert libraries have also been constructed in bacterial artificial chromosomes (BACs). Compared with

Received April 9, 2001. Accepted August 13, 2001. Published on the NRC Research Press Web site at http://genome.nrc.ca on October 18, 2001. Corresponding Editor: G.J. Scoles. D. Schmidt,2 M.S. Röder, and M.W. Ganal. Institute for Plant Genetics and Crop Plant Research, Corrensstr. 3, 06466 Gatersleben, Germany. H. Dargatz. Weissheimer Malz, Schaarstr. 1, 56626 Andernach, Germany. N. Wolf. Maltagen GmbH, Schaarstr. 1, 56626 Andernach, Germany. G.F. Schweizer. Bayerische Landesanstalt für Bodenkultur und Pflanzenbau (LBP), Biotechnologie, Vöttingerstr. 38, 85354 Freising, Germany. A. Tekauz. Agriculture and Agri-Food Canada, Cereal Research Center, Winnipeg, MB R3T 2M9, Canada. 1 2

The YAC library described is now curated by Maltagen GmbH to whom requests for screening should be addressed. Corresponding author (e-mail: [email protected]).

Genome 44: 1031–1040 (2001)

I:\gen\gen44\gen-06\G01-108.vp Monday, October 15, 2001 10:36:49 AM

DOI: 10.1139/gen-44-6-1031

© 2001 NRC Canada


1032

BAC libraries, the construction of YAC libraries is more costly and labour intensive, and part of the library may consist of chimeric or instable clones. However, plant BAC libraries rarely have insert sizes of more than 150 kb, whereas plant YAC libraries frequently have inserts larger than this size. YACs for barley (Hordeum vulgare) have been constructed by several laboratories in the past 10 years (Kleine 1993; Kleine et al. 1997; Simons et al. 1997). However, each of these libraries has inherent problems regarding their usefulness for barley genome analysis and map-based cloning. For example, the libraries described by Kleine (1993) and Kleine et al. (1997) contain less than one genome equivalent of barley DNA. We report here on the construction of a YAC library containing 45 000 individual clones representing almost two genome equivalents of barley cv. Franka. The library complements the YAC libraries of Kleine (1993) and Kleine et al. (1997) to provide a library of three times genome coverage and a more than 95% probability of finding any particular sequence from the barley genome represented on at least one YAC clone (Clarke and Carbon 1976). We used this combined barley YAC library to isolate clones for single-copy molecular markers from chromosome 1 of barley that were identified in the vicinity of the Rh2 resistance gene (Schweizer et al. 1995) by high-resolution mapping. The Rh2 gene confers resistance against the fungal pathogen Rhynchosporium secalis (Oud.) Davis, which causes scald of barley, an important disease in moist temperate areas such as central Europe.

Materials and methods Construction of a high-resolution map for a region of barley chromosome 1 In an F2 progeny of the cross ‘Atlas’ × ‘Steffi’ (1482 plants), recombinant plants near the marker MWG555 were identified by screening respective DNAs with the restriction fragment length polymorphism (RFLP) probes MWG555, R2869, and PSR119. The recombinant plants were advanced to F3, and homozygous recombinants were selected by probing with the respective markers. Disease tests against scald were performed in the F4 and F5 generations at the seedlings stage in the Bayerische Landesanstalt (Freising) and at Agriculture and Agri-Food Canada using protocols described previously (Tekauz 1991; Graner and Tekauz 1996). Additional RFLP markers were probed to the homozygous F4 plants and a map of the chromosomal region was constructed.

Plant material and preparation of high molecular weight (HMW) DNA DNA from ‘Franka’ was used as the source for YAC cloning. This variety is one of the parents of the mapping population described by Graner et al. (1991) and is susceptible to Rhynchosporium secalis. HMW DNA was originally provided by Paul Schulze-Lefert (University of Aachen, Germany, and Sainsbury Laboratory, Norwich, U.K.) or was prepared from leaf protoplasts according to Wu et al. (1992). Protoplasts were embedded in low melting point (LMP) agarose (Gibco BRL, Gaithersburg, Md.) plugs at a concentration of 107 cells/mL, corresponding to about 10 µg DNA/100 µL agarose plug. DNA was released from the agarose by agarase treatment (New England Biolabs, Beverly, Mass.).

Genome Vol. 44, 2001

Host strain and vector preparation Saccharomyces cerevisiae AB1380 and vector pYAC4 (Burke et al. 1987) were used as vector–host system. Vector plasmid was isolated with the Plasmid Maxi Kit (Qiagen, Hilden, Germany), digested with BamHI, dephosphorylated, and cut with EcoRI (Albertsen et al. 1990).

Partial digestion, ligation, and size selection Several methods for partial digestion of HMW plant DNA have been developed. Complete digestion can be avoided by the use of specific amounts of limiting enzyme (Burke et al. 1987) or suboptimal incubation temperature (Lee et al. 1992), limiting incubation time (Anand et al. 1989), or competition with a methylase recognizing the same DNA sequence as the endonuclease (Hanish and McClelland 1990; Larin et al. 1991). We found using specific amounts of a limiting enzyme the most reproducible approach. Aliquots of the HMW DNA (30 µL) were digested overnight (agarose-embedded DNA) or for 2 h (released DNA) with various amounts of EcoRI (0.003–30 U). Test digestions with 0.3–3 U restriction enzyme resulting in most fragments in the size range of 200–1000 kb were scaled up 40-fold. EcoRI was inactivated by incubating at 65°C for 10 min (Martin et al. 1992) or by proteinase K treatment (Kleine et al. 1997). Ligation reactions were set up with equal mass amounts of vector and partially digested insert DNA. Two successive size selection steps on a pulsed-field gel (PFG) (CHEF DRII, Bio-Rad, Hercules, Calif.; conditions: 25 s, 110 V, 20 h, 14°C, 1% LMP agarose) removed small ligation products and self-ligated vector (Albertsen et al. 1990; Anand et al. 1989). The rest of the DNA was focused in the limiting mobility band and recovered from the gel as described by Martin et al. (1992).

Transformation Yeast spheroplast transformation was done according to Burgers and Percival (1987) with some modifications, as described by McCormick et al. (1990) and Martin et al. (1994). Transformants were transferred to double-selective plates (SD medium (–Ura, –Trp)) after 5–7 days to screen for the presence of insert and both vector parts. Clones with the desired phenotype (Ura+Trp+red) were picked and individually stored in 384-well plates at –80°C.

Screening of the library DNA pools of each 384-well plate were prepared. For this purpose, the clones were plated on agar medium and grown for 2–3 days. The yeast cells were suspended in 10 mL TE (10 mM Tris–HCl (pH 8.0 at 25°C), 1 mM EDTA) with 20% glycerol. Of this suspension, 1 mL was transferred to a 1.5-mL tube and pelleted. After addition of 250 µL glass beads (0.45–0.5 mm, Braun Biotech, Melsungen, Germany) and 400 µL extraction buffer (200 mM Tris–HCl (pH 7.5), 250 mM NaCl, 25 mM EDTA, 0.5% SDS), the suspension was vortexed for 5 min. Cell debris and glass beads were pelleted and the supernatant was transferred to a new tube. DNA was precipitated with isopropanol and dissolved in 400 µL water. An aliquot of 1 µL was used for each PCR. DNA probes to be used for screening the library were sequenced and PCR primer pairs were chosen with Primer 0.5 (Whitehead Institute 1991). Primer pairs that amplified a product specific for the probe were used to screen the library in a three-step process (Table 1). Pools (384 clones each) were screened, and positive pools were divided into four subpools (96 clones each) and tested again. The positive subpool was then divided into pools of columns (1–12) and rows (A–H). The third screening step resulted in the coordinates of the positive clone, confirmed by single clone PCR and hybridization. © 2001 NRC Canada



Schmidt et al.

1033

Table 1. PCR primer combinations and annealing temperatures for screening the YAC library. Primers (5′→3′) Probe name

Forward

Reverse

TA (°C)

FB9 FPM6 FPSR119 118R 181R MWG555 MWG2018 181L 231L R2869

TCATTGAGTTGGCTACAAATGG ACGCTTTCACAAAGTGGCTT TCAGAACATAGATTGCCTCATG TGGAGAACTTTTTGAACGGC TCATCGAAGAAGCTTACAATCA GATTGGATTTTTTTTTGGATGG ACCTACCTCGTGGAGGCC CGAAGCAGCATAAATACGCA AAGATGCCGATGAGAAATGG GCTGTCACTAGAATTGGTCTTGC

ATTTGTTCGCAATACGTTTGC GTACGTCCTACTGAACGAGGTT TAGTCCACCCGGAAGTTGTC ACGCGTTGGATCTTTTGGT CCTCTCAAATATTCCACTCTGG AGCCCACTCTACTATGACGT CGTCGCCCAAGTCTAAGAAG TGTCGAAGTCACAGCACACA CATAAACTGCCATACGGCCT CCCTGCTCCAAGTGTGCT

60 55 55 60 60 60 65 60 60 60

Note: TA, annealing temperature.

YAC clone analysis The protocol described by Carle and Olson (1985) was adjusted to 5-mL culture volume. The DNA was separated on a PFG (60 s, 24 h, 170 V). For blotting, the DNA was UV-nicked, denatured in 0.4 N NaOH, and blotted onto Hybond N+ membrane (Amersham, Braunschweig).

Isolation of insert ends Left insert ends proximal to the centromere of the YAC were isolated by plasmid rescue, as described in Schmidt and Dean (1992), with the restriction enzyme XhoI. Right insert ends distal to the centromere were isolated by inverse PCR (Schmidt and Dean 1992; Putterill et al. 1993) with the restriction enzymes AluI or SalI and the primer combinations C70–C69 or C70–C72.

Results Characterization of the YAC library The barley YAC library constructed consists of 45 000 clones individually stored in 117 microtiter plates of 384 wells each. Approximately 1% of the library (500 clones) was surveyed via pulsed-field gel electrophoresis (PFGE) and inserts ranged in size from 50 to 1000 kb (Fig. 1). Ninety percent of the clones contain inserts larger than 100 kb, and more than 60% contain inserts larger than 150 kb (Table 2). The average insert size is 214 kb. The library contains approximately 9600 Mb of barley DNA, which corresponds to almost two times genome coverage according to genome size estimations of 4900 Mb by Arumuganathan and Earle (1991) and 5500 Mb by Bennett and Smith (1976). The barley origin of the inserts was confirmed by hybridization to genomic barley DNA (Fig. 1C). Our library has been merged with previously described barley YAC libraries (Kleine 1993; Kleine et al. 1997) resulting in a barley YAC library that comprises approximately three genome equivalents. According to calculations given by Clarke and Carbon (1976), this provides a >95% chance of finding at least one positive YAC clone for each screened single-copy probe. All further results reported in this paper refer to the merged library. High-resolution mapping of the resistance gene Rh2 on chromosome 1 From previous work, it was known that the Rh2 scald resistance gene originating from the landrace ‘Atlas’ resides

on barley chromosome 1, close to the RFLP marker loci CDO545 and MWG555A (Schweizer et al. 1995). The addition of more progeny in the resistance screening coupled with additional markers facilitated the placement of Rh2 between MWG2018 and MWG555. A recombinant screen for the chromosomal region between R2869 and PSR119 was performed in a large F2 progeny and resulted in 15 recombinants out of 1482 plants (2964 gametes) for the interval MWG555–R2869 and in 18 recombinants out of 741 plants (1482 gametes) for the interval MWG555–PSR119. After advancing the recombinant plants to homozygosity, a high-resolution genetic map was constructed (Fig. 2). The Rh2 resistance gene maps distal to MWG555A and is flanked by this marker (0.74 cM) and MWG2018 (0.27 cM). Marker CDO545 (Schweizer et al. 1995) is now located outside the investigated region and was not used further. Marker pM6, which was isolated and mapped by Kilian et al. (1995) to a position 0.6 cM distal from MWG555A in a ‘Steptoe’ × ‘Morex’ DH population, could not be mapped in the ‘Atlas’ × ‘Steffi’ progeny. Screening of the YAC library To investigate the usefulness of the library for map-based gene cloning, we screened it for 10 probes from the vicinity of the Rh2 gene, including four YAC ends listed in Table 3. Positive pools were detected in the first screen for all probes, verified for the presence of positive YACs by screening subpools as described in Materials and methods and shown in Fig. 3. The number of single YACs that could be extracted per probe ranged from six (MWG555) to one (118R). The positive pools found for MWG2018 and FPSR119 were not followed up for single positive YACs because the high number of positive pools indicated that both probes are not single copy. The high number of positive YACs for MWG555 had been expected because this marker has two copies in the barley genome; one on chromosome 1 near Rh2 and the other on chromosome 3 (Graner et al. 1991). The YAC clones were assigned to the two loci by a RFLP test described in Umehara et al. (1995) and shown in Fig. 4. Three YACs (100 kb, 950 kb, and 1100 kb) could be located on chromosome 1. Some of the probes originated from crop species other than barley (PSR119 from wheat (Triticum aestivum) (Chao et al. 1989) and pM6 from rice (Kilian et al. 1995)) or from © 2001 NRC Canada



1034


Fig. 1. Chromosome preparations of YAC clones, separated by PFGE (60 s, 170 V, 24 h). (A) Ethidium bromide - stained gel showing natural yeast chromosomes and some YACs (e.g., in lanes 3, 9, 10, 12, 19). (B) The gel from A was blotted and hybridized to YAC vector DNA as a probe. In each lane, only the artificial chromosome is labeled. (C) Hybridization of the same filter to genomic barley DNA as a probe. Not all artificial chromosomes are labeled at equal intensities, probably because of the different content of repetitive DNA. Weak labeling of natural yeast chromosomes enables size determination of YAC bands.

cultivars other than ‘Franka’, the barley genotype used for the YAC library, namely B9 from ‘Ingrid’ (Leister et al. 1998). Primers designed for these markers failed to give a

PCR product on ‘Franka’ DNA. To overcome this problem, we amplified a PCR product under reduced stringency from genomic ‘Franka’ DNA, cloned it, and selected the products © 2001 NRC Canada



Schmidt et al.

1035

Table 2. Distribution of YAC insert sizes in barley ‘Franka’ YAC library. Size range (kb)

Percentage of library

450

1.6 3.0 33.9 45.0 12.6 3.8

Fig. 2. Genetic map of the Rh2 region on chromosome 1 of barley. On the left, the number of recombinants is indicated in relation to all investigated gametes. The genetic distance in cM is given in brackets. Marker pM6 (dotted line) could not be mapped in this population but was mapped distal to MWG555A by Kilian et al. (1995) in a ‘Steptoe’ × ‘Morex’ population.

homologous to the original marker sequences. New primers deduced from the ‘Franka’ sequence subsequently allowed a reliable PCR screen for all three markers. For the random amplified polymorphic DNA (RAPD)-derived RFLP marker B10, which cosegregates with R2869, no PCR product could be amplified from ‘Franka’ DNA even under reduced stringency conditions. Probes MWG2018, PSR119, pM6, and B9, like MWG555, have more than one copy in the barley genome, resulting in more than the expected average of three positive pools per marker to be identified for each (Table 3). Single clones were only isolated from the pools shared by different markers. Additionally, all probes were hybridized to the YACs already found with MWG555 and R2869. By this combined approach, two pairs of markers were found to be physically linked: MWG555 with pM6 and R2869 with B10 (Table 4). Although pM6 could not be mapped into the high density map of the ‘Atlas’ × ‘Steffi’ population because of a lack of polymorphism, the location of pM6 close to MWG555 was also confirmed by data from Kilian et al. (1995). Screening the barley ‘Morex’ BAC library (Yu et al. 2000) with the same clones did not reveal additional overlaps with other probes (results not shown). The main reason for this is that the average insert size of the BAC library is only half that of the YAC library described here. The two large clones (181IIIG6 and 231IVA4, 950 and 1100 kb, respectively) were both unstable, resulting in smaller YACs of different sizes (data not shown). Most of the deleted forms of these YACs did not hybridize to MWG555 with which the YACs originally had been detected, indicating that a DNA section carrying the marker is lost preferentially. The same phenomenon was observed with two shorter MWG555 YACs from chromosome 3. Characterization of YAC insert ends The insert ends of the five YACs found for R2869 and MWG555 were isolated by plasmid rescue and inverse PCR. The original cloning products resulting from plasmid rescue (left insert end) were longer than 10 kb in all cases, making it very likely for them to carry repetitive DNA. Therefore, these end clones were digested with different restriction enzymes and the resulting subfragments were investigated for copy number in the barley genome. The right insert – vector junctions isolated by inverse PCR were found to be shorter, between 300 and 1000 bp, and were also tested for copy number. In total, five low-copy end clones and five high-copy end clones were isolated from the five YACs (Table 5). Two ends (118R, 127L) could be mapped but cosegregated with R2869,

with which the YACs had been found. Two more ends (113R, 181R) were monomorphic, and 181L hybridized to about six fragments that were either monomorphic or too weak for reliable mapping. Four of the end clones (118R, 181R, 181L, 231L) were used for rescreening the YAC library to find overlapping new YACs (Table 3). The ends of YAC113IA12 were not used because they both hybridized to YAC181IIIG6, indicating that YAC113IA12 is fully contained in YAC181IIIG6. Additionally, most of the sequence of 113R (406 bp of 489 bp) is identical to the se© 2001 NRC Canada



1036

Genome Vol. 44, 2001 Table 3. Results from the PCR-based screen of the barley YAC library. Probe name

Type of probe

No. of positive pools (no. of investigated pools)

No. of isolated single YAC clones

FB9 FPM6 FPSR119 118R 181R MWG555 MWG2018 181L 231L R2869

Barley genomic clone Barley genomic clone Barley genomic clone Barley YAC end Barley YAC end Barley genomic clone Barley genomic clone Barley YAC end Barley YAC end Rice cDNA

7 4 8 1 4 8 12 4 20 5

3 2 * 1 2 6 * 3 3 2

(4) (4) (0) (1) (3) (8) (0) (4) (5) (5)

Note: The third column gives the number of pools identified in the first screen; *, no pool was followed up for single YAC clones.

Fig. 3. PCR screening of the barley YAC library. Numbers 108–130 are DNA-pool numbers, I–IV are subpool numbers, and A–H and 1–12 are row and column numbers. W, negative control without template DNA; H, negative control with yeast DNA; P, positive control with marker plasmid; F, positive control with genomic barley DNA. (A) Screening of the pools (only part of the library is shown). Pool 118 shows the diagnostic signal. (B) Screening of the subpools of pool 118. IV is the positive subpool. (C) Screening of colums and rows of the subpool. The clone number is 118 IV E9.

quence of RFLP probe MWG555, which means that one end of YAC113IA12 is located exactly on the locus MWG555A. Large YACs have been reported to be chimeric more often than small YACs (Nagaraja et al. 1994), therefore we tested the ends of the large clones YAC181IIIG6 and YAC231IVA4. Neither end of these YACs (both of which were found with MWG555) hybridized to the other YAC, indicating that at least one of them is chimeric. To date, the Rh2 region has not been completely covered by YAC clones. However, the fact that positive pools have been found for all 10 screening probes indicates that the region is well represented in the library and that a complete contig can be constructed using additional markers to be identified.

Discussion Generation and use of a barley YAC library The high DNA content of the barley genome and the high percentage of repetitive DNA make a genomic library with very large DNA inserts a prerequisite for map-based cloning. We decided to use the YAC system because no BACs (Shizuya et al. 1992) or PACs (phage artificial chromosomes; Ioannou et al. 1994) larger than 350 kb have been reported, whereas clones of more than 1500 kb have been found in mammalian YAC libraries (Bellané-Chantelot et al. 1992; Cai et al. 1997; Larin et al. 1991). The results from screening our library confirm that clones can be isolated from a YAC library that are significantly larger than BAC clones (e.g., two clones of 950 and 1100 kb). The YAC library constructed is suitable for screening with low-copy probes. Screening with 10 different probes is described in this paper, but nine additional screenings have been performed for projects other than Rh2 cloning with probes from other chromosomes (e.g., from chromosome 5 (1H), Wei et al. 1999). Only one of these 19 probes failed to recognize any clone from the library, the others yielding at least one YAC. The library described here is composed of both EcoRI and MluI clones, which may reduce the problem of gaps, i.e., genomic regions not represented in the library. Nevertheless, such gaps still exist, indicated by the fact that no second overlapping YAC could be identified for YAC end 118R. This makes further chromosome walking steps at this position impossible and indicates the need for more markers as starting points for a complete contig. Few or no positive clones as a result of screening is not always caused by poor coverage of the library in the investigated region but may also be caused by YAC instability. Marker pM6 did not identify YAC181IIIG6 in the PCR-based screen, but only after hybridisation of pM6 to the YACs isolated for MWG555. One explanation for these findings could be that a deleted form of YAC181IIIG6, which was still carrying MWG555 but not pM6, was present in the PCR pool. Therefore, this clone was found only in the screen for MWG555 and was isolated as a full-length clone with both markers only from the original stock culture. Another explanation for the negative PCR screening result with pM6 on YAC pool 181 could be that the primer pairs recognize some but not all copies of the multi-copy probe pM6 and that the copy next to MWG555A is not among those © 2001 NRC Canada



Schmidt et al.

1037

Fig. 4. Southern blot for the assignment of the YACs isolated for MWG555 to the two loci of this marker in the barley genome. DNA of barley ‘Steffi’ (S), ‘Atlas’ (A), and ‘Franka’ (F) and DNA of the YAC clones was digested with DraI, blotted, and hybridized to MWG555. The upper band of ‘Atlas’ and ‘Franka’ was previously mapped to chr. 1, the lower one to chr. 3. The ‘Franka’ pattern resembles that of ‘Atlas’. One of the two fragments is found in every YAC and reveals its chromosomal origin. The approximate sizes of the fragments in kilobase pairs are given on the left.

recognized by PCR. This hypothesis is supported by the low number of two YACs identified for pM6, although Southern hybridizations indicated the presence of at least two copies of that marker in the barley genome, which made us expect at least six YACs in a 3× library. Another factor leading to poor screening results is an unsufficient optimization of the PCR test. We found that only robust PCR tests amplifying a strong fragment on ‘Franka’ DNA worked well on the 384-clone pools. Primer pairs that were only weakly amplifying on positive controls sometimes gave no signal at all in the YAC library, even though the region was represented. False positive pools may occur in addition to false negative screening results. The number of pools identified as positive in the original screen and the number of single clones that could be isolated from them are listed in Table 3. In most cases, more pools than single clones were identified. False positive pools often make up 20–50% of the primary screening results. We think that some of the false PCR bands may be slightly bigger or smaller than the expected one but can not be distinguished from the correct fragment size by agarose gel electrophoresis. Some other pools that turned out to be false positive show only very weak PCR fragments that may be PCR artefacts, but to be sure not to lose any YAC, we also investigated those pools. The problem of false positives has also been described for PCR-based screens of a BAC library of sugar beet and was found to be correlated with the pool size (Cai et al. 1997). False positive signals also were found in hybridization-based screens of a rice YAC library (Umehara et al. 1995). Therefore neither one library type (YACs or BACs) nor one specific screening method (PCR or hybridization) can be regarded as superior in this respect. The PCR-based screen described here is reliable and straightforward but requires barley-derived sequence information of the probes. In the case of the Rh2 region, several markers originated from species other than barley or from barley cultivars other than ‘Franka’, so primer pairs deduced from the sequences of the original marker did not amplify

Table 4. YAC clones investigated in this study. YAC clone

Size (kb)

Probes located on this YAC

45 I H2 64 II E5 94 III C12 113 I A12 116 IV D11 118 IV C11 118 IV E9 127 IV G7 152 III B5 158 III F12 171 III E3 181 III G6 207 I A11 231 IV A4 242 II H3 242 III C7 245 I F10

100 550 130 100 170 80 220 210 200 190 nd 950 200 1100 150 60 nd

pM6 pM6 181L MWG555 B9 181L R2869, B10 R2869, B10 MWG555 MWG555 231L MWG555, pM6 B9 MWG555 181R B9 MWG555

Note: Presence or absence of probes on a YAC was analysed by hybridization; nd, not determined.

the expected product with ‘Franka’ DNA. An exception was marker R2869, an apparently highly conserved cDNA from rice. For several other markers originating from wheat, rice, and ‘Ingrid’, an additional step for isolation of the marker-homologous sequences from ‘Franka’ was necessary. The ends of MluI-cloned YACs tend to be less repetitive than those of EcoRI-cloned YACs (Kleine et al. 1997). This tendency was also observed with the clones described above: three of six MluI ends were low copy, and two of these were single copy. Only one of the four EcoRI ends was low copy, another was mildly repetitive (approximately six copies), and two were repetitive. Two of the low copy ends (118R, 127L) could be mapped in barley. They cosegregate with R2869, with which the corresponding YACs had been found. This confirms that the YACs indeed carry genomic DNA © 2001 NRC Canada



1038


Table 5. Insert ends of the five YACs isolated with markers MWG555 and R2869. YAC end

Cloning site

Size (bp)

113 L 113 R

MluI MluI

118 118 127 127 181

L R L R L

MluI MluI MluI MluI EcoRI

12000 300 3100 400 4400

181 R

EcoRI

300

231 L 231 R

EcoRI EcoRI

550 1000

3500 500

Copy no.

Mapping result

Repetitive 2 copies

— Monomorphic

Repetitive 1 copy 1 copy Repetitive Approx. 6 copies

— Cosegregating with R2869 Cosegregating with R2869 — Monomorphic

2 copies

Monomorphic

Repetitive Repetitive

— —

Restriction enzymes tested and (or) used in Southern analysis EcoRI, EcoRV, HindIII, BamHI, XbaI, PstI, DraI XbaI BamHI EcoRI, EcoRV, HindIII, BamHI, XbaI, PstI, DraI EcoRI, EcoRV, HindIII, BamHI, XbaI, PstI, DraI

Note: (L) Left ends isolated by plasmid rescue and selection of nonrepetitive restriction fragments, when possible. (R) Right ends isolated by inverse PCR. The third column gives the insert sizes of the cloning products, the fourth column lists the estimated copy number in the barley genome. The last column indicates the restriction enzymes tested or those used for mapping the respective probe.

from chromosome 1. In addition, both YACs also carry B10, another marker cosegregating with R2869. One of the YACs found with MWG555, YAC181IIIG6 (950 kb), hybridizes to pM6, which could not be mapped to the ‘Atlas’ × ‘Steffi’ cross but maps 0.6 cM distal of MWG555 in the ‘Steptoe’ × ‘Morex’ population used by Kilian et al. (1995). Taking the maximum physical distance of 950 kb between both markers on the YAC and the genetic distance of 0.6 cM, the ratio of both values would be approximately 1.6 Mb/cM. This is in good accordance with the value of 1.3 Mb/cM given by Künzel et al. (2000) for the Rh2 region near the telomere of chromosome 1 and is more favourable for map-based cloning than the average value of approximately 3 Mb/cM for the barley genome (Bennett and Smith 1991; Becker et al. 1995; Simons et al. 1997). Large YACs are reported to be chimeric more often than small clones (Nagaraja et al. 1994), which was confirmed by the isolated YAC clones. Although isolated with the same marker (MWG555) and assigned to the same marker locus on chromosome 1, neither end of YAC181IIIG6 hybridized to YAC231IVA4, and vice versa. This indicates that four independent fragments may have been cloned in these two YACs. For all other YACs, we did not find any indication for chimerism. To date, a complete YAC contig covering the Rh2 region has not yet been constructed, but from current size estimations of 1.6 Mb/cM for the investigated region it seems possible to construct a contig with the described YAC library. It was shown that the YAC library represents the barley genome well, having positive pools for all but one of 19 probes used for screening. Our efforts are currently focusing on marker saturation in the Rh2 region for a chromosome landing approach (Tanksley et al. 1995) with more tightly linked markers. Owing to the extremely repetitive nature of the barley genome, the isolation of overlapping clones by chromosome walking is in most cases not feasible.

Acknowledgements We thank Beatrice Knüpfer and Heidi Haugk for excellent

technical assistance. This work was supported by a grant from the Bundesministerium für Bildung und Forschung (grant No. 0310688) and the Weissheimer Malz company.

References Albertsen, H.M., Abderrahim, H., Cann, H.M., Dausset, J., Le Paslier, D., and Cohen, D. 1990. Construction and characterisation of a yeast artificial chromosome library containing seven haploid human genome equivalents. Proc. Natl. Acad. Sci. U.S.A. 87: 4256–4260. Anand, R., Villasante, A., and Tyler-Smith, C. 1989. Construction of yeast artificial chromosome libraries with large inserts using fractionation by pulsed-field gel electrophoresis. Nucleic Acids Res. 17: 3425–3433. Arumuganathan, K., and Earle, E.D. 1991. Nuclear DNA content of some important plant species. Plant Mol. Biol. Rep. 9(3): 208–218. Becker, J., Vos, P., Kuiper, M., Salamini, F., and Heun, M. 1995. Combined mapping of AFLP and RFLP markers in barley. Mol. Gen. Genet. 249: 65–73. Bellanné-Chantelot, C., Lacroix, B., Ougen, P., Billault, A., Beaufils, S., Bertrand, S., Georges, I., Glibert, F., Gros, I., Lucotte, G., Susini, L., Codani, J.-J., Gesnouin, P., Pook, S., Vaysseix, G., Lu-Kuo, J., Ried, T., Ward, D., Chumakov, I., Le Paslier, D., Barillot, E., and Cohen, D. 1992. Mapping the whole human genome by fingerprinting yeast artificial chromosomes. Cell, 70: 1059–1068. Bennett, M.D., and Smith, J.B. 1976. Nuclear DNA amount in angiosperms. Philos. Trans. Roy. Soc. London B. Biol Sci. 274: 227–274. Bennett, M.D., and Smith, J.B. 1991. Nuclear DNA amount in angiosperms. Philos. Trans. R. Soc. London B. Biol. Sci. 334: 309–345. Bonnema, G., Hontelez, J., Verkerk, R., Zhang, Y.Q., van Daelen, R., van Kammen, A., and Zabel, P. 1996. An improved method of partially digesting plant megabase DNA suitable for YAC cloning: application to the construction of a 5.5 genome equivalent YAC library of tomato. Plant J. 9: 125–133. Burgers, P.M.J., and Percival, K.J. 1987. Transformation of yeast spheroplasts without cell fusion. Anal. Biochem. 163: 391–397. Burke, D.T., Carle, G.F., and Olson, M.V. 1987. Cloning of large © 2001 NRC Canada



Schmidt et al. segments of exogenous DNA into yeast by means of artificial chromosome vectors. Science (Washington, D.C.), 236: 806–812. Cai, D., Kleine, M., Kifle, S., Harloff, H.-J., Sandal, N.N., Marcker, K.A., Klein-Lankhorst, R.M., Salentijn, E.M., Lange, W., Stiekema, W.J., Wyss, U., Grundler, F.M.W., and Jung, C. 1997. Positional cloning of a gene for nematode resistance in sugar beet. Science (Washington, D.C.), 275: 832–834. Carle, G.F., and Olson, M.V. 1985. An electrophoretic karyotype for yeast. Proc. Natl. Acad. Sci. U.S.A. 82: 3756–3760. Chao, S., Sharp, P.J., Worland, A.J., Koebner, R.M.D., and Gale, M.D. 1989. RFLP-based genetic maps of wheat homologous group 7 chromosomes. Theor. Appl. Genet. 78: 495–504. Clarke, L., and Carbon, J. 1976. A colony bank containing synthetic Col EI hybrid plasmids representative of the entire E. coli genome. Cell, 9: 91–99. Edwards, K.J., Thompson, H., Edwards, D., de Saizieu, A., Sparks, C., Thompson, J.A., Greenland, A.J., Eyers, M., and Schuch, W. 1992. Construction and characterisation of a yeast artificial chromosome library containing three haploid maize genome equivalents. Plant Mol. Biol. 19: 299–308. Eyers, M., Edwards, K., and Schuch, W. 1992. Construction and characterisation of a yeast artificial chromosome library containing two haploid Beta vulgaris L. genome equivalents. Gene, 121: 195–201. Graner, A., and Tekauz, A. 1996. RFLP mapping in barley of a dominant gene conferring resistance to scald (Rhynchosporium secalis). Theor. Appl. Genet. 93: 421–425. Graner, A., Jahoor, A., Schondelmaier, J., Siedler, H., Pillen, K., Fischbeck, G., Wenzel, G., and Herrmann, R.G. 1991. Construction of an RFLP map of barley. Theor. Appl. Genet. 83: 250–256. Hanish, J., and McClelland, M. 1990. Methylase-limited partial NotI cleavage for physical mapping of genomic DNA. Nucleic Acids Res. 18: 3287–3291. Ioannou, P.A., Amemiya, C.T., Garnes, J., Kroisel, P.M., Shizuya, H., Chen, C., Batzer, M.A., and de Jong, P.J. 1994. A new bacteriophage P1-derived vector for the propagation of large human fragments. Nat. Genet. 6: 84–89. Kilian, A., Kudrna, D.A., Kleinhofs, A., Yano, M., Kurata, N., Steffenson, B., and Sasaki, T. 1995. Rice–barley synteny and its application to saturation mapping of the barley RPG1 region. Nucleic Acids Res. 23: 2729–2733. Kleine, M. 1993. Die Klonierung von DNA aus Zuckerrüben (Beta vulgaris L.) und Gerste (Hordeum vulgare L.) in künstliche Hefechromosomen (YACs) und die Isolation und Charakterisierung von definierten Klonen. Ph.D. thesis. LudwigMaximilians-Universität, München. Kleine, M., Cai, D., Elbl, C., Herrmann, R.G., and Jung, C. 1995. Physical mapping and cloning of a translocation in sugar beet (Beta vulgaris L.) carrying a gene for nematode (Heterodera schachtii) resistance from Beta procumbens. Theor. Appl. Genet. 90: 399–406. Kleine, M., Michalek, W., Diefenthal, T., Dargatz, H., and Jung, C. 1997. Construction of a MluI-YAC library from barley (Hordeum vulgare L.) and analysis of YAC insert terminal regions. Genome, 40: 896–902. Künzel, G., Korzun, L., and Meister, A. 2000. Cytologically integrated physical restriction fragment length polymorphism maps for the barley genome based on translocation breakpoints. Genetics, 154: 397–412. Larin, Z., Monaco, A.P., and Lehrach, H. 1991. Yeast artificial chromosome libraries containing large inserts from mouse and human DNA. Proc. Natl. Acad. Sci. U.S.A. 88: 4123–4127.

1039 Lee, J.T., Murgia, A., Sosnoski, D.M., Olivos, I.M., and Nussbaum, R.L. 1992. Construction and characterization of a yeast artificial chromosome library for Xpter-Xq27.3: a systematic determination of cocloning rate and X-chromosome representation. Genomics, 12: 526–533. Leister, D., Kurth, J., Laurie, D.A., Yano, M., Sasaki, T., Devos, K., Graner, A., and Schulze-Lefert, P. 1998. Rapid reorganization of resistance gene homologues in cereal genomes. Proc. Natl. Acad. Sci. U.S.A. 95: 370–375. Ling, H.-Q., Koch, G., Bäumlein, H., and Ganal, M.W. 1999. Map-based cloning of chloronerva, a gene involved in iron uptake of higher plants encoding nicotianamine synthase. Proc. Natl. Acad. Sci. U.S.A. 96: 7098–7103. Martin, G.B., Ganal, M.W., and Tanksley, S.D. 1992. Construction of a yeast artificial chromosome library of tomato and identification of cloned segments linked to two disease resistance loci. Mol. Gen. Genet. 233: 25–32. Martin, G.B., Brommonschenkel, S.H., Chungwongse, J., Frary, A., Ganal, M.W., Spivey, R., Wu, T., Earle, E.D., and Tanksley, S.D. 1993. Map-based cloning of a protein kinase gene conferring disease resistance in tomato. Science (Washington, D.C.), 262: 1432–1436. McCormick, M.K., Antonarakis, S.E., and Hieter, P. 1990. YAC cloning of DNA embedded in an agarose matrix. GATA, 7(5): 114–118. Nagaraja, R., Kere, J., MacMillan, S., Masisi, M.W.J., Johnson, D., Molini, B.J., Halley, G.R., Wein, K., Trusgnich, M., Eble, B., Railey, B., Brownstein, B.H., and Schlessinger, D. 1994. Characterisation of four human YAC libraries for clone size, chimerism and X chromosome sequence representation. Nucleic Acids Res. 22: 3406–3411. Putterill, J., Robson, F., Lee, K., and Coupland, G. 1993. Chromosome walking with YAC clones in Arabidopsis: isolation of 1700 kb of contiguous DNA on chromosome 5, including a 300 kb region containing the flowering-time gene CO. Mol. Gen. Genet. 239: 145–157. Schmidt, R., and Dean, C. 1992. Physical mapping of the Arabidopsis thaliana genome. In Strategies for physical mapping. Genome analysis. Vol. 4. Edited by K.E. Davies and S.M. Tilghman. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. pp. 71–98. Schweizer, G.F., Baumer, M., Daniel, G., Rugel, H., and Röder, M.S. 1995. RFLP markers linked to scald (Rhynchosporium secalis) resistance gene Rh2 in barley. Theor. Appl. Genet. 90: 920–924. Shizuya, H., Birren, B., Kim, U.-J., Mancino, V., Slepak, T., Tachiiri, Y., and Simon, M. 1992. Cloning and stable maintenance of 300-kilobase-pair fragments of human DNA in Escherichia coli using an F-factor-based vector. Proc. Natl. Acad. Sci. U.S.A. 89: 8794–8797. Simons, G., van der Lee, T., Diergaarde, P., van Daelen, R., Groenendijk, J., Frijters, A., Büschges, R., Hollricher, K., Töpsch, S., Schulze-Lefert, P., Salamini, F., Zabeau, M., and Vos, P. 1997. AFLP-based fine mapping of the Mlo gene to a 30 kb DNA segment of the barley genome. Genomics, 44: 61–70. Tanksley, S.D., Ganal, M.W., and Martin, G.B. 1995. Chromosome landing: a paradigm for map-based gene cloning in plants with large genomes. Trends Genet. 11(2): 63–68. Tekauz, A. 1991. Pathogenic variation in Rhynchosporium secalis on barley in Canada. Can. J. Plant Pathol. 13: 298–304. Umehara, Y., Inagaki, A., Tanoue, H., Yasukochi, Y., Nagamura, Y., Saji, S., Otsuki, Y., Fujimura, T., Kurata, N., and Minobe, Y. 1995. Construction and characterization of a rice YAC library for physical mapping. Mol. Breed. 1: 79–89. © 2001 NRC Canada



1040 Wei, F., Gobelman-Werner, K., Morroll, S.M., Kurth, J., Mao, L., Wing, R., Leister, D., Schulze-Lefert, P., and Wise, R.P. 1999. The Mla (Powdery Mildew) resistance cluster is associated with three NBS-LRR gene families and suppressed recombination within a 240-kb DNA interval on chromosome 5S (1HS) of barley. Genetics, 153: 1929–1948. Whitehead Institute. 1991. Primer 0.5 (Available from http:// www-genome.wi.mit.edu/ftp/distribution/software/primer.0.5/ manual.asc). Wu, K.-S., Röder, M.S., and Ganal, M.W. 1992. Isolation of plant DNA for pulsed-field gel electrophoresis. In Methods in molec-

Genome Vol. 44, 2001 ular biology 12: Pulsed-field gel electrophoresis. Edited by M. Burmeister and L. Ulanovsy. The Humana Press, Totowa, N.J. pp. 145–157. Yu, Y., Tomkins, J.P., Waugh, R., Frisch, D.A., Kudrna, D., Kleinhofs, A., Brueggeman, R.S., Muehlbauer, G.J., Wise, R.P., and Wing, R.A. 2000. A bacterial artificial chromosome library for barley (Hordeum vulgare L.) and the identification of clones containing putative resistance genes. Theor. Appl. Genet. 101: 1093–1099.

© 2001 NRC Canada
