Correlates of genetic monogamy in socially ...

Correlates of genetic monogamy in socially monogamous mammals: insights from Azara’s owl monkeys rspb.royalsocietypublishing.org

Maren Huck1,2,3, Eduardo Fernandez-Duque3,4, Paul Babb3 and Theodore Schurr3 1

Department of Biological and Forensic Sciences, University of Derby, Kedleston Road, Derby DE22 1GB, UK German Primate Centre, Kellnerweg 4, 37077 Go¨ttingen, Germany 3 Department of Anthropology, University of Pennsylvania, 3260 South Street, Philadelphia, PA 19104, USA 4 Centro de Ecologıá Aplicada del Litoral, Conicet, Corrientes, Argentina 2

Research Cite this article: Huck M, Fernandez-Duque E, Babb P, Schurr T. 2014 Correlates of genetic monogamy in socially monogamous mammals: insights from Azara’s owl monkeys. Proc. R. Soc. B 281: 20140195. http://dx.doi.org/10.1098/rspb.2014.0195

Received: 24 January 2014 Accepted: 21 February 2014

Subject Areas: behaviour, evolution Keywords: Aotus azarai, extra-pair paternity, mating system, paternal care, pair bond, pair-living mammals

Author for correspondence: Maren Huck e-mail: [email protected]

Electronic supplementary material is available at http://dx.doi.org/10.1098/rspb.2014.0195 or via http://rspb.royalsocietypublishing.org.

Understanding the evolution of mating systems, a central topic in evolutionary biology for more than 50 years, requires examining the genetic consequences of mating and the relationships between social systems and mating systems. Among pair-living mammals, where genetic monogamy is extremely rare, the extent of extra-group paternity rates has been associated with male participation in infant care, strength of the pair bond and length of the breeding season. This study evaluated the relationship between two of those factors and the genetic mating system of socially monogamous mammals, testing predictions that male care and strength of pair bond would be negatively correlated with rates of extra-pair paternity (EPP). Autosomal microsatellite analyses provide evidence for genetic monogamy in a pair-living primate with bi-parental care, the Azara’s owl monkey (Aotus azarae). A phylogenetically corrected generalized least square analysis was used to relate male care and strength of the pair bond to their genetic mating system (i.e. proportions of EPP) in 15 socially monogamous mammalian species. The intensity of male care was correlated with EPP rates in mammals, while strength of pair bond failed to reach statistical significance. Our analyses show that, once social monogamy has evolved, paternal care, and potentially also close bonds, may facilitate the evolution of genetic monogamy.

1. Introduction The evolution of mating systems has been a central topic in evolutionary biology for more than 50 years [1,2]. Ever since it was understood that natural selection acts ‘at the level of the individual genome’ [3, p. 215], it became imperative to examine the genetic consequences of mating and the relationships between social systems and mating systems in order to understand their evolution. Since sexual selection on males and females is greatly influenced by the relationship between the number of mating partners and the reproductive success of males and females [4–6], it also has become clear that extra-pair paternity (EPP) and extra-group paternity (EGP) [7–10] are likely to play an important role in the evolution of mating systems, and that the genetic mating system is more relevant than the social mating system to theories pertaining to the evolution of mating systems. Unfortunately, the social organization of animals is often a poor indicator of their genetic mating system [7–10]. For example, although the vast majority of passerine birds have traditionally been described as pair-living (Lack, 1968, cited in [8]), in 86% of the species some of the young were not sired by the female’s pair-mate and nearly 20% of the broods contained at least one extra-pair chick [8]. These high rates of EPP are not surprising, given theoretical predictions that males most effectively increase their fitness by increasing the number of mating partners [11,12]. More recently, the advantages to females of mating with several males have also become increasingly acknowledged [13–16]. Still, despite this overwhelming evidence of EPP in a broad range of avian taxa, there is still some

& 2014 The Author(s) Published by the Royal Society. All rights reserved.

2. Material and methods (a) Study area and study population The study area is located in the Guaycolec Ranch, 25 km from the city of Formosa in the Argentinean Gran Chaco of South America (588110 W, 258580 S). The local population of Azara’s owl monkeys inhabits the gallery forests of the Rıó Paraguay and its tributaries in the Argentinean provinces of Formosa and Chaco [58]. Most adult individuals in the study population are regularly captured and fitted with radio or bead collars for permanent and unequivocal identification [59,60].

(b) Genetic and parentage analyses Samples were collected from 128 individuals living in 29 social groups or as solitary floaters [61,62]. All individuals were genotyped for 14 genetic loci (average 13.8 loci, minimum 10 loci; average 4.3 alleles per locus) bearing polymorphic short tandem repeats (electronic supplementary material, tables S1a,b; for more information on methods see the electronic supplementary material, S1). For 35 infants born to 17 reproducing pairs, the identity of at least one of the two adults present in the group was known, and genetic samples at the time of birth were available. For seven infants, the mothers were known because they were seen nursing them. The adult male present in the group at the time of conception was regarded as the ‘social father’ of the respective infant. The terms ‘group female’ and ‘group male’ include not only known mothers (seen to nurse the infant) and social fathers, but also males and females who were not identified at the time of conception, but were identified and sampled later, when there was no evidence of change of individuals in the group. Maternity and paternity were only assessed for infants for whom the group female or male was sampled. If infants for whom the group male had not been sampled were included in the analysis, then this would necessarily render an extra-group male as the most likely father. As a result, extra-group parentage would have been overestimated. Maternity and paternity of the infants were determined using a Bayesian method that relies on a Markov chain Monte Carlo

2

Proc. R. Soc. B 281: 20140195

adult male contributes intensively to the care of the infant. From the second week of life, the infant is almost exclusively transported by the male, who also plays with and provides solid food for the infant more than the mother [48,49,52–54]. We therefore predicted genetic monogamy or a very low rate of EPP in our study species. Secondly, we wanted to assess whether the strength of the pair bond and the intensity of male care were associated with genetic monogamy in socially monogamous pair-living mammals. We hypothesized that, given the very high costs to males of providing care to non-related infants, male care should be closely linked to genetic monogamy. To date, no cross-mammal study has investigated whether levels of male care are associated with genetic monogamy (i.e. extent of EPP) in socially monogamous mammals, defined here as a social organization in which an adult individual has only one social adult partner of the opposite sex at a given time [7,55–57]. To examine our hypothesis, we conducted an evaluation of the relationship between genetic monogamy, male care and pair bonds in pair-living mammals using our results on owl monkeys and published data on genetically determined EPP rates. We predicted that a high intensity of male care and a close association between pair partners would be associated with low rates of EPP.

rspb.royalsocietypublishing.org

evidence for genetic monogamy in a few species [17–21]. While EPPs are widespread among socially monogamous bird species [8], evidence has also started to accumulate in socially monogamous mammals. Yet, among mammals, social monogamy remains an evolutionary puzzle [22,23]. In not being committed to parental investment through pregnancy and lactation, males may enhance their reproductive success through extra-pair copulations without increasing their parental investment [12]. Still, a small but significant number of mammal species are socially monogamous [24] and genetic monogamy has been reported for four species, the California mouse (Peromyscus californicus) [25], Kirk’s dik-dik (Madoqua kirkii) [26], the Malagasy giant jumping rat (Hypogeomys antimena) [27], as well as for packliving coyotes (Canis latrans) [28]. However, several other pair-living species have shown high EPP rates. For example, in the island fox (Urocyon littoralis) and the swift fox (Vulpes velox), about half of the offspring were not sired by the social father [29,30]. In order to understand the conditions under which genetic monogamy occurs and may have evolved, it is necessary to understand which aspects of social systems are associated with high or low rates of EPP. Among birds, EPP rates were associated with low adult mortality and low levels of male care, even when as much as 50% of interspecific variation was due to differences among taxonomic families or orders [31]. Many other factors have also been related to EPP and EGP rates in birds [32]. Among mammals, EGP was positively correlated with the length of the breeding season, but not the social mating system [9]. By contrast, the social organization (solitary þ family-living versus pair-living species), but not the strength of the pair bond, was predictive of EPP rates in allegedly socially monogamous mammals [33]. In the past, theoretical considerations proposed that, in mammals, male care would be associated with high paternity certainty and low levels of EGP ([34–36], but see [37]). A positive relationship between male care and high paternity certainty is usually postulated based on the assumption that the evolutionary benefits to males of providing care will be intimately related to the probability of biological relatedness between the male and the infant [35,37–39]. Under this scenario, one expects male care to be more likely when there is a close connection with the female (i.e. a closer pair bond) that increases the possibilities of monitoring, guarding and preventing her from engaging in extra-pair copulations [34]. Yet, several studies have shown high levels of extra-group copulations despite intense male care (e.g. prairie voles, Microtus ochrogaster [40]; fat-tailed dwarf lemurs, Cheirogaleus medius [41]; Ethiopian wolves, Canis simensis [42]; North American beavers, Castor canadensis [43]). The evidence from these empirical studies combined with the findings from phylogenetic analyses [22,44] suggest that, although male care is associated with social monogamy in some cases, it is more likely a consequence of it than a cause [34]. Furthermore, the phylogenetic studies described above have shown that ecological and social factors alone cannot account for the existence of male care since male care is both present and absent in monogamous and polygamous systems [26,45,46]. Given these empirical and theoretical observations, we pursued two goals in this study. First, we conducted a paternity study on Azara’s owl monkeys (Aotus azarae) [47–49]. Owl monkeys are pair-living and there is never more than one reproductive male and female in a group [47,50,51]. The

A comprehensive search of the primary literature for genetic studies of paternity in socially monogamous mammal species was conducted. According to the definition provided above, those species with more than 10% of breeding subordinates, or species that commonly have more than two unrelated adults in the group were not considered as socially monogamous. Based on those criteria, 15 pair-living mammal species were identified for which genetic paternity data were available, including this study (electronic supplementary material, table S1c). A recent examination of socially monogamous mammals [33] used a number of species that were not included in our analyses. Explicit criteria for the inclusion or exclusion of species in comparative analyses are paramount to the adequate interpretation of results [68,69]. Thus, the list of those species, and our reasons for their exclusion, are provided in the electronic supplementary material, table S1d, and we further consider the inclusion or exclusion and classifications of species in the Discussion. Each of the 15 species (owl monkeys and 14 species from the literature) was categorized according to the strength of the pair bond and the extent of male care. Pair bonds were classified as ‘close’ when partners travelled and spent most of the resting/ sleeping periods (more than 80% of their active period, at least during mating periods) together. They were classified as ‘dispersed’ when partners shared a common defended territory, but foraged or slept independently during at least 20% of their active period. Based on this information, the extent of male care in the different species was then classified as either ‘no or moderate

EPP rate

0.4 0.3

n=6

n=3

0.2 0.1 n=6 Madoqua kirkii

0 no

3

moderate intensive pattern of male care

Figure 1. EPP rates for different intensities of male care. For the analysis, the levels of ‘no care’ and ‘moderate care’ were grouped together. Box plots represent median and interquartile ranges (IQR). Whiskers show ranges excluding only values larger than +1.5 times the IQR; outliers beyond this range are represented as open circles. n, number of species.

care’, or ‘intensive care’. Preliminary analyses had suggested that the categories ‘moderate’ and ‘no care’ could be merged in a single category since they were not statistically different (Welch’s two-sample t-test: t ¼ 20.3, d.f. ¼ 5.5, p ¼ 0.55; see also figure 1 to see the similarity between these two categories). Species were classified as providing ‘no care’ if the male did not provide any infant care. ‘Moderate care’ was considered when males performed some basic infant care like huddling or grooming but the studies did not report a statistically significantly increase in infant survival due to male care. Species were classified as having ‘intensive male care’ if males contributed direct care (e.g. infant carrying or food provisioning) as much or more than the mother, if male care had been reported to be associated with infant survival (e.g. a comparison of infant survival raised with or without a male present), or if the care provided entailed a cost to the male (e.g. a statistically significant loss in body mass of caring males compared with non-caring males; references in the electronic supplementary material, table S1c). For comparative purposes with other studies (electronic supplementary material, table S1c), the proportion of EPP infants was estimated, rather than the proportion of litters in which at least one infant was sired by an extra-pair male. These proportional data were arcsine transformed to normalize them. Inspection of residuals versus fitted values did not suggest a strong deviation from normality for the overall model. A generalized least square model ( phylGLS) with a phylogenetic correlation structure was fitted to the data, using a Brownian motion model of character evolution, and variables or the interaction term were deemed statistically significant if p , 0.05 [70]. Details about the different taxon-phylogenies on which the overall phylogeny was based are presented in the electronic supplementary material, S1 and figure S11. Because reported divergence times and methods varied considerably between studies (e.g. [71] versus [72]), the robustness of our results was checked in several ways. First, 16 trees of the same topology were constructed in which branch lengths were randomly changed by some value between 220 and þ20 MYA, with the restriction that no negative divergence times were allowed and the general topology had to remain the same. Likewise, 15 trees (with the original topology) were constructed based on only 14 species, with each of the 15 species being removed in turn to check for the effects individual species might have on the phylGLS

Proc. R. Soc. B 281: 20140195

(c) Pair bonds, male care and extra-pair paternity: comparative analyses

Cheirogaleus medius

0.5


(MCMC) approach, using the package MASTERBAYES [63], implemented in program R v. 2.15.2 [64]. This program models the set of joint probabilities of dam –sire pairs for each offspring in a generalized log-linear model as dependent on both genetic and non-genetic data [63]. Treating all theoretically possible candidate parents as equally likely can seriously inflate estimates of EPP rates [63]. Therefore, females were a priori excluded as candidate parents if they did not share the same mtDNA haplotype group as the offspring [61]. Similarly, individuals of both sexes were excluded if they were less than 4 years older than the offspring, given the age at first reproduction of owl monkeys (i.e. adults [65]), or if they were known to have died before the year of birth of the offspring. The analysis also included information on the central location of the territories in which individuals lived. For individuals caught as solitary ‘floaters’ [66], the location where they had been caught was used. Following Hadfield et al. [63], the probability of a specific pair of adults being the parents of an offspring born in a particular territory was assumed to be proportional to an exponential function of parameter b times the Euclidean distance between offspring and each of the candidate parents. The exact value of b, genotyping error rates and the number of un-sampled candidate males and females were estimated by the MCMC procedure. Based on preliminary analyses, the starting values for Markov chains were set as 0.005 for both allelic drop-out rate and genotyping error rate (E1 and E2, respectively), two for the number of un-sampled females, and six for the number of un-sampled males. No mismatch between a candidate parent and offspring were allowed. The number of iterations was set to 1 000 000, whereby the first 50 000 iterations were discarded (‘burn-in’) [67], and the thinning rate (specifying the intervals at which the Markov chain is stored) was set to 10. Tuning parameters were set to b ¼ 100, and USdam and USsire to 0.1 in order to ensure that Metropolis acceptance rates lay between 0.2 and 0.5, as suggested by the programmer [67].

EPP rate

0.4


3. Results

4

0.5 Trichosurus cunninghami

n = 10

0.3 0.2 0.1 n=5 0 close

dispersed pair-bond type

Figure 2. EPP rates in species with close and dispersed pair bonds. Box plots represent median and IQR. Whiskers show ranges excluding only values larger than +1.5 times the IQR; outliers beyond this range are represented as open circles. n, number of species.

(a) Genetic monogamy in owl monkeys Our analyses are strongly indicative of genetic monogamy in owl monkeys. All of the 32 group females and 30 group males for which genetic information was available could not be excluded as parents of the offspring in their group because they exhibited no mismatches (electronic supplementary material, table S1e; the genotypes of all monkeys are given in the electronic supplementary material, S2). The Bayesian analysis identified all females, and all but one male in the group of the infant, as the most likely parents. In one case, no most likely sire was found. This result was probably due to both the group male and a direct neighbour not having any mismatches with the offspring, and no group female being sampled. For 53% of the females and 57% of males, the likelihood estimates for these assignments lay at least in the 95% confidence interval, and 66% of dams and 73% of sires had an assignment with a confidence interval of 85% or higher (electronic supplementary material, table S1e). The MCMC approach estimated genotyping error rates to be even lower than originally assumed with 0.002 (s.d. ¼ 0.0021) for E1 and 0.002 (s.d. ¼ 0.0018) for E2, respectively. Here, the number of un-sampled females was 2.0 (s.d. ¼ 1.01), the number of un-sampled males was 6.4 (s.d. ¼ 3.2) and b was 20.026 (s.d. ¼ 0.013).

(b) Relationship between pair bonds, male care and extra-pair paternity Species with intense male care had lower levels of EPP than those without intense male care (figure 1 and table 1). While most species with close bonds had lower levels of EPP than those with dispersed ones, this difference was not statistically significant (figure 2 and table 1). There was also no statistically significant interaction between male care and pair bond type (table 1). Qualitatively, the results were very robust, whether using phylogenies with different branch lengths, removing each species in turn, or adding the three additional species excluded from analyses (electronic supplementary material, table S1g). Male care was negatively correlated with EPP rates in all models (all p , 0.03, electronic supplementary material, table S1g), while the interaction term was never statistically

Table 1. Model coefficients for the phylogenetic generalized least square model. AIC 5 114.1

value

s.e.

t-value

26.5

14.7

1.8

0.10

7.5

6.7

1.1

0.29

male care

217.8

4.0

24.4

0.001

(intense)a pair bond :

210.2

15.0

20.7

0.51

intercepta pair bond (dispersed)a

p-value

male care a

Values from the model not including the interaction term.

significant. Close pair bonds were significantly associated with low EPP rates only in one tree with random branch length, and even removing Trichosurus cunninghami, a species that has close bonds but also high EPP rates from the analysis (figure 2), did not result in a statistically significant relationship. However, the direction of the association, with close pairs having lower EPP rates than dispersed species, was the same in all models (electronic supplementary material, table S1g).

4. Discussion (a) Genetic monogamy in Azara’s owl monkeys Our findings on genetic monogamy in Azara’s owl monkeys provide a potential explanation for a most remarkable and unusual commitment to paternal care shown by the species. Ever since paternal care was first described in owl monkeys, various hypotheses were evaluated to account for its evolution and maintenance [80,81]. Given the social proximity, sharing of space and coordination of activities that is characteristic of owl monkey pair-mates, it was reasonable to predict high paternity certainty and low levels of EGP through successful mate guarding by males. On the other hand, we could also expect that the

Proc. R. Soc. B 281: 20140195

results, essentially a (branch removal) boot-strapping approach. We also fitted a model to data including three additional species that were not included in the analyses even when they might be considered pair-living: Microtus ochrogaster [73], Hylobates lar [74] and Canis latrans [75]. (The electronic supplementary material, table S1d provides the reasons why these were not considered pair-living for the analyses). Different models of the phylGLS were compared by choosing the model with the lowest AIC variance structure [76]. We checked whether changing variance structures for either or both variables would increase the model fit [77]. Because AIC levels were higher for models with differing variance structures (AIC ¼ 115.1 to 117.1) than for the simpler model (AIC ¼ 114.9), we assumed similar variance structures. When the interaction term was not statistically significant (which was the case for all models), it was removed. The two variables were retained for the final model, even if not statistically significant, since they were of primary interest. Statistical analyses were conducted in R [64], using the packages ‘ape’ [78] and ‘nlme’ [79].

Our comparative phylogenetic analyses explored under what circumstances social monogamy, an already intriguing and rare social system among mammals, may lead to genetic monogamy, a mating system where the limitations on male reproductive potential take on an extreme form. Our study is the first to provide evidence that, within pair-living species, male care is linked to the genetic mating system. Low rates of EPPs are expected in species with male participation in infant care for at least two reasons that may imply a different causal directionality: the paternity certainty associated with low EPP may promote male care [35,36], or male care may enhance possibilities of mating monopolizations and, thus, reduce EPP rates [34]. Intense male care was strongly related to low levels of EPP, whereas the strength of the pair bond was not, even when most species with strong bonds had low rates of EPP rates. An earlier study of the relationships between EGP rates and their breeding system found that the variation in EPP was better explained by the social structure than by the type of pair bonding [33]. However, these authors did not consider paternal care in their analyses and included cooperative breeders and other species that are not pair living in their comparisons. These differences underscore the importance of explicit and clear definitions of categories when species are classified for comparative analyses (see below). When considering birds, our results fit partly with theoretical considerations and empirical findings where low rates of EPP are also associated with high rates of male care [31]. In dispersed bird pairs, though, the opportunity for extra-pair copulations is higher than in species with close bonds where partners can monitor each other more easily and effectively. There are still some notable exceptions among the 15 pairliving species analysed: species that do not conform to the general association of either intensive male care with close pair bonds, or no care and dispersed bonds. For example, male Kirk’s dik-diks do not seem to provide much infant care, but have been described as genetically monogamous [26], and fat-tailed dwarf lemurs have nearly 50% EPP rates but still show male care. It is possible that the influence of pair bonds and infant care are affected at different levels of influence in these species. The strength of the pair bond

(c) Classification issues and robustness of results Comparative analyses based on dichotomized marker traits (e.g. care versus no care) are likely to be significantly influenced by how species are classified. Potentially dismissed as an obvious methodological consideration to be addressed at an early stage of research design, the issue has lately been receiving proper, and much needed, attention following the publication of two large comparative analyses on social monogamy. For example, Dixson [69] suggested that some of the findings from the study on the evolution of social monogamy in primates [44] were based on comparing ‘apples with

5

Proc. R. Soc. B 281: 20140195

(b) Genetic monogamy, male care and pair bonds in mammals

represents a proximate influence where mates with close bonds are guarded more closely, and the opportunities of extra-pair copulations are more limited. Directly measured rates of mate guarding should provide much needed behavioural data that will allow a more fine-tuned exploration of this relationship. By contrast, the relationship between male care and EPP rates may be indirect. To further explore this possibility, it would be valuable to have individual-based data for more species in order to disentangle individual effects from species-level effects [35]. This approach may help to explain why cross-species approaches consistently find that reduced mean paternity covaries with reduced male care [35,36,83], whereas within-species studies produce contradictory results (e.g. [37,84–87]). The need for more and better behavioural data on mating patterns has been already raised in the avian literature, where a better understanding of the causes of EPP is being limited by a lack of adequate information on the behavioural events that affect paternity [27]. Following an exponential growth in the number of genetic studies that revolutionized the study of avian mating systems, it is now becoming clear that the proper interpretation of the correlates of paternity will require detailed information on mating patterns. Our analyses identified a relationship between EPP rates and male care, but whether male care drove the evolution of social monogamy or genetic monogamy remains unclear. Some authors have concluded that paternal care was not important in driving the evolution of social monogamy because it evolved more frequently in the absence of male care than in its presence [88]. Indeed, in at least three major lineages among the primates (lemurs, tarsiers and platyrrhines), pair-living seems to have evolved before male care [89]. Similarly, recent comparative studies of primates and other mammals also concluded that, when paternal care is associated with social monogamy, it is more likely to be as a consequence of its evolution rather than a cause [22,44]. These studies on the evolution of social monogamy analysed the correlated evolution of social monogamy with the traits ‘male care’, ‘grouping structure of females’ and ‘infanticide risk’ within primates [44] and mammals [22]. Opie et al. [44] concluded that male infanticide is the most compelling explanation for the appearance of monogamy, a conclusion that may warrant further examination given that their results show similar support for a relationship to biparental care and female ranges [90]. By contrast, Lukas & Clutton-Brock [22] suggest that social monogamy evolved where males were unable to defend multiple females and conclude that its evolution was not associated with a high risk of male infanticide. Thus, social monogamy probably evolved, and may be maintained, for different reasons and along different pathways in various species [89,91].


regular presence of intruders and the competition with extragroup males [66] would generate opportunities for extra-pair copulations that could lead to EPP. Not surprisingly, it was the suggested examination at the level of the individual genome [3] that provided the conclusive answer. Owl monkeys are then the sole primate taxon, and only the fifth socially monogamous mammal, for which genetic monogamy has been reported based on the empirical examination of adequate sample sizes. A study of the Bornean gibbon (Hylobates muelleri) did not find evidence of EPP, but the small sample size (n ¼ 4 infants) limits the conclusions to be drawn from it [82]. Although owl monkeys are an excellent model for studying the functioning and maintenance of social and genetic monogamy [22,44], a single-species approach cannot elucidate the processes that may have led to the evolution of genetic monogamy in owl monkeys. For this reason, we conducted a comparative phylogenetic analysis to explore these issues more expansively.

The collection of samples, and all subsequent related research, was approved by the corresponding animal research committees of the University of Pennsylvania and the Zoological Society of San Diego, and was done in adherence to the legal requirements of both Argentina and the USA.

Acknowledgements. T.S. acknowledges the infrastructural support of the

5. Conclusion

National Geographic Society. P.B. thanks for project support the University of Pennsylvania’s Department of Anthropology and Graduate Group. The authors thank all the students, volunteers and assistants who helped with data collection, as well as Bellamar Estancias S.A., the Ministry of Production and the Subsecretary of Natural Resources of the Province of Formosa for the continued support of the Owl Monkey Project. Finally, the authors would like to thank the anonymous reviewers of a previous draft for stimulating suggestions.

To our knowledge, this is the most complete dataset for studying genetic paternity in socially monogamous (i.e. pair-living) mammals. While the results are robust in terms of statistical analyses and margin of error with respect to certain classifications, it should still be noted that the analyses

Funding statement. M.H. was funded by a Research Grant from the German Science Foundation (HU 1746/2-1). E.F-D. acknowledges financial support from the Wenner-Gren Foundation, the L.S.B. Leakey Foundation, the National Geographic Society, the National Science Foundation (BCS-0621020, 1219368, and 1232349), the University of Pennsylvania Research Foundation and the Zoological Society of San Diego.

References 1.

2. 3.

4.

5.

6.

Orians GH. 1969 On the evolution of mating systems in birds and mammals. Am. Nat. 103, 589 –603. (doi:10.1086/282628) Selander RK. 1965 On mating systems and sexual selection. Am. Nat. 99, 124–141. (doi:10.1086/282360) Emlen ST, Oring LW. 1977 Ecology, sexual selection, and the evolution of mating systems. Science 197, 215–223. (doi:10.1126/science.327542) Clutton-Brock T. 2007 Sexual selection in males and females. Science 318, 1882– 1885. (doi:10.1126/ science.1133311) Kokko H, Jennions MD, Brooks R. 2006 Unifying and testing models of sexual selection. Annu. Rev. Ecol. Evol. Syst. 37, 43 –66. (doi:10.1146/annurev.ecolsys. 37.091305.110259) Eberhard WG. 2009 Postcopulatory sexual selection: Darwin’s omission and its consequences. Proc. Natl Acad. Sci. USA 106(Suppl. 1), 10 025– 10 032. (doi:10.1073/pnas.0901217106)

7.

Gowaty PA. 1996 Battles of the sexes and origins of monogamy. In Partnerships in birds: the study of monogamy (ed. JH Black), pp. 21 –52. Oxford, UK: Oxford University Press. 8. Griffith SC, Owens IPF, Thuman KA. 2002 Extra pair paternity in birds: a review of interspecific variation and adaptive function. Mol. Ecol. 11, 2195 –2212. (doi:10.1046/j.1365-294X.2002. 01613.x) 9. Isvaran K, Clutton-Brock T. 2007 Ecological correlates of extra-group paternity in mammals. Proc. R. Soc. B 274, 219–224. (doi:10.1098/rspb. 2006.3723) 10. Petrie M, Kempenaers B. 1998 Extra-pair paternity in birds: explaining variation between species and populations. Trends Ecol. Evol. 13, 52 –58. (doi:10. 1016/S0169-5347(97)01232-9) 11. Bateman AJ. 1948 Intrasexual selection in Drosophila. Heredity 2, 349–368. (doi:10.1038/hdy.1948.21)

12. Trivers RL. 1972 Parental investment and sexual selection. In Sexual selection and the descent of man (ed. B Campbell), pp. 136 –179. Chicago, IL: Aldine. 13. Birkhead T. 2000 Promiscuity, 1st edn. London, UK: Faber and Faber Limited. 14. Gowaty PA. 2004 Sex roles, contests for the control of reproduction and sexual selection. In Sexual selection in primates: new and comparative perspectives (eds PM Kappeler, CP Van Schaik), pp. 37– 54. Cambridge, UK: Cambridge University Press. 15. Wolff JO, Macdonald DW. 2004 Promiscuous females protect their offspring. Trends Ecol. Evol. 19, 127–134. (doi:10.1016/j.tree.2003.12.009) 16. Tang-Martinez Z, Ryder TB. 2005 The problem with paradigms: Bateman’s worldview as a case study. Integr. Comp. Biol. 45, 821 –830. (doi:10.1093/ icb/45.5.821) 17. Chu M, Koenig WD, Godinez A, McIntosh CE, Fleischer RC, Prum RO. 2002 Social and genetic

6

Proc. R. Soc. B 281: 20140195

were based on only 15 species, for some of which sample sizes are rather small. After recognizing that social monogamy is no guarantee for genetic monogamy [8,10], ornithologists have accumulated an impressive amount of genetic data for a broad range of species over the last two decades. Yet, the number of genetic studies of allegedly socially monogamous mammal species remains surprisingly scant. We hope that work on socially monogamous mammals will be expanded to produce a more comprehensive database that combines behavioural, demographic and parentage data with a judicious use of statistical and analyses tools. Finally, the findings from both evolutionary approaches (e.g. [22]) and our study suggest that, once social monogamy evolved, unaffected by male care patterns, the likelihood of genetic monogamy evolving was linked to male care. These results also suggest there is a relationship between genetic monogamy and the strength of the pair bond. Male care and potentially the intensity of the pair bond, as well as subsequent opportunities for close surveillance of the mating partner, would then have reinforced the maintenance of a monogamous social organization.


oranges’, whereas de Waal & Gavrilets [90] found the contrast in conclusions by the two research teams ‘disturbing’. Our analyses also depend on various underlying classifications. These include whether to consider the species to be socially monogamous or not, whether a species has a dispersed or close pair-bond, whether male care is considered as intense or only moderate and how EPP rates are calculated. Frequently, cut-off values are arbitrary, and estimates of proportions can be unreliable, if based on small sample sizes. Thus, when considering the inclusion or exclusion of a species, it is advisable to make the decision so that if there is an effect it is counter to the one ‘expected’. Our inclusion of Cheirogaleus medius strengthens our findings, because this species does not conform to the general trend, and its exclusion would therefore result in less noise in the analyses. Indeed, our analyses excluding each of the species in turn showed that our results robustly exhibited the same trends (electronic supplementary material, table S1g). Likewise, the classification of some species as having moderate or intensive male care is not always straightforward. Again, our analyses dropping these species still provide significant results. A further difficulty is defining criteria for a minimal sample size for each species. A genetic study on Mu¨ller’s Bornean gibbon (Hylobates muelleri) [82] was not included because it did not find evidence of EPP based on only four infants, whereas a study on fork-marked lemurs that was based on only five pairs was included [92]. Although the finding of EPP in a socially monogamous species clearly rejects the null-hypothesis that the species is also genetically monogamous, the lack of evidence for EPP based on only four infants cannot convincingly reject the alternative possibility.

19.

21.

22.

23.

24.

25.

26.

27.

28.

29.

30.

31.

48.

49.

50.

51.

52.

53.

54.

55.

56.

57.

58.

59.

60.

61.

62.

KC MacKinnon, SK Bearder, R Stumpf ), pp. 139– 154, 2nd edn. Oxford, UK: Oxford University Press. Huck M, Fernandez-Duque E. 2012 When dads help: male behavioral care during primate infant development. In Building babies: primate development in proximate and ultimate perspective (eds KBH Clancy, K Hinde, JN Rutherford), pp. 361–385. New York, NY: Springer. Rotundo M, Fernandez-Duque E, Dixon AF. 2005 Infant development and parental care in freeranging Aotus azarai azarai in Argentina. Int. J. Primatol. 26, 1459–1473. (doi:10.1007/s10764005-5329-z) Fernandez-Duque E, Jua´rez CP, Di Fiore A. 2008 Adult male replacement and subsequent infant care by male and siblings in socially monogamous owl monkeys (Aotus azarai). Primates 49, 81 –84. (doi:10.1007/s10329-007-0056-z) Huck M, Fernandez-Duque E. 2012 Children of divorce: effects of adult replacements on previous offspring in Argentinean owl monkeys. Behav. Ecol. Sociobiol. 66, 505–517. (doi:10.1007/s00265-011-1297-9) Welker C, Scha¨fer-Witt C. 1986 On the carrying behaviour of basic South American primates. Hum. Evol. 2, 459– 473. (doi:10.1007/BF02436385) Wolovich CK, Perea-Rodriguez JP, Fernandez-Duque E. 2007 Food transfers to young and mates in wild owl monkeys (Aotus azarai). Am. J. Primatol. 69, 1–16. Wright PC. 1984 Biparental care in Aotus trivirgatus and Callicebus moloch. In female primates: studies by women primatologists (ed. MF Small), pp. 59 –75. New York, NY: Alan R. Liss. Martin JK, Handasyde KA, Taylor AC, Coulson G. 2007 Long-term pair-bonds without mating fidelity in a mammal. Behaviour 144, 1419– 1445. (doi:10. 1163/156853907782418240) Wickler W, Seibt U. 1983 Monogamy: an ambiguous concept. In Mate choice (ed. P Bateson), pp. 33 –50. Cambridge, UK: Cambridge University Press. Kappeler PM, van Schaik CP. 2002 Evolution of primate social systems. Int. J. Primatol. 23, 707–740. (doi:10.1023/A:1015520830318) Brown AD, Zunino GE. 1994 Ha´bitat, densidad y problemas de conservacioń de los primates en Argentina. Vida Silvestre Neotropical 3, 30 –40. Fernandez-Duque E, Rotundo M. 2003 Field methods for capturing and marking azarai night monkeys. Int. J. Primatol. 24, 1113–1120. (doi:10. 1023/A:1026284430453) Jua´rez CP, Rotundo MA, Berg W, Fernańdez-Duque E. 2011 Costs and benefits of radio-collaring on the behavior, demography and conservation of owl monkeys (Aotus azarai) in Formosa, Argentina. Int. J. Primatol. 32, 69–82. (doi:10.1007/s10764010-9437-z) Babb PL, Fernandez-Duque E, Baiduc CA, Gagneux P, Evans S, Schurr TG. 2011 MtDNA diversity in Azara’s owl monkeys (Aotus azarai azarai) of the Argentinean Chaco. Am. J. Phys. Anthropol. 146, 209–224. (doi:10.1002/ajpa.21567) Babb PL, McIntosh AM, Fernandez-Duque E, Di Fiore A, Schurr TG. 2011 An optimized microsatellite

7

Proc. R. Soc. B 281: 20140195

20.

32. Westneat DF, Stewart IRK. 2003 Extra-pair paternity in birds: causes, correlates, and conflict. Annu. Rev. Ecol. Syst. 34, 365 –396. (doi:10.1146/annurev. ecolsys.34.011802.132439) 33. Cohas A, Allaine´ D. 2009 Social structure influences extra-pair paternity in socially monogamous mammals. Biol. Lett. 5, 313–316. (doi:10.1098/rsbl.2008.0760) 34. Kvarnemo C. 2006 Evolution and maintenance of male care: is increased paternity a neglected benefit of care? Behav. Ecol. 17, 144 –148. (doi:10.1093/ beheco/ari097) 35. Kokko H, Jennions MD. 2008 Parental investment, sexual selection and sex ratios. J. Evol. Biol. 21, 919 –948. (doi:10.1111/j.1420-9101.2008.01540.x) 36. Queller DC. 1997 Why do females care more than males? Proc. R. Soc. Lond. B 264, 1555–1557. (doi:10.1098/rspb.1997.0216) 37. Sheldon BC. 2002 Relating paternity to paternal care. Phil. Trans. R. Soc. Lond. B 357, 341 –350. (doi:10.1098/rstb.2001.0931) 38. Griffin AS, Alonzo SH, Cornwallis CK. 2013 Why do cuckolded males provide paternal care? PloS Biol. 11, e1001520. (doi:10.1371/journal.pbio.1001520) 39. Houston AI, McNamara JM. 2002 A self-consistent approach to paternity and parental effort. Phil. Trans. R. Soc. Lond. B 357, 351 –362. (doi:10.1098/ rstb.2001.0925) 40. Campbell JC, Laugero KD, Van Westerhuyzen JA, Hostetler CM, Cohen JD, Bales KL. 2009 Costs of pair-bonding and paternal care in male prairie voles (Microtus ochrogaster). Physiol. Behav. 98, 367 –373. (doi:10.1016/j.physbeh.2009.06.014) 41. Fietz J, Dausmann KH. 2003 Costs and potential benefits of parental care in the nocturnal fat-tailed dwarf lemur (Cheirogaleus medius). Folia Primatol. 74, 246– 258. (doi:10.1159/000073312) 42. Randall DA, Pollinger JP, Wayne RK, Tallents LA, Johnson PJ, Macdonald DW. 2007 Inbreeding is reduced by female-biased dispersal and mating behavior in Ethiopian wolves. Behav. Ecol. 18, 579 –589. (doi:10.1093/beheco/arm010) 43. Crawford JC, Liu ZW, Nelson TA, Nielsen CK, Blooniquist CK. 2008 Microsatellite analysis of mating and kinship in beavers (Castor canadensis). J. Mammal. 89, 575–581. (doi:10.1644/07-MAMMA-251R1.1) 44. Opie C, Atkinson QD, Dunbar RIM, Shultz S. 2013 Male infanticide leads to social monogamy in primates. Proc. Natl Acad. Sci. USA 110, 13 228– 13 232. (doi:10.1073/pnas.1307903110) 45. Heymann EW. 2000 The number of adult males in callitrichine groups and its implications for callitrichine social evolution. In Primate males (ed. PM Kappeler), pp. 64– 71. Cambridge, UK: Cambridge University Press. 46. Huck M, Lo¨ttker P, Heymann EW. 2004 The many faces of helping: possible costs and benefits of infant carrying and food transfer in moustached tamarins (Saguinus mystax). Behaviour 141, 915 –934. (doi:10.1163/1568539042265635) 47. Fernandez-Duque E. 2011 Aotinae: social monogamy in the only nocturnal anthropoid. In Primates in perspective (eds CJ Campbell, A Fuentes,


18.

monogamy in territorial and loosely colonial populations of phainopepla (Phainopepla nitens). The Auk 119, 770–777. (doi:10.1642/00048038(2002)119[0770:SAGMIT]2.0.CO;2) Stanback M, Richardson DS, Boix-Hinzen C, Mendelsohn J. 2002 Genetic monogamy in Monteiro’s hornbill, Tockus monteiri. Anim. Behav. 63, 787–793. (doi:10.1006/anbe.2001.1975) Koopman ME, McDonald DB, Hayward GD. 2007 Microsatellite analysis reveals genetic monogamy among female boreal owls. J. Raptor Res. 41, 314–318. (doi:10.3356/0892-1016(2007)41[314: MARGMA]2.0.CO;2) Kleven O, Bjerke B-A, Lifjeld JT. 2008 Genetic monogamy in the common crossbill (Loxia curvirostra). J. Ornithol. 149, 651– 654. (doi:10. 1007/s10336-008-0291-0) Taylor SS, Boessenkool S, Jamieson IG. 2008 Genetic monogamy in two long-lived New Zealand passerines. J. Avian Biol. 39, 579–583. (doi:10. 1111/j.0908-8857.2008.04331.x) Lukas D, Clutton-Brock T. 2013 The evolution of social monogamy in mammals. Science 341, 526–530. (doi:10.1126/science.1238677) Gavrilets S. 2012 Human origins and the transition from promiscuity to pair-bonding. Proc. Natl Acad. Sci. USA 109, 9923 –9928. (10.1073/pnas. 1200717109) Reichard UH, Boesch C. 2003 Monogamy: mating strategies and partnerships in birds, humans and other mammals. Cambridge, UK: Cambridge University Press. Ribble DO. 1991 The monogamous mating system of Peromyscus californicus as revealed by DNA fingerprinting. Behav. Ecol. Sociobiol. 29, 161–166. (doi:10.1007/BF00166397) Brotherton PNM, Pemberton JM, Komers PE, Malarky G. 1997 Genetic and behavioural evidence of monogamy in a mammal, Kirk’s dik-dik (Madoqua kirkii). Proc. R. Soc. Lond. B 264, 675–681. (doi:10.1098/rspb.1997.0096) Sommer S, Tichy H. 1999 Major histocompatibility complex (MHC) class II polymorphism and paternity in the monogamous Hypogeomys antimena, the endangered, largest endemic Malagasy rodent. Mol. Ecol. 8, 1259–1272. (doi:10.1046/j.1365294X.1999.00687.x) Hennessy CA, Dubach J, Gehrt SD 2012. Long-term pair bonding and genetic evidence for monogamy among urban coyotes (Canis latrans). J. Mammal. 93, 732–742. (doi:10.1644/11-MAMM-A-184.1) Roemer GW, Smith DA, Garcelon DK, Wayne RK. 2001 The behavioural ecology of the island fox (Urocyon littoralis). J. Zool. 255, 1 –14. (doi:10. 1017/S0952836901001066) Kitchen AM, Gese EM, Waits LP, Karki SM, Schauster ER. 2006 Multiple breeding strategies in the swift fox, Vulpes velox. Anim. Behav. 71, 1029 –1038. (doi:10.1016/j.anbehav.2005.06.015) Arnold KE, Owens IPF. 2002 Extra-pair paternity and egg dumping in birds: life history, parental care and the risk of retaliation. Proc. R. Soc. Lond. B 269, 1263–1269. (doi:10.1098/rspb.2002.2013)

64.

66.

67.

68.

69.

70. 71.

72.

74.

75.

76.

77.

78.

79.

80.

81.

82.

83. Yamamura N, Tsuji N. 1993 Parental care as a game. J. Evol. Biol. 6, 103–127. (doi:10.1046/j. 1420-9101.1993.6010103.x) 84. Kempenaers B, Lanctot RB, Robertson RJ. 1998 Certainty of paternity and paternal investment in eastern bluebirds and tree swallows. Anim. Behav. 55, 845 –860. (doi:10.1006/anbe.1997.0667) 85. Sheldon BC, Ra¨sa¨nen K, Dias PC. 1997 Certainty of paternity and paternal effort in the collared flycatcher. Behav. Ecol. 8, 421–428. (doi:10.1093/ beheco/8.4.421) 86. Westneat DF. 1995 Paternity and paternal behaviour in the red-winged blackbird, Agelaius phoeniceus. Anim. Behav. 49, 21 –35. (doi:10.1016/00033472(95)80150-2) 87. Wright J, Cotton PA. 1994 Experimentally induced sex differences in parental care: an effect of certainty of paternity? Anim. Behav. 47, 1311– 1322. (doi:10.1006/anbe.1994.1179) 88. Komers PE, Brotherton PNM. 1997 Female space use is the best predictor of monogamy in mammals. Proc. R. Soc. Lond. B 264, 1261– 1270. (doi:10. 1098/rspb.1997.0174) 89. Muhlenberger AH. 2011 The evolution of monogamy in primates: a phylogenetic approach. Master’s thesis, Kent State University, MA, USA. 90. de Waal FBM, Gavrilets S. 2013 Monogamy with a purpose. Proc. Natl Acad. Sci. USA 110, 15 167– 15 168. (doi:10.1073/pnas.1315839110) 91. Reichard UH. 2003 Social monogamy in gibbons: the male perspective. In Monogamy: mating strategies and partnerships in birds, humans and other mammals (eds UH Reichard, C Boesch), pp. 190 – 213. Cambridge, UK: Cambridge University Press. 92. Schu¨lke O. 2003 Living apart together—patterns, ecological basis, and reproductive consequences of life in dispersed pairs of fork-marked lemurs (Phaner furcifer, Primates). Doctoral thesis. Bayerische Julius-Maximilians-Universita¨t Wu¨rzburg, Wu¨rzburg, Germany.

8

Proc. R. Soc. B 281: 20140195

65.

73.

to the Cretaceous–Tertiary boundary. J. Mammal Evol. 4, 285–302. (doi:10.1023/a:1027378615412) Getz LL, McGuire B, Pizzuto T, Hofmann JE, Frase B. 1993 Social organization of the prairie vole (Microtus ochrogaster). J. Mammal 74, 44– 58. (doi:10.2307/1381904) Barelli C, Matsudaira K, Wolf T, Roos C, Heistermann M, Hodges K, Ishida T, Malaivijitnond S, Reichard UH. 2013 Extra-pair paternity confirmed in wild white-handed gibbons. Am. J. Primatol. 75, 1185 –1195. (doi:10.1002/ajp.22180) Hennessy CA, Dubach J, Gehrt SD. 2012 Long-term pair bonding and genetic evidence for monogamy among urban coyotes (Canis latrans). J. Mammal. 93, 732–742. (doi:10.1644/11-MAMM-A-184.1) Johnson JB, Omland KS. 2004 Model selection in ecology and evolution. Trends Ecol. Evol. 19, 101 –108. (doi:10.1016/j.tree.2003.10.013) Zuur A, Ieno EN, Walker NJ, Saveliev AA, Smith GM. 2009 Mixed effects models and extensions in ecology with R. Heidelberg, Germany: Springer. Paradis E, Claude J, Strimmer K. 2004 APE: analyses of phylogenetics and evolution in R language. Bioinformatics 20, 289–290. (doi:10.1093/ bioinformatics/btg412) Pinheiro J, Bates D, DebRoy S, Sarkar D, R Development Core Team. 2011 nlme: Linear and Nonlinear Mixed Effects Models. R package v. 3, pp. 1–98. Fernandez-Duque E, Valeggia CR, Mendoza SP. 2009 The biology of paternal care in human and nonhuman primates. Annu. Rev. Anthropol. 38, 115 –130. (doi:10.1146/annurev-anthro-091908164334) Wright PC. 1990 Patterns of paternal care in primates. Int. J. Primatol. 11, 89 –102. (doi:10. 1007/BF02192783) Oka T, Takenaka O. 2001 Wild gibbons’ parentage tested by non-invasive DNA sampling and PCRamplified polymorphic microsatellites. Primates 42, 67–73. (doi:10.1007/BF02640690)


63.

genotyping strategy for assessing genetic identity and kinship in Azara’s owl monkeys (Aotus azarai). Folia Primatol. 82, 107–117. (doi:10.1159/ 000330564) Hadfield JD, Richardson DS, Burke T. 2006 Towards unbiasced parentage assignment: combining genetic, behavioural and spatial data in a Bayesian framework. Mol. Ecol. 15, 3715 –3730. (doi:10. 1111/j.1365-294X.2006.03050.x) R Development Core Team. 2012 R: a language and environment for statistical computing. See http:// www.R-project.org. Huck M, Rotundo M, Fernandez-Duque E. 2011 Growth and development in wild owl monkeys (Aotus azarai) of Argentina. Int. J. Primatol. 32, 1133–1152. (doi:10.1007/s10764011-9530-y) Fernandez-Duque E, Huck M. 2013 Till death do us part: intense intra-sexual competition, aggression and death in a sexually monomorphic primate species. PLoS ONE 8, e53724. (doi:10.1371/journal. pone.0053724) Hadfield JD. 2012 MasterBayes: Maximum Likelihood and Markov chain Monte Carlo methods for pedigree reconstruction, analysis and simulation. See http://cran.r-project.org/web/packages/ MasterBayes/vignettes/Tutorial.pdf. Borries C, Gordon AD, Koenig A. 2013 Beware of primate life history data: a plea for data standards and a repository. PLoS ONE 8, e67200. (doi:10.1371/ journal.pone.0067200) Dixson AF. 2013 Male infanticide and primate monogamy. Proc. Natl Acad. Sci. USA 110, E4937. (doi:10.1073/pnas.1318645110) Paradis E. 2011 Analysis of phylogenetics and evolution with R, 2nd edn. Heidelberg, Germany: Springer. Bininda-Emonds ORP et al. 2007 The delayed rise of present-day mammals. Nature 446, 507– 512. (doi:10.1038/nature05634) Springer MS. 1997 Molecular clocks and the timing of the placental and marsupial radiations in relation

ESM1: Electronic Supplementary Material – Additional Methods, Tables, and Figures - to Huck et al., Correlates of genetic monogamy in pair-living mammals (Proc Roy Soc B, 2014)

Methods – Additional details Sample collection and genetic analyses Samples were collected from 128 individuals living in 29 social groups or as solitary floaters [1, 2]. High quality DNA was extracted from either tissue or blood using QIAamp DNA Mini and DNA Blood Mini purification kits according to the manufacturer’s protocols. All stock DNA samples were subsequently quantified on a NanoDrop ND-1000 spectrophotometer (Thermo Scientific) and DNA dilutions at 5ng/µl made from them [1, 2]. All individuals were genotyped for 14 genetic loci bearing polymorphic short tandem repeats (STRs). These included 12 previously described and optimized loci [2, Table EMS2_A], as well as two additional loci optimized for this study (Table ESM1_B). All genotyping was performed with GeneAmp 9700 (ABI) thermal cyclers using AmpliTaq Gold (ABI) with 6-FAM fluorescent forward primers and non-fluorescent reverse oligonucleotide primers (Sigma Genosys) [2]. Each genotyping reaction was repeated a minimum of four times to confirm the presence of homozygotes [3, 4]. All reactions were then run on a 3130xl Gene Analyzer (ABI) for capillary-based fragment analysis, and alleles were read using GeneMapper ID v4.1 software (ABI) [2]. In order to identify repeat motif and repeat length at each locus, individual homozygous alleles were amplified with unlabelled primers and directly sequenced. PCR amplicons were purified through SAP/Exo I digestion (New England BioLabs), and then cycle sequenced [5], with all DNA sequences being read on a 3130xl Gene Analyzer. For each individual, the overlapping forward and reverse fragments were aligned in Sequencher v4.9 (GeneCodes) and Geneious Pro v5.5.5 [6]. The predicted occurrence of null alleles (F) at each locus ranged between -0.21 and +0.11 across the different markers as estimated from using CERVUS [7]. Owl monkey parentage analyses We determined maternity and paternity of the 35 infants using a specific set of candidate parents for each infant. Individuals were considered candidate parents if (A) they had been born at least four years before the infant was born [i.e., adults, 8], and (B) they had been alive in the year of birth of the infant. Additionally, we excluded as candidate mothers those females who did not share the same haplogroups [haplotype groups A, B, or C, for locus control region (CR), and haplotypes AaaI-VI and Z at Cytochrome C Oxidase subunit II (COII) [1]. We did not distinguish between sub-types of CR haplotypes (e.g., A1 and A2), in order to allow for potential sequencing errors. For seven infants, the mothers were known because they were seen nursing the infants. Nevertheless, we used the same rules for these females as for males to test the reliability of our paternity estimates for group males. We calculated allele frequencies using only adults [9] to avoid over-representation of alleles in groups with many offspring. The details of the Bayesian analysis are given in the main text. Page 1 of 18

ESM1: Electronic Supplementary Material – Additional Methods, Tables, and Figures - to Huck et al., Correlates of genetic monogamy in pair-living mammals (Proc Roy Soc B, 2014) Comparative analyses For better comparability with "monogamous" birds, we focussed our analyses on pair-living ('socially monogamous') mammals, following the definition by Kappeler & van Schaik [10] and others [9-12]. Groups in socially monogamous species consist of pairs, families or stepfamilies that can contain offspring of several litters. Therefore, extended families (i.e., families including adult relatives of one of the adults), or groups in which additional unrelated adults commonly (more than 10% of groups) live and reproduce, were not considered socially monogamous. The latter case is illustrated by some of the cooperative breeders. For example, in meerkats (Suricatta suricatta), a dominant pair monopolises the majority of breeding, although approximately 20% of subordinate individuals may also reproduce successfully [13, 14]. Definitions of social monogamy also usually imply some extent of physical proximity and shared habitat use by the pair partners [11]. 'Dispersed pairs', where partners share their territory and sleeping sites, but forage solitarily [e.g., fork-marked lemurs, Phaner furcifer, 15], are still considered socially monogamous. On the other hand, species in which mating partners do not share a home-range or have strong social ties are not considered socially monogamous, even if they mate monogamously during a given breeding season [e.g., domestic cats, Felis silvestris catus, on Kerguelen Island, 16]. These differences among definitions have made efforts to analyse the evolution of different social systems and to compare major taxonomic groups (e.g., birds and mammals) quite difficult. Visual inspection of residual-vs.-fitted data plots showed that the data for the arcsine transformed proportion of EPP did not deviated from normality and showed homogeneity of variance. We fitted a generalized least square model (phylGLS) with a phylogenetic correlation structure to the data, based on the phylogeny presented in Supplementary Figure ESM2_1 and using a Brownian motion model of character evolution [17]. The different taxon-phylogenies on which we based our overall phylogeny used a variety of approaches. For basic mammalian taxa, Bininda-Emonds et al. [18] used a maximum likelihood approach (ML) to analyse 32 nuclear DNA, 19 tRNA and 15 other mtDNA genes representing a total of 51089 bp. Bininda-Emonds et al. [19] later used a matrix-representation with parsimony analysis to construct a 'super-tree' of extant carnivores from a total of 177 published 'source trees'. Similarly, Bardeleben et al. [20] used DNA sequence data from six loci using maximum parsimony (MP) and ML analyses for the canid phylogeny. Steppan et al. [21] used four nuclear genes, totalling 6400 bp, to compare results from MP, ML and Bayesian approaches for rodents, while Perelman et al. [22] reconstructed a primate phylogeny on 54 nuclear gene regions totalling 34,927 bp/animal (in total ~8 Mb) of sequence by applying ML, MP, and Bayesian approaches. The resulting branching pattern of our phylogeny produced only a single disagreement in the positioning of the two fox species [Otocyon megalotis and Urocyon littoralis, 19, vs. 20]. Therefore, we re-ran the analysis using Otocyon as sister taxon to (Vulpes + Urocyon). Page 2 of 18

ESM1: Electronic Supplementary Material – Additional Methods, Tables, and Figures - to Huck et al., Correlates of genetic monogamy in pair-living mammals (Proc Roy Soc B, 2014) Because reported divergence times and methods varied considerably between studies [e.g., 18, vs. 23], we checked for the robustness of our results. In this assessment, we constructed 16 trees of the same topology and randomly changing branch lengths by some value between -20 and +20 MYA, with the restriction that no negative divergence times were allowed and the general topology had to remain the same. We also compared different models of the phylGLS by choosing the model with the lowest AIC variance structure [24]. Because AIC levels were higher for models with differing variance structures (AIC=115.1 to 117.1) than for the simpler model (AIC=114.9), we assumed similar variance structures [25]. All statistical analyses were done in R 2.11.1 [26], using the packages 'ape' [27] and 'nlme' [28].

Page 3 of 18

ESM1: Electronic Supplementary Material – Additional Methods, Tables, and Figures - to Huck et al., Correlates of genetic monogamy in pair-living mammals (Proc Roy Soc B, 2014) Table ESM1_A: Locus name, number of alleles, observed (HObs) and expected heterozygosity (HExp), and significance levels for Hardy-Weinberg linkage disequilibrium tests (HW) for the 14 microsatellite loci used to determine parentage in the study. References are given at the end of this Supplement. Locus D4S411 Leon30c73 D13S160 CJ14 PEPC40 D8S275 D15S108 1115 PEPC3 PEPC8 SW34D SB24 D5S117 D16S417

# Alleles 8 3 4 5 2 5 3 2 4 2 3 8 6 5

HObs 0.849 0.169 0.815 0.407 0.301 0.43 0.366 0.216 0.446 0.376 0.543 0.231 0.62 0.472

HExp 0.735 0.176 0.553 0.431 0.352 0.399 0.349 0.194 0.359 0.475 0.401 0.251 0.63 0.477

HW * ND * NS NS NS NS ND NS NS * ND NS NS

Reference [29] [30] [29] [31] [32] [29] [29] [33] [32] [32] [34] [35] [29] [29]

*: Significant after Bonferroni-correction; NS: not significant/ p>0.05; ND: not done because minimum expected values are smaller than 4.

Page 4 of 18


Table ESM1_B: Repeat motif, primer sequences and PCR conditions for STR loci D16S417 and D5S117 [29]

Locus

Repeat motif

Primer

Primer sequence (5’-3’)

D16S417

(CA)15(TA)(CA)2

D5S117

(AC)17

D16S417-F D16S417-R D5S117-F D5S117-R

6*FAM-CTGTCCAACATGCAGCC TGAAGTCAATCCCACTTGAA 6*FAM-TGTCTCCTGCTGAGAATAG TAATATCCAAACCACAAAGGT

Size range (bp) 128-134 128-146

PCR

TA (°C)

mM MgCl2

45 cyc TD (60-55)

55

1.5

45 cyc TD (60-55)

55

1.5

Note: All DNA samples were diluted to 5 ng/µL concentrations, using 4 µL (20 ng) of DNA per PCR reaction.

Page 5 of 18

ESM1: Electronic Supplementary Material – Additional Methods, Tables, and Figures - to Huck et al., Correlates of genetic monogamy in pair-living mammals (Proc Roy Soc B, 2014) Table ESM1_C: List of socially monogamous mammals for which extra-pair paternity has been reported and corresponding pair bond strength, intensity of male care, and length of breeding season classification. References are given at the end of this Supplement.

Species

Common name

Pair bond

Aotus azarae

Azara's night monkey

C

I

17

0

This study

Nomascus gabriellae

Golden-cheeked gibbon

C

N

7

0.07

[36]

Tarsius lariang

Lariang tarsier

D

M

5

0.2

[37]

Phaner furcifer

Fork-marked lemur

Male Care

Sample size (# of pairs)

Proportion EPP

References

c

D

N

5

0.3

[38]

d

9

0.47

[39-42]

Cheirogaleus medius

Fat-tailed dwarf lemur

D

I

Lepilemur ruficaudatus

Red-tailed sportive lemurs

D

N

15

0.07e

[43-45]

Tupaia tana

Large tree shrew

D

N

13

0.5

[46, 47, p177]

Hypogeomys antimena

Malagasy giant jumping rat

Df

Ig

28

0.04

[48-50]

Peromyscus polionotus

Old field mouse

D?

M

147

0.1

[51-53]

Peromyscus californicus

California mouse D?

I

22

0

[54, 55]

Vulpes velox

Swift fox

D

M

15

0.52

[56-60]

Otocyon megalotis

Bat-eared fox

C

I

12

0.1

[61, 62]

h

i

Urocyon littoralis

Island fox

D

I

11

0.1

Madoqua kirkii

Kirk's dik-dik

C

N

11

0

[65, 66]

Trichosurus cunninghami

Mountain brushtail possum

C

N

12

0.35

[9]

[63, 64]

Page 6 of 18

ESM1: Electronic Supplementary Material – Additional Methods, Tables, and Figures - to Huck et al., Correlates of genetic monogamy in pair-living mammals (Proc Roy Soc B, 2014) Note: Species are ordered as in the phylogeny of Figure 1. IPY: Number of intra-pair young; EPY: Number of extra-pair young; EPP: proportion of extra-pair paternity. Pairbond: C=close, D=dispersed. Male care: N=no care, M=moderate care, I=intense care. a: infants can be seen year round, M. Kenyon, pers. comm. b: births are observed year round and partners forage separately, S. Merker, pers. comm. c: the reported proportion of extra-pair paternity is 0.57 if the identity of the mother is not taken into account. d: parental care consists mostly of guarding the infants. The authors claim that this behavior has considerable costs for both adults, although the tendency for males did not reach statistical significance [41]. e: this is a conservative estimate: one social father showed a mismatch with the infant at one locus, but since the infant was homozygous at that locus, and three mothers had one mismatch with their offspring who were homozygous at that locus, we assumed allelic dropout or genotyping error. If this social father was not the genetic father, the EPP rate would have been 0.13. f: S. Sommer, pers. comm. g: the classification of intense male care is based on the finding that male predation risk increases during periods when juveniles are heavily preyed on, while females do not have an increased risk. Males stay closer to juveniles than females, and give alarm calls when predators are present [48]. h: Island foxes forage individually [G.W. Roemer, pers comm.] i: The authors [63] estimate a much higher proportion of EPP. However, only in one case an EPP was assigned due to an exclusion (i.e., mismatch) with the group male, while in all other potential cases this was based on LOD scores. We used the conservative estimate of one young out of 11 groups. ?: No data on inter-individual distances are available in the wild. However, for P. californicus, during the night males were in located in the nest used by the mated female during the same sampling period between 7 and 36% of the time. Furthermore, while male and female home ranges overlapped extensively, those of males were larger, indicating that males have to roam on their own at least occasionally [67].

Page 7 of 18


Table ESM1_D: Putatively socially monogamous species not included in the analyses. References are given at the end of this Supplement.

Species Canis simensis * Canis lupus * Canis latrans Castor candadensis Crocidura russula

Cryptomys hottentotus Felis silvestris

Hapalemur griseus Helogale parvula * Hylobates lar Hylobates muelleri Lycaon pictus * Marmota caligata Marmota marmota

Reason for exclusion Unrelated adults present at least occasionally; one of seven packs had subordinate female breeding. Packs can consist of extended families and even include non-related adults; multiple breeding possible. Formed packs in the study area. Colonies include unrelated individuals. A few studies found more than one lactating or pregnant female. Many males and a few females mate polygamously, but it is not clear how this relates to whether females live with one male but mate with another, or whether the social system is in fact polygyny. The social organization is not strict monogamy, but polyandry or sometimes polygynandry. Unrelated individuals can be present. There is no indication that one male and one female interact exclusively with each other or have some kind of pair bond. Due to lack of partners, the system may result in genetic monogamy, but they are not socially monogamous. 40% of groups contain two breeding females. 24% of male and 15% of female subordinates mate and reproduce. 21% of groups lived in multi-male/one-female groups N = four infants. 10% of male and 8% of female subordinates reproduce. From the description, the species appears to be polygynandrous. Unrelated subordinates obtain 1/3 of all extra-pair young.

Reference [68] [69] [70, 71] [72] [73]

[74] [74]

[75] [76] [77] [78] [79] [80] [80] Page 8 of 18

ESM1: Electronic Supplementary Material – Additional Methods, Tables, and Figures - to Huck et al., Correlates of genetic monogamy in pair-living mammals (Proc Roy Soc B, 2014) * Meriones unguiculatus * Microtus pinetorum Microtus ochrogaster

Social groups consist of up to four breeding males and up to three breeding females. Many groups with several adult males or females; limited sample size. One study found evidence that not all groups are pair-living

Petrogale assimilis Suricata suricatta

A third of the population pairs polygynously. Some groups contain unrelated subordinate males. 20% of litters are born of subordinate females. Often female "helpers" are present, but the study does not allow to decide, whether these breed or not. Subordinate females breed too and many non-related adult subordinates are present in groups.

* Urocyon cinereoargenteus Vulpes vulpes

[81] [82] [83-85, but see 86] [87] [13, 88] [89] [90]

* Species not included in Cohas & Allainé [91], but also occasionally claimed to be socially monogamous. The term "unrelated individuals" refers to adults beyond the presumed dominant pair.

Page 9 of 18

ESM1: Electronic Supplementary Material – Additional Methods, Tables, and Figures - to Huck et al., Correlates of genetic monogamy in pair-living mammals (Proc Roy Soc B, 2014) Table ESM1_E: Likelihood of group female and male being the parents of individual offspring. Offspring Anastasia Angelita Anibal Anita Aparicio Apolo Cafe Camilo Candado Centauro Cata Colon Conchita Constanza Dante Dardo Dartagnan Dina Dionisio Diosa Diuresis Don Elegida Ernestina Evaristo Felix Fany Fidel Fuerte Furia Gargara Idiota Mony Pancho Vilma

Group Female Anana Anana Anana Antonia K Atenas Atenas Canela Canela Canela Cecropia Mony K Coronita Coronita Coronita K Dania Dania Dania Dinamita Dinamita K Dinamita K Dinamita Dorotea Esperanza Esperanza Eva K Felipa NA NA Fumata K Fumata Galaxia Irene NA Paulina Vicenta

Group Male Anacleto Anacleto Anacleto Anacleto S Aparato Aparato Candido Candido Candido Cesar Cola_Corta S Cola_Corta S Cola_Corta S Cola_Corta S NA NA NA Dixson Dixson S Dixson Dixson Donatello NA NA Eriko S Fede Fiero Fiero Fulano S Fulano Galileo Inodoro Marino Pampero Victor

Likelihood of group female 0.95 0.70 0.95 0.95 0.95 0.95 0.95 0.90 0.65 0.90 0.70 0.95 0.90 0.95 0.45 0.75 0.50 0.95 0.65 0.75 0.95 0.60 0.65 0.60 0.95 0.90 NA NA 0.95 0.95 0.95 0.95 NA 0.95 0.95

Likelihood of group male 0.95 0.70 0.95 0.95 0.95 0.95 0.95 0.90 0.65 0.90 0.70 0.95 0.90 0.95 NA NA NA 0.95 0.65 0.75 0.95 0.60 NA NA 0.95 0.90 0.75 0.85 0.95 0.95 0.95 0.95 * 0.95 0.95

Note: All group females and males (with the exception of Marino) were the most likely parent determined by Bayesian analysis. NA: Either the adult female or male of the group was never identified and no genetic sample was available. Therefore we did not conduct a maternity or paternity analysis in this case. * Not determined, but group male (Marino) did not have a mismatch with the offspring (Mony).

Page 10 of 18

ESM1: Electronic Supplementary Material – Additional Methods, Tables, and Figures - to Huck et al., Correlates of genetic monogamy in pair-living mammals (Proc Roy Soc B, 2014) Table ESM1_G: Median (and range) model coefficients based on 16 trees of the same topology as the tree in Figure ESM1_1, but randomly changed branch length (A) and 15 trees with only 14 of the 15 species (C), and model coefficients for a model using three additional species (A), and a model with the position of Otocyon and Urocyon exchanged (D). Value

Pair bond (dispersed) Male care (intense) Pair bond: Male care Pair bond (dispersed) Male care (intense) Pair bond: Male care* Pair bond (dispersed) Male care (intense) Pair bond: Male care Pair bond (dispersed) Male care (intense) Pair bond: Male care

Std. error t-value (A) Different branch length 10.2 (9.3 – 13.3) 6.6 (3.6 – 9.3) 1.6 (1.0 – 2.9) -16.2 (-17.9 - -12.4) 4.2 (2.5 – 5.4) -3.9 (-6.8 - -2.7) -5.7 (-11.3 - -2.2) 14.3 (11.5 – 14.9) -0.4 (-0.8 - -0.2) (B) One species missing 7.5 (0.4 – 20.0) 7.1 (4.0 – 14.8) 1.1 (0.1 – 1.9) -17.9 (-22.3 - -12.4) 4.2 (3.2 – 6.6) -4.2 (-5.9 - -2.6) -10.2 (-17.6 – 5.0) 16.1 (4.0 – 14.8) -0.7 (-1.1 – 0.3) (C) Including 18 species (+ Microtus ochrogaster, Hylobates lar, Canis latrans) 12.6 7.5 1.7 -16.4 4.9 -3.4 -11.5 17.7 -0.7 (D) Position of Otocyon and Urocyon exchanged 6.8 7.2 1.0 -18.3 4.0 -4.5 -11.0 15.2 -0.7

p-value 0.10 (0.01 – 0.32) 0.002 (