Dig Dis Sci (2007) 52:1415–1422 DOI 10.1007/s10620-006-9261-7
ORIGINAL PAPER
Deficiency of Invariant NK T Cells in Crohn’s Disease and Ulcerative Colitis Randall H. Grose · Fiona M. Thompson · Alan G. Baxter · Daniel G. Pellicci · Adrian G. Cummins
Received: 8 February 2006 / Accepted: 13 February 2006 / Published online: 10 April 2007 C Springer Science+Business Media, Inc. 2006
Abstract The aim of this study was to investigate whether immunoregulatory invariant NK T cells are deficient in Crohn’s disease or ulcerative colitis. Blood was collected for flow cytometry from 106 Crohn’s disease, 91 ulcerative colitis, and 155 control subjects. Invariant NK T cells were assessed by Vα24 and (α-galactosylceramide/CD1d tetramer markers. Intracellular cytokine was measured after in vitro anti-CD3 antibody stimulation. Vα24 + T cells were quantified in ileocolonic biopsies as mRNA by real-time PCR and by immunofluorescence. Circulating invariant NK T cells were 5.3% of the control levels in Crohn’s (P < 0.001) and 7.9% of the control levels in ulcerative colitis (P < 0.001). Interleukin-4 production was impaired in Crohn’s disease and ulcerative colitis. Intestinal Vα24 mRNA expression R. H. Grose · F. M. Thompson · A. G. Cummins Basil Hetzel Institute for Medical Research and Department of Medicine, University of Adelaide, Adelaide, and Department of Gastroenterology and Hepatology, DX 465384, The Queen Elizabeth Hospital, 28 Woodville Road, Woodville South, SA 5011, Australia A. G. Baxter Comparative Genomics Centre, James Cook University, Townsville, Queensland, Australia D. G. Pellicci Department of Pathology and Immunology, Monash University Central and Eastern Clinical School, Victoria, 3181 Australia A. G. Cummins () Basil Hetzel Institute for Medical Research and Department of Medicine, University of Adelaide, Adelaide, and Department of Gastroenterology and Hepatology, DX 465384, The Queen Elizabeth Hospital, 28 Woodville Road, Woodville South, SA 5011, Australia e-mail:
[email protected]
was 7% in Crohn’s disease (P < 0.05) and 9% in ulcerative colitis (P < 0.05). Intestinal Vα24 + T cells were 23% in Crohn’s disease but not reduced in ulcerative colitis. We conclude that invariant NK T cells are deficient in Crohn’s disease and in ulcerative colitis. Keywords Crohn’s disease . Invariant NK T cells . Ulcerative colitis
Introduction There is evidence in both Crohn’s disease and in ulcerative colitis for a loss of immunoregulation to lumenal antigens [1– 4]. Peripheral blood lymphocytes and intestinal lamina propria cells from patients with active Crohn’s disease and ulcerative colitis respond vigorously to antigens from sonicated autologous bacteria but not to heterologous bacteria from healthy individuals [1]. These studies showed that stimulated immune cells proliferate and produce pro-inflammatory interleukin [IL]-2 and interferon-γ [IFN-γ ] cytokines in response to autologous bacteria. The work of Mayer and colleagues has shown that a defect in immunoregulation in Crohn’s disease also extends to a soluble protein antigen, indicating a wider defect in immunoregulation that is not antigen restricted [3, 4]. In Crohn’s disease, there is an exaggerated response to bacterial flagellin antigens humorally [5]. It is possible that same antigens could be responsible for the exaggerated Th1 T-cell response that characterizes Crohn’s disease [6]. The immune response in ulcerative colitis is less well defined but includes an atypical Th2 response from a noninvariant NK T cell producing IL-13 possibly mixed with an Arthus reaction with immune complex activation and neutrophil recruitment
Springer
1416
[7–9]. An unexplained feature of both Crohn’s disease and ulcerative colitis is low or absent mucosal expression of IL-4 [10, 11]. Invariant (i)NK T cells comprise a unique regulatory class of NK T cells. They have a T-cell receptor with an invariant Vα24Jα18 chain that pairs with a Vβ11 chain. iNK T cells have antigenic specificity for the marine-derived αgalactosylceramide (α-GalCer) glycolipid that is believed to mimic endogenous glycolipids [12]. One possibility is that these are exposed on cell membranes during cellular damage such as during viral infection [13]. iNK T cells are CD1d restricted and have the unique ability to rapidly produce IL-4, which suppresses Th1 responses [14]. The gold standard for detecting iNK T cells is α-GalCer-loaded CD1d tetramers [15]. iNK T cells differ from the effector noninvariant NK T cells previously described in inflammatory bowel disease (IBD) [7]. A previous study found that Vα24 + Vβ11 + T cells were deficient in subjects with IBD but did not specifically examine iNK T cells [16]. The purpose of this study was to investigate iNK T-cell deficiency systemically in blood in IBD and to assess their stimulated cytokine production for any functional deficiency. We also investigated any deficiency of Vα24 + T cells (a population containing iNK T cells) mucosally.
Subjects and Methods
Dig Dis Sci (2007) 52:1415–1422
α-GalCer/Cd1d Tetramers Recombinant baculovirus encoding his-tagged mouse CD1d and mouse β2 microglobulin was generated by M. Kronenberg’s laboratory (Division of Developmental Immunology, La Jolla Institute of Allergy and Immunology, San Diego, CA) and has been described previously [15]. Recombinant virus was amplified by infecting High Five insect cells (Invitrogen Australia, Mount Waverley, Victoria, Australia) at a multiplicity of infection (MOI) of < 1. For CD1d protein production, High Five cells were infected at a MOI of 5–10, and after 5 days, supernatant containing CD1d protein was harvested and dialyzed in phosphate-buffered saline (PBS). CD1d protein was affinity purified from dialyzed supernatant by Ni-NTA agarose (Qiagen) chromatography. Purified CD1d protein was biotinylated using Bir-A enzyme (made in-house, University of Melbourne). Typically, 1 mg of protein was incubated with 2.5 µg of Bir-A at 30◦ C for 16 hr in buffer containing 50 mM Bicine (pH 8.3), 10 mM ATP, 10 mM Mg acetate, and 50 µM biotin. Biotinylated CD1d protein was loaded with α-GalCer containing 0.5% Tween 20 (Kirin Brewery Co, Shibuya-ku, Tokyo) at a 1:3 protein:lipid molar ratio. Unloaded biotinylated CD1d was made by incubation of protein with an equivalent volume of 0.5% Tween 20. Loaded or unloaded biotinylated CD1d protein was tetramized by the addition of streptavidin-PE (BD Biosciences PharMingen, San Jose, CA) at a 4:1 molar ratio.
Subjects Subjects with IBD were recruited from those attending the Department of Gastroenterology and Hepatology, The North West Adelaide Health Service at The Queen Elizabeth and Lyell McEwin Hospitals, as well as from those who responded to an invitation in the newsletter of the Crohn’s and Colitis Association of South Australia. Only patients with a verified diagnosis of either Crohn’s disease or ulcerative colitis were recruited. A total of 106 subjects with Crohn’s disease, 91 subjects with ulcerative colitis, and 155 subjects who were healthy (apart from nonulcer dyspepsia) were recruited. For α-GalCer/Cd1d tetramer staining, normal subjects were screened for rheumatoid factor, anti-nuclear factor, and thyroid and parietal cell autoantibodies, and those positive for one or more autoantibodies were excluded. Crohn’s patients were divided into those who only had disease of the small intestine and those who had large intestinal disease (either alone or with small intestinal involvement). Blood was collected for flow cytometry and a complete blood examination. Some members of the control group were used in other studies of NK T cells. This study had ethical permission given by the Human Ethics’ Committee of the North West Adelaide Health Service. Springer
Flow Cytometry Blood was collected in a lithium heparin tube and diluted 1:2 in PBS. The suspension was overlaid on lymphoprep (Nycomed, Oslo, Norway) and centrifuged at 400g for 30 min at room temperature. The mononuclear interface layer was collected and washed twice in sterile PBS containing 0.01% (w/v) sodium azide, except for the study of intracellular cytokine staining, which requires viable cells. Aliquots of 106 cells were incubated for 30 min at 4◦ C in the dark with saturating concentrations of antibodies (labeled with either Cy5, FITC, or PE fluorochromes) against the Vα24 and Vβ11 T-cell receptor or appropriate isotypic controls (antibodies from either Coulter-Immunotech or BD Biosciences, San Jose, CA). The labeled cells were washed twice in PBS. For α-GalCer/Cd1d tetramer staining, cells were incubated for 30 min at 4◦ C in the dark with saturating concentrations α-GalCer/CD1d tetramers or CD1d vehicle alone (labeled with PE fluorochrome). The labeled cells were washed in PBS, then incubated for a further 30 min at 4◦ C with Vα24-FITC and Vβ11-biotin antibodies. Cells were washed once again, then incubated for 30 min at 4◦ C in the dark
Dig Dis Sci (2007) 52:1415–1422
with streptavidin-Cy5. The labeled cells were washed for a final time, then analyzed. Labeled cells were analyzed on a flow cytometer (BD Biosciences) after selecting a lymphocyte gate based on forward- and side-scatter characteristics. Between 250,000 and 500,000 events within the lymphocyte gate were collected and analyzed. The absolute numbers of NK T cells were calculated from the flow cytometric relative reading and the absolute lymphocyte count recorded in the complete blood examination. Intestinal Vα24 + T Cells As Vα24 + T cells were likely to be at low levels mucosally, we used mRNA expression of the Vα24 gene to detect these cells in intestinal biopsies. Intestinal biopsies were collected from control subjects, subjects with Crohn’s disease, and subjects with ulcerative colitis. Ileal or colonic biopsy samples were stored in RNAlater (Ambion, Austin, TX) to prevent RNA degradation. Total RNA was isolated using the TRIzol reagent method (Life Technologies, Gaithersburg, MD). Two micrograms of RNA was converted to cDNA using a first-strand M-MLV cDNA synthesis kit (GibcoBRL, Melbourne, Australia). RNA was combined with 200 ng PD(N)6 primers (Amersham, Uppsala, Sweden), heated to 90◦ C for 5 min, and placed on ice for 3 min. The RNA and primer mixture was combined with 5 × firststrand buffer, 4 mM dNTPs (Bioline, Canton, MA), 10 mM DTT, and 400 U M-MLV reverse transcriptase. The mixture was incubated for 90 min at 37◦ C. PCR was preformed in a 25-µl reaction volume containing 2 µl of cDNA template, 1 µl of 50 ng Vα24 specific sense (ACACAAAGTCGAACGGAAG) and constant-region α antisense (GATTTAGAGTCTCTCAGCTG) primers as previously described by Illes and colleagues [17], 2.5 µl of 10 × Mg free buffer, 1.5 µl of 2.5 mM MgCl2 , 0.5 µl of 40 mM dNTPs (Bioline, Canton, MA), and 1 U of Taq DNA polymerase (Promega Corp., Sydney, Australia). Samples were amplified using an Eppendorf Mastercycler 5330 thermal cycler for 38 cycles (1 min at 94◦ C, 1 min at 60◦ C, and 1 min at 72◦ C). A QuantumRNA 18S internal standard (Ambion) was incorporated as a control housekeeping gene. Two microliters of 18S paired primers and competimer were added to each PCR sample at a ratio of 1:10, respectively. PCR samples were run on a 1.5% agarose gel at 100 V in 0.5 × Tris-borate EDTA buffer and analyzed using the Kodak (Rochester, NY) electrophoresis system. Data are expressed as the ratio of the net intensity of the Vα24 TCR band to that of the 18S internal RNA control band. Quantification of Vα24 was carried out using realtime PCR and performed by a DNA Engine OPTICON 2 Continuous Fluorescence Detector (MJ Research, Boston, MA). PCR primers were designed by Primer Premier version 5 (PREMIER Biosoft International, Palo Alto, CA).
1417
Both the Vα24 (5 -CTGGAGGGAAAGAACTGC-3’, 5 TGTCAGGGAAACAGGACC-3 ) and the GAPDH (5 CCACTCCTCCACCTTT-3 , 5 -ACCACCCTGTTGCTGT3 ) primer pairs were specific for a 105-bp product and were acquired from the GeneBank database, accession numbers U32532 and HUMGAPDHG, respectively. Vα24 and GAPDH oligonucleotide standards were synthesized by Geneworks (Adelaide, SA, Australia). In each experiment, duplicates of Vα24 and GAPDH standard dilution series of specific oligonucleotide and unknown samples were amplified in a 20-µl reaction containing 2 × DyNAmo SYBR Green qPCR master mix (Finnzymes, Keilaranda, Espoo, Finland) and 1.0 µl cDNA template. The real-time thermal PCR profile consisted of 1 cycle at 94◦ C for 7 min, 34 cycles at 94◦ C for 30 sec, 55◦ C for 30 sec, 72◦ C for 45 sec (increased by 1 sec per cycle), and 76◦ C for 2 sec, and a final extension at 72◦ C for 4 min. Fluorescence measurements were recorded during each annealing step and separation of any primer dimers at 76◦ C. The cycle threshold value (CT) was used to assess the quantity of Vα24 and GAPDH gene expression. The CT was fixed manually in each experiment at the exponential phase of the PCR. The relative copy number of each transcript was determined by interpolating the CT values of the unknown sample to each standard curve and the obtained values were normalized to the GAPDH copy number. The lack of primer-dimer, nonspecific product accumulation, or cDNA contamination was checked by melt-curve analysis. Dissociation curves showed a single peak corresponding to a melting temperature of 78.6 ± 0.2◦ C for Vα24 and 81.4 ± 0.1◦ C for GAPDH, demonstrating specific amplification and the absence of primer dimers. To exclude the possibility of coamplification of contaminating genomic DNA during RT-PCR, the GAPDH primers were designed to span an intron resulting in a larger, 195-bp product, corresponding to a secondary melt curve peak of 85.2◦ C. To verify Vα24 amplification, several 105-bp products were sequenced and confirmed by a BLAST search. Immunohistochemistry Cryostat 7-µm sections were fixed briefly in 95% ethanol, air-dried and immersed in PBS-azide. Tissue sections were incubated with either Vα24-FITC (diluted 1:10; Immunotech, Marseille, France) or isotype-matched control antibody (diluted 1:10; Immunotech) antibody for 1 hr at room temperature, then washed twice in PBS-azide for 10 min. Slides were mounted using DAKO fluorescent mounting medium (DAKO Corp., Carpinteria, CA). Slides were viewed and cells per square millimeter counted using a Nikon Eclipse 800 microscope (Nikon, Kanagawa, Japan) with a SPOT RT digital camera and SPOT V3.5 software (Diagnostic Instruments, Sterling Heights, MI). Springer
1418
Dig Dis Sci (2007) 52:1415–1422
Determination of Intracellular Cytokines Mononuclear cells were cultured in RPMI 1640 (Gibco, Life Technologies, Melbourne, Australia) culture medium supplemented with heat-inactivated fetal bovine serum (CSL Ltd., Melbourne, Australia), 0.3 mg/ml l-glutamine, 0.12 mg/ml benzylpenicillin, and 10 µg/ml gentamicin for 4 hr at 37◦ C. The cells were resuspended in 2 × 106 aliquots in a six-well tissue culture plate. The cells were stimulated with 5 µg/ml anti-CD3 antibody (OKT3; Ortho Pharmaceutical Corp., Raritan, NJ), 10 µg/ml brefeldin A (added for the last 4 hr of incubation; Sigma Chemical Co., St Louis, MO), and 2 µg/ml anti-CD28 antibody (BD Biosciences). Three-color immunofluorescence by flow cytometry was used to determine intracellular cytokine production by Vα24 + αGalCer/CD1d tetramer + cells. After 4 hr of anti-CD3 stimulation cells were harvested and washed in 4 ml of PBS/sodium azide. Antibody directed against Vα24 was added to cells and incubated for 30 min in the dark. Cells were washed in 4 ml of PBS/sodium azide, resuspended in 100 µl of FACS permeabilizing solution (BD Biosciences), and incubated with anti-IL-4, -IL-10, -IL-13, or -IFN-γ monoclonal antibodies. The cells were washed twice in PBS before analysis. Alternatively, cells were harvested, washed in 4 ml PBS/sodium azide, and incubated for 30 min with αGalCer/CD1d tetramer + or vehicle/CD1d. αGalCer/CD1d tetramer or vehicle-stained cells were washed in 4 ml PBS/sodium azide and incubated for a further 30 min with biotinylated Vα24. Cells were washed in 4 ml of PBS/sodium azide, resuspended in 100 µl of FACS permeabilizing solution, washed once again, and incubated with anti-IL-4, -IL-10, -IL-13, or -IFN-γ antibodies. The cells were washed twice in PBS before analysis. Statistics Data were summarized as the mean ± SE. Means of multiple groups were compared for significance by Peritz’ multiple-comparison F test [18]. The ratio of copy number of Vα24:GAPDH mRNA was log10 (x + 1) transformed to normalize the data and stabilize the variance before analysis.
Results Circulating Vα24 + T Cells and Vα24 + β11 + T Cells in Crohn’s Disease and Ulcerative Colitis The numbers of Vα24 + T cells in Crohn’s subjects were significantly reduced to 34% of those present in healthy subjects, and those in ulcerative colitis subjects were 93% of Springer
Fig. 1 Graph of Vα24 T cells versus age, with regression lines drawn for normal subjects and those with Crohn’s disease and ulcerative colitis
those present in healthy subjects (Table 1). Vα24 + T cells decreased with age in both normal subjects and those with ulcerative colitis but were low regardless of age in subjects with Crohn’s disease (Fig. 1). The mean ± SE number of circulating Vα24 + T cells for small bowel (n = 22) and large bowel (n = 27) Crohn’s disease was 2.9 ± 1.0 × 103 and 3.5 ± 0.6 × 103 cells/ml, respectively (P = NS). The mean ± SE number of circulating Vα24 + T cells for active Crohn’s (n = 35) and Crohn’s subjects in remission (n = 58) was 3.4 ± 0.8 × 103 and 2.5 ± 0.02 × 103 cells/ml, respectively (P = NS). The mean numbers of Vα24 + Vβ11 + T cells were significantly reduced, to 18% and 13%, respectively, of the values in subjects with Crohn’s disease and ulcerative colitis (Table 1). iNK T Cells α-GalCer/CD1d Tetramer + in Crohn’s Disease and in Ulcerative Colitis The mean numbers of iNK T cells were significantly reduced compared to the levels in control subjects, to 5.3% in Crohn’s disease and to 7.9% in ulcerative colitis (Table 1, Fig. 2). In control subjects, 88% of α-GalCer/CD1d tetramer + NK T cells expressed Vα24. iNK T cells were 43% of total Vα24 + T cells in control subjects. Intestinal Vα24 + T-Cell mRNA Expression Intestinal Vα24 T-cell mRNA expression was investigated by relative and real-time PCR. Vα24 mRNA from subjects with Crohn’s disease and ulcerative colitis was decreased to 15% and 29%, respectively, of the levels present in the intestine of control subjects (Fig. 3). Crohn’s subjects in remission had a similar level of Vα24 mRNA expression compared to subjects with active Crohn’s disease. This deficiency of Vα24 mRNA expression agreed with the systemic deficiency, at least in Crohn’s disease, as assessed by flow cytometry but also showed a mucosal deficiency of Vα24 + cells in
Dig Dis Sci (2007) 52:1415–1422
1419
Table 1 Comparison of circulating Vα24 + T cells and iNK T cells in normal subjects and in subjects with Crohn’s disease and ulcerative colitis: mean cells × 103 /ml ± SE Cells
Normal
Vα24 + T cells Vα24 + Vβ11 + T cells α-GalCer/CD1d tetramer + α-GalCer/CD1d tetramer + Vα24 +
8.8 ± 0.4a 3.8 ± 0.4a 4.3 ± 0.4a 3.8 ± 0.4a
(n = 155) (n = 72) (n = 23) (n = 23)
Crohn’s disease
Ulcerative colitis
3.0 ± 0.2ab 0.7 ± 0.2ab 1.0 ± 0.2ab 0.2 ± 0.1ab
8.2 ± 0.5b (n = 91) 0.5 ± 0.2b (n = 69) 1.6 ± 0.6b (n = 13) 0.3 ± 0.1b (n = 13)
(n = 106) (n = 36) (n = 17) (n = 17)
Note.a,b Means compared by Peritz F test, P < 0.001.
ulcerative colitis that was not evident in blood. The deficiency of intestinal Vα24 T-cell mRNA expression was confirmed by real-time PCR. There was no significant difference in intestinal GAPDH mRNA expression among control, Crohn’s disease, and ulcerative colitis subjects. However, real-time PCR confirmed a deficiency of Vα24:GAPDH mRNA, to 7% and 9% of levels in control subjects in Crohn’s and ulcerative colitis subjects, respectively. Comparison of Vα24 + T Cells in the Intestine In Crohn’s disease, Vα24 + T cells were reduced to 23% of the numbers in control subjects (Fig. 4). In ulcerative colitis, Vα24 + T cells were not reduced. Stimulated Intracellular Cyokine Staining Peripheral blood mononuclear cells were stimulated with either anti-CD3 antibody or PMA/ionomycin for 4 hr, and intracellular staining of iNK T cells recorded on flow cytometry (Fig. 5). Intracellular IL-4, IL-10, IL-13, and IFN-γ increased significantly in control subjects but did not change in subjects with Crohn’s disease or ulcerative colitis.
Discussion This study found that Vα24 + T cells were deficient in Crohn’s disease both systemically and mucosally. Vα24 + T-cell deficiency was present in subject’s with Crohn’s regarless of age and was independent of site of disease or activity of Crohn’s disease. iNK T cells were deficient systemically in both Crohn’s disease and ulcerative colitis and the residual iNK T cells were functionally deficient in stimulated cytokine production. The use of α-GalCer/CD1d tetramer staining revealed a severe deficiency of iNK T cells in IBD which was greater than that evident using Vα24 + or Vα24 + Vβ11 + surface markers. This was particularly the case for ulcerative colitis, in which the Vα24 + T-cell population was intact systemically but probably not mucosally. van der Vliet and colleagues [16] found that mean levels of Vα24 + Vβ11 + T cells were lower in 15 subjects with Crohn’s disease and in 6 subjects with ulcerative colitis, but there was overlap with the control subjects. Our study extends this work using α-GalCer/Cd1d tetramer staining, which precisely defines the immunoregulatory NK T-cell subset. We were also careful to screen our control subjects for autoantibodies. Deficiency of iNK T cells has been found in several autoimmune diseases such as type 1 diabetes, multiple
Fig. 2 Flow cytometric diagrams of iNK T cells in control subjects and those with Crohn’s disease and ulcerative colitis. The vertical axis is Vα24 + and the horizontal axis is α-GalCer/CD1d tetramer + cells Springer
1420
Dig Dis Sci (2007) 52:1415–1422
Fig. 4 Intestinal V α24 + T cells detected by immunofluorescence in control subjects and in subjects with Crohn’s disease and ulcerative colitis
Fig. 3 Intestinal V α24 mRNA expression shown in gel electrophoresis (A) and by relative PCR (B) and real-time PCR (C) in control subjects (A, lanes 1–3) and in subjects with Crohn’s disease (A, lanes 4–6) and ulcerative colitis (A, lanes 7–9)
sclerosis, rheumatoid arthritis, and systemic sclerosis in humans [17, 19–21] and experimental type 1 diabetes, encepalomyelitis, and colitis in mice [22–25]. This suggests that iNK T-cell deficiency is associated with autoimmunity either causally or as a result of the disease process. Our study adds Crohn’s disease and ulcerative disease to this list of autoimmune diseases associated with iNK T-cell deficiency. The evidence that deficiency of iNK T cells cause autommune disease comes from animal studies showing that transfer of iNK T cells prevents onset of type 1 diabetes or experimental colitis in susceptible mice or, conversely, that depletion of iNK T cells accelerates autoimmune disease. Stimulation of iNK T cells either with αGalCer directly in vivo or with NK T cells preactivated with αGalCer improved symptomatic scores and survival in mice with dextran sodium sulfate-induced colitis [25]. CD1d knockout mice did not benefit from αGalCer treatment, nor did mice depleted of NK T cells [25]. As IBD in humans are polygenetic diseases with environmental factors (as are other autoimmune
Springer
diseases in humans), presumably iNK T-cell deficiency may be a contributing factor to an autoimmune pathogenesis. iNK T cells are immunoregulatory by their production of Th2 cytokines such as IL-4 that suppress Th1 responses. The discrepancy between the intact total Vα24 + T cells and the low iNK T cells systemically in ulcerative colitis was an unexpected finding. Possibly this could even be used to help discriminate between Crohn’s disease with low Vα24 + T-cell numbers and ulcerative colitis with intact Vα24 + Tcell numbers. This could possibly be explained by the differences in thymic development of the two lineages [26, 27]. In both Crohn’s disease and ulcerative colitis, the profound deficiency of iNK T cells would be compatible with defective thymic development in early life, although this would be difficult to confirm directly in humans. It would be interesting to investigate iNK T cells early in life and to study family members of subjects with IBD to see whether they also have low iNK T cells, especially as it is known in Crohn’s disease at least that there is an increase in defective immunoregulation in family members [3, 4]. NK T cells have been classified into three types [28]. Type I classical CD1d-restricted NK T cells are iNK T cells, type II cells are CD1d-restricted noninvariant NK T cells, and type III cells are non-CD1d-restricted and noninvariant. We have identified a deficiency of type I NK T cells in Crohn’s disease and ulcerative colitis. This type I NK T cell is different from the type II effector NK T cell described by Fuss and colleagues [7]. They showed that type II noninvariant NK T cells produce IL-13 in vitro after isolation from areas of inflamed intestine in subjects with ulcerative colitis. Type II noninvariant NK T cells do not react with α-GalCer/CD1d tetramers. They are also functionally different in having peak cytokine production at 48 to 72 hr after in vitro stimulation, compared with 4 hr for type I NK T cells. Moreover, the significance of the importance of type II effector NK T cells in ulcerative colitis is mitigated by two studies showing that IL-13 is deficient in intact
Dig Dis Sci (2007) 52:1415–1422
1421
Fig. 5 Intracellular cyokine staining of iNK T cells after anti-CD3 antibody (squares) or PMA/ionomycin (diamonds) stimulation for 4 hr in control subjects and in subjects with Crohn’s disease and ulcerative colitis
intestinal mucosa rather than occurring at the expected high levels [29, 30]. Another study has, however, shown that IL-13 was increased [31]. Hopefully, further studies will clarify this issue. Our findings of iNK T-cell deficiency and impaired stimulated cytokine secretion could explain the absence of IL-4 in intestinal mucosa in Crohn’s disease and ulcerative colitis [10, 11]. While this could be explained in Crohn’s disease by an exaggerated Th1 response suppressing Th2 cytokine production, it has not been easy to explain the absence of IL-4 in ulcerative colitis. Although iNK T cells are few in number systemically and mucosally, they are unique in rapidly producing large quantities of IL-4 and other cytokines. In mice, at least, iNK T cells are the principal source of IL-4 in vivo [32]. Thus, the absence of iNK T cells with impaired cytokine production could have a profound effect in regulating immune reactivity in IBD. In summary, we found that Vα24 + T cells and iNK T cells were deficient in Crohn’s disease. In ulcerative colitis, we found that Vα24 + T cells were not deficient systemically but were low mucosally and iNK T cells were deficient. Functionally, iNK T cells in both Crohn’s disease and ulcer-
ative colitis had impaired stimulated cytokine production. iNK T-cell deficiency in both Crohn’s disease and ulcerative colitis may therefore contribute to loss of immunoregulation. Acknowledgments R.H.G. was supported by a PhD scholarship from The Queen Elizabeth Hospital Research Foundation. We also gratefully acknowledge funding support for this work from the Broad Medical Research Program. We acknowledge and thank Dr. Mitchell Kronkenberg (La Jolla Institute of Allergy and Immunology, San Diego, California) as the original source of the CD1d transfectants.
References 1. Duchmann R, Kaiser I, Hermann E, Mayet W, Ewe K, Meyer Zum B¨uschenfelde K-H (1995) Tolerance exists towards resident intestinal flora but is broken in active inflammatory bowel disease. Clin Exp Immunol 102:448–455 2. MacDonald TT (1995) Breakdown of tolerance to the intestinal bacterial flora in inflammatory bowel disease (IBD). Clin Exp Immunol 102:445–447 3. Kraus TA, Toy L, Chan L, Childs J, Cheifetz A, Mayer L (2004) Failure to induce oral tolerance in Crohn’s and ulcerative colitis patients: possible genetic risk. Ann NY Acad Sci 1029:225– 238 Springer
1422 4. Kraus TA, Toy L, Chan L, Childs J, Mayer L (2004) Failure to induce oral tolerance to a soluble protein in patients with inflammatory bowel disease. Gastroenterology 126:1771– 1778 5. Lodes MJ, Cong Y, Elson CO, Mohamath R, Landers CJ, Targan SR, Fort M, Hershberg RM (2004) Bacterial flagellin is a dominant antigen in Crohn disease. J Clin Invest 113:1296–1306 6. MacDonald TT, DiSabatino A, Gordon JN (2005) Immunopathogenesis of Crohn’s disease. JPEN 29:S118 7. Fuss IJ, Heller F, Boirivant M, Leon F, Yoshida M, Fichtner-Fiegl S, Yang Z, Exley M, Kitani A, Blumberg RS (2004) Non classical CD1d-restricted NK T cells that produce IL-13 characterize an atypical Th2 response in ulcerative colitis. J Clin Invest 113:1490– 1497 8. Heller F, Florian P, Bojarski C, Richter J, Christ M, Hillenbrand B, Mankertz J, Gitter AH, Burgel N, Fromm M, Zeitz M, Fuss I, Strober W, Schulzke JD (2005) Interleukin-13 is the key effector Th2 cytokine in ulcerative colitis that affects epithelial tight junctions, apoptosis, and cell restitution. Gastroenterology 129:550– 564 9. Mayer L (2005) Editorial. A novel approach to the treatment of ulcerative colitis. Gastroenterology 128:1117–1119 10. Karttunnen R, Breese EJ, Walker-Smith JA, MacDonald TT (1994) Decreased mucosal interleukin-4 (IL-4) production in gut inflammation. J Clin Pathol 47:1015–1018 11. West GA, Matsuura T, Levine AD, Klein JS, Fiocchi C (1996) Interleukin 4 in inflammatory bowel disease and mucosal reactivity. Gastroenterology 110:1683–1695 12. Joyce S, Woods AS, Yewdell JW, Bennink JR, De Silva AD, Boesteanu A, Balk SP, Cotter RJ, Brutkiewicz RR (1998) Natural ligand of mouse CD1d1: cellular glycosylphosphatidylinositol. Science 279:1541–1544 13. Godfrey DI, Hammond KJL, Poulton LD, Smyth MJ, Baxter AG (2000) NKT cells: facts, functions and fallacies. Immunol Today 21:573–583 14. Nieda M, Nicol A, Koezuka Y, Kikuchi A, Takahashi T, Nakamura H, Furukawa H, Yabe T, Ishikawa Y, Tadokoro K, Juji T (1999) Activation of human Valpha24NKT cells by alpha-glycosylceramide in a CD1d-restricted and Valpha24TCR-mediated manner. Hum Immunol 60:10–11 15. Matsuda JL, Naidenko OV, Gapin L, Nakayama T, Taniguchi M, Wang CR, Koezuka Y, Kronenberg M (2000) Tracking the response of natural killer T cells to a glycolipid antigen using CD1d tetramers. J Exp Med 192:741–754 16. van der Vliet HJ, von Blomberg BM, Nishi N, Reijm M, Voskuyl AE, van Bodegraven AA, Polman CH, Rustemeyer T, Lips P, van den Eertwegh AJ, Giaccone G, Scheper RJ, Pinedo HM (2001) Circulating VSp(alpha24 + ) Vbeta11 + NKT cell numbers are decreased in a wide variety of diseases that are characterized by autoreactive tissue damage. Clin Immunol 100:144–148 17. Illes Z, Kondo T, Newcombe J, Oka N, Tabira T, Yamamura T (2000) Differential expression of NK T cell Valpha24JalphaQ invariant TCR chain in the lesions of multiple sclerosis and chronic inflammatory demyelinating polyneuropathy. J Immunol 164:4375–4381
Springer
Dig Dis Sci (2007) 52:1415–1422 18. Harper JF (1994) Pertiz’ F test: BASIC programme of a robust multiple comparison test for statistical comparison for statistical analysis of all differences among group means. Comput Biol Med 14:437–445 19. Maeda T, Kelno H, Asahara H, Taniguchi M, Nishioka K, Sumida T (1999) Decreased TCR AV24αJ18 double-negative T cells in rheumatoid synovium. Rheumatology 38:186–188 20. Wilson SB, Kemi SC, Patton KT, Orban T, Jackson RA, Exley M, Porcelli S, Schatz DA, Atkinson MA, Balk SP, Strominger JL, Hafler DA (1998) Extreme Th1 bias of invariant Vα24JαQ T cells in type 1 diabetes. Nature 391:177–181 21. Sumida T, Sakamoto A, Murata H, Makino Y, Takahashi H, Yoshida S, Nishioka K, Iwamoto I, Tanguchi M (1995) Selective reduction of T cells bearing invariant V-alpha-24J alpha-Q antigen receptor in patients with systemic sclerosis. J Exp Med 182:1163–1168 22. Mendiratta SK, Martin WD, Hong S, Boesteanu A, Joyce S, Kaer LV (1997) CD1d1 mutant mice are deficient in natural T cells that promptly produce IL-4. Immunity 6:469–477 23. Zhang B, Yamamura T, Kondo T, Fujiwara M, Tabira T (1997) Regulation of experimental autoimmune encephalomyelitis by natural killer (NK) cells. J Exp Med 186:1677–1687 24. Trop S, Samsonov D, Gotsman I, Alper R, Diment J, Ilan Y (1999) Liver-associated lymphocytes expressing NK1.1 are essential for oral immune tolerance induction in a murine model. Hepatology 29:746–755 25. Saubermann LJ, Beck P, De Jong Y, Pitman RS, Ryan MS, Kim HS, Exley M, Snapper S, Balk SP, Hagen SJ, Kanauchi O, Motoki K, Sakai T, Terhorst C, Koezuka K, Podolsky DK, Blumberg RS (2000) Activation of natural killer T cells by α-galactosylceramide in the presence of CD1d provides protection against colitis in mice. Gastroenterology 119:119–128 26. Jordan MA, Fletcher J, Baxter AG (2004) Genetic control of NKT cell numbers. Immunol Cell Biol 82:276–284 27. Berzin SP, Uldrich AP, Pellicci DG, McNab F, Hayakawa Y, Smyth MJ, Godfrey DI (2004) Parallels and distinctions between T and NKT cell development in the thymus. Immunol Cell Biol 82:269– 275 28. Godfrey DI, MacDonald R, Kronenberg M, Smyth MJ, van Kaer L (2004) NKT cells: What’s in a name? Nat Rev Immunol 4:231– 237 29. Vainer B, Nelson OH, Hendel J, Horn T, Kirman I (2000) Colonic expression and synthesis of interleukin 13 and interleukin 15 in inflammatory bowel disease. Cytokine 12:1531–1536 30. Kadivar K, Ruchelli ED, Markwitz JE, Defelice ML, Strogatz ML, Kanzaria MM, Reddy KP, Baldassano RN, von Allmen D, Brown KA (2004) Intestinal interleukin-13 in pediatric inflammatory bowel disease patients. Inflamm Bowel Dis 10:593–598 31. Inoue S, Matsumoto T, Lida M, Mizuno M, Kuroki F, Hoshika K, Shimizu M (1999) Characterization of cytokine expression in the rectal mucosa of ulcerative colitis: correlation with disease activity. Am J Gastroenterol 94:2441–2446 32. Yoshimoto T, Paul WE (1994) CD4pos NK1.1pos T cells promptly produce interleukin 4 in response to in vivo challenge with antiCD3. J Exp Med 179:1285–1295
